Synthesis of substituted diarylmethylenepiperidines (DAMPs), a novel class of anti-HIV agents.

Article abstract of DOI:10.1016/S0968-0896(02)00095-0

Substituted diarylmethylenepiperidines (DAMPs) were synthesized as conformationally restricted analogues of the alkenyldiarylmethane (ADAM) class of non-nucleoside reverse transcriptase inhibitors (NNRTIs). Although, like the ADAMs, the DAMPs were found to inhibit the cytopathic effect of HIV-1(RF) in CEM-SS cells, they were completely inactive as inhibitors of HIV-1 reverse transcriptase. The DAMPs were assessed for inhibition of HIV attachment and fusion. DAMP was active in both assays with IC(50) values of 26.5 microM (TI 3.8) and 12.1 microM (TI: >8), respectively. DAMP also inhibited HIV fusion with an IC(50 )12.8 microM (TI: >6), but not virus attachment. However, attempts to verify inhibition of virus attachment and fusion as antiviral targets using time-of-addition experiments failed to confirm these observations, and instead identified an antiviral target occurring after completion of reverse transcription. DAMPs, and were found to inhibit virus replication if added 8 h post virus exposure, and DAMP was equipotent at inhibition of virus replication if added 24 h after virus addition. DAMPs, and did not inhibit virus replication in TNF-alpha induced latently infected U1 cells, a model for post-integrative antiviral targets. When tested in both 3' end-processing and strand-transfer assays in the presence of HIV-1 integrase, none of the DAMPs showed any inhibitory activity, indicating that HIV-1 integrase is not involved in the mechanism of the antiviral action. Thus, the DAMPs are novel conformationally restricted analogues of the previously published ADAM series with an unidentified antiviral target bounded by the completion of reverse transcription and virus integration.

Full text of DOI:10.1016/S0968-0896(02)00095-0

Bioorganic & Medicinal Chemistry 10 (2002) 2807–2816
Synthesis of Substituted Diarylmethylenepiperidines (DAMPs),
a Novel Class of Anti-HIVAgents
Guozhang Xu,a Arunachalam Kannan,a Tracy L. Hartman,b,1 Heather Wargo,b,1
Karen Watson,b,1 Jim A. Turpin,b,1 Robert W. Buckheit, Jr.,b,1 Allison A. Johnson,c
Yves Pommierc and Mark Cushmana,*
aDepartment of Medicinal Chemistry and Molecular Pharmacology, School of Pharmacy and Pharmacal Sciences,
Purdue University, West Lafayette, IN 47907, USA
bInfectious Disease Research Department, Southern Research Institute, 431 Aviation Way, Frederick, MD 21701, USA
cLaboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute,
Bethesda, MD 20892-4255, USA
Received 25 October 2001; accepted 26 December 2001
Abstract—Substituted diarylmethylenepiperidines (DAMPs) were synthesized as conformationally restricted analogues of the
alkenyldiarylmethane (ADAM) class of non-nucleoside reverse transcriptase inhibitors (NNRTIs). Although, like the ADAMs, the
DAMPs were found to inhibit the cytopathic effect of HIV-1RF in CEM-SS cells, they were completely inactive as inhibitors of
HIV-1 reverse transcriptase. The DAMPs were assessed for inhibition of HIV attachment and fusion. DAMP 14 was active in both
assays with IC50 values of 26.5 mM (TI 3.8) and 12.1 mM (TI: >8), respectively. DAMP 15 also inhibited HIV fusion with an IC50
12.8 mM (TI: >6), but not virus attachment. However, attempts to verify inhibition of virus attachment and fusion as antiviral
targets using time-of-addition experiments failed to confirm these observations, and instead identified an antiviral target occurring
after completion of reverse transcription. DAMPs 11, 12, 14, and 15 were found to inhibit virus replication if added 8 h post virus
exposure, and DAMP 11 was equipotent at inhibition of virus replication if added 24 h after virus addition. DAMPs 11, 12, and 15
did not inhibit virus replication in TNF-a induced latently infected U1 cells, a model for post-integrative antiviral targets. When
tested in both 30 end-processing and strand-transfer assays in the presence of HIV-1 integrase, none of the DAMPs showed any
inhibitory activity, indicating that HIV-1 integrase is not involved in the mechanism of the antiviral action. Thus, the DAMPs are
novel conformationally restricted analogues of the previously published ADAM series with an unidentified antiviral target bounded
by the completion of reverse transcription and virus integration. # 2002 Elsevier Science Ltd. All rights reserved.
Although combination chemotherapy of HIV infection
with protease and reverse transcriptase inhibitors has
been successful in delaying disease progression and
improving the quality of life of AIDS patients, sig-
nificant problems still remain, including drug toxicity
and the emergence of resistant viral strains.1ꢀ5 Conse-
quently, there is a need for new anti-HIV agents with
novel mechanisms of action. Recently, the appendage of
a modified aurintricarboxylic acid (1) fragment to cho-
lestane resulted in cosalane (2) and related analogues,
which inhibit the binding of gp120 to CD4 and the
fusion of the viral envelope with the cell membrane.6ꢀ13
Work in the cosalane series led to the alkenyldiaryl-
methanes (e.g., 3), which have proven to be effective
non-nucleoside reverse transcriptase inhibitors.14ꢀ18
Both 2 and 3 inhibit the cytopathic effect of HIV-1 in
cell cultures.
The present investigation was undertaken in order to
make and test conformationally restricted analogues of
the ADAMs in which the alkenyl side chain is con-
strained in a piperidine ring. Another goal was to
replace the terminal ester on the side chain with a
carbamate, which would be expected to have enhanced
metabolic stability. These considerations led to the
design of substituted 4-(diarylmethylene)piperidines
(DAMPs), represented by general structure 4. As
detailed in the present report, the DAMPs (4) have been
successfully prepared and have been found to have sig-
nificant anti-HIV activity, but they appear to act by a
novel mechanism that is not related to either that of
cosalane (2) or the ADAMs (e.g., 3).
*Corresponding author. Tel.: +1-765-494-1465; fax: +1-765-494-
6790; e-mail: cushman@pharmacy.purdue.edu
1Present address: TherImmune Research Corporation, Gaithersburgh,
MD 20879, USA.
0968-0896/02/$ - see front matter # 2002 Elsevier Science Ltd. All rights reserved.
PII: S0968-0896(02)00095-0

2808
G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
Scheme 1. Reagents and conditions: (a) R1COCl, aq Na2CO3, 0 ꢁC
.
(2 h); (b)TiCl4 THF, Zn dust, THF, reflux.
.
Scheme 2. Reagents and conditions: (a) TiCl4 THF, Zn dust, THF,
reflux (14 h).
Chemistry
Scheme 3. Reagents and conditions: (a) H2, Pd/C (30%), MeOH.
As shown in Scheme 1, treatment of 4-piperidone (5)
with methyl chloroformate or 5-chloro-5-oxovalerate in
aqueous sodium carbonate afforded the corresponding
N-acylated 4-piperidones 7 and 8. The related inter-
mediate 6 is commercially available. The McMurry
reaction of compounds 6–8 with the substituted benzo-
phenones 919 and 106 afforded the desired DAMPs 11–16
in 78–98% yields. Similarly, reaction of the substituted
piperidone 7 with dibenzosuberenone 17 or dibenzosu-
berone 18 produced the expected products 19 and 20 in
78 and 84% yield, respectively (Scheme 2).
hydrogenated. As displayed in Scheme 3, hydrogenation
of DAMPs 11 and 12, using 30% palladium on charcoal
as the catalyst, afforded the expected dihydro products
21 and 22.
Hydrolysis of the two ester groups of DAMPs 14 and 15
in ethanolic sodium hydroxide led to the carboxylic
acids 23 and 24 (Scheme 4). The disodium salts 25 and
26 were prepared by adding two equivalents of sodium
hydroxide to the acids 23 and 24.
In order to demethylate both the ester and ether groups
of 14 while leaving the carbamate intact, the bis(aceto-
nide) 27 was employed as the starting material.
In order to introduce more conformational flexibility
into the DAMP system, the tetrasubstituted alkene was

G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
2809
Table 1. Anti-HIV-1 activities of 6,6-diarylmethylenepiperidines
Compd
RT (IC50 mM)a EC50 (mM)b CC50 (mM)c
TId,e
ADAM (2)
Cosalane (4)
0.3
0.013
5.1
31.6
200
4.34
5.00
8.62
2430
39.2
3.76
30
8.29
11
12
13
14
15
16
19
20
21
22
23
24
25
26
28
29
>100
1.16
0.40
1.04
1.26
8.40
NA
NA
NA
5.23
NA
64.9
NA
88.5
NA
NA
NA
>100
>100
>100
>100
>100
>100
4.87
3.88
5.71
48.00
12.70
11.90
12.20
12.30
8.58
>100
>100
2.35
3.08
1.13
200
>100
>100
>100
200
100
200
100
10.5
aInhibitory activity versus HIV-1 reverse transcriptase with rCdG as the
template primer.
bThe EC50 is the inhibitory concentration for cytopathicity of HIV-1RF
in CEM-SS cells.
Scheme 4. Reagents and conditions: (a) (1) NaOH, EtOH; (2) HCl; (b)
NaOH, EtOH.
cThe CC50 is the 50% cytotoxic concentration for mock-infected CEM
cells.
dThe TI is the therapeutic index, which is the CC50 divided by the EC50
.
eNA means there was no observed inhibition of HIV-1 cytopathicity up
to the cytotoxic concentration in uninfected cells.
McMurry reaction of 27 with 6 yielded intermediate 28,
which was deprotected with sodium hydroxide in methanol
to afford the desired compound 29 (Scheme 5).
Table 2. Effects of selected 6,6-diarylmethylenepiperidines on viral
attachment
Compd
IC50 (mM)a
CC50 (mM)b
Chicago Sky Blue
Cosalane (4)
1.8c
21
>10
11
12
13
14
15
23
25
>100
>100
>100
26.5
>100
52.7
48.8
>100
>100
>100
100
>100
100
100
aAttachment of HIV-1RF to human PBLs, as quantitated by the associ-
ation of virion p24 with the cells.
bCytotoxic concentration in PBLs.
cThe concentration of Chigago Sky Blue is reported in mg/mL.
the remaining DAMPs were without detectable antiviral
activity. The cytotoxicities of the compounds in unin-
fected CEM-SS cells were also determined, and the
resulting CC50 values are also listed in Table 1. The
therapeutic index (TI) listed for each compound is the
ratio of the cytotoxic concentration (CC50) divided by
the concentration required for antiviral efficacy (EC50).
The most active compound proved to be DAMP 12,
and it was also the compound with the highest ther-
apeutic index.
.
Scheme 5. Reagents and conditions: (a) 6, TiCl4 THF, Zn dust, THF,
reflux (14 h); (b) (1) NaOH, MeOH, 50–55 ꢁC (3 h), (2) HCl.
Biological Results and Discussion
Comparison of the activities of 11 and 12 with those of
the dihydro derivatives 21 and 22 suggests that the
greater conformational restriction provided by the dou-
ble bond does contribute to the anti-HIV activity. The
activities of the esters 14 and 15 versus the less active
compounds 23 and 25, or the inactive compounds 24,
26, and 29, indicates that the four methyl groups of the
All of the new DAMPs were evaluated for inhibition of
the cytopathic effect of HIV-1RF in CEM-SS cell cul-
ture, and the results are listed in Table 1. The DAMPs
11–14 inhibited HIV-1 replication with a 50% reduction
in virus-mediated cytopathicity (EC50) in the 1 mM
range. DAMPs 15, 21, 23, and 25 were less potent, while

2810
G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
Table 3. Effects of selected 6,6-diarylmethylenepiperidines on cell
fusion
Compd
IC50 (mM)a
TC50 (mM)b
Chicago Sky Blue
Cosalane (4)
2.3e
33
>10e
11
12
13
14
15
19.7
12.4
22.8
12.1
12.8
23.0
21.0
30.5
>100
>81.7
aFusion of HeLaCD4/b-gal cells with HL2/3 cells expressing env and tat
proteins.
bThe TC50 is the 50% cytotoxic concentration for the combined popu-
lation of HeLaCD4/b-gal cells and HL 2/3 cells.
Figure 1. Time of addition experiment for DAMP 11.
aromatic esters and ethers are important for maximal
antiviral activity.
Since the ADAMs (e.g., 2), which function as non-
nucleoside reverse transcriptase inhibitors, are structural
analogues of the DAMPs, we expected that the biologi-
cally active DAMPs would be effective inhibitors of
HIV-1 reverse transcriptase (RT). However, when tested
for inhibition of RT with rCdG as the template primer,
none of the DAMPs were active (Table 1).
Because cosalane (2) and related compounds are inhibi-
tors of virus attachment and fusion, the DAMPs 11, 12,
13, 14, 15, 23, and 25 were also tested for those activ-
ities. In p24 ELISA assays designed to quantitate virus
attachment to cells, compounds 11, 12, 13, and 15 failed
to inhibit attachment (Table 2). DAMP 14 was an inhi-
bitor of virus attachment, but the IC50 of 26.5 mM was
considerably higher than the EC50 of 1.26 mM necessary
for inhibition of the cytopathic effect of the virus, which
casts doubt on the idea that attachment inhibition is
related to antiviral activity. The corresponding acid 23
(IC50 52.7 mM) and the salt 25 (IC50 48.8 mM) were less
active attachment inhibitors than 14, but their potencies
as attachment inhibitors did approximate their antiviral
activities (EC50 values of 74.9 and 88.5, respectively),
suggesting that their anti-HIV-1 effects may be due to
attachment inhibition.
Figure 2. Time of addition experiment for DAMP 12.
To assess inhibition of fusion, HL2/3 cells expressing
gp120 and intracellular Tat were mixed with HeLa CD4
LTR b-gal cells. Following cytoplasmic mixing after the
gp120/CD4 mediates membrane fusion, Tat trans acti-
vates the b-galactosidase reporter, with inhibition of
fusion correlating with decreased b-galactosidase produc-
tion. The results of these assays involving DAMPs 11–15
are reported in Table 3. Although all five compounds
yielded IC50 values, only 14 (IC50 12.1 mM) and 15 (IC50
12.8 mM) were sufficiently non-cytotoxic to be graded as
active. These two DAMPs were essentially equipotent as
fusion inhibitors, but they were less potent in the fusion
assay than they were in the assay for anti-HIV-1 activity.
Figure 3. Time of addition experiment for DAMP 14.
In order to gain further insight into the mechanism of
action of the DAMPs, ‘time-of-addition’ (TOA) experi-
ments were performed in order to identify the stage(s) of
the HIV-1 replication cycle at which the compounds
Figure 4. Time of addition experiment for DAMP 15.

G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
2811
were acting. To accomplish this, a single round of
Experimental
infection assay using HeLa CD4 LTR b-gal cells was
used. Virus replication was assessed at 48 h post-
infection by b-galactosidase expression following the
integration of the provirus, production of new Tat pro-
tein and transactivation of the LTR b-galactosidase
enzyme reporter. Thus the time-of-addition assay mod-
els antiviral targets from initial virus-cell interaction
(gp120-CD4) to the initiation of new virus transcription
following synthesis of Tat. Timed addition of known
inhibitors, such as zidovudine (AZT, reverse tran-
scriptase) and Chicago Sky Blue20 (CSB, attachment
and fusion), are used to monitor the initiation and
completion of these key processes during the pre-inte-
grative phases of virus replication. The results of the
TOA experiments are shown in Figure 1–4 for DAMPs
11, 12, 14, and 15, along with the control compounds
AZT and CSB. These experiments show that the pro-
cesses of virus attachment and fusion and reverse tran-
scription are completed within the first 1 and 4 h of
infection, respectively. In contrast, all four DAMPs
retained significant antiviral activity (>60% inhibition
of virus replication) if added 8 h post-infection. After 8
h, the potencies of the compounds vary, with compound
15 loosing all antiviral activity and 11 maintaining com-
plete suppression, even if added 24 h post-infection. The
DAMPs 12 and 14 show intermediate patterns of virus
inhibition at 24 h with 70 and 35% inhibition of virus
replication, respectively.
General
Melting points were determined in capillary tubes on a
Mel-Temp apparatus and were uncorrected. Spectra
were obtained as follows: CI mass spectra on a Finne-
gan 4000 spectrometer; FABmass spectra and EI mass
spectra on a Kratos MS50 spectrometer; and NMR
spectra on a Bruker ARX-300 spectrometer. Micro-
analyses were performed at the Purdue Microanalysis
Laboratory, and all values were within ꢂ0.4% of the
calculated compositions. Silica gel used for column
chromatography was 230–400 mesh. 1-Carboethoxy-
4-piperidone (6) was obtained from Aldrich.
1-Carbomethoxy-4-piperidone (7). 4-Piperidone mono-
hydrate hydrochloride (3.07 g, 20.0 mmol) was dis-
solved in water (12 mL). The solution was stirred and
cooled on an ice bath, and an ice-cold solution of
potassium carbonate (6.97 g, 50.4 mmol) in water (40
mL) was added, followed by addition of methyl chloro-
formate (2.80 g, 29.6 mmol). Stirring was continued at
0 ꢁC for 2 h, and the reaction mixture was then extrac-
ted with CH2Cl2 (3ꢃ40 mL). The CH2Cl2 extracts were
dried (Na2SO4), evaporated and the crude residue pur-
ified by flash chromatography on silica gel (ethyl ace-
tate/hexanes 1:1, v/v) to afford a colorless liquid (3.10 g,
1
98.7%). H NMR (CDCl3) d 3.76 (t, J=6.04 Hz, 4H),
3.75 (s, 3H), 2.45 (t, J=6.18 Hz, 4H); 13C NMR
(CDCl3) d 207.22, 155.80, 53.00, 43.10, 41.06; CIMS m/z
158 (MH+).
We have previously used latently HIV-1 infected TNF-a
induced U1 cells to identify inhibitors with specificity
for antiviral targets occurring after proviral integra-
tion.21 DAMPs 11, 12, and 15 failed to inhibit virus
replication in TNF-a induced U1 cells. This lack of
activity for post-integrative antiviral targets was con-
firmed in chronically HIV-1 infected cells. CEM-SS cells
chronically infected with the clinical HIV-1 isolate SK-1
were treated for 6 days with DAMPs 11–15, and virus
replication measured by supernatant reverse tran-
scriptase activity. All five DAMPs failed to inhibit HIV
replication in chronically infected cells. These results
strongly suggest that the antiviral mechanism of action
for the DAMPs is restricted to cellular or viral targets
occurring at or prior to provirus integration. When tes-
ted in both 30 end-processing and strand-transfer assays
in the presence of HIV-1 integrase, none of the DAMPs
showed any inhibitory activity up to a concentration of
110 mM, indicating that HIV-1 integrase is not involved
in the mechanism of the antiviral action.
1-(4-Carbomethoxybutanoyl)-piperidin-4-one (8). 4-Piper-
idone monohydrate hydrochloride (1.53 g, 9.96 mmol)
was dissolved in water (8 mL). The solution was stirred
and cooled on an ice bath, and an ice-cold solution of
potassium carbonate (3.48 g, 25.2 mmol) in water (20
mL) was added at 0 ꢁC, followed by addition of methyl
5-chloro-5-oxovalerate (2.44 g, 14.8 mmol). Stirring was
continued at 0 ꢁC for 2 h, and the reaction mixture was
extracted with CH2Cl2 (3 40 mL). The CH2Cl2 extracts
were dried (Na2SO4), evaporated and the crude residue
purified by flash chromatography on silica gel (ethyl
acetate/hexanes 1:1, v/v) to afford a colorless liquid
1
(1.77 g, 78.2%). H NMR (CDCl3) d 3.86 (t, J=5.79
Hz, 2H), 3.75 (t, J=5.81 Hz, 2H), 3.66 (s, 3H), 2.45 (m,
8H), 1.98 (m, 2H); 13C NMR (CDCl3) d 206.72, 173.66,
170.91, 51.54, 43.97, 41.17, 40.77, 32.95, 32.06, 20.25;
CIMS m/z (relative intensity) 228 (MH+, 100), 196
(M+ - OCH3, 43).
Therefore, these data indicate that despite the structural
similarities of the DAMPs to the cosalanes and
ADAMs, these compounds do not mediate their anti-
viral activity by inhibition of HIV attachment (cos-
alane) or reverse transcription (ADAM). Rather, the
data supports interaction with a novel cellular or anti-
viral target present during the interval between the
completion of reverse transcription and the initiation of
new virus transcription. Potential antiviral targets in
this interval include cytoplasmic transport of the pre-
integration complex and the nuclear import of the
complex.
Ethyl
4-(40,400-dimethoxy-30,300-di(methoxycarbonyl)-
50,500-dimethyl-diphenylmethylene)piperidinecarboxylate
.
(11). A slurry of TiCl4 THF 1:2 complex (0.70 g, 2.1
mmol) and Zn dust (0.28 g, 4.2 mmol) in THF (25 mL)
was heated under reflux and kept stirring for 2 h. A
solution of benzophenone 9 (0.27 g, 0.70 mmol) and
1-carbethoxy-4-piperidone (6) (0.18 g, 1.1 mmol) in
THF (10 mL) was added. The black mixture was heated
under reflux for 15 h, and it was then cooled to room
temperature and water (25 mL) was added. The mixture
was stirred at room temperature 6 h. Then it was filtered
through a pad of Celite and washed with ethyl acetate

2812
G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
(3ꢃ20 mL). The layers were separated and the aqueous
one was extracted with ethyl acetate (2ꢃ20 mL). The
combined organic extracts were washed with brine,
dried over Na2SO4, filtered, and the solvent removed to
give a brown residue. The crude residue was purified by
flash chromatography (ethyl acetate/hexanes 1:2, v/v) to
afford the product 11 (227 mg, 61.7%): mp 47–50 ꢁC.
1H NMR (CDCl3) d 7.32 (d, J=3.0 Hz, 2H), 7.00 (d,
J=3.0 Hz, 2H), 4.09 (q, J=7.0 Hz, 2H), 3.78 (s, 6H),
4H), 3.75 (s, 3H), 3.45 (t, J=6.0 Hz, 4H), 2.26 (t, J=6.0
Hz, 4H), 2.22 (s, 6H),1.20 (t, J=7.5 Hz, 3H); 13C NMR
(CDCl3) d 166.77, 157.03, 155.42, 136.82, 136.10,
135.33, 134.90, 132.56, 129.96, 124.12, 61.39, 61.24,
52.11, 44.98, 31.37, 16.07, 14.59; CIMS m/z 526 (MH+);
HRMS calcd for C29H36NO8 (MH+) 526.2441, found
526.2431. Anal. calcd for C29H35NO8: C, 66.21; H, 6.66;
N, 2.66. Found C, 65.88; H, 6.90; N, 2.96.
7.02 (d, J=2.23 Hz, 2H), 3.90 (s, 6H), 3.81 (s, 6H), 3.65
(s, 3H), 3.59 (br, 2H), 3.45 (br, 2H), 2.40 (t, J=7.03 Hz,
2H), 2.39 (t, J=7.18 Hz, 2H), 2.31 (m, 4H), 2.26 (s, 6H),
1.94 (m, 2H); 13C NMR (CDCl3) d 173.75, 170.60,
166.80, 157.12, 136.60, 136.50, 136.06, 135.29, 134.78,
132.68, 129.93, 124.20, 61.43, 52.17, 51.48, 47.00, 43.57,
33.11, 32.27, 31.99, 31.26, 20.40, 16.10; CIMS m/z 582
(MH+); HRMS calcd for C32H39NO9 581.2625, found
581.2625. Anal. calcd for C32H39NO9: C, 66.08; H, 6.76;
N, 2.41. Found C, 65.87; H, 6.70; N, 2.32.
Ethyl 4-(30,300-dichloro-40,400-dimethoxy-5,5-di(methoxy-
carbonyl)-diphenylmethylene)piperidinecarboxylate (14).
.
TiCl4 THF (1:2 complex) (1.55 g, 4.65 mmol) was
added to a stirred suspension of zinc powder (608 mg,
9.30 mmol) in THF (20 mL) under argon. The resulting
dark mixture was heated under reflux for 1 h. The sus-
pension was cooled to room temperature and a mixture
of benzophenone 10 (639 mg, 1.50 mmol) and 1-carbo-
ethoxy-4-piperidone (6) (0.28 g, 1.6 mmol) in THF (10
mL) was added. The mixture was heated at reflux and
stirred for 15 h, cooled, and poured into 10% aqueous
potassium carbonate (20 mL). Then it was filtrated
through a pad of Celite and the filtrate was evaporated
to give a light-yellow residue, which was purified by
flash chromatography (EtOAc–hexanes 1:2, v/v) to
afford compound 14 (495 mg, 58.3%): mp 51–53 ꢁC. 1H
NMR (CDCl3) d 7.40 (d, J=2.37 Hz, 2H), 7.24 (d,
J=2.03 Hz, 2H), 4.12 (q, J=7.13 Hz, 2H), 3.92 (s, 6H),
3.89 (s, 6H), 3.49 (t, J=5.62 Hz, 4H), 2.29 (t, J=5.57
Hz, 4H), 1.23 (t, J=7.16 Hz, 3H); 13C NMR (CDCl3) d
165.38, 155.36, 154.64, 137.93, 137.29, 134.84, 132.60,
130.73, 129.57, 126.66, 61.94, 61.38, 52.50, 44.76, 31.42,
14.59; CIMS m/z 566 (MH+); HRMS calcd for
C27H29NCl2O8 566.1348, found 566.1331. Anal. calcd
for C27H29NCl2O8: C, 57.25; H, 5.16; N, 2.54. Found C,
57.01; H, 5.19; N, 2.14.
Methyl 4-(40,400 -dimethoxy-30,300 -di(methoxycarbonyl)-
50,500 - dimethyl - diphenylmethylene)piperidinecarboxylate
.
(12). TiCl4 THF (1:2 complex) (0.93 g, 2.8 mmol) was
added to a stirred suspension of zinc powder (0.37 g, 5.6
mmol) in dry THF (15 mL) under argon. The resulting
dark mixture was heated under reflux for 2 h. The sus-
pension was cooled to room temperature and a mixture
of benzophenone 9 (348 mg, 0.901 mmol) and 1-carbo-
methoxy-4-piperdione 7 (152 mg, 0.967 mmol) in dry
THF (10 mL) was added. The mixture was stirred at
room temperature for 1.5 h and then heated at reflux for
15 h. The resulting solution was poured into 10% aqu-
eous potassium carbonate (15 mL), followed by filtra-
tion through a pad of Celite. The filtrate was evaporated
and the crude residue was purified by flash chromato-
graphy on silica gel (18 g, column: 2.5ꢃ31 cm), eluting
with EtOAc–hexanes (1:2, v/v) to afford compound 12
(260 mg, 56.4%): mp 45–46 ꢁC. 1H NMR (CDCl3) d 7.34
(d, J=2.08 Hz, 2H), 7.01 (d, J=2.09 Hz, 2H), 3.87 (s,
6H), 3.83 (s, 6H), 3.67 (s, 3H), 3.46 (t, J=5.66 Hz, 4H),
2.27 (t, J=5.66 Hz, 4H), 2.24 (s, 6H); 13C NMR (CDCl3)
d 166.80, 157.04, 155.84, 136.79, 136.10, 135.20, 135.02,
132.59, 129.96, 124.17, 61.44, 52.53, 52.15, 45.06, 32.54,
31.37; CIMS m/z (relative intensity) 512 (MH+, 28), 480
(M+ ꢀOCH3, 100); HRMS calcd for C28H33NO8
511.2206, found 511.2210. Anal. calcd for C28H33NO8: C,
65.74; H, 6.50; N, 2.74. Found C, 65.36; H, 6.61; N, 2.50.
Methyl 4-(30,300-dichloro-40,400-dimethoxy-50,500-di(methoxy-
carbonyl)-diphenylmethylene)piperidinecarboxylate (15).
.
A mixture of TiCl4 THF (1:2 complex) (1.07 g, 3.20
mmol) and Zn powder (419 mg, 6.41 mmol) in dry THF
(25 mL) was heated under reflux for 2 h under nitrogen.
A solution of benzophenone 10 (426 mg, 0.997 mmol)
and 1-carbomethoxy-4-piperidone 7 (199 mg, 1.27
mmol) in dry THF (15 mL) was added, the reaction
mixture was stirred at room temperature for 1 h, and
then heated under reflux for 15 h. The mixture was
allowed to cool and 10% aqueous potassium carbonate
(20 mL) was added. Then it was filtrated through a pad
of Celite, and washed with ethyl acetate (3ꢃ15 mL). The
organic solvents were evaporated and the crude residue
was purified by silica gel flash chromatography (hex-
anes/EtOAc 2:1, v/v) to afford a white solid (269 mg,
48.8%): mp 48–50 ꢁC. 1H NMR (CDCl3) d 7.39 (d,
J=2.29 Hz, 2H), 7.23 (d, J=2.31 Hz, 2H), 3.91 (s, 6H),
3.89 (s, 6H), 3.67 (s, 3H), 3.47 (t, J=5.45 Hz, 4H), 2.28
(t, J=5.45 Hz, 4H); 13C NMR (CDCl3) d 165.54,
155.78, 154.67, 137.71, 137.23, 134.81, 132.68, 130.68,
129.57, 126.66, 61.93, 52.49, 44.81, 31.37; EIMS m/z 551
(M+); HRMS calcd for C26H27Cl2NO8 551.1114, found
551.1094. Anal. calcd for C26H27NCl2O8: C, 56.53; H,
4.93; N, 2.54. Found C, 56.43; H, 5.17; N, 2.44.
Methyl 5-[4-{40,400-dimethoxy-40,400-bis(methoxycarbo-
nyl)-50,500-(dimethyl)diphenylmethylene}piperidyl]-5-oxo-
.
pentanoate (13). A slurry of TiCl4 THF (1:2 complex)
(1.28 g, 3.84 mmol) and Zn dust (0.50 g, 7.6 mmol) in
THF (20 mL) was heated under reflux for 2 h. A mix-
ture of benzophenone 9 (0.46 g, 1.2 mmol) and ketone 8
(0.38 g, 1.7 mmol) in dry THF (10 mL) was added. The
dark mixture was stirred at room temperature for 1.5 h
and then heated under reflux for 12 h. It was cooled to
room temperature and an aqueous 10% K2CO3 solu-
tion (10 mL) was added. The mixture was stirred over-
night. The precipitate was filtered off and washed with
chloroform. The filtrate was concentrated and the resi-
due was chromatographed on silica gel (13 g, column:
2.5 cm ꢃ 31 cm), eluting with EtOAc– hexanes (1:1.2, v/
v) to provide 13 as a light-yellow liquid (100 mg,
1
14.4%). H NMR (CDCl3) d 7.35 (d, J=2.23 Hz, 2H),

G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
2813
Methyl 5-[4-{30,300-dichloro-40,400-dimethoxy-5,5-di(meth-
oxycarbonyl)diphenylmethylene}piperidyl]-5-oxopentano-
mixture was heated at reflux for 14 h and then con-
centrated. The concentrated residue was passed through
a short column (silica gel: 10 g, eluent: ethyl acetate 40
mL) to remove the solid. The combined fractions were
evaporated and the yellow residue was purified by flash
chromatography on silica gel (80 g), eluting with hex-
anes–ethyl acetate (3:1, v/v), to give a light-yellow solid
(1.07 g, 80.2%): mp 59–61 ꢁC. 1H NMR (CDCl3) d
7.09–7.30 (m, 8H), 3.76 (m, 2H), 3.76 (s, 3H), 3.45 (ddd,
J=15.07, 8.36, and 5.45 Hz, 2H), 3.21 (m, 2H), 2.88
(ddd, J=15.20, 8.49, and 4.18 Hz, 2H), 2.42 (t, J=5.71
Hz, 4H); 13C NMR (CDCl3) d 155.81, 140.28, 137.80,
136.18, 132.73, 129.26, 128.51, 126.92, 125.47, 52.47,
45.11, 32.32, 30.60; CIMS m/z 334 (MH)+. Anal. calcd
for C22H23NO2: C, 79.25; H, 6.95; N, 4.20. Found C,
79.52; H, 7.09; N, 4.10.
.
ate (16). A mixture of TiCl4 THF (1:2 complex) (1.10 g,
3.29 mmol) and Zn powder (431 mg, 6.59 mmol) in dry
THF (20 mL) was heated under reflux for 2 h under
nitrogen. A solution of benzophenone 10 (426 mg, 0.997
mmol) and ketone 8 (269 mg, 1.18 mmol) in dry THF
(15 mL) was added. The reaction mixture was stirred at
room temperature for 0.5 h, and then heated under
reflux for 14 h. The mixture was allowed to cool and
10% aqueous potassium carbonate (20 mL) was added.
The resulting mixture was stirred at room temperature
overnight, then filtrated through a Celite pad, and
washed with ethyl acetate (3ꢃ15 mL). The organic sol-
vents were evaporated and the crude residue was pur-
ified by silica gel flash chromatography (hexanes/EtOAc
1:2, v/v) to afford a colorless liquid (80.8 mg, 13.0%).
1H NMR (CDCl3) d 7.40 (d, J=2.28 Hz, 2H), 7.25 (d,
J=2.28 Hz, 2H), 3.94 (s, 6H), 3.91 (s, 6H), 3.66 (s, 3H),
3.63 (br, 2H), 3.49 (br, 2H), 2.41 (t, J=6.98 Hz, 2H),
2.40 (t, J=7.15 Hz, 2H), 2.33 (m, 4H), 1.95 (m, 2H); 13C
NMR (CDCl3) d 173.72, 170.65, 165.54, 154.71, 137.30,
137.20, 137.02, 134.78, 132.93, 130.66, 129.66, 129.63,
126.69, 61.97, 52.53, 51.50, 46.14, 42.58, 33.05, 32.24,
31.97, 31.10, 20.35; CIMS m/z 523 (M+). Anal. calcd
for C30H33NCl2O9: C, 57.89; H, 5.34; N, 2.25. Found C,
57.77; H, 5.47; N, 2.22.
Ethyl 4 - (40,400 - dimethoxy - 30,300 - di(methoxycarbonyl)-
50,500-dimethyl-diphenylmethyl)piperidinecarboxylate (21).
The piperidinecarboxylate 11 (42 mg, 0.08 mmol) was
hydrogenated at 60 psi over palladium (30%) on acti-
vated carbon (40 mg) in MeOH (15 mL). After TLC
had shown that all the starting material was consumed,
the catalyst was filtered and the solvent was evaporated.
The crude residue was flash chromatographed on silica
gel (15 g) using hexanes/EtOAc (1:1 v/v) to give product
21 as a colorless oil (41.8 mg, 99.1%). 1H NMR (CDCl3)
d 7.51 (d, J=1.87 Hz, 2H), 7.20 (d, J=1.87 Hz, 2H), 4.10
(q, J=7.08 Hz, 2H), 3.91 (s, 6H), 3.82 (d, J=2.83 Hz,
1H), 3.77 (s, 6H), 3.70 (m, 1H), 3.39 (m, 1H), 2.72 (t,
J=12.63 Hz, 2H), 2.28 (s, 3H), 2.19 (m, 1H), 1.51 (m,
2H), 1.23 (t, J=7.08 Hz, 3H), 1.04 (m, 2H); 13C NMR
(CDCl3) d 166.83, 156.79, 155.38, 138.03, 134.41, 132.97,
128.18, 124.38, 61.32, 61.04, 57.15, 52.10, 43.75, 39.47,
30.90, 16.16, 14.55. Anal. calcd for C29H37NO8: C, 66.03;
H, 7.02; N, 2.66. Found C, 65.75; H, 7.31; N, 2.54.
Methyl 4-dibenzo[b,f][7]annulen-5-ylidenepiperidinecar-
.
boxylate (19). TiCl4 THF (1:2) complex (2.24 g, 6.71
mmol) was added to a stirred suspension of zinc dust
(879 g, 13.44 mmol) in dry THF (10 mL). The resulting
black mixture was heated at reflux for 1 h under argon.
The suspension was cooled to room temperature and a
solution of dibenzosuberenone 17 (433 mg, 2.10 mmol)
and 1-carbomethoxy-4-piperidone 7 (363 mg, 2.31
mmol) in dry THF (12 mL) was added. The mixture was
heated at reflux for 14 h and then concentrated. The
concentrated residue was passed through a short col-
umn (silica gel: 5 g, eluent: ethyl acetate, 20 mL) to
remove the black solid. The combined fractions were
evaporated and the yellow residue was purified by flash
chromatography on silica gel (60 g), eluting with hex-
anes-ethyl acetate (3:1, v/v), to give a light-yellow solid
Methyl 4 - (40,400 - dimethoxy - 30,300 - di(methoxycarbonyl)-
50,500-dimethyl-diphenylmethyl)piperidinecarboxylate (22).
The piperidinecarboxylate 12 (82 mg, 0.16 mmol) was
hydrogenated at 60 psi over palladium (30%) on acti-
vated carbon (50 mg) in MeOH (20 mL). After TLC
had shown that all the starting material was consumed,
the catalyst was filtered and the solvent was evaporated.
The crude residue was flash chromatographed on silica
gel (15 g) using hexanes/EtOAc (1:1 v/v) to give product
22 as a colorless oil (60.4 mg, 73.4%). 1H NMR
(CDCl3) d 7.50 (d, J=2.22 Hz, 2H), 7.19 (d, J=2.02 Hz,
2H), 3.91 (s, 6H), 3.84 (d, J=3.14 Hz, 1H), 3.76 (s, 6H),
3.69 (m, 1H), 3.67 (s, 3H), 3.38 (m, 1H), 2.73 (t, J=12.63
Hz, 2H), 2.27 (s, 6H), 2.18 (m, 1H), 1.51 (m, 2H), 1.02 (m,
2H); 13C NMR (CDCl3) d 166.79, 156.79, 155.76, 137.98,
134.38, 132.97, 128.15, 124.38, 61.31, 57.12, 52.34, 52.09,
43.84, 39.40, 30.88, 16.15. Anal. calcd for C28H35NO8: C,
65.50; H, 6.82; N, 2.73. Found C, 65.75; H, 6.30; N, 2.46.
(542 mg, 77.9%): mp 63–65 ꢁC. H NMR (CDCl3) d
1
7.22–7.41 (m, 8H), 6.97 (s, 2H), 3.66–3.80 (br, 2H), 3.73
(s, 3H), 3.12 (ddd, J=12.89, 8.98, and 3.88 Hz, 2H),
2.31 (ddd, J=12.89, 8.89, and 4.40 Hz, 2H), 2.18 (dt,
J=19.0 and 4.77 Hz, 2H); 13C NMR (CDCl3) d 155.74,
138.64, 134.80, 134.59, 134.20, 130.85, 128.18, 128.12,
127.79, 126.35, 52.44, 45.22, 29.84; CIMS m/z 332
(MH)+. Anal. calcd for C22H21NO2: C, 79.76; H, 6.34;
N, 4.23. Found C, 79.63; H, 6.60; N, 3.97.
Methyl 4-(5,6-dihydrodibenzo[b,f][7]annulen-11-ylidene)pi-
.
peridinecarboxylate (20). TiCl4 THF (1:2) complex
(4.27 g, 12.8 mmol) was added to a stirred suspension of
zinc dust (1.67 g, 25.6 mmol) in dry THF (12 mL). The
resulting black mixture was heated at reflux for 1 h
under argon. The suspension was cooled to room tem-
perature and a solution of dibenzosuberone 18 (833 mg,
4.00 mmol) and 1-carbomethoxy-4-piperidone 7 (691
mg, 4.40 mmol) in dry THF (18 mL) was added. The
Ethyl 4-(30,300-dicarboxy-50,500-dichloro-40,400-dimethoxy-
diphenylmethylene)piperidinecarboxylate (23). Diester 14
(200 mg, 0.353 mmol) and NaOH (1.2 mL of 1 N NaOH
solution) were added to aqueous ethanol (3:2, v/v, 6
mL). The mixture was heated on a water bath at
65–70 ꢁC for 3 h. The reaction mixture was concentrated
to remove ethanol, and then acidified with concd HCl.

2814
G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
The acidified suspension was extracted with ethyl ace-
tate (3ꢃ10 mL). The organic layer was separated, dried
over Na2SO4 and crystallized in hexanes–ethyl acetate
(2:1, v/v) to afford white crystals (180 mg, 94.7%): mp
(25 mL) under argon. The resulting dark mixture was
heated under reflux for 1 h. The suspension was cooled
to room temperature and a mixture of benzophenone 27
(485 mg, 1.08 mmol) and 1-carbethoxy-4-piperidone (6)
(216 mg, 1.29 mmol) in THF (15 mL) was added. The
mixture was heated at reflux and stirred for 14 h,
cooled, and poured into 10% aqueous potassium car-
bonate (20 mL). Then it was filtrated through a pad of
Celite and the filtrate was evaporated to give a light
yellow residue, which was purified by flash chromato-
graphy (EtOAc–hexanes 1:1, v/v) to afford compound
28 as a white powder (204 mg, 32.1%): mp 154–156 ꢁC.
1H NMR (CDCl3) d 7.58 (d, J=Hz, 2H), 7.30 (d,
J=Hz, 2H), 4.12 (q, J=Hz, 2H), 3.50 (t, J=Hz, 4H),
2.29 (t, J=Hz, 4H), 1.77 (s, 12H), 1.23 (t, J=Hz, 3H);
13C NMR (CDCl3) d 159.93, 155.32, 151.01, 138.54,
137.34, 135.55, 132.0, 128.83, 122.39, 114.59, 107.39,
61.43, 44.69, 31.45, 25.90, 14.58; EIMS m/z 590 (MH)+.
Anal. calcd for C29H29NCl2O8: C, 58.98; H, 4.92; N,
2.37. Found C, 58.91; H, 5.15; N, 2.14.
116–118 ꢁC. H NMR (CDCl3) d 7.71 (d, J=2.15 Hz,
1
2H), 7.36 (d, J=2.34 Hz, 2H), 4.15 (d, J=7.14 Hz, 2H),
4.03 (s, 6H), 3.56 (t, J=4.99 Hz, 4H), 2.35 (t, J=5.12
Hz, 4H), 1.29 (t, J=7.07 Hz, 3H); 13C NMR (CDCl3) d
163.06, 151.74, 150.87, 134.80, 134.03, 132.38, 128.19,
125.58, 125.19, 125.08, 120.70, 58.64, 57.85, 40.87,
27.56, 10.72; CIMS m/z 538 (MH)+. Anal. calcd for
C25H25NCl2O8: C, 55.76; H, 4.65; N, 2.60. Found C,
54.63; H, 4.75; N, 2.22.
Methyl 4-(30,30-dicarboxy-50,500-dichloro-40,400-dimethoxy-
diphenylmethylene)piperidinecarboxylate (24). Diester 15
(410 mg, 0.742 mmol) and NaOH (2.23 mL of 1 N
NaOH solution) were added to aqueous ethanol (3:2, v/v,
10 mL). The mixture was heated on a water bath at 50–
55 ꢁC for 3 h. The reaction mixture was concentrated to
remove ethanol, and then acidified with concd HCl. The
acidified suspension was extracted with ethyl acetate
(3ꢃ15 mL). The organic layer was separated, dried over
Na2SO4 and crystallized in hexanes–ethyl acetate (2:1, v/
v) to afford white crystals (356 mg, 91.5%): mp 143–
Ethyl 4-(30,300-di(carboxy)-50,500-dichloro-40,400-dihdroxy-
diphenylmethylene)piperidinecarboxylate (29). Diester 28
(150 mg, 0.254 mmol) and NaOH (3 mL of 1 N NaOH
solution) were added into aqueous methanol (3:2, v/v, 5
mL). The mixture was heated on a water bath at 50–
55 ꢁC for 3 h, the reaction mixture was concentrated to
remove methanol, and then acidified with 1 N HCl (5.4
mL). The acidified suspension was extracted with ethyl
acetate (3ꢃ10 mL). The organic layer was separated,
dried over Na2SO4 and crystallized in hexanes/ethyl
acetate (2:1, v/v) to afford white crystals (94 mg,
72%): mp 270–272 ꢁC. 1H NMR (CDCl3) d 7.70 (d,
J=2.11 Hz, 2H), 7.51 (d, J=2.10 Hz, 2H), 4.10 (q,
J=7.12 Hz, 2H), 3.56 (t, J=5.55 Hz, 4H), 2.38 (t,
J=5.77 Hz, 4H), 1.22 (t, J=7.09 Hz, 3H); 13C NMR
(CDCl3) d 172.64, 157.88, 156.30, 138.64, 138.10,
134.27, 133.88, 131.28, 122.71, 114.83, 62.03, 45.93,
32.65, 15.39; CIMS m/z 510 (MH)+. Anal. calcd for
C29H29NCl2O8: C, 54.13; H, 4.15; N, 2.75. Found C,
54.42; H, 4.55; N, 2.37.
ꢁ
1
145 C. H NMR (CDCl3) d 7.65 (d, J=2.28 Hz, 2H),
7.30 (d, J=2.13 Hz, 2H), 4.02 (s, 6H), 3.66 (s, 3H), 3.51
(t, J=5.35 Hz, 4H), 2.31 (t, J=5.35 Hz, 4H); 13C NMR
(CDCl3) d 167.25, 155.98, 154.81, 138.39, 137.78,
136.15, 132.19, 131.94, 129.17, 124.70, 62.43, 52.87,
44.78, 31.36; ESI m/z 524 (MH)+. Anal. calcd for
C24H23NCl2O8: C, 54.96; H, 4.39; N, 2.67. Found C,
54.14; H, 4.41; N, 2.52.
Ethyl 4-(30,300-dicarboxy-50,500-dichloro-40,400-dimethoxy-
diphenylmethylene)piperidinecarboxylate disodium salt
(25). The diacid 23 (107 mg, 0.199 mmol) was dissolved
in a mixture of ethanol (2 mL) and a 1 N solution of
NaOH (0.4 mL). The resulting solution was con-
centrated and dried in vacuo to yield a white solid (116
mg, 100%): mp 300 ꢁC. 1H NMR (D2O) d 7.26 (d,
J=2.12 Hz, 2H), 7.15 (d, J=2.15 Hz, 2H), 4.09 (q,
J=7.20 Hz, 2H), 3.85 (s, 6H), 3.46 (t, J=5.06 Hz, 4H),
2.31 (t, J=5.06 Hz, 4H), 1.21 (t, J=7.01 Hz, 3H). Anal.
calcd for C24H21NNa2Cl2O8: C, 50.70; H, 3.70; N, 2.46.
Found C, 50.32; H, 3.92; N, 2.15.
Cells and viruses
U1, CEM-SS, HL2/3 and HeLa CD4 LTR b-gal cell
lines were obtained from the NIAID AIDS Research
and Reference Reagent Program (Bethesda, MD, USA).
The U1 and CEM-SS cells were maintained in RPMI
1640 medium supplemented with 10% heat inactivated
fetal bovine serum, 2 mM glutamine, penicillin (100 U/
mL) and streptomycin (100 mg/mL), and the HeLa CD4
LTR b-gal cells were maintained in DMEM 10% FBS,
penicillin, streptomycin and glutamine. HeLa CD4 LTR
b-gal cell cultures were also supplemented with G418
(200 mg/mL) and hygromycin (100 mg/mL), which was
removed prior to assays by a 24 h pre-culture in selec-
tion antibiotic-free medium. Human immunodeficiency
virus type 1 (HIV-1) strains RF and IIIBwere obtained
from the NIAID AIDS Research and Reference
Reagent Program. CEM-SS cells chronically infected
with the clinical isolate SK-122 of HIV-1 were derived
from an acute infection, and maintained as described
above.
Methyl
4-(30,300-di(carboxy)-50,500-dichloro-40,400-dime-
thoxy-diphenylmethylene)piperidinecarboxylate disodium
salt (26). The diacid 24 (104 mg, 0.198 mmol) was dis-
solved in a mixture of ethanol (2 mL) and a 1 N solution
of NaOH (0.4 mL). The resulting solution was con-
centrated and dried in vacuo to yield a white solid (113
mg, 100%): mp 300 ꢁC. 1H NMR (D2O) d 7.22 (d,
J=1.83 Hz, 2H), 7.15 (d, J=2.12 Hz, 2H), 3.86 (s, 6H),
3.68 (s, 3H), 3.48 (t, J=5.35 Hz, 4H), 2.33 (t, J=5.35
Hz, 4H). Anal. calcd for C25H23NNa2Cl2O8: C, 51.55;
H, 3.95; N, 2.41. Found C, 51.21; H, 3.78; N, 2.32.
Ethyl 4-[bis(8-chloro-2,2-dimethyl-4-oxobenzo[3,4-E]1,3-di-
.
oxin-6-yl)methylene]piperidinecarboxylate (28). TiCl4 THF
(1:2 complex) (1.15 g, 3.44 mmol) was added to a stirred
suspension of zinc powder (452 mg, 6.91 mmol) in THF

G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
2815
HIVcytoprotection assay
b-galactosidase enzyme expression was determined by
chemiluminescence. The compounds CSBand AZT
were used as positive controls.
The inhibitory activities of the compounds were eval-
uated as previously described with the cytopathic RF
strain of HIV-1 and CEM-SS cells.23 These are micro-
titer assays, which quantitate the ability of a compound
to inhibit HIV-1 induced cell killing via syncytium for-
mation. Cytoprotection and compound cytotoxicity are
measured with the CellTiter 961 Reagent (Promega,
Madison, WI, USA) 6 days post infection. This reagent
contains the tetrazolium compound 3-(4,5-dimethyl-
thiazol-2-yl)-5-(carboxymethoxyphenyl)-2-(4-sulfophenyl)-
2H-tetrazolium, inner salt (MTS) and the electron cou-
pling agent phenazine ethosulfate in a colorless stable
solution, which upon reduction by viable cells forms a
colored solution with absorbance at 490 nm. Antiviral
and toxicity data are reported as the concentration of
compound required to inhibit 50% virus-induced cell
killing (50% effective concentration [EC50]) and the
concentration of compound required to reduce cell via-
bility by 50% (cytotoxicity). All data are derived from
triplicate tests with the variation of the mean averaging
10%.
Integration enzyme assay
The integration reaction mixtures contained MOPS
(250 mM), pH 7.2, MnCl2 (75 mM), b-mercap-
toethanol (14.3 mM), BSA (0.1 mg/mL) and the
21 mer duplex (10 nM) of the HIV-1 U5 LTR. The
sequence of the top strand of the U5 LTR was 50
GTGTGGAAAATCTCTAGCAGT30, and the bottom
strand was the complementary sequence. The 50 end of
the top strand was labeled with 32P, by T4 polynucleo-
tide kinase according to the manufacturer’s recommen-
dations (New England BioLabs, Beverly, MA).
Unincorporated nucleotide was removed by applying
the labeling mixture to a BioSpin6 column (BioRad,
Hercules, CA). The top and bottom strands were
annealed by heating the mixture at 95 ꢁC for 5 min and
cooling to room temperature. The DAMPs 11, 12, 14,
and 15 were dissolved in DMSO at a concentration
equal to 10 times the final concentration, and the
resulting solutions (1 mL) were added to reaction mix-
tures without DNA (8.5 mL). The final DAMP con-
centrations were 111, 37, and 12.3 mM. After a 10 min
preincubation of the drug and integrase at room tem-
perature, the DNA was added (0.5 mL) to allow the
reaction to occur. The mixtures were incubated at 37 ꢁC
for 30 min. Gel loading dye (98% formamide, 0.025%
xylene cyanol, 0.025% bromophenol blue, 10 mM
EDTA) was added to each tube to stop the reactions,
and the reactions were heated at 95 ꢁC. The 21mer sub-
strate was separated from 19mer and strand transfer
products on a 20% denaturing gel. The gels were
exposed to a Molecular Dynamics phosphoimager
screen and quantified by ImageQNT.25
RT inhibition assay
Analysis of the effects of the compounds on recombi-
nant HIV-1 RT enzyme (p66/51 dimer) were performed
as previously described.24 Briefly, inhibition of purified
recombinant reverse transcriptase enzyme was measured
by the incorporation of [32P] GTP into poly(rC)-oli-
go(dG) (rCdG) homopolymer template primers.
HIVattachment and fusion assays
Attachment and fusion assays were performed as pre-
viously described with minor modifications.22 Briefly,
for the attachment assay, compound and cells (1ꢃ104)
were preincubated for 30 min and a pre-titered amount
of HIV-1 IIIBadded. Cells and virus were incubated for
1 h and unbound virus removed by washing. The fusion
assay was performed by coculture of 5ꢃ103 HL2/3 and
HeLa CD4 LTR b-gal cells, following pre-exposure of
both cell lines to the compounds for 30 min. Virus
replication in both assays was detected by chemilumin-
escence using a single step lysis and detection method
(Tropix Gal-screenTM, Bedford, MA, USA). Virus
binding to HeLa CD4 LTR b-gal cells was quantitated
by determination of cell-associated p24 antigen (ELISA,
Coulter Electronics Hialeah, Fl, USA) to confirm lack
of inhibitory activity on virus-cell interaction, following
a 1 h adsorption of virus and vigorous washing to
remove unbound virus.
Acknowledgements
This investigation was made possible by Grant RO1-AI-
43637, awarded by the National Institutes of Health,
DHHS.
References and Notes
1. Carpenter, C. C. J.; Fischl, M. A.; Hammer, S. M.; Hirsch,
M. S.; Jacobsen, D. M.; Katzenstein, D. A.; Montaner, J. S. G.;
Richman, D. D.; Saag, M. S.; Schooley, R. T.; Thompson,
M. A.; Vella, S.; Yeni, P. G.; Volberding, P. A. J. Am. Med.
Assoc 1998, 280, 78.
2. Barry, M.; Mulcahy, F.; Back, D. J. Br. J. Clin. Pharmacol.
1998, 45, 221.
3. Fischl, M. A. AIDS 1999, 13 (Suppl. 1), S49.
4. Vajpayee, M.; Dar, L. Indian J. Pharmacol. 1999, 31, 96.
5. Beach, J. W. Clin. Ther. 1998, 20, 2.
6. Cushman, M.; Golebiewski, W. M.; McMahon, J. B.; Buc-
kheit, R. W., Jr.; Clanton, D. J.; Weislow, O.; Haugwitz,
R. D.; Bader, J.; Graham, L.; Rice, W. G. J. Med. Chem.
1994, 37, 3040.
7. Cushman, M.; Golebiewski, W. M.; Pommier, Y.;
Mazumder, A.; Reymen, D.; De Clercq, E.; Graham, L.; Rice,
W. G. J. Med. Chem. 1995, 38, 443.
Time-of-addition assay
Time-of-addition assays (TOA) were performed using a
pre-titered concentration of the IIIBstrain of HIV and
HeLa CD4 LTR b-gal cells. Test materials were added
30 min before, at the time of infection or at 30 min, 1, 2,
4, 8, or 24 h post infection. At 2 h post infection
unbound virus was removed by washing and cultures
continued with fresh compound. At 48 h post infection

2816
G. Xu et al. / Bioorg. Med. Chem. 10 (2002) 2807–2816
8. Cushman, M.; Insaf, S.; Ruell, J. A.; Schaeffer, W. G.;
Rice, W. G. Bioorg. Med. Chem. Lett. 1998, 8, 833.
9. Cushman, M.; Insaf, S.; Paul, G.; Ruell, J.; De Clercq, E.;
Schols, D.; Pannecouque, C.; Witvrouw, M.; Schaeffer, C. A.;
Turpin, J. A.; Williamson, K.; Rice, W. G. J. Med. Chem.
1999, 42, 1767.
Stup, T. L.; Watson, K.; Buckheit, R. W., Jr.; Cushman, M.
J. Med. Chem. 1999, 42, 4861.
19. Xu, G.; Micklatcher, M.; Silvestri, M.; Loftus, T. L.; Turpin,
J. A.; Buckheit, R. W.; Cushman, M., Unpublished results.
20. Clanton, D. J.; Moran, R. A.; McMahon, J. B.; Weislow,
O. S.; Buckheit, R. W., Jr.; Hollingshead, M. G.; Ciminale, V.;
Felber, B. K.; Pavlakis, G. N.; Bader, J. P. J. Acquir. Immune
Defic. Syndr. 1992, 5, 771.
10. Golebiewski, W. M.; Keyes, R. F.; Cushman, M. Bioorg.
Med. Chem. 1996, 4, 1637.
11. Keyes, R. F.; Golebiewski, W. M.; Cushman, M. J. Med.
Chem. 1996, 39, 508.
12. Paul, G. C.; De Clercq, E.; Pannecouque, C.; Vitvrouw,
M.; Loftus, T. L.; Turpin, J. A.; Buckheit, R. W.; Cushman,
M. Bioorg. Med. Chem. Lett. 2000, 10, 2149.
21. Turpin, J. A.; Buckheit, R. W., Jr.; Derse, D.; Hollings-
head, M.; Williamson, K.; Palamone, C.; Osterling, M. C.;
Hill, S. A.; Graham, L.; Schaeffer, C. A.; Bu, M.; Huang, M.;
Cholody, W. M.; Michejda, C. J.; Rice, W. G. Antimicrob.
Agents Chemother. 1998, 42, 487.
13. Ruell, J. A.; De Clercq, E.; Pannecouque, C.; Witvrouw,
M.; Stup, T.; Turpin, J. A.; Buckheit, R. W., Jr; Cushman, M.
J. Org. Chem. 1999, 64, 5858.
22. Buckheit, R. W., Jr.; Robertson, J. L.; Lackman-Smith,
C.; Wyatt, J. R.; Vickers, T. A.; Exker, D. J. AIDS Res. Hum.
Retroviruses 1994, 10, 1497.
14. Cushman, M.; Golebiewski, M.; Buckheit, R. W., Jr.; Gra-
ham, L.; Rice, W. G. Bioorg. Med. Chem. Lett. 1995, 5, 2713.
15. Cushman, M.; Golebiewski, W. M.; Graham, L.; Turpin,
J. A.; Rice, W. G.; Fliakas-Boltz, V.; Buckheit, R. W., Jr.
J. Med. Chem. 1996, 39, 3217.
23. Buckheit, R. W., Jr.; Kinjerski, T. L.; Fliakas-Boltz, V.;
Russell, J. D.; Stup, T. L.; Pallansch, L. A.; Brouwer,
W. G.; Dao, D. C.; Harrison, W. A.; Schultz, R. J.; Bader,
J. P.; Yang, S. S. Antimicrob. Agents Chemother. 1995, 39,
2718.
16. Cushman, M.; Casimiro-Garcia, A.; Hejchman, E.; Ruell,
J. A.; Huang, M.; Schaeffer, C. A.; Williamson, K.; Rice,
W. G.; Buckheit, R. W., Jr. J. Med. Chem. 1998, 41, 2076.
17. Cushman, M.; Casimiro-Garcia, A.; Williamson, K.; Rice,
W. G. Bioorg. Med. Chem. Lett. 1998, 8, 195.
24. Buckheit, R. W., Jr.; Fliakas-Boltz, V.; Decker, W. D.;
Robertson, J. L.; Stup, T. L.; Pyle, C. A.; White, E. L.;
McMahon, J. B.; Currens, M. J.; Boyd, M. R.; Bader, J. P.
Antiviral Res. 1995, 26, 117.
25. Marchand, C.; Neamati, N.; Pommier, Y. Methods Enzy-
mol. 2001, 340, 624.
18. Casimiro-Garcia, A.; Micklatcher, M.; Turpin, J. A.;