Cloning and functional characterisation of a cis-muuroladiene synthase from black peppermint (Mentha × piperita) and direct evidence for a chemotype unable to synthesise farnesene

Article abstract of DOI:10.1016/j.phytochem.2005.06.012

Using oligonucleotide primers designed to the known gene sequence of an (E)-β-farnesene (EβF) synthase, two cDNA sequences (MxpSS1 and MxpSS2) were cloned from a black peppermint (Mentha × piperita) plant. MxpSS1 encoded a protein with 96% overall amino acid sequence identity with the EβF synthase. Recombinant MxpSS1 produced in Escherichia coli, after removal of an N-terminal thioredoxin fusion, had a K_m for FPP of 1.91 ± 0.1 μM and k_cat of 0.18 s^-1, and converted farnesyl diphosphate (FPP) into four products, the major two being cis-muurola-3,5-diene (45%) and cis-muurola-4(14),5-diene (43%). This is the first cis-muuroladiene synthase, to be characterised. MxpSS2 encoded a protein with only two amino acids differing from EβF synthase. Recombinant MxpSS2 protein showed no activity towards FPP. One of the two mutations, at position 531 (leucine in MxpSS2 and serine in EβF synthase) was shown, by structural modelling to occur in the J-K loop, an element of the structure of sesquiterpene synthases known to be important in the reaction mechanism. Reintroduction of the serine at position 531 into MxpSS2 by site-directed mutagenesis restored EβF synthase activity (K_m for FPP 0.98 ± 0.12 μM, k_cat 0.1 s^-1), demonstrating the crucial role of this residue in the enzyme activity. Analysis, by GC-MS, of the sesquiterpene profile of the plant used for the cloning, revealed that EβF was not present, confirming that this particular mint chemotype had lost EβF synthase activity due to the observed mutations.

Full text of DOI:10.1016/j.phytochem.2005.06.012

PHYTOCHEMISTRY
Phytochemistry 67 (2006) 1564–1571
www.elsevier.com/locate/phytochem
Cloning and functional characterisation of a
cis-muuroladiene synthase from black peppermint
(Mentha · piperita) and direct evidence for a
chemotype unable to synthesise farnesene
1
1
Ian M. Prosser , Racheal J. Adams , Michael H. Beale, Nathan D. Hawkins,
*
Andrew L. Phillips, John A. Pickett, Linda M. Field
Rothamsted Research, Harpenden, West Common, Herts, AL5 2JQ, UK
Received 3 November 2004; received in revised form 6 June 2005
Available online 3 August 2005
Dedicated to Professor Rod Croteau on the occasion of his 60th birthday.
Abstract
Using oligonucleotide primers designed to the known gene sequence of an (E)-b-farnesene (EbF) synthase, two cDNA
sequences (MxpSS1 and MxpSS2) were cloned from a black peppermint (Mentha · piperita) plant. MxpSS1 encoded a protein
with 96% overall amino acid sequence identity with the EbF synthase. Recombinant MxpSS1 produced in Escherichia coli, after
removal of an N-terminal thioredoxin fusion, had a Km for FPP of 1.91 0.1 lM and kcat of 0.18 sꢀ1, and converted farnesyl
diphosphate (FPP) into four products, the major two being cis-muurola-3,5-diene (45%) and cis-muurola-4(14),5-diene (43%).
This is the first cis-muuroladiene synthase, to be characterised. MxpSS2 encoded a protein with only two amino acids differing
from EbF synthase. Recombinant MxpSS2 protein showed no activity towards FPP. One of the two mutations, at position 531
(leucine in MxpSS2 and serine in EbF synthase) was shown, by structural modelling to occur in the J–K loop, an element of the
structure of sesquiterpene synthases known to be important in the reaction mechanism. Reintroduction of the serine at position
531 into MxpSS2 by site-directed mutagenesis restored EbF synthase activity (Km for FPP 0.98 0.12 lM, kcat 0.1 sꢀ1), demon-
strating the crucial role of this residue in the enzyme activity. Analysis, by GC–MS, of the sesquiterpene profile of the plant used
for the cloning, revealed that EbF was not present, confirming that this particular mint chemotype had lost EbF synthase activity
due to the observed mutations.
ꢀ 2005 Elsevier Ltd. All rights reserved.
Keywords: Mentha · piperita; Black peppermint; Farnesyl diphosphate; Sesquiterpene synthase; cis-Muuroladiene; (E)-b-farnesene
1. Introduction
are derived from farnesyl diphosphate (FPP (1)) or via
nerolidyl diphosphate by the action of sesquiterpene
synthases. Synthesis of sesquiterpenes from FPP takes
place at the cytosol/endoplasmic reticulum boundary
(Belingheri et al., 1988; Gleizes et al., 1980) and one of
the products is (E)-b-farnesene (EbF) which occurs in
a number of plants and animals and can be involved
in chemical communication. Potentially the most impor-
tant signalling role of EbF is in aphids, where it is se-
creted from the cornicles when aphids are attacked by
Sesquiterpenes are a large family of C15 isoprenoids,
found in bacteria, fungi, insects and plants where they
Abbreviations: EbF, (E)-b-farnesene; FPP, farnesyl diphosphate.
Corresponding author. Tel.: +44 1582 763133; fax: +44 1582
*
762595/3010.
E-mail address: lin.field@bbsrc.ac.uk (L.M. Field).
Joint first authors.
1
0031-9422/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2005.06.012

I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
1565
predators and acts as an alarm pheromone, causing
other aphids to disperse(Glinwood and Pickett, 2004;
Pickett et al., 1992, 1997).
has eight exons of 113, 257, 351, 223, 210, 210, 184
and 305 bp, interspersed by seven introns of approxi-
mately 100, 200, 50, 575, 500, 200 and 650 bp (the intron
sizes are approximate because in some cases only the
borders have been sequenced).
The biosynthesis of EbF in peppermint (Men-
tha · piperita, L. cv. ÔBlack MitchamÕ) has been studied
at the molecular level by Crock et al. (1997)) who iden-
tified an EbF synthase in a collection of expressed
sequence tags (ESTs) from oil-gland cells. The cloned
gene encoded a protein most similar to the sesquiterpene
synthase, epi-aristolochene synthase, from tobacco, and
with Mg2+ as the co-factor, the recombinant enzyme
expressed in Escherichia coli from pBluescript was able
to convert FPP to EbF (85%), (Z)-b-farnesene (8%),
d-cadinene (5%) and other minor unidentified sesquiter-
pene products. With Mn2+ as the co-factor, EbF (98%)
and (Z)-b-farnesene (2%) were synthesised.
We have been following up this original work on
Mentha sesquiterpene synthases with a view to exploring
the suggestion (Crock et al., 1997) that EbF synthase
gene could be used to engineer other plants to produce
EbF and hence to exploit the pheromonal properties
of the natural product for plant defence against aphids.
In this paper we report further work on sesquiterpene
synthases in Mentha, in particular the cloning and func-
tional characterisation of two novel genes.
2.2. Activity of MxpSS1 and MxpSS2
The two cDNAs cloned from Mentha · piperita, with
homology to the EbF synthase, were cloned into the
expression vector pET-32b and the sequences verified.
Recombinant thioredoxin fusion proteins were ex-
pressed in Codon Plus E. coli, purified using Ni-chelate
chromatography and then incubated with radiolabelled
substrate [1-3H]FPP. The products were extracted and
quantified by scintillation counting. MxpSS1 gave sig-
nificant levels of radiolabelled product (2302 disintegra-
tions minꢀ1), whereas MxpSS2 gave no counts above the
background control (28 disintegrations minꢀ1).
The non-polar, volatile products produced from FPP
by the activity of MxpSS1 were separated by GC–MS as
shown in Fig. 2. This revealed four major sesquiterpene
peaks which were initially identified by comparison with
published spectra and retention indices (Adams, 2001)
as cis-muurola-3,5-diene (9) (45%) (see Fig. 4), cis-muu-
rola-4(14),5-diene (10) (43%), c-cadinene (6) (7%) and
a-cadinene (7) (5%). Since the formation of the muuro-
ladienes was unexpected, their identification was
confirmed by GC–MS with authentic muuroladienes
from a sample of Cupressus bakerii (Kim et al., 1994).
Two GC columns were employed and use of the chiral
phase confirmed the absolute stereochemistry of the
cis-muuroladienes as being the same as that described
originally (Kim et al., 1994). The same products and
product profile were obtained using purified protein
that had the N-terminal fusion (thioredoxin +
histidine-tag) removed and showed that the fusion
did not alter the specificity of the enzyme. Kinetic
analysis of MxpSS1 with respect to FPP gave a Km of
1.91 lM 0.1 with the direct linear plot and kcat of
2. Results
2.1. Isolation of sesquiterpene synthase genes from
Mentha · piperita Ôblack peppermint’
Primers, designed from the published EbF synthase
cDNA sequence (Accession No. AF024615, (Crock et
al., 1997)), were used successfully in RT-PCR reac-
tions to amplify a fragment from Mentha · piperita
of 1700 bp (data not shown), the same size as would
be expected for the EbF synthase cDNA. Sequencing
of cloned PCR products identified two distinct
cDNAs. One sequence, MxpSS1, encoded a predicted
protein with 17 amino acids differing from the pub-
lished EbF synthase and also containing an inserted
glycine residue at position 95 (MxpSS1, Accession
No. AJ786641, 96% overall identity). The other se-
quence, MxpSS2, encoded a protein almost identical
to the reported EbF synthase (MxpSS2, Accession
No. AJ786642, 99.6% overall identity), except for a
leucine to isoleucine substitution at position 471 and
a serine to leucine substitution at position 531 (Fig.
1). There were several other differences in the DNA
sequences of these clones but these did not affect the
predicted protein sequences.
0.18 sꢀ1
.
2.3. Mutagenesis of MxpSS2
The clone MxpSS2, which encodes a protein with no
activity towards FPP and has two amino acids differing
from the reported EbF synthase, was subjected to site-
directed mutagenesis to give three new sequences
MxpSS2a (I471L), MxpSS2b (L531S) and MxpSS2c
(I471L and L531S), the latter encoding a predicted pro-
tein identical to the published EbF synthase.
The same primers, used on gDNA from Men-
tha · piperita produced an approximately 4500 bp frag-
ment. Cloning and sequencing of this fragment gave
only the MxpSS2 sequence and showed that this gene
Recombinant MxpSS2a, MxpSS2b and MxpSS2c
were produced in E. coli and analysed by SDS–PAGE,
confirming that the proteins were expressed and to a
similar level (data not shown). The proteins were then

1566
I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
Fig. 1. Predicted amino acid sequences of the (E)-b-farnesene synthase (AF024615) reported by Crock et al. (1997), and the proteins encoded by the
cDNAs MxpSS1 (Accession No. AJ86642) and MxpSS2 (Accession No. AJ86642). Arrows indicate differences between AF024615 and MxpSS2.
incubated with labelled FPP and the products were
extracted and quantified by scintillation counting.
MxpSS2a gave no significant levels of product,
whereas MxpSS2b and MxpSS2c produced products
which were separated by GC–MS, giving only single
peaks corresponding to EbF (data for MxpSS2c shown
in Fig. 3(a)). Thus, the I471L mutation did not restore
activity but L531S and the double mutant I471L/
L531S had normal activity.
Kinetic analysis of MxpSS2c with respect to FPP
gave a Km of 0.98 lM 0.1 and kcat of 0.1 sꢀ1 which
is similar to the result for MxpSS1 and demonstrated
that normal levels of activity had been restored.
not involved in catalysis. However, the L531 residue lies
in the J–K loop proposed to clamp down over the active
site entrance (Starks et al., 1997) and the serine to leucine
mutation has a significant impact on the catalytic activity.
The crystallography data from the epi-aristolochene syn-
thase suggests that this J–K loop exhibits a great deal of
flexibility and the mutation in this loop may alter its con-
formation and affect activity. It should be noted that in
the muuroladiene synthase (MxpSS1) there is a leucine
at the same position and yet the enzyme is active.
2.5. Sesquiterpenes in extracts of Mentha · piperita
‘black peppermint’
2.4. Structure of EbF synthase
The compounds present in hexane extracts of young
and mature leaves of Mentha · piperita are shown in
Fig. 3(b) and (c), respectively. In both cases there is
no EbF, suggesting that this compound is not synthes-
ised in the plants used in this study. Neither of the
muuroladienes were found in the extract. Extraction
of plant material with ethyl acetate revealed two puta-
The I471 mutation in MxpSS2a is far removed from
the active site and the observation that the single replace-
ment to give I471L did not restore activity, when coupled
with the high activity of L531S mutant, which retained
the isoleucine at position 47, suggests that the I471 is

I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
1567
Fig. 2. (a) Total ion current trace of the products synthesised by MxpSS1 from FPP and the structures of the principal products. (b) TIC of hexane
extract of Cupressus bakerii. (c) Mass spectra derived from the main peaks.
tive oxidised sesquiterpene products. From the mass
spectra of these compounds it appears that neither of
them are related to muuroldiene.
thase. It is interesting to note that we have not been able
to identify these compounds in extracts ofour plants, indi-
cating that either the cis-muurolodiene synthase is ex-
pressed at very low levels in vivo or that the
hydrocarbon products are further metabolised in the
plant beyond simple oxygenations. However, this is not
without precedent; an epi-cedrol synthase has been iso-
lated from Artemisia annua but neither cedrol or epi-ce-
drol were found in the sesquiterpene profile of the plant
(Mercke et al., 1999). From our cis-muuroladiene syn-
thase, the four detected products are biosynthetically
related and their biosynthesis via nerolidyl diphosphate
can be rationalised following (Kim et al., 1994) as shown
3. Discussion
One of the cDNAs cloned here (MxpSS1) is a novel
member of the sesquiterpene synthase family and
encodes an enzyme which can convert FPP to a range of
sesquiterpenes. The major products are cis-muurola-3,5-
diene (45%) and cis-muurola-4(14),5-diene (43%) and
we therefore name this enzyme a cis-muuroladiene syn-

1568
I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
100
a
E
69
100
%
93
133
120
105
%
79
55
161
(E)-β-farnesene
204
189
147
m/z
0
60 80 100 120 140 160 180 200 220
0
25.00
26.00
27.00
28.00
29.00
30.00
Time
31.00
32.00
33.00
34.00
35.00
100
b
Young leaf
%
0
c
100
Mature leaf
%
0
27.00
28.00
29.00
30.00
31.00
32.00
33.00
Time
Fig. 3. GC-MS. (a) Total ion current trace of the products from FPP synthesised by MxpSS2c. Inset: mass spectrum of main peak. (b) The
compounds present in a hexane extract of young and mature leaves of Mentha · piperita.
in Fig. 4. FPP (1) rearranges (2) and ionisation–cyclisa-
tion creates a 11-germacryl cation (3) which by a 1,3-hy-
dride migration generates the 1-germacryl cation (4).
This cation, by cyclisation rearranges to the 10-cadinyl
cation (5), which deprotonates to give the cadinenes (6
and 7). However, the majority of the cation (5) undergoes
two further 1,2-hydride migrations to generate the cis-
muurolyl cation (8), leading to the muuroladiene prod-
ucts (9 and 10) by proton elimination. The production
of multiple products is in line with other reports that many
of the enzymes which act on isoprenoid diphosphates pro-
duce a range of products (Steele et al., 1998).
of Deligeorgopoulou and Allemann (2003), showing that
a single amino acid substitution could convert an aristo-
lochene synthase into an enzyme which produced 73%
EbF. Here it was suggested that differential folding of
FPP in the active site was responsible for the change in
activity. In our case the change from a serine to a leucine
in MxpSS2 may alter the structure of the J–K loop and
may therefore abolish catalytic activity by preventing
correct closure of the loop after substrate binding. How-
ever, this is unlikely since the muuroladiene synthase also
has a leucine at this position and is functionally active.
The subtle change,is thus either due to a steric effect or
the physico-chemical nature of the leucine versus serine
residue may impinge on the reaction mechanism.
The other cDNA cloned here (MxpSS2) has two ami-
no acids differing to a known EbF synthase and shows no
activity towards FPP. However, reinstating the serine at
position 531 restores activity. This is in line with the work
GC–MS studies showed that both MxpSS2b and
MxpSS2c produced a single product from FPP which

I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
1569
- OPP
1,3-H
H
1
H
PPO
+
1
11
OPP
4
3
+
2
1
H
H
H
H
H
10
-H+
+
+
+
H
6
7
5
2 x 1,2-H
H
H
H
H
3
-H+
14
+
5
8
9
10
Fig. 4. Putative route for conversion by MxpSS1 of FPP (1), via nerolidyl diphosphate (2) to c-cadinene (6) a-cadinene (7), cis-muurola-3,5-diene (9)
and cis-muurola-4(14),5-diene (10).
was identified as EbF (other small peaks were not ses-
quiterpenes). Thus, both of these enzymes are EbF syn-
thases and interestingly they produce pure product. This
is in contrast to the published EbF synthase which has
the same amino acid sequence and, in the presence of
Mg2+ (i.e., the conditions used in our study), produced
only 85% EbF with 8% ZbF and 5% cadinene. The rea-
son for the difference is not obvious but our assay con-
ditions may have been slightly different or the different
products may be the result of re-arrangement during
analysis. Initially, our study used a fusion protein with
a large N-terminal region. However, this did not result
in any alteration of product specificity or profile when
compared to the products from the enzymes with the
N-terminal fusions cleaved with thrombin (data not
shown).
In a publication by Trapp and Croteau (2001), a new
classification of terpene synthase genes was suggested
using a comparison of intron/exon patterns; 12–14
introns would denote a class I synthase, nine introns a
class II and six introns a class III. Using this guideline,
the gene described here with seven introns does not fall
in to any of these categories. The closest category is class
III, which also contains similar plant sesquiterpene
genes such as vetispiradiene synthase and 5-epi-aristo-
lochene synthase. Furthermore, (Facchini and Chappell,
1992) isolated two 5-epi-aristolochene synthase genes
from a genomic source and both of these had five
introns.
material. The plant used by Crock et al. (1997) was
Mentha · piperita L. cv. ‘‘Black Mitcham’’ and the plant
that we purchased was only described as Mentha · pipe-
rita, black peppermint. Extracts of the leaves of our
plant did not show any measurable amounts of EbF
suggesting that it did not have any active EbF synthase,
in line with the cloning which produced an apparently
inactive cDNA. This inactive cDNA was produced by
PCR, but the sequence differences between it and the
published EbF synthase are not PCR-induced errors
since the same sequence was found in the gene sequence
amplified from the genomic DNA. However, since we
cloned MxpSS2 by RT-PCR, the apparently inactive
form must be expressed even though it is unlikely to
contribute to the sesquiterpene profile of our particular
plant. These findings are in line with the known exis-
tence of ÔchemotypesÕ of Mentha · piperita (Piccaglia,
1998) which could arise from mutations in the sesquiter-
pene synthases leading to different product profiles. If
there are any other EbF synthase genes in Men-
tha · piperita they are either not expressed in the photo-
synthetic tissues or at such low levels that EbF cannot be
detected.
4. Experimental
4.1. Plant material
The fact that we did not clone the original sequence
encoding the EbF synthase reported by Crock et al.
(1997) suggest that we were not using equivalent plant
A Mentha · piperita Ôblack peppermintÕ plant was
purchased from Harpenden Garden Centre, Harpenden,
UK and propagated by root cuttings in compost at

1570
I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
20 5 ꢁC under 400 W HPS mercury vapour lamps.
Leaves were excised, frozen in liquid nitrogen and stored
at ꢀ80 ꢁC. Samples of Cupressus bakerii ssp. mathewsii
(Siskiyou Cypress) were obtained from Castle Howard
Arboretum, UK.
mid DNAs were isolated using the Qiaprepꢃ Spin Mini-
prep Kit (Qiagen) and inserts sequenced using a
BigDyeꢂ Termination Cycle Sequencing Ready Reac-
tion Kit (PE Applied Biosystems). The reactions were
run on an ABI 373A automated sequencer.
4.2. Oligonucleotides
4.6. Expression of recombinant protein
Primers designed to amplify the full-length EbF syn-
thase gene were custom synthesised by Gibco-BRL and
the concentrations checked by spectrophotometer read-
ings. The sequences were as underlined: Forward primer
50-CAGAGAGTTTGTTGTAGTGAAAAATG-30 and
Reverse primer 30-ACTAACGTATTAGTTTCTGG-
GATATT-50 where ATG and ACT are the start and
stop codons of the published EbF synthase cDNA
(Crock et al., 1997).
cDNAs were subcloned into the pET32b vector
(Novagen) and transferred into competent E. coli DH5
alpha cells, from which recombinant plasmids were iso-
lated and checked. The plasmids were then transferred
into E. coli Codon Plus (Stratagene). Expression and
purification of the recombinant protein followed the
procedure described in Prosser et al. (2002).
4.7. Cleavage of N-terminal fusion protein
4.3. Extraction of nucleic acids
HisBind-purified MxpSS1 and MxpSS2 were digested
with thrombin (1 unit mgꢀ1 protein) in 10 mM Tris pH
7.5, 150 mM NaCl at 23 ꢁC for 16 h. The resulting prod-
ucts were analysed by SDS–PAGE to ensure complete
digestion and a sample of the cleaved protein was as-
sayed and the products analysed by GC–MS.
Plant material stored at ꢀ80 ꢁC was used to extract
total RNA and gDNA using the RNeasy and DNeasy
plant kits (Qiagen) according to the manufacturerÕs
instructions and including the QIA shredder method
for tissue disruption.
4.8. Site-directed mutagenesis
4.4. PCR amplifications
Site-directed mutagenesis was done using the Quick-
changeꢂ Site-Directed Mutagenesis Kit (Stratagene)
according to the manufacturerÕs instructions. The
forward primers used were: I 471 L: TTTCCAC-
ATGAAAGAATATGGACTAACAAAGGAAGAG-
GCG and L531 S: AAACTGACGGAGACGCT-
For RT-PCR reactions, total RNA (200 ng) was used
to synthesise first strand cDNA from an oligo(dT) pri-
mer. The RNA and primer were heated at 65 ꢁC for
10 min, chilled on ice for 2 min and then added to reac-
tion mixes each containing dNTPs (1 mM each), DTT
(10 mM), Superscriptꢂ II Rnase Hꢀ reverse transcrip-
tase (200 U, Gibco-BRL), buffer supplied with the
enzyme and RNA guard (10 U, Amersham Pharmacia
Biotech) in a total volume of 20 ll. The reaction pro-
ceeded for 1 h at 37 ꢁC. PCR amplifications were done
in 25 ll reactions containing either cDNA (200 ng) or
gDNA (100 ng), MgCl2 (1.5 mM), dNTPs (0.2 mM),
primers (31.25 mg each), Pfu DNA polymerase (0.75
U, MBI Fermentas) and buffer supplied with the
enzyme. Reactions continued for 35 cycles of 94 ꢁC; 30
s, 45–55 ꢁC; 60 s and 72 ꢁC for 60 s kbꢀ1 template. This
was followed by heating at 72 ꢁC for 10 min. Products
were run on agarose gel electrophoresis (alongside suit-
able markers to check the size and the approximate
amounts) and then purified from the gel using the CON-
CERTꢂ gel purification kit (Gibco-BRL).
TATTCAGATCCTAATGTTGCCAA,
where
the
mutation sites are underlined. Reverse primers were ex-
act complements of the above. The amplification con-
sisted of 12 cycles with an annealing temperature of 55
ꢁC and extension time of 14 min.
4.9. Extraction and identification of sesquiterpenes from
plant material
Fresh young or mature leaves of Mentha · piperita
were extracted sequentially with redistilled hexane and
then ethyl acetate by grinding with a pestle and mortar
aided with a pinch of sand. The hexane extract was ap-
plied a short column of silica gel (BDH, 40–63 lm):mag-
nesium sulphate (10:1), eluted with hexane, and then
sequentially eluted with ether and ethyl acetate and the
eluates collected. The ethyl acetate extract was similarly
applied to the column and eluted with ethyl acetate. The
column eluates wereanalysed by GC–MS on aMicromass
GCT instrument using a BPX5 (SGE) capillary column.
The temperature programme was 50 ꢁC hold for 2 min
then an additional 3 ꢁC/min to 246 ꢁC which was held
for 4.67 min. Identification of the individual products
4.5. Cloning and sequencing
PCR fragments were cloned into pGEM-T-Easy
(Promega) according to the manufacturerÕs instructions
and transformed into competent E. coli XLI Blue cells
prepared by the method of Alexander et al. (1984). Plas-

I.M. Prosser et al. / Phytochemistry 67 (2006) 1564–1571
1571
was done by comparing spectra and KovatÕs retention
indices with published data (Adams, 2001), which defined
geometric isomers but not the absolute stereochemistry,
and by comparison of mass spectra and retention indices
with sesquiterpenes from C. bakerii (Kim et al., 1994).
Additionally, the samples were analysed using a Cyclo-
sil-B (J and W Scientific) chiral column. The temperature
programme was 50 ꢁC held for 2 min then an additional 3
ꢁC per min to 230 ꢁC which was held for 4.67 min. Terp-
enes were similarly extracted from 2 g C. bakerii leaf mate-
rial and analysed by GC–MS.
making available the Cupressus bakerii ssp. mathewsii
sample.
References
Adams, R.P., 2001. Identification of Essential Oil Components by Gas
Chromatography/Quadrupole Mass Spectrometry. Allured Pub-
lishing, Illinois.
Alexander, D.C., Mcknight, T.D., Williams, B.G., 1984. A simpli-
fied and efficient vector-primer cDNA cloning system. Gene 31,
79–89.
Belingheri, L., Pauly, G., Gleizes, M., Marpeau, A., 1988. Isolation by
an aqueous 2-polymer phase system and identification of endo-
membranes from Citrofortunella mitis fruits for sesquiterpene
hydrocarbon synthesis. J. Plant Physiol. 132, 80–85.
Crock, J., Wildung, M., Croteau, R., 1997. Isolation and bacterial
expression of a sesquiterpene synthase cDNA clone from pepper-
mint (Mentha · piperita, L.) that produces the aphid alarm
pheromone (E)-b-farnesene. Proc. Natl Acad. Sci. 94, 12833–
12838.
Deligeorgopoulou, A., Allemann, R.K., 2003. Evidence for differential
folding of farnesyl pyrophosphate in the active site of aristolochene
synthase: a single-point mutation converts aristolochene synthase
into an (E)-b-farnesene synthase. Biochemistry 42, 7741–7747.
Facchini, P.J., Chappell, J., 1992. Gene family for an elicitor-induced
sesquiterpene cyclase in tobacco. Proc. Natl Acad. Sci. 89, 11088–
11092.
Gleizes, M., Carde, J.P., Pauly, G., Bernarddagan, C., 1980. In vivo
formation of sesquiterpene hydrocarbons in the endoplasmic-
reticulum of pine. Plant Sci. Lett. 20, 79–90.
Glinwood, R.T., Pickett, J.A., 2004. In: Harrington, R.H. (Ed.),
Aphids as Crop Pests. CABI, Wallingford.
Kim, Y.K., Cool, L.G., Zavarin, E., 1994. cis-Calamenene-related
sesquiterpenoids from Cupressus bakeri Foliage. Phytochemistry
36, 961–965.
Mercke, P., Crock, J., Croteau, R., Brodelius, P.E., 1999. Cloning,
expression, and characterization of epi-cedrol synthase, a sesqui-
terpene cyclase from Artemisia annua L.. Arch. Biochem. Biophys.
369, 213–222.
4.10. Sesquiterpene synthase assays
For product identification, recombinant enzymes
were added to reactions containing sodium phosphate
pH 7.2 (20 mM), MgCl2 (5 mM), glycerol (10%),
[1-3H]FPP 850 GBq mmolꢀ1 (0.2 lM) and FPP (36
lM). This was overlaid with hexane and incubated at
27 ꢁC for 3 h. Then the hexane was removed, vortexed,
applied to a silica gel column, eluted with hexane and
the amount of radioactivity representing the sesquiter-
pene products was counted in a Rackbeta Scintillation
counter. The sesquiterpenes produced were identified
by GC–MS as above. A final elution of the column with
ethyl acetate gave no measurable radioactivity.
Kinetic analysis used the same core buffer but 5 ll of
the purified enzyme (2.4 pmoles MxpSS1 or MxpSS2)
was added to different substrate concentrations and
incubated for 10 min before the reaction was stopped
by the addition of 50 ll of 0.5 M EDTA. The reaction
was overlaid with hexane and processed as described
above. These quantities of enzyme were in the linear
part of a Vmax vs. enzyme concentration plot (not
shown).
Piccaglia, R., 1998. Aromatic plants: a world of flavouring com-
pounds. Agro Food Industry Hi-Tech 9, 12–15.
Pickett, J.A., Wadhams, L.J., Woodcock, C.M., 1997. Developing
sustainable pest control from chemical ecology. Agric. Ecosys.
Environ. 64, 149–156.
Pickett, J.A., Wadhams, L.J., Woodcock, C.M., Hardie, J., 1992. The
chemical ecology of aphids. Ann. Rev. Entomol. 37, 67–90.
Prosser, I., Phillips, A.L., Gittings, S., Lewis, M.J., Hooper, A.M.,
4.11. Modelling of protein structures
Three-dimensional structures of the predicted pro-
teins encoded by the cloned genes were modelled using
the ExPASy SWISS-MODEL program (Schwede et al.,
2003) with 5-epi-aristolochene synthase as the template
and refining with DeepView. RMS values of 0.25 were
computed over 515 residues (of 550 total and 532 from
modelling) which indicates reasonable structural
alignment.
Pickett, J.A., Beale, M.H., 2002. (+)-(10R)-Germacrene
A
synthase from goldenrod, Solidago canadensis; cDNA isolation,
bacterial expression and functional analysis. Phytochemistry 60,
691–702.
Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-
MODEL: an automated protein homology-modeling server. 0305-
1048, 31, 3381–3385.
Starks, C.M., Back, K.W., Chappell, J., Noel, J.P., 1997. Structural
basis for cyclic terpene biosynthesis by tobacco 5-epi-aristolochene
synthase. Science 277, 1815–1820.
Acknowledgements
Steele, C.L., Crock, J., Bohlmann, J., Croteau, R., 1998. Sesquiterpene
synthases from grand fir (Abies grandis) – Comparison of consti-
tutive and wound-induced activities, and cDNA isolation, charac-
terization and bacterial expression of delta-selinene synthase and
gamma-humulene synthase. J. Biol. Chem. 273, 2078–2089.
Trapp, S.C., Croteau, R.B., 2001. Genomic organization of plant
terpene synthases and molecular evolutionary implications. Genet-
ics 158, 811–832.
Rothamsted Research receives grant-aided support
from the Biotechnology and Biological Sciences Re-
search Council (BBSRC), UK and this work was in part
supported by the Department of the Environment Food
and Rural Affairs (Defra), UK. We thank John Sim-
mons (Curator) Kew at Castle Howard, UK for kindly