Full text of DOI:10.1007/s004380000324

Mol Gen Genet 92000) 264: 306±316
Digital Object Identi®er 9DOI) 10.1007/s004380000324
ORIGINAL PAPER
J. M. Samuel á N. Fournier á V. Simanis
J. B. A. Millar
spo12 is a multicopy suppressor of mcs3 that is periodically
expressed in ®ssion yeast mitosis
Received: 10 January 2000 / Accepted: 22 June 2000 / Published online: 9 August 2000
Ó Springer-Verlag 2000
Abstract Hyperactivation of Cdc2 in ®ssion yeast
Introduction
causes cells toundergoa lethal premature mitosis, a
phenomenon called mitotic catastrophe. This phenotype
In eukaryotic cells, both the onset of DNA replication 9S
is observed in cdc2-3w wee1-50 cells at high temperature
and is suppressed by a single recessive mutant, mcs3-12.
Mcs3 acts independently of the Wee1 kinase and Cdc25
phosphatase, two major regulators of Cdc2. We have
isolated multicopy suppressors of the cell cycle arrest
phenotype of mcs3-12 wee1-50 cdc25-22 cells, but did
not identify the mcs3 gene itself. Instead several known
mitotic regulators were isolated, including the Cdc25
phosphatase, Wis2 cyclophilin, Cek1 kinase, and an
Hsp90 homologue, Swo1. We also isolated clones en-
coding non-functional, truncated forms of the Wee1
kinase and Dis2 type 1 phosphatase. In addition we
identi®ed a multicopy suppressor that encodes a struc-
tural homologue of the budding yeast SPO12 gene. We
®nd that overexpression of ®ssion yeast spo12 not only
suppresses the phenotype of the mcs3-12 wee1-50 cdc25-
22 strain, but alsothat of a win1-1 wee1-50 cdc25-22
strain at high temperature, indicating that the function
of spo12 is not directly related to mcs3. We show that
spo12 mRNA is periodically expressed during the ®ssion
yeast cell cycle, peaking at the G2/M transition coinci-
dently with cdc15. Deletion of spo12, however, has no
overt e€ect on either the mitotic or meiotic cell cycles,
except when the function of the major B type cyclin,
Cdc13, is compromised.
phase) and initiation of mitosis 9M phase) are triggered
by members of the cyclin-dependent kinase 9Cdk) family
in association with a regulatory cyclin subunit. Consid-
erable e€orts have been made in the past 10 years to
understand exactly how Cdk/cyclin complexes are reg-
ulated. In the ®ssion yeast both major transitions are
catalysed by a single gene product, Cdc2 9Nurse and
Bissett 1981). Although Cdc2 associates with four dis-
tinct cyclins, encoded by the cdc13, cig1, cig2 and puc1
genes, only one of these, Cdc13, is indispensable for
cycle progression and is sucient to trigger both S phase
and the initiation of mitosis in the absence of the other
cyclins 9Fisher and Nurse 1996; Stern and Nurse 1996).
Although the activity of the Cdc2/Cdc13 complex os-
cillates periodically through the cell cycle, our under-
standing of how this complex is regulated, where it
resides in the cell and the identity of its substrates is far
from complete.
The Cdc2/Cdc13 kinase is maintained in an inactive
state in G1 both by proteolytic degradation of the cyclin
subunit and by direct binding of a Cdk inhibitor 9CdkI),
Rum1 9Correa-Bordes and Nurse 1995; Kitamura et al.
1998; Kominani et al. 1998). The activity of Cdc2 is
restrained in S phase and G2 by the inhibitory phos-
phorylation of a conserved tyrosine residue 9Y15) by
two functionally overlapping kinases, Wee1 and Mik1
9Russell and Nurse 1987; Lundgren et al. 1991). At the
initiation of mitosis the Cdc2/Cdc13 complex is fully
activated by dephosphorylation of this tyrosine residue
by the Cdc25 phosphatase 9reviewed in Millar and
Russell 1992). It is thought that in addition to its pro-
cessive roles in the cell cycle, the presence or activity of
the Cdc2 /Cdc13 complex also prevents reinitiation of S
phase during G2 phase, since either deletion of cdc13 or
overexpression of the CdkI Rum1 induces cells to
undergo re-replication in the absence of an intervening
mitosis 9Hayles et al. 1994; Correa-Bordes and Nurse
Key words Cell cycle á spo12 á Mitosis á cdc2 á
Schizosaccharomyces pombe
Communicated by C. P. Hollenberg
J. M. Samuel á J. B. A. Millar 9&)
Division of Yeast Genetics,
National Institute of Medical Research, The Ridgeway,
Mill Hill, London NW7 1AA, UK
Tel.: +44-181-9593666; Fax: +44-181-9138536
N. Fournier á V. Simanis
Cell Cycle Control Laboratory, ISREC, Chemin des Boveresses
155, 1066 Epalinges, Switzerland

307
1995). These data have led researchers to propose a mechanism by which they regulate Cdc2 activity is still
quantitative model to explain how the Cdc2/Cdc13 unclear 9Ogden and Fantes 1986; Warbrick and Fantes
complex can trigger both S phase and mitosis in the 1992; Millar et al. 1995; Shiozaki and Russell 1995;
correct sequence during the cell cycle 9Stern and Nurse Samejima et al. 1997; Shieh et al. 1997, 1998; Shiozaki
1996). The fact that hyperactivation of Cdc2/Cdc13 et al. 1997).
kinase causes cells toundergoan aberrant lethal mitosis
Of the mcs mutants yet tobe identi®ed, mcs3 is re-
9or mitotic catastrophe) is consistent with this model, quired for mitotic progression in cdc25-22 wee1-50 cells
although it is not known whether this is due to a pre- and triple mutants undergocell-cycle arrest in G2 9Molz
mature entry intoM phase or toan inability todown-
regulate Cdc2/Cdc13 activity and exit mitosis 9Russell genetic screens designed to isolate suppressors of mcs3.
and Nurse 1987).
Although most of the genes identi®ed in this screen have
et al. 1989). We exploited this synthetic lethality in
Inactivation of Cdc2/Cdc13 in telophase is primarily previously been implicated in the control of mitosis,
due to ubiquitination and subsequent degradation of the none are allelic to mcs3. One of them encodes a struc-
cyclin B subunit by a specialised ubiquitin ligase complex tural homologue of the budding yeast protein Spo12. In
called the Anaphase Promoting Complex 9APC; re- contrast to its role in budding yeast, we demonstrate
viewed in Page and Hieter 1999; Zachariae and Nasmyth that loss of ®ssion yeast Spo12 has only a minor e€ect on
1999). The controls that regulate the timing of cyclin the mitotic and meiotic cell cycles, even though the spo12
destruction in ®ssion yeast are not well understood. In transcript is periodically expressed in late M phase.
the related budding yeast, Saccharomyces cerevisiae, a
number of proteins including the kinases Cdc5, Cdc15
and Dbf2 act in a signalling pathway required for trig-
gering of cyclin destruction at telophase 9Jaspersen et al.
1998). The requirement for these genes can be bypassed
if either the CDKI Sic1 or the protein Spo12 are over-
expressed 9Parkes and Johnston 1992; Donovan et al.
1994; Jaspersen et al. 1998). Consistent with a role in
mitosis is the ®nding that both genes are periodically
expressed during M phase, though the precise function
of SPO12 is still unknown 9Parkes and Johnston 1992).
Spo12 plays an additional role in meiosis, since in bud-
ding yeast spo12 cells fail toundergomeiosis I during the
sexual di€erentiation cycle and produce two viable dip-
loid asci 9Klapholz and Esposito 1980).
Materials and methods
Media and general techniques
Media and genetic methods for studying ®ssion yeast have been
reviewed by Moreno et al. 91991). General DNA methods were
performed using standard techniques 9Sambrook et al. 1989). Cell
length measurements were made on log-phase cells using a Nikon
®lar eyepiece drum micrometer at 1200´ magni®cation. Transfor-
mations were regularly performed by the lithium acetate method
9Moreno et al. 1991) or by electroporation 9Prentice 1991) using a
Biorad Gene Pulser. The S. pombe strains used are listed in Table 1.
Isolation and transposon mutagenesis of mcs3-12 wee1-50
cdc25-22 suppressors
Tofurther dissect the mechanisms governing Cdc2/
Cdc13 function we have focussed on a number of mu- A genomic library, in pURB1 9Barbet et al. 1992), was introduced
tant alleles in ®ssion yeast which display potent genetic
intoa mcs3-12 wee1-50 cdc25-22 ura4-D18 h) strain by electropo-
ration, and plated on medium lacking uracil. A total of 60,000
transformants were screened. Transformants were replica plated
interactions with cdc2 and thus may encode novel
regulators of the Cdc2/Cdc13 complex. In particular,
twice to30 °C and 55 complementing colonies were identi®ed.
cdc2-3w wee1-50 cells express a dominantly active Cdc2
kinase and a temperature-sensitive Wee1 kinase, and
undergo mitotic catastrophe 9Russell and Nurse 1987).
This phenotype is suppressed by mutations in any one of
six mitotic catastrophe suppressors 9mcs1 ± mcs6; Mo lz
et al. 1989). We and others have recently shown that the
mcs2 and mcs6 genes code for a cyclin H-like molecule
and its cyclin dependent kinase, respectively, that inter-
act to form ®ssion yeast Cdc2-activating kinase 9or
CAK; Buck et al. 1996; Damagnez et al. 1996), which
phosphorylates Threonine 167 of Cdc2. This indicated
that the mcs genes can code for regulators which control
Cdc2 function by a mechanism that is independent of
tyrosine 15 phosphorylation. Indeed we have previously
shown that mcs4 encodes a response-regulator protein
that is a component of the stress-activated Sty1/Spc1
MAP kinase pathway in ®ssion yeast. In the combined
absence of the Wee1 kinase and the Cdc25 phosphatase,
mcs4 and other components of this pathway, including
win1, wis4 9alsoknown as wak1 or wik1), wis1 and sty1/
DNA from these colonies was isolated by transformation into
E. coli. Plasmids encoding cdc25 and wis2 were identi®ed by a
combination of restriction mapping, PCR and Southern analysis.
The remaining sequences responsible for suppression were identi®ed
by transposon mutagenesis of the genomic clones using TnHIS3 as
previously described 9Sedgwick and Morgan 1994). Complementing
activity was tested by transforming transposed DNA into a mcs3-12
wee1-50 cdc25-22 ura4-D18 h) strain, which was then assayed for
growth at 37 °C. Dideoxy sequencing was performed with a T7
sequencing kit from Pharmacia, using previously described primers
complementary to the 5¢ and 3¢ ends of the transposon.
Tagging the swo1 locus
Plasmid pRIP82-Swo196HisHA) 9Aligue et al. 1994) was linearised
with XhoI and transformed into a wee1-50 cdc25-22 ura4-D18 h+
strain. Stable integrants were selected on medium lacking uracil.
Genomic DNA was isolated and integrants con®rmed by Southern
analysis.
Disruption of the spo12 function
The entire spo12 ORF was deleted from the genome; a 778-bp
spc1, are essential for mitotic progression, though the stretch 5¢ tothe spo12 ORF was ampli®ed by PCR using a 5¢

308
Table 1 Strains used in this
study
Strain
Genotype
Reference/source
JM1058
JM1059
JM1658
JM1659
JM529
JM1666
JM1667
JM1569
PR47
leu1-32 ura4-D18 ade6-210 his7-366 h+
C. Ho€mann
C. Ho€man
This study
This study
This study
This study
This study
Molz et al. 91989)
P. Russell
P. Russell
This study
This study
This study
Weisman et al. 91996)
Samejima et al. 91994)
This study
This study
This study
Hiranoet al. 91986)
This study
This study
leu1-32 ura4-D18 ade6-216 his7-366 h)
wee1-50 cdc25-22 leu1-32 ura4-D18 h+
wee1-50 cdc25-22 leu1-32 ura4-D18 ade6-210 h)
wee1-50 cdc25::LEU2 leu1-32 ura4-D18 h)
mcs3-12 wee1-50 cdc25-22 leu1-32 ura4-D18 h)
mcs3-12 wee1-50 cdc25-22 leu1-32 ura4-D18 h+
mcs3-12 wee1-50 cdc25-22 leu1-32 h)
wee1::ura4 leu1-32 ura4-D18
JM722
wee1::ura4 cdc25-22 leu1-32 ura4-D18 h+
mcs3-12 wee1::ura4 cdc25-22 leu1-32 ura4-D18 h+
mcs3-12 wee1::ura4 cdc25-22 leu1-32 ura4-D18 h)
win1-1 wee1-50 cdc25-22 leu-32 ura4-D18 ade6-210 his7? h)
wis2::ura4 wee1-50 cdc25-22 leu1-32 ura4-D18 ade6-M216 h)
cek1::ura4 leu1-32 ura4-D18 his2 h)
JM1956
JM1957
JM1694
ED1136
JM1903
JM1951
JM1954
JM1955
JM1946
JM1947
JM1900
JM1899
JM1904
JM1903
JM2114
JM2161
cek1::ura4 cdc25-22 leu1-32 h+
cek1::ura4 wee1-50 cdc25-22 leu1-32 ura4-D18 h+
cek1::ura4 wee1-50 cdc25-22 leu1-32 ura4-D18 h)
cut8-563 ura4-D18 h-
swo1-ura4 wee1-50 cdc25-22 ura4-D18 h+
spo12::ura4 leu1-32 ura4-D18 ade6-210 his7-366 h+
spo12::ura4 leu1-32 ura4-D18 ade6-210 his7-366 h)
spo12::ura4 leu1-32 ura4-D18 ade6-210 his7-366 h90
spo12::ura4 wee1-50 cdc25-22 leu1-32 ura4-D18 h+
dis2::ura4 leu1-32 ura4-D18 h)
This study
This study
This study
M. Yanagida
This study
dis2::ura4 wee1-50 cdc25-22 leu1-32 ura4-D18 h)
oligonucleotide 9GGTAAAAGGTACCGCGTT) incorporating a Cell synchronisation and Northern analysis
KpnI site 9italicised) and a 3¢ oligonucleotide 9CTTGGATCCTG-
GAAGTTTCAAAAATTACCAA) incorporating a BamHI site Wild-type cells were grown to a density of 3 ´ 106 in YES medium
9italicised). An 836-bp segment 3¢ tothe spo12 ORF was ampli®ed at 25 °C and loaded into a Beckman JE5.0 elutriation system
using the 5¢ oligonucleotide AAAAGGATCCAAACGAAGAG- equipped with a 40-ml separation chamber, spinning at 3000 rpm
ATTCCAGATG 9incorporating a BamHI site, shown in italics) in a Beckman J6-M centrifuge. In all, 6 l of cells were loaded at 80±
and a 3¢ oligonucleotide ATGACTGCGAAGCTTCTAC 9incor- 82 ml/min. Fractions were eluted at 88±92 ml/min and pooled
porating a HindIII site, shown in italics). The PCR products were 91.4 l at 1.2 ´ 106 cells/ml), and 50 ml of cells were collected for
digested with KpnI and BamHI, and BamHI and HindIII, respec- RNA preparation at the indicated times. RNA was prepared as
tively. The two digested PCR products were simultaneously ligated described 9Moreno et al. 1991), fractionated on a formaldehyde-
intopUC19 digested with KpnI and HindIII, toform pUC19-
containing agarose gel, and blotted onto Gene Screen Plus mem-
spo12D. A 1.6-kb BamHI fragment carrying ura4 was excised from brane 9NEN). Hybridisation was performed according to the
pCRII-ura4 and ligated intothe BamHI site of pUC19-spo12D, to manufacturer's recommendations. The ®lter was probed with the
create pUC19-spo12::ura4 9Grimm et al. 1988). pUC19- spo12 ORF, ampli®ed by PCR, and alsowith the cdc15+ gene
spo12::ura4 was digested with KpnI and HindIII, and the resulting 9Fankhauser et al. 1995) and the ura4+ gene 9Grimm et al. 1988).
3.2-kb fragment was transformed into a leu1-32/leu1-32 ura4-D18/
ura4-D18 ade6-M210/ade6-M216 his7-366/his7-366 h)/h+ diploid.
Stable integrants were selected on medium lacking uracil. Genomic
Results
DNA was isolated and integrants con®rmed by PCR and Southern
analysis. Heterozygous spo12+/spo12::ura4 diploids were then
sporulated and the resulting asci separated by tetrad dissection.
Genomic DNA from the resulting haploids was also isolated and
subjected to Southern hybridisation, using a spo12-speci®c probe.
Mcs3 acts independently of Wee1 kinase and Cdc25
phosphatase
A single recessive mutation, mcs3-12, bypasses the lethal
hyperactivation of Cdc2 kinase in a cdc2-3w wee1-50
strain 9Molz et al. 1989). Moreover, in agreement with a
possible role for Mcs3 in controlling the G2/M transi-
tion, a wee1-50 cdc25-22 double mutant strain is able to
proliferate at 37 °C, whereas the triple mutant strain
carrying the mcs3-12 allele cannot 9Molz et al. 1989).
Previous genetic analyis had suggested a strong genetic
interaction between mcs3 and wee1, perhaps suggesting a
direct physical interaction 9Molz et al. 1989). To exam-
ine whether mcs3 can function in the complete absence
of wee1, we constructed a mcs3-12 wee1::ura4 cdc25-22
strain. At 28 °C both wee1::ura4 cdc25-22 and mcs3-12
wee1::ura4 cdc25-22 cells were able toprloiferate
Overexpression of spo12
The spo12 cDNA was ampli®ed by PCR from pURB1-Spo12. The
5¢ oligonucleotide ATTCAGAATTCATATGTCAGAAACTCA-
AGCTGACTC 9incorporating EcoRI and NdeI sites, shown in
italics) hybridises to sequences surrounding the ATG initiation
codon, whereas the 3¢ oligonucleotide TTACAGAGCTCGGAT-
CCTATTCTTTTTCTGTCTGGA, incorporating SacI and Bam-
HI sites 9italics) hybridised tosequences surrounding the TGA
termination codon. PCR ampli®cation generated a 300-bp frag-
ment that was cleaved with NdeI and BamHI and cloned into
pREP1 9Maundrell 1993) to form pREP1-Spo12. pREP1-Spo12
was used totransform strains bearing the leu1-32 mutation and
leucine prototrophs were selected. The phenotype associated with
spo12 overexpression was determined after at least 48 h of growth
in the absence of thiamine.

309
9Fig. 1A). However at 37 °C, mcs3-12 wee1::ura4 cdc25- that wee1-50 mcs3-12 cdc25::LEU2 spores germinated at
22 cells ceased proliferating and arrested as highly 35.5 °C but were unable to undergo division. To con®rm
elongated cells, whereas the wee1::ura4 cdc25-22 strain this, asci from the same cross were subjected to tetrad
continued to proliferate, although cell size at division dissection. Three NPD tetrads had two spores that grew
was somewhat heterogeneous 9Fig. 1A and B). Although to give two viable colonies that behaved as wee1-50
the cdc25-22 allele is temperature sensitive we wished to mcs3+ cdc25+ and twospores that germinated but un-
determine whether mcs3 could function in the complete derwent cell cycle arrest at 35.5 °C. The inviable spores
absence of cdc25. Totest this possibility, wee1-50 mcs3- were classi®ed as wee1-50 mcs3-12 cdc25::LEU2. From
12 cells were mated to wee1-50 cdc25::LEU2. We this we conclude that mcs3 function is essential for the
selected for growth of spores of the genotype wee1-50 viability of wee1) cells in which cdc25 is disrupted. These
mcs3-12 cdc25::LEU2 at 35.5 °C on medium lacking data indicate that Mcs3 acts in the absence of Wee1
leucine. On microscopic inspection ꢀ50% of the spores kinase and Cdc25 phosphatase to control Cdc2 function.
were found to have germinated but had arrested as
single highly elongated cells. This observation suggested
Multicopy suppressors of mcs3-12
We used the cell cycle arrest phenotype of the mcs3-12
wee1.50 cdc25-22 strain to screen a ®ssion yeast genomic
library for the mcs3 gene 9Barbet et al. 1992). A total of
55 plasmids that supported growth of the mutant strain
at 37 °C were isolated and identi®ed. These are discussed
in the following sections.
Cdc25 phosphatase
We predicted that some of the suppressors would encode
the Cdc25 phosphatase, since mcs3-12 wee1-50 cells are
viable at high temperature. By means of restriction di-
gests and PCR, we ascertained that 36 of the 55 plasmid
inserts carried cdc25 9Table 2).
Wis2 cyclophilin
Previous studies have shown that two genes, wis2, en-
coding a cyclophilin homologue, and wis3, a gene of
unknown function, suppress the cell cycle arrest of the
Table 2 Multicopy suppressors of mcs3
Gene
Number of Degree of rescuea
isolates
mcs3-12 wee1-50 win1-1 wee1-50
cdc25-22
cdc25-22
cdc25
wis2
spo12/wis3
Truncated dis2
Truncated wee1
swo1
cek1
wis1
wis4/wak1
36
11
2
2
1
2
1
0
0
++++
+++
+++
++
++++
+++
+++
±
+++
++
++
++
++
±
±
Fig. 1A, B Mcs3 is essential in the absence of the Wee1 and Cdc25
mitotic regulators. A mcs3-12 wee1::ura4 cdc25-22 cells arrest when
grown at high temperature. The strains mcs3-12 wee1::ura4 cdc25-22,
+++
++++
±
wee1::ura4 cdc25-22, wee1::ura4 and cdc25-22were streaked onto YES a Plasmids were retransformed into either mcs3-12 wee1-50 cdc25-
medium and grown at either 28 °C o r 37°C. B The mcs3-12 22 or win1-1 wee1-50 cdc25-22 cells at 28 °C and the ability of the
wee1::ura4 cdc25-22 cell cycle arrest phenotype. The wee1::ura4 cdc25- transformants to growth was assessed at either 37 °C or 35.5 °C,
22 and mcs3-12 wee1::ura4 cdc25-22 strains grown in liquid YES respectively. Colonies appeared after 2 days 9++++), 3 days
medium at 28 °C were transferred tothe same medium at 37 °C.for 9+++), 4 days 9++) or were unable to rescue the temperature-
4 h and examined by microscopy
dependent growth arrest at all 9±)

310
mcs3-12 wee1-50 cdc25-22 strain at high temperature
9Warbrick and Fantes 1992; Weisman et al. 1996).
Again using PCR and restriction digest analysis we
found that 11 of the remaining 19 plasmids carried wis2
9Table 2).
The wis2 gene was originally isolated as a multicopy
plasmid suppressor of a win1-1 wee1-50 cdc25-22 strain
at high temperature 9Warbrick and Fantes 1992). Win1
is a MAP kinase kinase kinase that acts in a signalling
pathway that ultimately controls the Sty1/Spc1 stress-
activated MAP kinase 9Ogden and Fantes 1986;
Samejima et al. 1998; Shieh et al. 1998). Twotoher
suppressors of the win1-1 triple mutant are the Wis1
MAP kinase kinase and Wis4/Wak1 MAP kinase kinase
kinase, both of which are components of the Sty1/Spc1
MAP kinase pathway 9Warbrick and Fantes 1991, 1992;
Shieh et al. 1997; Shiozaki et al. 1997). In contrast to
wis2, neither wis1 nor wis4/wak1 could suppress the
temperature sensitivity of the mcs3-12 wee1-50 cdc25-22
strain 9Table 2). We reasoned that we could use this
observation to discriminate between those suppressors
of mcs3-12 wee1-50 cdc25-22 that speci®cally compen-
sate for Mcs3 function from those that bypass it.
The eight remaining plasmid inserts were mapped
into ®ve additional distinct genomic regions by restric-
tion enzyme analysis 9Table 2). A single representative
plasmid from each group was used for further analysis.
Each plasmid suppressor 9cdc25, wis2 and the ®ve un-
identi®ed clones) was then independently transformed
intothe win1-1 wee1-50 cdc25-22 strain and the trans-
formants weretested for growth at 35.5 °C. As expected,
both cdc25 and wis2 suppressed the cell cycle defect of
the strain, suggesting that neither is speci®c for Mcs3
function.
Fig. 2A±D Multicopy suppressors of mcs3-12 wee1-50 cdc25-22. A
Restriction map and subclone analysis of the swo1 genomic region.
B Restriction map and subclone analysis of the cek1 genomic region.
C Restriction map and subclone analysis of the dis2 genomic region.
D Restriction map and subclone analysis of the wee1 genomic
region. The restriction enzymes used were HindIII 9H), PstI, 9P), XbaI
9Xb), XhoI 9Xh), EcoRI 9E), BamHI 9B), KpnI 9K), Spe1 9Sp), ClaI
9C), PvuII 9Pv) and SalI 9S)
Speci®c suppressors of Mcs3 function
mcs3-12 and swo1, the genomic swo1 locus was tagged
with the ura4 marker in a wee1-50 cdc25-22 ura4-D18-32
h+ strain 9see Materials and methods) to form
The remaining ®ve were subjected totransposon muta-
genesis and subclone analysis to identify the sequences swo1+::ura4 wee1-50 cdc25-22 ura4-D18 h+ 9Table 1).
responsible. Two of them carried speci®c suppressors This was then crossed to mcs3-12 wee1-50 cdc25-22 h)
whilst three were non-speci®c.
Swo1, an Hsp90 homologue
cells. Many of the progeny from this cross were both
uracil prototrophs and temperature sensitive for growth,
indicating that mcs3-12 and swo1 are not allelic.
The ®rst speci®c suppressor gene was identi®ed as swo1. Cek1 kinase, a regulator of anaphase
When carried on a multicopy plasmid, swo1 e€ectively
suppresses the temperature-sensitive defect of an mcs3- The second multicopy suppressor speci®c for mcs3-12
12 wee1-50 cdc25-22 strain, but not that of win1-1 wee1- wee1-50 cdc25-22 was found to encode the Cek1 kinase
50 cdc25-22 cells 9Table 2). Swo1, a homologue of the 9Fig. 2B and Table 2). Cek1 was recently identi®ed as a
Hsp90 family of chaperones 9Fig. 2A), was initially multicopy suppressor of cut8-563, a temperature-sensi-
identi®ed as a suppressor of wee1 overexpression. Swo1 tive mutant that undergoes chromosome overconden-
interacts directly with, and is required for proper func- sation and forms short spindles in the absence of sister
tion of, the Wee1 kinase 9Aligue et al. 1994). A more chromatid separation 9Samejima and Yanagida 1994).
recent study indicates that Swo1 is more widely required The cut8-563 mutation allows cytokinesis before the
to maintain the stability of a subset of proteins that completion of anaphase, thus producing cells with a Cut
control both mitosis and cytokinesis 9Munoz and phenotype. Although the clone we isolated carried an
Jimenez 1999). Todetermine the relationship between
incomplete cek1 gene, it was still able torescue cut8-563

311
at the restrictive temperature and is therefore likely to Truncated Wee1 kinase
encode an active kinase 9data not shown). To determine
the relationship between cek1 and mcs3-12, cek1, a This clone, one of the most potent suppressors of mcs3-
non-essential gene, was disrupted in wee1-50 cdc25-22 12 wee1-50 cdc25-22, expresses only the N-terminal 460
ura4-D18 h) toform cek1::ura4 wee1-50 cdc25-22 ura4- aminoacids of the Wee1 kinase 9Russell and Nurse
D18h+. These cells behaved identically tothe parental
1987). The truncated gene was shown to be responsible
wee1-50 cdc25-22 strain at high temperature. Several of for the suppression of at high temperature 9Fig. 2D).
the progeny from a cross of cek1::ura4 wee1-50 cdc25-22 Since the truncated Wee1 protein encoded by this clone
ura4-D18 h+ toa mcs3-12 wee1-50 cdc25-22 h) strain lacks all sequences necessary for catalytic activity, it is
were prototrophic for uracil but temperature sensitive likely tobe acting as a dominant negative 9Aligue et al.
for growth, indicating that mcs3-12 and cek1 are not 1997). It is possible that this protein may sequester
allelic. We considered the possibility that since cek1 is a proteins that are required for the related Mik1 kinase to
multicopy suppressor of cut8-563, cut8 might be allelic function. Since mcs3-12 segregates independently from
to mcs3. However, a plasmid expressing cut8 from its wee1 they are not allelic.
own promoter was unable to suppress a mcs3-12 wee1-50
cdc25-22 strain at high temperature, making this possi-
bility unlikely 9data not shown). Another multicopy A homologue of budding yeast Spo12
suppressor of cut8-563 is the anaphase regulator cut1
9Samejima and Yanagida 1994). We have not analysed The third gene responsible for non-speci®c suppression
the relationship between cut1 and mcs3.
of mcs3-12 resided on a 1.86-kb fragment ¯anked by
KpnI and HindIII sites. Database searches with the se-
quences in this region revealed three genes, a truncated
unknown ORF, a 270-bp ORF and part of a gene for a
putative GTP-binding protein, which we have named
Non-speci®c suppressors of Mcs3
Genes carried by the remaining three plasmids could gtp1 9Fig. 3A and B). The nucleotide sequence of the
rescue both mcs3-12 wee1-50 cdc25-22 and win1-1 wee1- 270-bp ORF presented in Fig. 3 translates intoa pre-
50 cdc25-22 strains at high temperature.
dicted protein of 90 amino acids which we found to be
most closely related to two proteins in budding yeast,
Spo12 and Bns1 9Grether and Herskowitz 1999;
Fig. 3A). All three proteins are most highly related in
their C-terminal regions and contain two conserved
Truncated Dis2 phosphatase
This clone contained partial ORFs derived from the putative phosphorylation sites for 9a) proline-directed
dis2/bws1 gene for a type 1 phosphatase and hsd1, which kinase9s). We have thus termed the ®ssion yeast gene
encodes a homoserine dehydrogenase. Our analysis re- spo12. We expressed the S. pombe spo12 cDNA from the
vealed that the truncated dis2 gene was responsible for thiamine-repressible nmt1 promoter in mcs3-12 wee1-50
the suppression 9Fig. 2C). The dis2/bws1 gene was in- cdc25-22 cells and found that it rescued the temperature-
dependently identi®ed based on a mutation which causes sensitive defect of the strain as e€ectively as the genomic
defects in sister chromatid separation at mitosis and on clone 9data not shown). We conclude that the spo12 gene
its ability when overexpressed to cause a wee1-50 cdc25- is responsible for the suppression of both mcs3-12 wee1-
22 strain toundergocell cycle arrest at high temperature
50 cdc25-22 and win1-1 wee1-50 cdc25-22 phenotypes at
9bypass of wee suppression; Booher and Beach 1989; high temperature. We noted that the restriction map of
Ohkura et al. 1989). This latter phenotype is precisely spo12 is similar tothat described for wis3 and have
the reverse of the suppression of mcs3-12 wee1-50 cdc25- recently learnt that the twogenes are in fact allelic
22 by truncated dis2/bws1, which is consistent with the 9Fig. 3B; Warbrick and Fantes 1992; R. Bayne and P.
idea that the fragment of Dis2 isolated in our screen may Fantes, personal communication).
interact with other components of the endogenous type I
phosphatase complex and thus alter either its location or
activity. Tofurther analyse the relationship between dis2 Expression of spo12 mRNA is regulated
and mcs3-12, a dis2::ura4 wee1-50 cdc25-22 strain was during the cell cycle and peaks in early M phase
constructed. These cells were viable at high temperature.
Progeny from a cross of dis2::ura4 wee1-50 cdc25-22 As expected for a gene with a role in controlling mitotic
ura4-D18 cells toa mcs3-12 wee1-50 cdc25-22 ura4-D18 progression, the SPO12 transcript is periodically
h) strain were analysed for growth at 37 °C. Approxi- expressed at the G2/M phase of the budding yeast cell
mately 25% of the progeny grew at 37 °C, but were cycle, coinciding with the expression of DBF2 9Parkes
unable to grow in the absence of uracil and were thus and Johnston 1992). The transcription factor9s) re-
designated as wee1-50 cdc25-22 cells, indicating that re- sponsible for this induction is not known. We examined
combination had occurred between the dis2 and mcs3 the expression of spo12 during the ®ssion yeast cell cycle.
loci. Thus we infer that dis2/bws1 is not allelic to Early G2 cells collected from a log-phase culture by
mcs3-12.
sequential sucrose gradient fractionation and centrifugal

312
Fig. 3A±D Spo12 is not re-
quired for the mitotic or meiotic
cell cycle. A Spo12 is evolutio-
narily conserved. The shaded
regions indicate regions of ho-
mology between S.p. Spo12,
S.c. Spo12 and S.c. Bns1 pro-
teins. The protein sequence for
the ®ssion yeast Spo12 protein
appears in the SWISSPROT
database under the Accession
No. Q10189. B Disruption map
and subclone analysis of the
spo12 genomic region. Restric-
tion enzymes used were HindIII
9H), HpaI 9Hp), KpnI 9K), ScaI
9Sc), Spe1 9Sp) and MscI 9M).
C Southern hybridisation of
genomic DNA from a tetrad
analysis of Dspo12/spo12+ to
con®rm spo12 gene disruption.
The results of a representative
tetrad are shown. Genomic
DNA isolated from each of the
four haploid colonies was di-
gested with EcoRI and then
fractionated on an agarose gel.
The resulting blot was probed
with a probe speci®c for the
spo12 genomic region. D Ascus
formation in the absence of
spo12. Wild-type 9wt) and
spo12::ura4 9Dspo12) strains
were grown on YES medium at
28 °C, then transferred tomin-
imal medium 9EMM) at 28 °C
for 48 h to induce sporulation
elutriation were re-inoculated into fresh medium and role for spo12 at the G2/M transition and to the exis-
total RNA was extracted at various times thereafter. tence of a new cell cycle-regulated transcription factor
Cell number and the percentage of septated cells were that is responsible for a wave of gene expression at the
analysed to monitor cell cycle progression. As the data initiation of mitosis.
in Fig. 4 demonstrate, the level of spo12 mRNA ¯uc-
tuates through the cell cycle, peaking at the G2/M
boundary. This is coincident with the cell cycle expres- Loss of spo12/wis3 has no e€ect on either the mitotic
sion of cdc15, a gene required for the onset of cytoki- or meiotic cell cycle
nesis 9Fankhauser et al. 1995). Note that S. pombe
Cdc15 is not related to the S. cerevisiae CDC15 kinase To determine the e€ect of loss of spo12 function on the
by sequence. Peak expression of cdc15 occurs before the cell cycle, the spo12 ORF was replaced by the ura4+
peak of expression of cdc18, cdc22 and cig2, genes which gene, togenerate the plasmid pUC12- spo12::ura4
are under the control of the START-speci®c gene tran- 9Fig. 3B). pUC12-spo12::ura4 was linearised with KpnI
scription complex MBF, and is independent of compo- and HindIII and stably integrated intoa leu1-32/leu1-32
nents of this complex including the Cdc10 transcription ura4-D18/ura4-D18 ade6-M216/ade6-M210 h+/h) dip-
factor 9Fankhauser et al. 1995). These results point to a loid strain. Tetrad dissection of asci from heterozygous

313
Fig. 4 spo12 is periodically ex-
pressed in M phase. Wild-type
cells were synchronised in early
G2 by centrifugal elutriation as
described in the Materials and
methods, and reinoculated into
toYES medium. RNA was
prepared at various times
thereafter, and probed for the
expression of either the spo12+
or cdc15+ genes by Northern
analysis. Filters were reprobed
with the ura4+ gene tocon®rm
approximately equal loading of
the gel 9Grimm et al. 1988)
diploids resulted in four viable spores which on germi-
Spo12 was originally identi®ed in budding yeast on
nation gave rise to a 2:2 segregation of uracil auxotrophs the basis of a naturally occurring mutation that pro-
to uracil prototrophs, the genotypes of which were duced viable two-spored asci in meiosis, resulting from
con®rmed by Southern analysis 9Fig. 3C). All uracil an inability to undergo meiosis I 9Klapholz and Esposito
prototrophs underwent cell division at a size indistin- 1980). The molecular basis for this e€ect is not under-
guishable from wild type and displayed no overt sensi- stood. To ascertain whether Spo12 in ®ssion yeast might
tivity tohigh temperature, wlo temperature,
play a similar role, spo12 sequences were removed from
thiabendazole or ca€eine 9data not shown). In budding a homothallic h90 strain. The resulting Dspo12 h90 cells
yeast, overexpression of SPO12 bypasses the require- were grown in poor nutrient conditions to induce mating
ment for a number of genes that control exit from mi- and sexual conjugation. As the results in Fig. 3D dem-
tosis, including DBF2, CDC15 and TEM1, and plays an onstrate, asci from these cells contained four spores
overlapping role in the exit from mitosis with HCT1, a 9Fig. 3D). Nochange in the eciency of mating, number
regulator of cyclin B destruction 9Parkes and Johnston of spores per ascus nor spore viability was observed in
1992; Jaspersen et al. 1998; Grether and Herkowitz the absence of spo12, indicating that, unlike budding
1999). The analogous genes in ®ssion yeast control the yeast, the ®ssion yeast Spo12 protein is not required for
onset of cytokinesis. These include sid2, spg1, sid4, meiotic progression.
cdc14, cdc7, sid1 and cdc11 9reviewed in Le Go€ et al.
1999). Overexpression of spo12 from the nmt1 promoter
was unable tocomplement temperature-sensitive muta-
tions in any of these genes, nor could we detect any
Discussion
synthetic lethal interactions of these mutants with loss of It is now widely recognised that the molecular mecha-
spo12 function 9data not shown). We were also unable to nisms controlling the eukaryotic cell cycle have been
®nd any genetic interaction between a number of mu- conserved throughout evolution. Much of our current
tations in either cdc2 or cdc25, though cdc13-117 Dspo12 understanding of these controls has come from genetic
cells underwent cell arrest at a slightly reduced temper- analysis in yeast. In the ®ssion yeast S. pombe a single
ature compared to the cdc13-117 parent 9data not kinase, Cdc2, is thought to regulate both the initiation of
shown). Thus spo12 has only a marginal e€ect on mitotic DNA replication and the onset of mitosis. Although a
cell division in ®ssion yeast.
considerable amount is known about how the activity of

314
the Cdc2 kinase is regulated by tyrosine phosphorylation onset of cytokinesis 9but unrelated to the budding yeast
and the proteins that regulate this event, extensive ge- CDC15 kinase). This suggests that spo12 controls
netic analysis has revealed several other loci which show mitotic progression in an analogous fashion in ®ssion
genetic interactions with cdc2, but which donot in¯u-
yeast. However, we could ®nd no overt cell cycle defect
ence the tyrosine phosphorylation status of Cdc2. For in the absence of spo12 alone or in combination with a
example, in cdc2-3w wee1-50 cells, which express a battery of late mitotic mutants 9V. Simanis, unpub-
dominantly active Cdc2 kinase and a temperature-sen- lished). We did observe a synthetic interaction of Dspo12
sitive Wee1 kinase, hyperactivation of the Cdc2 kinase with cdc13-117, which encodes a temperature sensitive
induces a premature, lethal mitosis known as mitotic version of the Cdc13 cyclin B, but this e€ect was quite
catastrophe. This phenotype is suppressed by mutations weak. Thus the role of periodic expression of spo12 at
in any one of six genes, mcs1±mcs6, which appear to this stage in the cell cycle is not clear. We also examined
function in the absence of both the Wee1 kinase and whether the budding and ®ssion yeast genes could cross-
Cdc25 phosphatase 9Molz et al. 1989). Indeed we and complement. However overexpression of budding yeast
others have recently shown that the mcs2 and mcs6 genes SPO12 from the nmt1 promoter was not able to rescue
encode a cyclin H-like molecule and its cyclin dependent mcs3-12 wee1-50 cdc25-22 at high temperature, nor was
kinase, respectively, that interact toform a Cdc2-acti-
®ssion yeast spo12 able tosuppress a temperature-sen-
vating kinase 9or CAK) that phosphorylates Cdc2 on sitive CDC15 mutant in budding yeast when expressed
threonine 167 9Buck et al. 1996; Damagnez et al. 1996). from the strong GAL1 promoter 9data not shown). Thus
The strongest suppressor of the mitotic catastrophe despite the structural similarity between budding and
phenotype in cdc2-3w wee1-50 cells is a single nuclear ®ssion yeast Spo12 proteins and the observation that
mutation, mcs3-12. In this study we have taken advan- both transcripts are regulated during the cell cycle, we
tage of the observation that the mcs3-12 mutation con- have no further clue to the function of either. One ®nal
fers a temperature-sensitive cell cycle arrest phenotype in di€erence is that, unlike the requirement for SPO12 for
a wee1-50 cdc25-22 background to screen for the mcs3 meiosis I in budding yeast, ®ssion yeast cells lacking
gene by suppression using a multicopy genomic library. spo12 have no observable meiotic defect. This latter re-
We isolated seven distinct extragenic suppressors, in- sult is likely to have signi®cant implications for the
cluding the cdc25 phosphatase, the wis2 cyclophilin, the conservation of the mechanisms controlling the separa-
swo1 hsp90 homologue, the cek1 kinase, spo12 and tion of homologous chromosomes during the reduc-
clones encoding truncated forms of the dis2 phosphatase tional division in meiosis.
and wee1 kinase; however, none of these are allelic to
mcs3. We have been able toseparate these suppressors
In this paper we have reported the isolation of mul-
ticopy suppressors of mcs3-12, the strongest suppressor
into two groups: members of the ®rst group, swo1 and of the mitotic catastrophe phenotype of cdc2-3w wee1-50
cek1, are unable torescue the win1-1 wee1-50 cdc25-22 cells at high temperature. We were unable toisolate the
strain, suggesting they are speci®c to mcs3. The cek1 mcs3 gene itself, although the library was comprehen-
gene was originally isolated as a multicopy suppressor of sively screened. The reason for this may be that the mcs3
cut8-563, a gene required for sister chromatid separation gene is either very large or causes cell growth arrest in
at mitosis. However there is no indication that cut8 and ®ssion yeast when expressed from a multicopy episomal
mcs3 functions are related since a multicopy plasmid plasmid. Alternatively, the genomic fragment bearing
bearing cut8 was unable torescue mcs3-12 wee1-50 mcs3 may be toxic to bacteria and thus not represented
cdc25-22. One possibility is that, since cut1 is alsoa
in the library. A similar problem was encountered when
multicopy suppressor of cut8-563, cut1 and mcs3 func- researchers attempted toisolate the win1 gene by sup-
tions may be related. We are currently testing this pos- pression of a win1-1 wee1-50 cdc25-22 strain at high
sibility.
temperature, even though various libraries were tried
Members of the second group of suppressors, which 9Warbrick and Fantes 1992). These researchers were
includes cdc25, wis2, spo12 and the truncated dis2 and eventually able tomap the win1 locus by meiotic map-
wee1 genes, rescue not only mcs3-12 wee1-50 cdc25-22 ping and isolate the win1 gene by transposon-based
but also win1-1 wee1-50 cdc25-22 strains at high tem- mutagenesis of overlapping cosmids 9Samejima et al.
perature. Thus, these genes are unlikely tobe closely
1998). Unfortunately the mcs3-12 allele has little or no
linked to mcs3 function and may regulate mitotic pro- cell cycle phenotype by itself, making attempts to map
gression by some other means. We were particularly its genomic locus very dicult. It is notable, however,
interested in spo12 since in budding yeast overexpression that all the genes isolated as multicopy suppressors of
of SPO12 bypasses the requirement for a number of mcs3-12 wee1-50 cdc25-22, with the exception of spo12,
genes that control mitotic exit, including DBF2, CDC15 have previously been implicated in mitotic control. This
and TEM1, and plays an overlapping role in the exit of indicates that the Cdc2 kinase is under the control of
mitosis with HCT1, a regulator of cyclin B destruction multiple functionally redundant pathways that can alter
9Jaspersen et al. 1998; Grether and Herskowitz 1999). In its activity. It also suggests that many, if not most, of the
this paper we show that the ®ssion yeast spo12 mRNA is genes that impinge on Cdc2 function have now been
periodically expressed at the G2/M transition coincident identi®ed. It is noteworthy that the phenotype of the
with the expression of cdc15, a gene required for the mcs3-12 mutant is only observed at 37 °C, a temperature

315
Jaspersen SL, Charles JF, Tinker-Kulberg RL, Morgan DO 91998)
A late mitotic regulatory network controlling cyclin destruction
in Saccharomyces cerevisiae. Mol Biol Cell 9: 2803±2817
Kitamura K, Maekawa H, Shimoda C 91998) Fission yeast Ste9, a
homologue of Hct1/Cdh1 and Fizzy-related, is a novel negative
regulator of cell cycle progression during G1 phase. Mol Biol
Cell 9: 1065±1080
Kominani K, Seth-Smith H, Toda T 91998) Apc10 and Ste9/Srw1,
two regulators of the APC-cyclosome, as well as the CDK in-
hibitor Rum1 are required for G1 cell cycle arrest in ®ssion
yeast. EMBO J 17: 5388±5399
at which ®ssion yeast cells can only proliferate if the
stress-activated MAP kinase pathway is intact 9Millar
et al. 1995; Shiozaki and Russell 1995). Thus, mcs3 and
some of the multicopy suppressors identi®ed in this
screen such as the Wis2 cyclophilin and Swo1, an hsp90
homologue, may function to protect or compensate for
the function of key cell cycle regulators under adverse
conditions. Our understanding of how cell cycle pro-
gression is modulated under these conditions is still
rather poor.
Klapholz S, Esposito RE 91980) Recombination and chromosome
segregation during the single division meiosis in spo12-1 and
spo13-1 diploids. Genetics 96: 589±611
Acknowledgements The authors thank Lee Johnston, Sylvie
Tournier, Vicky Buck, Rajvee Shah and members of the Division
of Yeast Genetics for helpful advice, discussions and critical
reading of the manuscript. The authors also thank David Beach
9Cold Spring Harbor Laboratory, N.Y.) for strains, Ekaterina
Salimova and Marc Sohrmann, who initiated the analysis of the
spo12 gene, and Elena Canofor technical assistance. Research in
the Simanis lab is funded by the Swiss National Science Founda-
tion, The Swiss Cancer League and ISREC and by a MRC grant to
J.B.A.M.
Le Go€ X, Utzig S, Simanis V 91999) Controlling septation in
®ssion yeast: ®nding the middle, and timing it right. Curr Genet
35: 571±584
Lundgren K, Walworth RM, Booher M, Demski M, Kirschner M,
Beach D 91991) mik1 and wee1 co-operate in the inhibitory
tyrosine phosphorylation of cdc2. Cell 64: 1111±1122
Maundrell K 91993) Thiamine repressible expression vectors pREP
and pRIP for ®ssion yeast. Gene 123: 127±130
Millar JBA, Russell P 91992) The cdc25 mitotic inducer: an un-
conventional protein phosphatase. Cell 68: 407±410
Millar JBA, Buck V, Wilkinson MG 91995) Pyp1 and Pyp2 PTP-
ases dephosphorylate an osmosensing MAP kinase controlling
cell size at division in ®ssion yeast. Genes Dev 9: 2117±2130
Molz L, Booher R, Young P, Beach D 91989) cdc2 and the regu-
lation of mitosis: six interacting mcs genes. Genetics 122:
773±782
References
Aligue R, Akhavan-Niak H, Russell P 91994) A role for Hsp90 in
cell cycle control: Wee1 tyrosine kinase activity requires inter- Moreno S, Klar A, Nurse P 91991) Molecular genetic analysis of
action with Hsp90. EMBO J 13: 6099±6106
Aligue R, Wu L, Russell P 91997) Regulation of Schizosaccharo-
®ssion yeast Schisosaccharomyces pombe. Methods Enzymol
194: 795±823
myces pombe Wee1 tyrosine kinase. J Biol Chem 272: 13320± Munoz MJ, Jimenez J 91999) Genetic interactions between Hsp90
13325
and the Cdc2 mitotic machinery in the ®ssion yeast Schizosac-
charomyces pombe. Mol Gen Genet 261: 242±250
genomic libraries for use with Schizosaccharomyces pombe. Nurse P, Bissett Y 91981) Gene required in G1 for commitment to
Barbet N, Muriel WJ, Carr AM 91992) Versatile shuttle vectors and
Gene 114: 59±66
Booher R, Beach D 91989) Involvement of a type 1 protein phos-
cell cycle and in G2 for control of mitosis in ®ssion yeast.
Nature 292: 558±560
phatase encoded by bws1+ in ®ssion yeast mitotic control. Cell Ogden JE, Fantes P 91986) Isolation of a novel type of mutation in
57: 1009±1016
Buck V, Russell P, Millar JB 91995) Identi®cation of a cdk-acti-
vating kinase in ®ssion yeast. EMBO J 14: 6173±6183
the mitotic control of Schizosaccharomyces pombe whose phe-
notypic expression is dependent on the genetic background and
nutritional environment. Curr Genet 10: 509±514
Correa-Bordes J, Nurse P 91995) p25rum1 orders S phase and mi- Ohkura H, Kinoshita N, Miyatani S, Toda T, Yanagida M 91989)
tosis by acting as an inhibitor of the p34cdc2 mitotic kinase. Cell
83: 1001±1009
Damagnez V, Makela TP, Cottarel G 91995) Schizosaccharomyces
The ®ssion yeast dis2+ gene required for chromosome disjoin-
ing encodes one of two putative type 1 protein phosphatases.
Cell 57: 997±1007
pombe Mop1-Mcs2 is related to mammalian CAK. EMBO J 14: Page AM, Hieter P 91999) The Anaphase Promoting Complex: new
6164±6172
subunits and regulators. Annu Rev Biochem 68: 583±609
Donovan JD, Toyn JH, Johnson AL, Johnston LH 91994) Parkes V, Johnston LH 91992) SPO12 and SIT4 suppress muta-
P40SDB25, a putative CDK inhibitor, has a role in the M/G1
tions in DBF2, which encodes a cell cycle protein kinase that is
periodically expressed. Nucleic Acids Res 20: 5617±5623
Fankhauser C, Reymond A, Cerutti L, Utzig S, Hofmann K, Prentice HL 91991) High eciency transformation of Schizosac-
transition in Saccharomyces cerevisiae. Genes Dev 8: 1640±1653
Simanis V 91995) The S. pombe cdc15 gene is a key element in
the reorganization of F-actin at mitosis. Cell 82: 435±444
charomyces pombe by electroporation. Nucleic Acids Res
20: 621
Fisher DL, Nurse P 91996) A single ®ssion yeast mitotic cyclin B Russell P, Nurse P 91987) Negative regulation of mitosis by wee1+
a gene encoding a protein kinase homolog. Cell 49: 559±567
,
p34cdc2 kinase promotes both S- phase and mitosis in the ab-
sence of G1 cyclins. EMBO J 15: 850±860
Grether ME, Herskowitz I 91999) Genetic and biochemical char-
acterization of the yeast Spo12 protein. Mol Biol Cell 10: 3689±
3703
Grimm C, Kohli J, Murray J, Maundrell K 91988) Genetic engi-
neering of Schizosaccharomyces pombe: a system for gene dis-
ruption and replacement using the ura4 gene as a selectable
marker. Mol Gen Genet 215: 81±86
Hayles J, Fisher D, Woollard A, Nurse P 91994) Temporal order of
S-phase and mitosis in ®ssion yeast is determined by the state of
the p34cdc2/mitotic cyclin B complex. Cell 78: 813±822
Hirano T, Funahashi S, Uemura T, Yanagida M 91986) Isolation
and characterization of Schizosaccharomyces pombe cut mu-
tants that block nuclear division but not cytokinesis. EMBO J
5: 2973±2979
Sambrook J, Fritsch EF, Maniatis T 91989) Molecular cloning: a
laboratory manual 92nd edn). Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.
Samejima I, Yanagida M 91994) Identi®cation of cut8+ and
cek1+, a novel protein kinase gene, which complement a ®s-
sion yeast mutation that blocks anaphase. Mol Cell Biol 14:
6361±6371
Samejima I, Mackie S, Fantes PA 91997) Multiple modes of acti-
vation of the stress-responsive MAP kinase pathway in ®ssion
yeast. EMBO J. 16: 6162±6170
Samejima I, Mackie S, Warbrick E, Weisman R, Fantes PA 91998)
The ®ssion yeast mitotic regulator win1+ encodes an MAP
kinase kinase kinase that phosphorylates and activates Wis1
MAP kinase kinase in response to high osmolarity. Mol Biol
Cell 9: 2325±2335

316
Sedgwick SG, Morgan BA 91994) Locating, DNA sequencing, and Stern B, Nurse P 91996) A quantitative model for the cdc2 control
disrupting yeastgenes using tagged Tn1000. Methods Mol of S phase and mitosis in ®ssion yeast. Trends Genet 12:
Genet 3: 131±140 345±350
Shieh J-C, Wilkinson MG, Buck V, Morgan B, Makino K, Millar Warbrick E, Fantes P 91991) The Wis1 protein kinase is a dose-
JBA 91997) The Mcs4 response regulator co-ordinately controls
the stress activated Wak1-Wis1-Sty1 MAP kinase pathway and
®ssion yeast cell cycle. Genes Dev 11: 1008±1022
dependent regulator of mitosis in Schizosaccharomyces pombe.
EMBO J 10: 4291±4299
Warbrick E, Fantes PA 91992) Five novel elements involved in the
regulation of mitosis in ®ssion yeast. Mol Gen Genet 232:
440±446
Shieh J-C, Wilkinson MG, Millar JBA 91998) The Win1 mitotic
regulator is a component of the stress activated Sty1 MAP
kinase pathway in ®ssion yeast. Mol Biol Cell 9: 311±322
Shiozaki K, Russell P 91995) Cell cycle control linked to extracel-
lular environment by MAP kinase pathway in ®ssion yeast.
Nature 378: 739±743
Weisman R, Creanor J, Fantes P 91996) A multicopy suppressor
of a cell cycle defect in S. pombe encodes a heat shock-
inducible 40 kDa cyclophilin-like protein. EMBO
447±456
J 15:
Shiozaki K, Shiozaki M, Russell P 91997) Mcs4 mitotic catastrophe Zachariae W, Nasmyth K 91999) Whose end is destruction: cell
suppressor regulates the ®ssion yeast cell cycle through the
Wik1-Wis1-Spc1 kinase cascade. Mol Biol Cell 8: 409±419
division and the anaphase-promoting complex. Genes Dev 13:
2039±2058