Synthesis and Characterization of Specific Reverse Transcriptase Inhibitors for Mammalian LINE-1 Retrotransposons

Article

Synthesis and Characterization of Speciﬁc Reverse

Transcriptase Inhibitors for Mammalian LINE-1

Retrotransposons

Graphical Abstract

Authors

Guillermo Banuelos-Sanchez,

Laura Sanchez,

Maria Benitez-Guijarro, ...,

Francisco Franco-Montalban,

Juan A. Tamayo, Jose L. Garcia-Perez

Correspondence

jtamayo@ugr.es (J.A.T.),

jose.garcia-perez@igmm.ed.ac.uk

(J.L.G.-P.)

In Brief

The mobilization of active LINE-1

retrotransposons continues to impact the

human genome. LINE-1s move using a

copy-and-paste mechanism that relies on

reverse transcriptase activity. The

identiﬁcation of compounds that

selectively inhibit the reverse

transcriptase activity of mammalian

LINE-1s will allow studying the impact of

their mobilization.

Highlights

d

Characterization of 33 compounds has identiﬁed speciﬁc

inhibitors of LINE-1s

GBS-149, FTC, and 3TC are non-toxic and mammalian-

speciﬁc LINE-1 inhibitors

GBS-149 is a new and potent RTi of active human LINE-1s

Banuelos-Sanchez et al., 2019, Cell Chemical Biology 26, 1–15

August 15, 2019 ª 2019 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2019.04.010

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Cell Chemical Biology

Article

Synthesis and Characterization

of Speciﬁc Reverse Transcriptase Inhibitors

for Mammalian LINE-1 Retrotransposons

Guillermo Banuelos-Sanchez,¹Laura Sanchez,²Maria Benitez-Guijarro,²Valentin Sanchez-Carnerero,²

Carmen Salvador-Palomeque,^2,5Pablo Tristan-Ramos,^2,3Meriem Benkaddour-Boumzaouad,²Santiago Morell,^2,6

Jose L. Garcia-Puche,²Sara R. Heras,^2,3Francisco Franco-Montalban,¹Juan A. Tamayo,^1,

*

and Jose L. Garcia-Perez^2,4,7,

*

¹Department of Medicinal and Organic Chemistry, Faculty of Pharmacy, University of Granada, Campus de Cartuja, s/n 18071

Granada, Spain

´

GENYO. Centro de Genomica e Investigacion Oncologica: Pﬁzer-Universidad de Granada-Junta de Andalucıa, Avenida de la Ilustracion 114,

2

´

PTS Granada, 18016 Granada, Spain

³Department of Biochemistry and Molecular Biology II, Faculty of Pharmacy, University of Granada, Campus Universitario de Cartuja, 18071

Granada, Spain

⁴MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine (IGMM), University of Edinburgh, Western General Hospital, Crewe

Road, Edinburgh, EH4 2XU, UK

⁵Present address: Mater Research Institute - University of Queensland, TRI Building, Woolloongabba, Australia

⁶Present address: Department of Genetics, University of Cambridge, UK

⁷Lead Contact

*Correspondence: jtamayo@ugr.es (J.A.T.), jose.garcia-perez@igmm.ed.ac.uk (J.L.G.-P.)

https://doi.org/10.1016/j.chembiol.2019.04.010

SUMMARY

cessfully been ampliﬁed to high numbers over evolution (Ivan-

cevic et al., 2018; Lander et al., 2001; Waterston et al., 2002).

Retrotransposons are a type of transposable element Indeed, at least a third of the human and mouse genomes are

made of retrotransposons, which include long terminal repeat

(LTR)-containing retrotransposons and non-LTR retrotranspo-

(TE) that have ampliﬁed to astonishing numbers in

mammalian genomes, comprising more than a third

of the human and mouse genomes. Long inter-

spersed element class 1 (LINE-1 or L1) retrotranspo-

sons are abundant and currently active retroelements

in the human and mouse genomes. Similarly, long

terminal repeat (LTR)-containing retrotransposons

are abundant in both genomes, although only active

sons (Lander et al., 2001; Richardson et al., 2015; Waterston

et al., 2002). Retrotransposons are a type of TE that move (i.e.,

retrotranspose) using a replicative copy-and-paste mechanism

that involves reverse transcription of an intermediate retroele-

ment-derived RNA (Boeke and Chapman, 1991; Richardson

et al., 2015). LTR retrotransposons or endogenous retroviruses

(ERVs) are similar to retroviruses in their structure (resemble

the proviral integrated form) and mode of reverse transcription,

and comprise 8% and 10% of the human and mouse genome,

in mice. LTR- and LINE-1-retroelements use different

mechanisms for retrotransposition, although both

involve the reverse transcription of an intermediate respectively (Lander et al., 2001; Richardson et al., 2015; Water-

ston et al., 2002). Because of the lack of a functional envelope

gene, ERVs are considered obligated intracellular retrotranspo-

retroelement-derived RNA. Retrotransposon activity

continues to effect the germline and somatic ge-

nomes, generating interindividual variability over

evolution and potentially inﬂuencing cancer and brain

physiology, respectively. However, relatively little is

known about the functional consequences of retro-

transposition. In this study, we have synthesized

and characterized reverse transcriptase inhibitors

sons (Mager and Stoye, 2015). However, evolutionary analyses

have demonstrated that germline reinfection, rather than retro-

transposition, is the main insertion pathway exploited by ERVs,

which further suggest that a small pool of ERVs might retain

infection activity in the germline (Belshaw et al., 2004; Kim

et al., 1994). In humans, all ERVs (i.e., HERVs) have been inacti-

vated by the accumulation of mutations over evolution, and

speciﬁc for mammalian LINE-1 retrotransposons,

which might help deciphering the functional impact

of retrotransposition in vivo.

although some HERVs from the K subfamily (HERV-K) are poly-

morphic in the human population (Hughes and Cofﬁn, 2004), they

are thought to be currently immobile in the human genome

(Richardson et al., 2015). However, several ERVs remain active

in the mouse genome, including intracisternal A-particle (IAP),

endogenous type D murine (MusD), and early transposon retro-

elements (reviewed in Mager and Stoye, 2015). Indeed, active

INTRODUCTION

Most vertebrate genomes contain a large fraction of transpos- mouse LTR retrotransposons are often drivers of mutations

able element (TE)-derived sequences (Ivancevic et al., 2018), in mice (Mager and Stoye, 2015), and autonomous IAP and

and in most mammalian genomes retrotransposons have suc- MusD elements have been characterized in the mouse genome

Cell Chemical Biology 26, 1–15, August 15, 2019 ª 2019 Elsevier Ltd.

1

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

(Dewannieux et al., 2004; Ribet et al., 2004). On the other hand, brain, or in other somatic cells. In summary, we know relatively

ꢀ17% and ꢀ19% of the human and mouse genome is made of little about the functional impact of retrotransposition in heritable

long interspersed element class 1 (LINE-1 or L1) non-LTR retro- disorders, mendelian interferonopathies, cancer, brain physi-

transposons (Lander et al., 2001; Waterston et al., 2002), and ology, or even brain disorders, and additional research is needed

active copies have been characterized in both genomes (DeBer- to reveal the potential contribution of retrotransposition, if any, to

ardinis et al., 1998; Goodier et al., 2001; Kazazian et al., 1988; these biological processes.

Naas et al., 1998; Sassaman et al., 1997). Although only one

Inhibiting ongoing retrotransposition represents a simple and

LINE-1 subfamily is currently active in the human genome effective manner to infer the role that the mobilization of a given

(L1Hs elements), at least three active subfamilies of LINE-1 ele- retroelement might manifest in any biological process, using a

ments currently coexist in the mouse genome (termed L1Md-A, loss-of-function approach. Although during retrotransposition

L1Md-G_F, and L1Md-T_F) (reviewed in Mager and Stoye, 2015; the mechanism of LTR and non-LTR reverse transcription is

Richardson et al., 2015). Despite their genomic abundance, markedly different, both rely on an encoded reverse transcrip-

and similar to ERVs, most LINE-1 copies are no longer active tase (RT) activity. Previous studies have demonstrated that

because of mutation accumulation over evolution and/or certain RT inhibitors (RTi) used to treat HIV/AIDS with a nucle-

because of 5⁰truncation during LINE-1 insertion (Beck et al., oside structure can also inhibit retrotransposon mobilization

2010; Brouha et al., 2003; Grimaldi et al., 1984; Lander et al., in a dose-dependent manner (Contreras-Galindo et al., 2017;

2001). However, ꢀ100 and up to ꢀ3,000 LINE-1 copies retain Dai et al., 2011; Jones et al., 2008). In fact, cellular phosphory-

retrotransposition capability in the human and mouse genome, lated nucleoside analogs are known to inhibit different types of

respectively (Beck et al., 2010; Brouha et al., 2003; DeBerardinis retroviral RTs through competitive inhibition with the native

et al., 1998; Goodier et al., 2001; Naas et al., 1998). Active LINE- dNTP for RT binding and chain termination of elongating

1s are also responsible for the mobilization of non-autonomous cDNAs; thus, their inhibitory efﬁciency is inﬂuenced by their

active short interspersed elements (SINEs, also classiﬁed as cellular uptake, efﬁciency of phosphorylation by cellular

non-LTR-retrotransposons), such as Alu and SVA in humans, kinases, efﬁciency of the analog to bind the RT, and incorpora-

and B1, B2, and B4 in rodents (Dewannieux et al., 2003; Dewan- tion efﬁciency into elongating cDNAs among other factors

nieux and Heidmann, 2005; Lander et al., 2001; Waterston et al., (reviewed in Arts and Wainberg, 1996). The simplicity of their

2002). SINE mobilization has been very proliﬁc over evolution, use and their wide activity spectrum has resulted in many

and millions of insertions have accumulated in the human and studies using RTis to analyze the role of retrotransposition

mouse genomes, comprising >11% and >5% of their genomes, on mouse oocyte attrition (Malki et al., 2014), on human tumor

respectively (Lander et al., 2001; Mager and Stoye, 2015; growth in mouse xenografts (Sciamanna et al., 2005), on

Richardson et al., 2015; Waterston et al., 2002).

cellular aging (De Cecco et al., 2019; Simon et al., 2019), or

The ongoing activity of LTR and non-LTR retrotransposons even in mouse memory formation (Bachiller et al., 2017).

continues to impact the mammalian genome, and in mice and However, conﬂicting results have been found when using

humans both types of elements have generated sporadic dis- RTis to ameliorate the phenotype of AGS mice models, and

ease-causing germline mutations (Mager and Stoye, 2015; further research with more speciﬁc RTis would help to deter-

Richardson et al., 2015). Furthermore, it is becoming increas- mine the therapeutic potential of RTis to treat AGS (Achleitner

ingly evident that LINE-1 retrotransposons might participate in et al., 2017; Beck-Engeser et al., 2011). Recently, RTis have

human interferonopathies, such as Aicardi-Goutieres syndrome been used in a pilot clinical study involving a small number of

(AGS) (Benitez-Guijarro et al., 2018; Stetson et al., 2008; Thomas AGS patients, revealing a signiﬁcant amelioration of their

et al., 2017). Unexpectedly, active LINE-1s can also affect interferon score (Rice et al., 2018). However, these studies

selected somatic tissues, including cancer and brain cells (re- had a number of signiﬁcant biases, as relatively nothing is

viewed in Burns, 2017; Garcia-Perez et al., 2016; Richardson known about the speciﬁcity of RTis on mammalian retrotrans-

et al., 2015; Singer et al., 2010; Thomas et al., 2012). Indeed, it posons, together with potential secondary effects of RTis

has now been very well documented that most epithelial-derived such as intrinsic anti-inﬂammatory activity (Fowler et al.,

human tumors are characterized for accumulating new LINE-1 2014), and toxicity effects due to off-target effects on cellular

insertions (reviewed in Burns, 2017; Scott and Devine, 2017). DNA polymerases (Arts and Wainberg, 1996), etc.

Data on mouse is limited, although mouse LINE-1 retrotranspo-

To better understand the speciﬁcity of nucleoside analog

sition has been reported in a mouse model of hepatic carcino- RTis, and aiming to identify a speciﬁc and potent inhibitor of

genesis (Schauer et al., 2018), and IAP ERVs can generate active human LINE-1 retrotransposons, in this study we have

new insertions in mouse radiation-induced myeloid leukemia analyzed the speciﬁcity and inhibitory strength of 33 nucleoside

tumors (Takabatake et al., 2008). In the brain, it has been demon- analogs (commercially available and synthesized de novo) on

strated that human and mouse LINE-1s can retrotranspose in active human and mouse LINE-1s and on active mouse ERVs.

neuronal progenitor cells and mature non-dividing neurons Notably, we have identiﬁed three non-toxic and selective

in vitro and in vivo (Coufal et al., 2009; Erwin et al., 2016; Evrony LINE-1 RTis that exhibit no activity against mouse LTR retro-

et al., 2012; Macia et al., 2017; Muotri et al., 2005; Upton et al., transposons. Furthermore, an RTi synthesized and character-

2015). Although there is currently no evidence of mouse ERV ized in this study, GBS-149, is on average 18-fold more active

activity in the brain, a recent report demonstrated that gypsy at inhibiting human LINE-1s than mouse LINE-1 retrotranspo-

LTR retrotransposons could retrotranspose in the Drosophila sons. In summary, we have generated robust and novel tools

brain (Li et al., 2013); thus, additional studies are required to study the impact of LINE-1 retrotransposition in arguably

to determine if ERVs are expressed and active in the mouse any cellular context.

2

Cell Chemical Biology 26, 1–15, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

A

B

C

D

Figure 1. Rationale of the Study and Structures of Drug Tested

(A) Scheme of the rationale of the study. Further details are provided in the main text.

(B–D) Chemical structure of drugs tested in this study. (B) The chemical structure of drugs used to treat AIDS that were tested in this study. (C and D) The chemical

structure of commercially available and synthesized nucleoside analogs tested in this study, respectively (see Table 1).

RESULTS

we also tested the effect of three non-nucleoside analog HIV RTis

(efavirenz, etravirine, and nevirapine, Figure 1B). To test the effect

of these drugs on retrotransposons, we took advantage of

previously established cell-based retrotransposition assays for

Rationale of the Study and Structures of Nucleoside

Analogs Tested

To identify a speciﬁc and potent RTi for human LINE-1 retrotrans- LINE-1s and ERVs (Figure S1) (Boeke et al., 1985; Freeman

posons, we analyzed the effect that 33 nucleoside analog struc- et al., 1994; Heidmann and Heidmann, 1991; Moran et al.,

tures exert on the retrotransposition rate of human and mouse 1996). As retrotransposition occurs through an RNA intermediate,

LINE-1s and on mouse ERVs, together with short-term/acute LINE-1 and ERV retrotransposition assays are based on the same

and long-term/clonability toxicity controls (Figure 1A). As controls, principle. In brief, the presence of an engineered intron within a

Cell Chemical Biology 26, 1–15, August 15, 2019

3

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Effect of Drugs Used to Treat AIDS on Mammalian

Table 1. HIV/AIDS RTis and Commercially Available Nucleoside

Retrotransposons

Here, we tested the effect that RTis used to treat AIDS exert on

Analogues Used in This Study

Name

CAS

136470-78-5 Hospital

30516-87-1 Hospital

Provider

Solvent

Water

DMSO

Water

DMSO

Water

DMSO

Water

the retrotransposition rate of an active human LINE-1 (L1.3

[Sassaman et al., 1997]) tagged with the NEO-based retrotrans-

position indicator cassette (Figures 2A and 2B). These assays

revealed that several of the drugs used to treat AIDS are potent

inhibitors of human LINE-1 retrotransposition (Figure 2A),

consistent with two previous reports (Dai et al., 2011; Jones

et al., 2008). However, MTT control assays revealed that etravir-

ine, and to a lesser extent AZT and efavirenz, are mildly toxic

Abacavir

AZT

Efavirenz

154598-52-4 Hospital

143491-57-0 Hospital

269055-15-4 Hospital

134678-17-4 Hospital

129618-40-2 Hospital

Emtricitabine

Etravirine

Lamivudine

Nevirapine

Stavudine

Tenofovir disoproxil

to HeLa cells in

a dose-dependent manner (Figure 2E).

3056-17-5

Hospital

Consistently, similar data were observed in long-term toxicity/

clonability controls, conﬁrming that etravirine, and to a lesser

extent AZT and efavirenz, are toxic to HeLa cells in a dose-

dependent manner (Figures S2C and S2D). Thus, we used the

toxicity values induced by RTis to quantify the overall effect of

HIV RTis on human L1.3 retrotransposition. These analyses re-

vealed that abacavir, AZT, emtricitabine, lamivudine, stavudine,

and tenofovir inhibit human L1 retrotransposition in a dose-

dependent manner (Figures 2A and 2B). Among the RTis tested,

emtricitabine and lamivudine were the more potent non-toxic

inhibitors, reducing human L1.3 retrotransposition by more

than 3- and 6-fold when tested at 25 mM (Figure 2B). Notably, te-

nofovir reduced retrotransposition of human L1.3 >75-fold,

although it showed mild acute toxicity in HeLa cells (Figure 2E).

As expected, no effect on human L1 retrotransposition was de-

tected in cells treated with non-nucleoside analog RTis, with the

exception of nevirapine, which led to a ꢀ30% reduction in L1 ret-

rotransposition, but in a dose-independent manner (Figure 2B).

Consistently, a previous study found that nevirapine led to a mi-

nor reduction on human L1 retrotransposition (Dai et al., 2011).

To test the speciﬁcity of RTis used to treat HIV/AIDS on human

LINE-1 retrotransposons, we next tested their inhibitory effect on

147127-20-6 Hospital

2⁰,3⁰-Dideoxy-3⁰-

ﬂuorouridine (C1)

41107-56-6

362-43-6

Aldrich

2’,3’-Isopropylideneuridine

(C2)

Water

2’,3⁰-Dideoxy-3⁰-

25526-93-6

ﬂuorothymidine (C4)

2⁰,3⁰-Dideoxy-5-

iodouridine (C5)

105784-83-6 Aldrich

2’,3’-O-

362-75-4

Aldrich

isopropylideneadenosine (C6)

2’-Azido-2’-deoxyuridine

(C7)

26929-65-7

N4-Acetyl-2’-O-

113886-71-8 Carbosynth Water

159414-97-8 Carbosynth Water

methylcytidine (C8)

N4-Acetyl-2’-deoxy-2’-

ﬂuorocytidine (C9)

5’-O-Acetyl-2’,3’-O-

isopropylideneadenosine

(C10)

15888-38-7

Carbosynth DMSO

reporter gene ensures that reporter gene expression can only the retrotransposition rate of two mouse LTR retrotransposons

occur after a round of retrotransposition (Figures S1A–S1C). (MusD, Figures 2C and S2A; IAP, Figures 2D and S2B), also us-

The effect of each nucleoside analog was tested at two concen- ing HeLa cells. Taking into account their short- and long-term

trations, 5 and 25 mM, using HeLa cells because LINE-1 and ERV toxicity (Figures 2E, S2C, and S2D), our data revealed that AZT

retrotransposition occur at high frequencies in this cervix cancer- and tenofovir are also potent inhibitors of both mouse LTR retro-

derived cell line (Moran et al., 1996; Ribet et al., 2004). As a transposons, while abacavir and nevirapine mildly inhibit the

reporter gene, we used the neomycin phosphotransferase retrotransposition frequency of both mouse ERVs, all in a dose-

gene (NEO), which activates resistance to G418 upon retrotrans- dependent manner (Figures 2C, 2D, S2A, and S2B). Furthermore,

position (Figures S1A–S1C). Notably, the NEO-based retrotrans- we observed that nevirapine and stavudine lead to statistically

position assay is quantitative, and the resulting number of signiﬁcant but modest reductions in MusD retrotransposition

drug-resistant foci provides a readout of retrotransposition activ- levels (ꢀ30% reduction at 25 mM, Figures 2D and S2A).

ity. To control for long-term toxicity/clonability, HeLa cells were

In summary, our data demonstrate that AZT and tenofovir are

transfected with a plasmid expressing the NEO gene (pU6ineo, potent but not selective RTis, inhibiting human LINE-1 and

Figure S1D), while short-term/acute toxicity was tested using an mouse ERV retrotransposition, but inducing short- and long-

MTT colorimetric assay (Figure 1A). Figures 1B–1D show the term toxicity in HeLa cells. However, emtricitabine and

structure of each nucleoside analog tested, including drugs lamivudine are non-toxic-speciﬁc inhibitors of human LINE-1 ret-

used to treat HIV/AIDS (Figure 1B: abacabir, AZT, emtricitabine rotransposition, as was stavudine, although the latter is mildly

[FTC]; lamivudine [3TC], stavudine [d4T], and tenofovir; the non- toxic to HeLa cells.

nucleoside analogs efavirenz, etravirine, and nevirapine were

used as internal controls), commercially available nucleoside Effect of Commercially Available Nucleoside Analogs on

analogs (Figure 1C: C1, C2, C4, C5, C6, C7, C8, C9, and C10, Mammalian Retrotransposons

see the STAR Methods) and the 18 nucleoside analogs that Next, we tested the inhibitory retrotransposition potential of nine

were synthesized and puriﬁed in this study (Figure 1D: GBS- commercially available nucleoside analogs (Figure 1C). MTT as-

147, 146, 197, 128, 187, 188, 186, 185, 149, 148, 127, 177, 196, says revealed that C2, C8, and C9 were mildly toxic to HeLa cells

130, 179, 133, 192, and 191).

(Figure S3A), while long-term/clonability assays revealed that C4

4

Cell Chemical Biology 26, 1–15, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

A

C

D

B

E

Figure 2. Effect of Drugs Used to Treat AIDS on Mammalian Retrotransposons

(A and B) Effect on a human LINE-1 retrotransposon (L1.3). (A) Representative results of LINE-1 retrotransposition assays conducted in the presence of the

indicated HIV RT inhibitor (tested at 5 and 25 mM) using HeLa cells (2 3 10⁴cell/well). (B) The quantiﬁcation of the above assays in triplicate (including SD; black

bars, no drug; orange bars, 5 mM; green bars, 25 mM). Retrotransposition values of untreated cells were assigned 100% for comparisons. A cartoon of the L1

construct used (plasmid JM101/L1.3) is shown at the top of (A and B). *p % 0.05, **p % 0.01, ***p % 0.001.

(legend continued on next page)

Cell Chemical Biology 26, 1–15, August 15, 2019

5

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

was very toxic to HeLa cells, as was C1, although to a much when tested at low concentrations (5 and 25 mM, Figures 2 and

lesser degree (Figures S3D and S3E). When retrotransposition 4). Thus, we selected these three nucleoside analogs for further

assays were quantiﬁed and normalized taking into consideration experimentation.

the toxicity of RTis, we observed that C4 inhibited the retrotrans-

To conﬁrm the inhibitory potential of GBS-149, emtricitabine,

position rate of human L1.3, mouse IAP, and mouse MusD, in a and lamivudine on active LINE-1 retrotransposons, we conduct-

dose-dependent manner (Figures 3, S3B, and S3C). In addition, ed retrotransposition assays using: (1) a different retrotransposi-

C9 mildly inhibited the retrotransposition rate of human L1.3 (Fig- tion indicator reporter gene and a different human LINE-1, (2)

ures 3A and 3B).

lower RTi concentrations, and (3) additional cell lines. First,

In summary, our data demonstrate that C4 is a mild and not we evaluated the potential toxicity of GBS-149, emtricitabine,

selective RTi that can inhibit human L1s and mouse LTR retro- and lamivudine on human PA-1 cells, an ovarian teratocarci-

transposons in HeLa cells. However, C4 induced signiﬁcant noma-derived pluripotent cell line that naturally overexpresses

long-term toxicity to HeLa cells, which could limit its endogenous LINE-1 ribonucleoprotein particles (L1-RNPs) (Gar-

applications.

cia-Perez et al., 2010; Zeuthen et al., 1980). MTT short-term

toxicity assays revealed that none of the three RTis tested

induced signiﬁcant toxicity to PA-1 or HeLa cells when tested

at low concentrations (5 and 25 mM, Figure S6B [PA-1], 5B

Effect of Synthesized Nucleoside Analogs on

Mammalian Retrotransposons

The data presented above revealed that RTis with a very similar [HeLa]). Consistently, none of the three RTis tested induced sig-

chemical structure could have markedly different effects on the niﬁcant toxicity to PA-1 cells when tested at higher concentra-

retrotransposition rate of human LINE-1 and mouse ERV retro- tions (50 and 150 mM, Figure S6C). Additional controls revealed

transposons. Aiming to increase the strength and speciﬁcity of that none of the RTis tested induced changes in endogenous

nucleoside analog RTis for human LINE-1 retrotransposons, L1-ORF1p or p53 expression (Figures 5 and S6A; Data S1;

we next modiﬁed the structure of active 2⁰,3⁰-dideoxynucleotide STAR Methods). Similar data were observed in cultured HeLa

RTis by including different substituents. Thus, we next synthe- cells (data not shown). Thus, these data suggest that the three

sized and puriﬁed 18 nucleoside analogs, all pyrimidine analogs RTis selected, GBS-149, emtricitabine and lamivudine, are not

(Figure 1D), and we then tested their effect on mammalian toxic to cultured cells expressing high (PA-1) or low (HeLa) levels

retrotransposition rates using HeLa cells. Control MTT assays of endogenous L1-RNPs.

revealed that several of the synthesized nucleoside analogs

Next, we conducted retrotransposition assays using the blas-

induced signiﬁcant short-term toxicity (Figure S4A), including ticidin S deaminase gene as a retrotransposition indicator re-

GBS-177, -196, -179, -133, -192, -191, -187, and -186. Howev- porter gene (BLAST, mblastI-tagged constructs, Figure S1E)

er, clonability controls revealed that GBS-133, -192, -191, -187, (Goodier et al., 2007; Morrish et al., 2002). The BLAST retrotrans-

and -186 also induced signiﬁcant long-term toxicity (Figure S5B). position assay is similar to the NEO-based assay, but the kinetics

When the effect of the 18 nucleoside analogs was tested on of retrotransposition and selection is different due to blasticidin

human LINE-1 retrotransposition, we observed that, while S inducing rapid cell death (Izumi et al., 1991). Thus, we tested

GBS-196, -191, and -186 mildly reduced retrotransposition in a the effect of a range of GBS-149, emtricitabine, and lamivudine

dose-dependent manner, GBS-149 reduced L1.3 retrotranspo- concentrations on the retrotransposition rate of an active human

sition by more than 30-fold when tested at 25 mM (Figures 4A LINE-1 tagged with the mblastI cassette (construct JJ101/L1.3)

and S4B). Notably, GBS-149 had no effect on mouse LTR using HeLa cells. Notably, we conﬁrmed robust inhibition of

retrotransposition (neither MusD, Figures 4B and S4C; nor IAP, human LINE-1 retrotransposition with the three RTis tested (Fig-

Figure S5A), while GBS-179 and -192 mildly reduced MusD ure 5A), even at low concentrations (2.5 mM). We conﬁrmed these

LTR retrotransposition (Figures 4B and S4C). Interestingly, no results using an active mouse LINE-1 from the L1Md-T_Fclass

signiﬁcant reduction on IAP retrotransposition was detected (L1SM; Han and Boeke, 2004) tagged with the same mblastI

with any of the 18 nucleoside analogs tested (Figure S5A).

cassette (Goodier et al., 2007; Morrish et al., 2002) (Figures

In summary, our data revealed that GBS-149 is a new potent, S6D–S6F). Thus, these data conﬁrm that GBS-149, emtricita-

non-toxic, and speciﬁc human LINE-1 RTi.

bine, and lamivudine are potent, non-toxic, and LINE-1-speciﬁc

RTis, at least on HeLa cells.

GBS-149, Emtricitabine, and Lamivudine Dose-

Response Assays

We next tested the inhibitory potential of GBS-149, emtricita-

bine, and lamivudine on LINE-1 retrotransposition using human

The above experiments demonstrated that, of the 33 nucleoside HEK293T cells. However, in HEK293T cells we used a human

analogs tested, GBS-149, emtricitabine, and lamivudine are LINE-1 retrotransposition assay that activates expression of ﬁreﬂy

potent and non-toxic inhibitors of human LINE-1 retrotransposi- luciferase upon retrotransposition (mFlucI, Figure S1F) (Xie et al.,

tion, with no inhibitory effect on mouse LTR retrotransposition 2011). This assay is not based on antibiotic selection/generation

(C and D) Effect on mouse LTR-retrotransposons. (C) (MusD) and (D) (IAP) show the effect of the indicated HIV RT inhibitor on mouse LTR-retrotransposition using

HeLa cells when tested at 5 mM (orange bars) and 25 mM (green bars) (black bars, no drug). In (C) and (D), 2 3 10⁴and 1 3 10⁴HeLa cells were plated per well,

respectively, and a cartoon of each construct used is also shown. *p % 0.05, **p % 0.01.

(E) MTT assays in the presence of HIV inhibitors. The graph shows the results of MTT cell metabolic activity assays conducted on HeLa cells in the presence of

5 mM (purple bars) and 25 mM (yellow bars) of the indicated HIV inhibitor (triplicate). Colorimetric values of untreated cells (green bars) were used to normalize and

were arbitrarily designated as 1. *p % 0.05, **p % 0.01, ***p % 0.001.

See also Figures S7 and S8.

retrotransposition. These data suggest that, although the cata- inhibitory activity against human LINE-1 retrotransposons,

lytic domain of all characterized RTs is conserved (known as although both elicit some level of toxicity in cultured HeLa cells.

domain C, and containing bhDD, where b = big and h = hydro- However, AZT and tenofovir, which, alongside LINE-1, are also

phobic amino acids), and presumably its 3D structure, minor active RTis against mouse LTR-retrotransposons, are uracil and

changes in the structure of nucleoside analogs can have a signif- adenine analogs, respectively. Given the mechanism of action

icant effect in their inhibitory strength and speciﬁcity. Thus, it is of nucleoside analogs (Arts and Wainberg, 1996), we speculate

likely that additional synthesis and testing will uncover nucleo- that cytidine analogs might bind the RT domain of mammalian

side analog structure(s) with retrotransposition inhibition activity LINE-1s with more afﬁnity; similarly, it is also likely that GBS-

speciﬁc for mouse LTR retrotransposons.

149 might bind the RT of human LINE-1s with more afﬁnity than

From a structural view, it is worth mentioning that all active RTis mouse LINE-1s. At present, there is no available crystal structure

to human LINE-1 retrotransposition are b-nucleoside analogs for the RT domain of any LINE-1, and no binding predictions of

(either ^D- or L-series), and the most potent are pyrimidine nucleoside analogs can be made. Similarly, the lack of a LINE-

analogs, with the exception of tenofovir. Indeed, GBS-149, emtri- 1-RT 3D structure prohibits inferring predictions of nucleoside

citabine, and lamivudine, three non-toxic and speciﬁc LINE-1 analog structures that could potentially bind speciﬁcally and

RTis, are cytidine analogs; consistently, GBS-187 and -186 are strongly to the catalytic motif of the RT domain of human L1-

cytidine and ﬂuorocytidine analogs, respectively, with speciﬁc ORF2p. However, previous reports have shown that purifying

Cell Chemical Biology 26, 1–15, August 15, 2019 11

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

human L1-ORF2p is extremely challenging (Cost et al., 2002; Pis- onopathies (reviewed in Crow and Manel, 2015), it might be worth

kareva et al., 2003; Piskareva and Schmatchenko, 2006), which to further explore non-toxic and human L1-speciﬁc RTis to treat

might explain why a crystal structure for mammalian L1-ORF2p AGS patients, as a very recent report presented data suggesting

is currently unavailable. Very recently, progress has been made that nucleoside analog RTis with known activity to human L1 ret-

in deciphering the 3D structure of the RT domain from two group rotransposition are effective in ameliorating part of the symptoms

II introns, which are retroelements evolutionarily related to LINE-1 of these patients (Rice et al., 2018).

retrotransposons (Stamos et al., 2017; Zhao et al., 2018). Thus,

additional research is needed to obtain a reliable 3D structure

for mammalian L1-ORF2p, but, once obtained, it could be the ba-

sis to develop potent and speciﬁc human LINE-1 RTis. It is worth

mentioning that the inhibitory activity of GBS-149, a drug synthe-

sized and characterized in this study, is on average 18-fold more

active on human LINE-1s than in mouse LINE-1s (from any of the

three currently active subfamilies of elements present in the

mouse genome). In our study, we tested two previously charac-

terized active human LINE-1s, L1.3 (Sassaman et al., 1997) and

L1_RP(Kimberland et al., 1999), and we showed that GBS-149 is

active in both human LINE-1s, reducing retrotransposition by

>30-fold at 25 mM. Currently active human LINE-1s are 99.99%

identical at the nucleotide level (Beck et al., 2010; Brouha et al.,

2003), and we thus speculate that GBS-149, and other nucleoside

analog RTis with activity against human LINE-1s, would be effec-

tive in inhibiting the ongoing retrotransposition of any human

LINE-1 present in the genome, ﬁxed or polymorphic.

SIGNIFICANCE

Retrotransposons are abundant transposable elements that

have successfully colonized the genome of most mammals,

generating millions of insertions over evolution. As a result,

almost half of the human and mouse genomic mass is

made of retrotransposon-derived sequences. Although

most mammalian retrotransposons are currently inactive, a

small number of these retroelements continue to mobilize

and can impact the genome they reside in. Retrotransposons

from the long interspersed element class 1 (LINE-1 or L1)

class can still mobilize in humans and mice, whereas long

terminal repeat (LTR)-containing retrotransposons are only

active in the mouse genome. The mobilization of LINE-1s

and LTR retrotransposons in the germline can sporadically

generate heritable genetic disorders, while LINE-1 activity in

cancer and brain cells has the potential to inﬂuence cancer

progression and brain biology. However, we know very little

about the implications that retrotransposition have in these

biological processes. Retrotransposition requires reverse

transcription of an intermediate RNA, and previous studies

have demonstrated that several reverse transcriptase inhibi-

tors (RTis) used to treat AIDS can indeed inhibit ongoing

LINE-1 retrotransposition. Here, we have conducted the

most extensive analysis of the effect of RTis on mammalian

retrotransposons. After testing 33 nucleoside analogs for

their effect on LINE-1 and LTR retrotransposition, we have

identiﬁed three RTis speciﬁc for mammalian LINE-1s, with

no effect on LTR-retrotransposons. Two of these drugs

were previously known and used to treat AIDS; however, in

this study we have synthesized and characterized an RTi,

GBS-149, that can inhibit very efﬁciently the mobilization of

human LINE-1 retrotransposons. Although GBS-149 can

inhibit the retrotransposition of mouse and humans LINE-1s,

its activity on human LINE-1s is ꢀ18-fold more effective

than on mouse LINE-1s. In summary, we have identiﬁed

RTis that will allow testing the functional impact of LINE-1

retrotransposition in vivo.

Given the potential role of LINE-1 retrotransposition in the origin

and progression of human cancers (reviewed in Burns, 2017; Car-

reira et al., 2013; Scott and Devine, 2017), the development of

non-toxic, speciﬁc, and potent inhibitors of human L1 retrotrans-

position might open the way for clinical trials aiming to test the role

of retrotransposition on cancer progression. For most cancer

cases, a fully malignant lesion is already present in the patient

at the time of diagnosis, and cancer cells might carry hundreds

of genomic mutations, including new retrotransposon insertions.

The selection of cancer treatments depends on clinical and

genomic features of tumors, but we propose that RTis could be

used as adjuvant drugs to prevent the accumulation of further

L1-driven genomic mutations in cancer cells. In this context, pre-

vious studies in mice have found conﬂicting results, as it was re-

ported that two non-nucleoside analog RTis (efavirenz and nevira-

pine) with no effect on LINE-1 retrotransposition can reduce cell

proliferation and reduce tumor size in animals models (Landris-

cina et al., 2007; Mangiacasale et al., 2003; Sciamanna et al.,

2005). Although at present it is unclear why non-nucleoside ana-

logs might aid cancer treatment, our data suggest that efavirenz is

toxic to cancer cells in short- and long-term assays, which could

explain their reported effect. However, future studies are needed

to truly test whether human L1 RTis might help the prognosis of

human cancer patients. Notably, recent data on animal and

cellular models have revealed that L1 activity is activated during

cellular senescence and aging, triggering a strong type I interferon

response (De Cecco et al., 2019; Simon et al., 2019). Intriguingly,

these studies demonstrated that nucleoside analog RTis rescued

the interferon response observed in senescence cells, expanded

the lifespan of aging mice models, and even reduced the sterile

inﬂammation of tissues from aged mice (De Cecco et al., 2019;

Simon et al., 2019). Thus, these data suggest that RTis could

be also used to prevent aging, although future studies are

required to unveil the anti-aging effect of RTis. Finally, and further

considering the role of LINE-1 retrotransposons in human interfer-

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Cell Line Authentication

B Cell Line Conditions

d METHOD DETAILS

B Chemicals Used in this Study

B Chemical Synthesis of 2’,3’-dideoxynucleosides

12 Cell Chemical Biology 26, 1–15, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

B Expression Plasmids

Bachiller, S., Del-Pozo-Martin, Y., and Carrion, A.M. (2017). L1 retrotransposi-

tion alters the hippocampal genomic landscape enabling memory formation.

Brain Behav. Immun. 64 , 65–70.

B Retrotransposition Assays

B MTT Assays

Beck, C.R., Collier, P., Macfarlane, C., Malig, M., Kidd, J.M., Eichler, E.E.,

Badge, R.M., and Moran, J.V. (2010). LINE-1 retrotransposition activity in

human genomes. Cell 141 , 1159–1170.

B qPCR and RT-qPCR Control Assays

B Western Blot Analyses

d QUANTIFICATION AND STATISTICAL ANALYSIS

Beck-Engeser, G.B., Eilat, D., and Wabl, M. (2011). An autoimmune disease

prevented by anti-retroviral drugs. Retrovirology 8 , 91.

SUPPLEMENTAL INFORMATION

Belshaw, R., Pereira, V., Katzourakis, A., Talbot, G., Paces, J., Burt, A., and

Tristem, M. (2004). Long-term reinfection of the human genome by endoge-

nous retroviruses. Proc. Natl. Acad. Sci. U S A 101 , 4894–4899.

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2019.04.010.

Benitez-Guijarro, M., Lopez-Ruiz, C., Tarnauskaite, Z., Murina, O., Mian

Mohammad, M., Williams, T.C., Fluteau, A., Sanchez, L., Vilar-Astasio, R.,

Garcia-Canadas, M., et al. (2018). RNase H2, mutated in Aicardi-Goutieres

syndrome, promotes LINE-1 retrotransposition. EMBO J. 37, https://doi.org/

10.15252/embj.201798506.

ACKNOWLEDGMENTS

Current members of the J.L.G.-Perez lab are acknowledged for helpful discus-

sions during the course of the study. We also acknowledge Drs Thierry Heid-

mann (Institut Pasteur, France) for providing the MusD- and IAP-neo^TNF

Boeke, J.D., and Chapman, K.B. (1991). Retrotransposition mechanisms.

-

Curr. Opin. Cell Biol. 3 , 502–507.

tagged constructs, Jef Boeke (NYU, USA) for providing plasmid pCEPL1SM,

and John Goodier (John Hopkins, USA) for providing mouse LINE-1 expres-

sion vectors (from the A and G_Fclasses) tagged with the mneoI retrotranspo-

sition indicator cassette. J.A.T.’s lab has been funded by University of Granada

(project CS2016-6). G.B.-S. is funded by a ‘‘Garantı´a Juvenil’’ contract from

the European Social Fund in collaboration with the Andalusian Regional Gov-

ernment. M.B.-G. is funded by a ‘‘Formacion Profesorado Universitario’’ (FPU)

PhD fellowship from the Government of Spain (MINECO, Ref FPU15/03294). In

J.L.G.-Perez’s lab, this study has been funded by an International Early Career

Scientist grant from the Howard Hughes Medical Institute (IECS-55007420)

and by a private donation from Ms Francisca Serrano (Trading y Bolsa para

Torpes, Granada, Spain). J.L.G.Perez’s lab is also supported by the European

Research Council (ERC-Consolidator ERC-STG-2012-309433), and by

MINECO-FEDER (SAF2017-89745-R).

Boeke, J.D., Garﬁnkel, D.J., Styles, C.A., and Fink, G.R. (1985). Ty elements

transpose through an RNA intermediate. Cell 40 , 491–500.

Brouha, B., Schustak, J., Badge, R.M., Lutz-Prigge, S., Farley, A.H., Moran,

J.V., and Kazazian, H.H., Jr. (2003). Hot L1s account for the bulk of retro-

transposition in the human population. Proc. Natl. Acad. Sci. U S A 100 ,

5280–5285.

Burns, K.H. (2017). Transposable elements in cancer. Nat. Rev. Cancer 17 ,

415–424.

Camarasa, M.J., De las Heras, F., and Perez-Perez, M.J. (1990). Aldol reaction

of nucleoside 5⁰-carboxaldehydes with acetone. synthesis of 5⁰-C-chain

extended thymidine derivatives. Nucleosides Nucleotides 9 , 533–546.

Carreira, P.E., Richardson, S.R., and Faulkner, G.J. (2013). L1 retrotranspo-

sons, cancer stem cells and oncogenesis. FEBS J. 281 , 63–73.

Contreras-Galindo, R., Dube, D., Fujinaga, K., Kaplan, M.H., and Markovitz,

D.M. (2017). Susceptibility of human endogenous retrovirus type K to reverse

transcriptase inhibitors. J. Virol. 91, https://doi.org/10.1128/JVI.01309-17.

AUTHOR CONTRIBUTIONS

Conceptualization, G.B.-S., J.A.T., and J.L.G.-Perez; Investigation, G.B.-S.,

L.S., V.S.-C., C.S.-P., P.T.-R., M.B.-B., M.B.-G., and S.M.; Writing – Original

Draft, J.L.G.-Perez; Writing – Review & Editing, all authors; Funding Acquisi-

tion, J.A.T., S.R.H., and J.L.G.-Perez; Resources, F.F.-M., and J.L.G.-Puche;

Supervision, J.A.T., S.R.H., and J.L.G.-Perez.

Cost, G.J., Feng, Q., Jacquier, A., and Boeke, J.D. (2002). Human L1 element

target-primed reverse transcription in vitro. EMBO J. 21 , 5899–5910.

Coufal, N.G., Garcia-Perez, J.L., Peng, G.E., Yeo, G.W., Mu, Y., Lovci, M.T.,

Morell, M., O’Shea, K.S., Moran, J.V., and Gage, F.H. (2009). L1 retrotranspo-

sition in human neural progenitor cells. Nature 460 , 1127–1131.

DECLARATION OF INTERESTS

Crow, Y.J., and Manel, N. (2015). Aicardi-Goutieres syndrome and the type I

interferonopathies. Nat. Rev. Immunol. 15 , 429–440.

None of the authors declare any conﬂict of interest.

Dai, L., Huang, Q., and Boeke, J.D. (2011). Effect of reverse transcriptase

inhibitors on LINE-1 and Ty1 reverse transcriptase activities and on LINE-1

retrotransposition. BMC Biochem. 12 , 18.

Received: January 22, 2019

Revised: March 29, 2019

Accepted: April 19, 2019

Published: May 30, 2019

De Cecco, M., Ito, T., Petrashen, A.P., Elias, A.E., Skvir, N.J., Criscione, S.W.,

Caligiana, A., Brocculi, G., Adney, E.M., Boeke, J.D., et al. (2019). L1 drives IFN

in senescent cells and promotes age-associated inﬂammation. Nature

566 , 73–78.

REFERENCES

DeBerardinis, R.J., Goodier, J.L., Ostertag, E.M., and Kazazian, H.H., Jr.

(1998). Rapid ampliﬁcation of a retrotransposon subfamily is evolving the

mouse genome. Nat. Genet. 20 , 288–290.

Achleitner, M., Kleeﬁsch, M., Hennig, A., Peschke, K., Polikarpova, A., Oertel,

R., Gabriel, B., Schulze, L., Lindeman, D., Gerbaulet, A., et al. (2017). Lack of

Trex1 causes systemic autoimmunity despite the presence of antiretroviral

drugs. J. Immunol. 199 , 2261–2269.

Dewannieux, M., Dupressoir, A., Harper, F., Pierron, G., and Heidmann, T.

(2004). Identiﬁcation of autonomous IAP LTR retrotransposons mobile in

mammalian cells. Nat. Genet. 36 , 534–539.

Agyei-Aye, K., and Baker, D.C. (1988). Synthesis and evaluation of a series of

1-(3-alkyl-2,3-dideoxy-alpha,beta-D-erythro-pentofuranosyl)thymines.

Carbohydr. Res. 183 , 261–275.

Dewannieux, M., Esnault, C., and Heidmann, T. (2003). LINE-mediated retro-

transposition of marked Alu sequences. Nat. Genet. 35 , 41–48.

Arts, E.J., and Wainberg, M.A. (1996). Mechanisms of nucleoside analog anti-

viral activity and resistance during human immunodeﬁciency virus reverse

transcription. Antimicrob. Agents Chemother. 40 , 527–540.

Dewannieux, M., Harper, F., Richaud, A., Letzelter, C., Ribet, D., Pierron, G.,

and Heidmann, T. (2006). Identiﬁcation of an infectious progenitor for the

multiple-copy HERV-K human endogenous retroelements. Genome Res. 16 ,

1548–1556.

Audat, S.A., Love, C.T., Al-Oudat, B.A., and Bryant-Friedrich, A.C. (2012).

Synthesis of C3’ modiﬁed nucleosides for selective generation of the

C3’-deoxy-3’-thymidinyl radical: a proposed intermediate in LEE induced

DNA damage. J. Org. Chem. 77 , 3829–3837.

Dewannieux, M., and Heidmann, T. (2005). L1-mediated retrotransposition of

murine B1 and B2 SINEs recapitulated in cultured cells. J. Mol. Biol. 349 ,

241–247.

Cell Chemical Biology 26, 1–15, August 15, 2019 13

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Erwin, J.A., Paquola, A.C., Singer, T., Gallina, I., Novotny, M., Quayle, C.,

Bedrosian, T.A., Alves, F.I., Butcher, C.R., Herdy, J.R., et al. (2016). L1-asso-

ciated genomic regions are deleted in somatic cells of the healthy human brain.

Nat. Neurosci. 19 , 1583–1591.

Kazazian, H.H., Jr., Wong, C., Youssouﬁan, H., Scott, A.F., Phillips, D.G., and

Antonarakis, S.E. (1988). Haemophilia A resulting from de novo insertion of L1

sequences represents a novel mechanism for mutation in man. Nature 332 ,

164–166.

Esnault, C., Casella, J.F., and Heidmann, T. (2002). A Tetrahymena thermo-

phila ribozyme-based indicator gene to detect transposition of marked retro-

elements in mammalian cells. Nucleic Acids Res. 30 , e49.

Khwaja, T.A., and Heidelberger, C. (1967). Fluorinated pyrimidines. XXIX.

Syntheses of 2’,3’-dehydro-5-ﬂuoro-2’-deoxyuridine and 2’,3’-dideoxy-5-

ﬂuorouridine. J. Med. Chem. 10 , 1066–1070.

Evrony, G.D., Cai, X., Lee, E., Hills, L.B., Elhosary, P.C., Lehmann, H.S.,

Parker, J.J., Atabay, K.D., Gilmore, E.C., Poduri, A., et al. (2012). Single-neuron

sequencing analysis of L1 retrotransposition and somatic mutation in the

human brain. Cell 151 , 483–496.

Kim, A., Terzian, C., Santamaria, P., Pelisson, A., Purd’homme, N., and

Bucheton, A. (1994). Retroviruses in invertebrates: the gypsy retrotransposon

is apparently an infectious retrovirus of Drosophila melanogaster . Proc. Natl.

Acad. Sci. U S A 91 , 1285–1289.

Fowler, B.J., Gelfand, B.D., Kim, Y., Kerur, N., Tarallo, V., Hirano, Y., Amarnath,

S., Fowler, D.H., Radwan, M., Young, M.T., et al. (2014). Nucleoside reverse

transcriptase inhibitors possess intrinsic anti-inﬂammatory activity. Science

346 , 1000–1003.

Kim, C.H., Marquez, V.E., Broder, S., Mitsuya, H., and Driscoll, J.S. (1987).

Potential anti-AIDS drugs. 2’,3’-dideoxycytidine analogues. J. Med. Chem.

30 , 862–866.

Kimberland, M.L., Divoky, V., Prchal, J., Schwahn, U., Berger, W., and

Kazazian, H.H., Jr. (1999). Full-length human L1 insertions retain the capacity

for high frequency retrotransposition in cultured cells. Hum. Mol. Genet. 8 ,

1557–1560.

Freeman, J.D., Goodchild, N.L., and Mager, D.L. (1994). A modiﬁed indicator

gene for selection of retrotransposition events in mammalian cells.

Biotechniques 17 , 46, 48–49, 52.

Furukawa, Y., Yoshioka, Y., Imai, K., and Honjo, M. (1970). Studies on the

synthesis of pyrimidine deoxynucleosides. I. synthesis of 2’, 3’-dideoxyuridine

and 1-(3-ethylthio-3-deoxy-b -D-xylofuranosyl) uracil. Chem. Pharm. Bull.

(Tokyo) 18 , 554–560.

Kopera, H.C., Moldovan, J.B., Morrish, T.A., Garcia-Perez, J.L., and Moran,

Proc. Natl. Acad. Sci. U S A 108 , 20345–20350.

Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J.,

Devon, K., Dewar, K., Doyle, M., FitzHugh, W., et al. (2001). Initial sequencing

and analysis of the human genome. Nature 409 , 860–921.

Garcia-Perez, J.L., Morell, M., Scheys, J.O., Kulpa, D.A., Morell, S., Carter,

C.C., Hammer, G.D., Collins, K.L., O’Shea, K.S., Menendez, P., et al. (2010).

Epigenetic silencing of engineered L1 retrotransposition events in human

embryonic carcinoma cells. Nature 466 , 769–773.

Landriscina, M., Spadafora, C., Cignarelli, M., and Barone, C. (2007). Anti-

tumor activity of non-nucleosidic reverse transcriptase inhibitors. Curr.

Pharm. Des. 13 , 737–747.

Garcia-Perez, J.L., Widmann, T.J., and Adams, I.R. (2016). The impact

of transposable elements on mammalian development. Development 143 ,

4101–4114.

Li, W., Prazak, L., Chatterjee, N., Gruninger, S., Krug, L., Theodorou, D., and

Dubnau, J. (2013). Activation of transposable elements during aging and

neuronal decline in Drosophila . Nat. Neurosci. 16 , 529–531.

Goodier, J.L., Ostertag, E.M., Du, K., and Kazazian, H.H., Jr. (2001). A novel

active L1 retrotransposon subfamily in the mouse. Genome Res. 11 ,

1677–1685.

Lin, T.-S., Luo, M.-Z., and Liu, M.C. (1995). Synthesis of several pyrimidine

L-nucleoside analogues as potential antiviral agents. Tetrahedron 51 ,

1055–1068.

Goodier, J.L., Zhang, L., Vetter, M.R., and Kazazian, H.H., Jr. (2007). LINE-1

ORF1 protein localizes in stress granules with other RNA-binding proteins,

including components of RNA interference RNA-induced silencing complex.

Mol. Cell. Biol. 27 , 6469–6483.

Lin, T.S., Luo, M.Z., Liu, M.C., Pai, S.B., Dutschman, G.E., and Cheng, Y.C.

(1994). Synthesis and biological evaluation of 2’,3’-dideoxy-L-pyrimidine

nucleosides as potential antiviral agents against human immunodeﬁciency

virus (HIV) and hepatitis B virus (HBV). J. Med. Chem. 37 , 798–803.

Grimaldi, G., Skowronski, J., and Singer, M.F. (1984). Deﬁning the beginning

and end of KpnI family segments. EMBO J. 3 , 1753–1759.

Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression

data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.

Methods 25 , 402–408.

Han, J.S., and Boeke, J.D. (2004). A highly active synthetic mammalian retro-

transposon. Nature 429 , 314–318.

Heidmann, O., and Heidmann, T. (1991). Retrotransposition of a mouse IAP

Macia, A., Widmann, T.J., Heras, S.R., Ayllon, V., Sanchez, L., Benkaddour-

Boumzaouad, M., Munoz-Lopez, M., Rubio, A., Amador-Cubero, S., Blanco-

Jimenez, E., et al. (2017). Engineered LINE-1 retrotransposition in nondividing

human neurons. Genome Res. 27 , 335–348.

sequence tagged with an indicator gene. Cell 64 , 159–170.

Heras, S.R., Macias, S., Plass, M., Fernandez, N., Cano, D., Eyras, E., Garcia-

Perez, J.L., and Caceres, J.F. (2013). The microprocessor controls the activity

of mammalian retrotransposons. Nat. Struct. Mol. Biol. 20 , 1173–1181.

MacLennan, M., Garcia-Canadas, M., Reichmann, J., Khazina, E., Wagner, G.,

Playfoot, C.J., Salvador-Palomeque, C., Mann, A.R., Peressini, P., Sanchez,

L., et al. (2017). Mobilization of LINE-1 retrotransposons is restricted

by Tex19.1 in mouse embryonic stem cells. Elife 6, https://doi.org/10.7554/

eLife.26152.

Horwitz, J.P., Chua, J., Noel, M., and Donatti, J.T. (1967). Nucleosides. XI.

2’,3’-dideoxycytidine. J. Org. Chem. 32 , 817–818.

Hughes, J.F., and Cofﬁn, J.M. (2004). Human endogenous retrovirus K

solo-LTR formation and insertional polymorphisms: implications for human

and viral evolution. Proc. Natl. Acad. Sci. U S A 101 , 1668–1672.

Mager, D.L., and Stoye, J.P. (2015). Mammalian endogenous retrovi-

ruses. Microbiol. Spectr. 3, https://doi.org/10.1128/microbiolspec.

MDNA3-0009-2014.

Ivancevic, A.M., Kortschak, R.D., Bertozzi, T., and Adelson, D.L. (2018).

Horizontal transfer of BovB and L1 retrotransposons in eukaryotes. Genome

Biol. 19 , 85.

Malki, S., van der Heijden, G.W., O’Donnell, K.A., Martin, S.L., and Bortvin, A.

(2014). A role for retrotransposon LINE-1 in fetal oocyte attrition in mice. Dev.

Cell 29 , 521–533.

Izumi, M., Miyazawa, H., Kamakura, T., Yamaguchi, I., Endo, T., and Hanaoka,

F. (1991). Blasticidin S-resistance gene (bsr): a novel selectable marker for

mammalian cells. Exp. Cell Res. 197 , 229–233.

Mangiacasale, R., Pittoggi, C., Sciamanna, I., Careddu, A., Mattei, E.,

Lorenzini, R., Travaglini, L., Landriscina, M., Barone, C., Nervi, C., et al.

(2003). Exposure of normal and transformed cells to nevirapine, a reverse

transcriptase inhibitor, reduces cell growth and promotes differentiation.

Oncogene 22 , 2750–2761.

Jones, R.B., Garrison, K.E., Wong, J.C., Duan, E.H., Nixon, D.F., and

Ostrowski, M.A. (2008). Nucleoside analogue reverse transcriptase inhibitors

differentially inhibit human LINE-1 retrotransposition. PLoS One 3 , e1547.

Kawakami, H., Ebata, T., Koseki, K., Matsumoto, K., Matsushita, H., Naoi, Y.,

and Itoh, K. (1990). Stereoselectivities in the coupling reaction between

silylated pyrimidine bases and 1-Halo-2,3-dideoxyribose. Heterocycles 31 ,

2041–2054.

Michelson, A.M., and Todd, A.R. (1955). Deoxyribonucleosides and related

compounds. Part V. cycloThymidines and other thymidine derivatives. The

conﬁguration at the glycosidic centre in thymidine. J. Chem. Soc. 815–823.

14 Cell Chemical Biology 26, 1–15, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Mitsudo, K., Kawaguchi, T., Miyahara, S., Matsuda, W., Kuroboshi, M., and

Tanaka, H. (2005). Electrooxidative glycosylation through C-S bond cleavage

of 1-arylthio-2,3-dideoxyglycosides. Synthesis of 2’,3’-dideoxynucleosides.

Org. Lett. 7 , 4649–4652.

Inhibition of endogenous reverse transcriptase antagonizes human tumor

growth. Oncogene 24 , 3923–3931.

Scott, E.C., and Devine, S.E. (2017). The role of somatic L1 retrotransposition

in human cancers. Viruses 9, https://doi.org/10.3390/v9060131.

Moran, J.V., Holmes, S.E., Naas, T.P., DeBerardinis, R.J., Boeke, J.D., and

Kazazian, H.H., Jr. (1996). High frequency retrotransposition in cultured

mammalian cells. Cell 87 , 917–927.

Simon, M., Van Meter, M., Ablaeva, J., Ke, Z., Gonzalez, R.S., Taguchi, T., De

Cecco, M., Leonova, K.I., Kogan, V., Helfand, S.L., et al. (2019). LINE1 dere-

pression in aged wild-type and sirt6-deﬁcient mice drives inﬂammation. Cell

Metab. 29 , 871–885.e5.

Morrish, T.A., Garcia-Perez, J.L., Stamato, T.D., Taccioli, G.E., Sekiguchi, J.,

and Moran, J.V. (2007). Endonuclease-independent LINE-1 retrotransposition

at mammalian telomeres. Nature 446 , 208–212.

Singer, T., McConnell, M.J., Marchetto, M.C., Coufal, N.G., and Gage, F.H.

(2010). LINE-1 retrotransposons: mediators of somatic variation in neuronal

genomes? Trends Neurosci. 33 , 345–354.

Morrish, T.A., Gilbert, N., Myers, J.S., Vincent, B.J., Stamato, T.D., Taccioli,

G.E., Batzer, M.A., and Moran, J.V. (2002). DNA repair mediated by endonu-

clease-independent LINE-1 retrotransposition. Nat. Genet. 31 , 159–165.

Sivets, G.G., Klennitskaya, T.V., Zhernosek, E.V., and Mikhailopulo, I.A. (2002).

Synthesis of peracylated derivatives of L-ribofuranose from D-ribose and their

use for the preparation of b-L-ribonucleosides. Synthesis 2, https://doi.org/10.

1055/s-2002-19805.

Muotri, A.R., Chu, V.T., Marchetto, M.C., Deng, W., Moran, J.V., and Gage,

F.H. (2005). Somatic mosaicism in neuronal precursor cells mediated by L1

retrotransposition. Nature 435 , 903–910.

Stamos, J.L., Lentzsch, A.M., and Lambowitz, A.M. (2017). Structure of a

thermostable group II intron reverse transcriptase with template-primer and

its functional and evolutionary implications. Mol. Cell 68 , 926–939.e4.

Naas, T.P., DeBerardinis, R.J., Moran, J.V., Ostertag, E.M., Kingsmore, S.F.,

Seldin, M.F., Hayashizaki, Y., Martin, S.L., and Kazazian, H.H. (1998). An

actively retrotransposing, novel subfamily of mouse L1 elements. EMBO J.

17 , 590–597.

Stetson, D.B., Ko, J.S., Heidmann, T., and Medzhitov, R. (2008). Trex1 pre-

vents cell-intrinsic initiation of autoimmunity. Cell 134 , 587–598.

Okabe, M., Sun, R.C., Tam, S.Y.K., Todaro, L.J., and Coffen, D.L. (1988).

Synthesis of the dideoxynucleosides ‘‘ddC’’ and ‘‘CNT’’ from glutamic acid,

ribonolactone, and pyrimidine bases. J. Org. Chem. 53 , 4780–4786.

Takabatake, T., Ishihara, H., Ohmachi, Y., Tanaka, I., Nakamura, M.M.,

Fujikawa, K., Hirouchi, T., Kakinuma, S., Shimada, Y., Oghiso, Y., et al. (2008).

Microarray-based global mapping of integration sites for the retrotransposon,

intracisternal A-particle, in the mouse genome. Nucleic Acids Res. 36 , e59.

Ostertag, E.M., Prak, E.T., DeBerardinis, R.J., Moran, J.V., and Kazazian, H.H.,

Jr. (2000). Determination of L1 retrotransposition kinetics in cultured cells.

Nucleic Acids Res. 28 , 1418–1423.

Takahara, T., Ohsumi, T., Kuromitsu, J., Shibata, K., Sasaki, N., Okazaki, Y.,

Shibata, H., Sato, S., Yoshiki, A., Kusakabe, M., et al. (1996). Dysfunction of

the Orleans reeler gene arising from exon skipping due to transposition of a

full-length copy of an active L1 sequence into the skipped exon. Hum. Mol.

Genet. 5 , 989–993.

Pﬁtzner, K.E., and Moffatt, J.G. (1964). The synthesis and hydrolysis of 2’,3’-

dideoxyuridine. J. Org. Chem. 29 , 1508–1511.

Piskareva, O., Denmukhametova, S., and Schmatchenko, V. (2003).

Functional reverse transcriptase encoded by the human LINE-1 from baculo-

virus-infected insect cells. Protein Expr. Purif. 28 , 125–130.

Takahashi, Y., Honda, Y., and Tsuchiya, T. (1995). Synthesis of (3’R)-3’-deoxy-

3’-C-nitromethylthymidine. Carbohydr. Res. 270 , 77–83.

Piskareva, O., and Schmatchenko, V. (2006). DNA polymerization by the

reverse transcriptase of the human L1 retrotransposon on its own template

in vitro. FEBS Lett. 580 , 661–668.

Thomas, C.A., Paquola, A.C., and Muotri, A.R. (2012). LINE-1 retrotransposi-

tion in the nervous system. Annu. Rev. Cell Dev. Biol. 28 , 555–573.

Thomas, C.A., Tejwani, L., Trujillo, C.A., Negraes, P.D., Herai, R.H., Mesci, P.,

Macia, A., Crow, Y.J., and Muotri, A.R. (2017). Modeling of TREX1-dependent

autoimmune disease using human stem cells highlights L1 accumulation as a

source of neuroinﬂammation. Cell Stem Cell 21 , 319–331.e8.

Rassu, G., Zanardi, F., Battistini, L., Gaetani, E., and Casiraghi, G. (1997).

Expeditious syntheses of sugar-modiﬁed nucleosides and collections thereof

exploiting furan-, pyrrole-, and thiophene-based siloxy dienes. J. Med. Chem.

40 , 168–180.

Upton, K.R., Gerhardt, D.J., Jesuadian, J.S., Richardson, S.R., Sanchez-

Luque, F.J., Bodea, G.O., Ewing, A.D., Salvador-Palomeque, C., van der

Knaap, M.S., Brennan, P.M., et al. (2015). Ubiquitous L1 mosaicism in hippo-

campal neurons. Cell 161 , 228–239.

Ribet, D., Dewannieux, M., and Heidmann, T. (2004). An active murine trans-

poson family pair: retrotransposition of ‘‘master’’ MusD copies and ETn

trans-mobilization. Genome Res. 14 , 2261–2267.

Rice, G.I., Meyzer, C., Bouazza, N., Hully, M., Boddaert, N., Semeraro, M., Zeef,

L.A.H., Rozenberg, F., Bondet, V., Duffy, D., et al. (2018). Reverse-transcriptase

inhibitors in the Aicardi-Goutieres syndrome. N. Engl. J. Med. 379 , 2275–2277.

Van Aerschot, A., Everaert, D., Balzarini, J., Augustyns, K., Jie, L., Janssen, G.,

Peeters, O., Blaton, N., De Ranter, C., De Clercq, E., et al. (1990). Synthesis

and anti-HIV evaluation of 2’,3’-dideoxyribo-5-chloropyrimidine analogues:

reduced toxicity of 5-chlorinated 2’,3’-dideoxynucleosides. J. Med. Chem.

33 , 1833–1839.

Richardson, S.R., Doucet, A.J., Kopera, H.C., Moldovan, J.B., Garcia-Perez,

J.L., and Moran, J.V. (2015). The inﬂuence of LINE-1 and SINE retrotranspo-

sons on mammalian genomes. Microbiol. Spectr. 3, https://doi.org/10.1128/

microbiolspec.MDNA3-0061-2014.

Waterston, R.H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J.F., Agarwal,

P., Agarwala, R., Ainscough, R., Alexandersson, M., An, P., et al. (2002). Initial

sequencing and comparative analysis of the mouse genome. Nature 420 ,

520–562.

Richardson, S.R., Narvaiza, I., Planegger, R.A., Weitzman, M.D., and Moran,

J.V. (2014). APOBEC3A deaminates transiently exposed single-strand DNA

during LINE-1 retrotransposition. Elife 3 .

Wei, W., Morrish, T.A., Alisch, R.S., and Moran, J.V. (2000). A transient assay

reveals that cultured human cells can accommodate multiple LINE-1 retro-

transposition events. Anal. Biochem. 284 , 435–438.

Rosowsky, A., and Pai, N.N. (1991). Synthesis of the 2⁰-,3⁰-didehydro-2⁰-,3⁰-di-

deoxy and 2⁰-,3⁰-dideoxy derivatives of 6-azauridine and a new route to 2⁰-,3⁰-di-

dehydro-2⁰-,3⁰-dideoxy-5-chlorouridine. Nucleosides Nucleotides 10 , 837–851.

Xie, Y., Rosser, J.M., Thompson, T.L., Boeke, J.D., and An, W. (2011).

Characterization of L1 retrotransposition with high-throughput dual-luciferase

assays. Nucleic Acids Res. 39 , e16.

Sassaman, D.M., Dombroski, B.A., Moran, J.V., Kimberland, M.L., Naas, T.P.,

DeBerardinis, R.J., Gabriel, A., Swergold, G.D., and Kazazian, H.H., Jr. (1997).

Many human L1 elements are capable of retrotransposition. Nat. Genet.

16 , 37–43.

Zeuthen, J., Norgaard, J.O., Avner, P., Fellous, M., Wartiovaara, J., Vaheri, A.,

Rosen, A., and Giovanella, B.C. (1980). Characterization of a human ovarian

teratocarcinoma-derived cell line. Int. J. Cancer 25 , 19–32.

Schauer, S.N., Carreira, P.E., Shukla, R., Gerhardt, D.J., Gerdes, P., Sanchez-

Luque, F.J., Nicoli, P., Kindlova, M., Ghisletti, S., Santos, A.D., et al. (2018). L1

retrotransposition is a common feature of mammalian hepatocarcinogenesis.

Genome Res. 28 , 639–653.

Zhao, C., Liu, F., and Pyle, A.M. (2018). An ultraprocessive, accurate reverse

transcriptase encoded by a metazoan group II intron. RNA 24 , 183–195.

Zhuk, R.A., Berzinya, A.E., Silinya, V.N., Liepin’sh, E.E., and Giller, S.A. (1979).

Analogs of pyrimidine mono- and polynucleotides. Chem. Heterocycl. Comp.

10 , 1468–1470.

Sciamanna, I., Landriscina, M., Pittoggi, C., Quirino, M., Mearelli, C., Beraldi,

R., Mattei, E., Seraﬁno, A., Cassano, A., Sinibaldi-Vallebona, P., et al. (2005).

Cell Chemical Biology 26, 1–15, August 15, 2019 15

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Antibodies

SOURCE

IDENTIFIER

Mouse monoclonal anti-L1Hs-ORF1p

Mouse monoclonal anti-p53

Mouse monoclonal anti-b-actin

Horse anti-mouse IgG HRP-linked

Bacterial and Virus Strains

Merck

Cat# MABC1152

Santa Cruz Biotechnology

Sigma-Aldrich

Cat# sc-126; RRID: AB_628082

Cat# A2228; RRID: AB_476697

Cat# 7076; RRID: AB_330924

Cell Signaling Technology

Escherichia coli DH5a [F^-f80lacZDM15

D(lacZYA-argF) U169 recA1 endA1 hsdR17

(r_k^-, m_k⁺) phoA supE44 thi-1 gyrA96 relA1 l^-]

Thermo Fisher Scientiﬁc

Cat# 18265017

Chemicals, Peptides, and Recombinant Proteins

Abacavir

Hospital Cl´ınico San Cecilio,

Granada, Spain

CAS: 136470-78-5

CAS: 30516-87-1

CAS: 154598-52-4

CAS: 143491-57-0

CAS: 269055-15-4

CAS: 134678-17-4

CAS: 129618-40-2

CAS: 3056-17-5

AZT

Hospital Cl´ınico San Cecilio,

Granada, Spain

Efavirenz

Hospital Cl´ınico San Cecilio,

Granada, Spain

Emtricitabine

Etravirine

Hospital Cl´ınico San Cecilio,

Granada, Spain

Hospital Cl´ınico San Cecilio,

Granada, Spain

Lamivudine

Nevirapine

Stavudine

Tenofovir disoproxil

Hospital Cl´ınico San Cecilio,

Granada, Spain

Hospital Cl´ınico San Cecilio,

Granada, Spain

Hospital Cl´ınico San Cecilio,

Granada, Spain

Hospital Cl´ınico San Cecilio,

Granada, Spain

CAS: 147127-20-6

2⁰,3⁰-Dideoxy-3⁰-ﬂuorouridine (C1)

2’,3’-Isopropylideneuridine (C2)

2’,3⁰-Dideoxy-3⁰-ﬂuorothymidine (C4)

2⁰,3⁰-Dideoxy-5-iodouridine (C5)

2’,3’-O-isopropylideneadenosine (C6)

2’-Azido-2’-deoxyuridine (C7)

Sigma-Aldrich

Carbosynth

Cat# 393711

Cat# I5127

Cat# 361275

Cat# 327859

Cat# I22404

Cat# 11544

N4-Acetyl-2’-O-methylcytidine (C8)

N4-Acetyl-2’-deoxy-2’-ﬂuorocytidine (C9)

5’-O-Acetyl-2’,3’-O-isopropylideneadenosine (C10)

Ethylaluminium dichloride, 1.8M solution in toluene

Tetrabutylammonium ﬂuoride, 1M solution in THF

Lipofectamine 2000

Cat# NA08375

Cat# NA02623

Cat# NA04029

Cat# 428041000

Cat# 433511000

Cat# 11668019

Cat# E2691

Carbosynth

Acros Organics

Thermo Fisher Scientiﬁc

Promega

FuGENE 6

DNase I, Ampliﬁcation Grade

Invitrogen

Cat# 18068015

Cat# M610A

Cat# N261A

RQ1 RNase-Free DNase

Promega

RNasin Plus RNase Inhibitor

Promega

TRIzol Reagent

Invitrogen

Cat# 15596026

Critical Commercial Assays

Dual-Luciferase Reporter Assay System

Micro BCA Protein Assay Kit

Promega

Cat# E1910

Cat# 23235

Thermo Fisher Scientiﬁc

(Continued on next page)

e1 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Continued

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Cat# 1705061

Cat# 4368814

Cat# A6002

Clarity Western ECL Substrate

High-Capacity cDNA Reverse Transcription Kit

GoTaq qPCR Master Mix

Bio-Rad

Applied Biosystems

Promega

Experimental Models: Cell Lines

Human: HeLa cells (HeLa S3)

Human: PA-1 cells

ATCC

CCL-2.2

CRL-1572

CRL-11268

Human: HEK293T cells (HEK 293T/17)

Oligonucleotides

qPCR primer GADPH-s

Sigma-Aldrich

N/A

(5’CGTTCCCAAAGTCCTCCTGT)

qPCR primer GADPH-as

(5’AGGTGATCGGTGCTGGTTC)

qPCR and RT-qPCR primer EBNA-1-s

(5’CGTCATCTCCGTCATCACC)

qPCR and RT-qPCR primer EBNA-1-as

(5’AGATTTGCCTCCCTGGTTTC)

RT-qPCR primer GAPDH-s

(5’TGCACCACCAACTGCTTAGC)

RT-qPCR primer GAPDH-as

(5’GGCATGGACTGTGGTCATGAG)

RT-qPCR primer NEOjunct2-s

(5’TGCCTCGTCCTGAAGCTC)

RT-qPCR primer NEOjunct2-as

(5’CAATCGGCTGCTCTGATG)

Recombinant DNA

Plasmid JM101/L1.3

Sassaman et al.1997. From John V.

Moran Lab.

N/A

Plasmid pCEPL1SM

Plasmid pCEP-TG_F21

Plasmid pCEP-A101

Plasmid pCMV-MusD-6neo^TNF

Plasmid pIAP-92L23neo^TNF

Plasmid pU6ineo

Han and Boeke, 2004. From Jef D.

Boeke Lab.

Goodier et al., 2001. From Haig H.

Kazazian Lab.

Goodier et al., 2001. From Haig H.

Kazazian Lab.

Ribet et al., 2004. From Thierry

Heidmann Lab.

Dewannieux et al., 2004. From Thierry

Heidmann Lab.

Richardson et al., 2014. From John V.

Moran Lab.

Plasmid JJ101/L1.3

Kopera et al., 2011. From John V.

Moran Lab.

Plasmid JJL1SM

MacLennan et al., 2017. From Jose L.

Garcia-Perez Lab.

Plasmid pXY014

Xie et al., 2011. From Wenfeng An Lab.

N/A

Plasmid pXY015

Software and Algorithms

GraphPad Prism

GraphPad

Mestrelab

https://www.graphpad.com/scientiﬁc-

software/prism/

Mnova

https://mestrelab.com/software/mnova/

Other

PLC Silicagel 60 F₂₅₄, 0,5 mm

Discovery DSC-8 SPE Tube, 500 mg, 3 mL

Merck

Cat# 105744

Cat# 52713-U

Supelco

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e2

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the lead contact, Jose L.

Garcia-Perez (jose.garcia-perez@igmm.ed.ac.uk).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Line Authentication

The cell lines used in this study were originally obtained from ATCC. Their identity was conﬁrmed by STR analyses at least once a year

at Lorgen, Granada, Spain. Furthermore, the absence of Mycoplasma spp. was conﬁrmed every month using a PCR-based assay

(Minerva).

Cell Line Conditions

All cell lines used in this study were grown at 37^ꢁC, 5% CO₂and atmospheric O₂, and passaged using Trypsin 0.05% (from Gibco,

used for HeLa and PA-1 cells) or by pipetting up/down (for HEK293T cells).

HeLa Cells

HeLa cells (Moran et al., 1996) were grown on Dulbecco’s Modiﬁed Eagle Medium-High Glucose (DMEM, Invitrogen) supplemented

with 1x penicillin/streptomycin/glutamine (Invitrogen) and 10% Fetal Bovine Serum (FBS, Hyclone).

HEK293T Cells

HEK293T cells were grown on DMEM-High Glucose (Invitrogen) supplemented with 1x penicillin/streptomycin/glutamine (Invitrogen)

and 10% FBS (Hyclone).

PA-1 Cells

PA-1 cells (Zeuthen et al., 1980) were cultured as described (Garcia-Perez et al., 2010), using Minimum Essential Media (MEM,

Invitrogen) supplemented with 1x penicillin/streptomycin/glutamine (Invitrogen), 0.1 mM non-essential amino acids (Invitrogen),

and 10% heat-inactivated FBS (Hyclone).

METHOD DETAILS

Chemicals Used in this Study

RTis used to treat HIV/AIDS (Abacavir, AZT, efavirenz, emtricitabine, etravirine, lamivudine, nevirapine, stavudine, and tenofovir) were

obtained from Hospital Clinico San Cecilio, Granada, Spain. The name, provider and CAS number of commercially available nucleo-

side analogues used in this study are indicated in Table 1. The procedure for the synthesis of nucleoside analogues used in this study is

included in Method details, and all compounds (GBS-147, 146, 197, 128, 187, 188, 186, 185, 149, 148, 127, 177, 196, 130, 179, 133,

192, and 191) were dissolved in water. Aliquots of all chemicals were prepared to avoid repeated freeze-thaw cycles.

Chemical Synthesis of 2’,3’-dideoxynucleosides

Although some nucleoside analogues have been previously synthesized in other studies, below we describe the general procedures

used to obtain the 18 nucleoside analogues tested in this study.

All solvents and chemicals were used as purchased without further puriﬁcation. Thin layer chromatography was performed on

pre-coated silica gel 60 F₂₅₄plates (Merck), and silica gel 60 (230-400 mesh, Aldrich) was used for ﬂash column chromatography

(FCC). Preparative TLC was developed on pre-coated silica gel 60 F₂₅₄, using 0.5 mm glass plates (Merck). Optical rotatory power

was determined employing a JASCO DIP-370 polarimeter. NMR spectra are provided in Data S2, and were recorded using the

following spectrometers: Varian Inova Unity 300 MHz, Varian Direct Drive 400 MHz, Varian Direct Drive 500 MHz and Varian

Direct Drive 600 MHz. Chemical shifts (d) are reported in parts per million relative to the residual peak of the deuterated solvent.

High-resolution mass spectra were recorded on a Micromass LCT time-of-ﬂight instrument using electrospray ionization (ESI).

Low-resolution mass spectra (LRMS) were obtained operating in an electrospray ionization mode (ESI) coupled to high resolution

liquid chromatography in a simple Quadrupole Agilent 6110 instrument, provided with a Zorbax Eclipse XDB-C18 4.6 x 150 mm

column.

General Procedure for Sugar-Base Coupling

Coupling reactions between sugar moiety and nitrogenous base were carried out as previously described (Okabe et al., 1988).

A mixture of the nitrogenous base (0.73 mmol), HMDS (1.5 mL, 7.30 mmol), and (NH₄)₂SO₄(cat.) was reﬂuxed during 2 hours until

a clear solution was obtained. The reaction mixture was cooled and the solvent evaporated in vacuum. The residue was dissolved

e3 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

in dry 1,2-dichloroethane (3 mL), under argon atmosphere, and a solution of acetate 1 (100 mg, 0.36 mmol) in dry 1,2-dichloroethane

(2 mL) was added. The reaction mixture was cooled in an ice-bath, treated with EtAlCl₂in toluene (1.8 M in toluene, 222 mL, 0.4 mmol)

and allowed to stir for 16 hours at room temperature. The reaction was then quenched with saturated aqueous NaHCO₃solution and

partitioned between CH₂Cl₂and water. The organic layer was dried over Mg₂SO₄, ﬁltered and concentrated. The residue was initially

puriﬁed by FCC to obtain a mixture of isomeric nucleosides that was next separated by preparative thin layer chromatography on a

glass plate. The silica was scraped off and percolated through a pad of silica gel using DCM/MeOH (90:10).

General Procedure for the Desilylation of Nucleosides

Each protected nucleoside (1.0 equiv) was dissolved in THF and treated with TBAF (1 M in THF, 1.5 equiv). After stirring during

15-30 minutes, the solvent evaporated under reduced pressure. The residue was dissolved in water and passed through a C8

SPE (Sulpelco, bed wt. 500 mg, volume 3 mL) eluting with water. Each tube was analyzed with an LC-MS instrument in order to collect

those tubes containing the unprotected nucleoside and lacking tetrabutylammonium salts.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-uracil (GBS-109-P1). 1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-di-

deoxy-b-D-ribofuranosyl]-uracil (GBS-109-P1) has been previously synthesized (Mitsudo et al., 2005).

28

TLC diethyl ether/hexane (9:1); preparative TLC diethyl ether/hexane (1:1). Colorless syrup (28 mg, 23%). ½aꢂ_D+23.9^ꢁ(C 1.2,

CH₃Cl); ¹H NMR (500 MHz, CDCl₃) d 9.21 (s, 1H), 8.08 (d, J = 8.1 Hz, 1H), 6.07 (dd, J = 6.5, J = 3.1 Hz, 1H), 5.65 (d, 1H, J =

8.1 Hz), 4.18 – 4.13 (m, 1H), 4.05 (dd, J = 11.5, J = 2.4 Hz, 1H), 3.70 (dd, J = 11.6, J = 2.4 Hz, 1H), 2.43 – 2.34 (m, 1H), 2.10 – 2.04

(m, 1H), 2.03 – 1.96 (m, 1H), 1.92 – 1.86 (m, 1H), 0.90 (s, 9H), 0.09 (2s, 6H) (Mitsudo et al., 2005); ¹³C NMR (125 MHz, CDCl₃)

d 163.8, 150.5, 140.7, 101.5, 86.4, 82.2, 63.7, 33.6, 26.0, 24.4, 18.6, -5.33, -5.43; HRMS (m/z): [M + H]⁺calcd. for C₁₅H₂₇N₂O₄Si,

327.1740; found, 327.1746.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-uracil (GBS-109-P2). 1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-

a-^D-ribofuranosyl]-uracil (GBS-109-P2) has been previously synthesized (Mitsudo et al., 2005).

29

TLC diethyl ether/hexane (9:1); preparative TLC diethyl ether/hexane (1:1). White solid (22 mg, 18%). mp: 126-128^ꢁC; ½aꢂ_D-42.6^ꢁ

(C 1, CH₃Cl); ¹H NMR (500 MHz, CDCl₃) d 9.15 (s, 1H), 7.35 (d, J = 8.1 Hz, 1H), 6.05 (dd, J = 6.2, J = 3.1 Hz, 1H), 5.72 (d, J = 8.2 Hz, 1H),

4.40 (m, 1H), 3.68 (dd, J = 10.9, J = 4.3 Hz, 1H), 3.63 (dd, J = 10.9, J = 4.1 Hz, 1H), 2.51 (m, 1H), 2.03 – 1.95 (m, 3H), 0.90 (s, 9H), 0.07

(s, 6H) (Mitsudo et al., 2005); ¹³C NMR (125 MHz, CDCl₃) d 163.6, 150.3, 139.4, 101.9, 88.1, 82.2, 65.4, 32.9, 26.0, 25.8, 18.4, -5.21,

-5.27; HRMS (m/z): [M + Na]⁺calcd. for C₁₅H₂₆N₂O₄NaSi, 349.1560; found 349.1563.

2’,3’-dideoxy-b-^D-uridine (GBS-127). 2’,3’-dideoxy-b-D-uridine (GBS-127) has been previously synthesized (Pﬁtzner and Moffatt,

1964).

Obtained as a white solid (6 mg, quant.) from GBS-109-P1 (9 mg, 0.027 mmol). TLC dichloromethane/methanol (9:1). mp:

28

122-124^ꢁC (Rassu et al., 1997); ½aꢂ_D+52.3 (C 0.5, MeOH) (Rassu et al., 1997); ¹H NMR (500 MHz, CDCl₃) d 8.55 (s, 1H), 7.79

(d, J = 8.1 Hz, 1H), 6.09 (dd, J = 6.9, J = 3.8 Hz, 1H), 5.71 (d, 1H), 4.23 – 4.16 (m, 1H), 4.01 (dd, J = 11.8, J = 2.7 Hz, 1H), 3.74

(dd, J = 11.9, J = 3.8 Hz, 1H), 2.48 – 2.38 (m, 1H), 2.20 – 2.07 (m, 2H), 2.06 – 1.95 (m, 2H); ¹³C NMR (125 MHz, CDCl₃) d 163.3,

150.3, 140.6, 102.1, 86.7, 81.7, 63.5, 32.7, 25.1; HRMS (m/z): [M + Na]⁺calcd. for C₉H₁₂N₂O₄Na, 235.0695; found 235.0683.

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e4

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

2’,3’-dideoxy-a-D-uridine (GBS-177). 2’,3’-dideoxy-a-D-uridine (GBS-177) has been previously synthesized (Kawakami et al., 1990)

Obtained as a waxy solid (8 mg, quant.) from GBS-109-P2 (12 mg, 0.037 mmol). TLC dichloromethane/methanol (9:1). mp:

28

1

96-98^ꢁC (Rassu et al., 1997); ½aꢂ_D-28.9 (C 0.5, MeOH) (Rassu et al., 1997); H NMR (500 MHz, CDCl₃) d 8.99 (s, 1H), 7.37 (d, J =

8.1 Hz, 1H), 6.10 (dd, J = 6.2, J = 4.5 Hz, 1H), 5.74 (d, J = 8.1 Hz, 1H), 4.50 – 4.42 (m, 1H), 3.76 (dd, J = 11.9, J = 3.2 Hz, 1H),

3.58 (dd, J = 11.9, J = 5.7 Hz, 1H), 2.60 – 2.47 (m, 1H), 2.12 – 2.01 (m, 3H), 1.99 – 1.88 (m, 1H); ¹³C NMR (125 MHz, CDCl₃)

d 163.4, 150.4, 139.5, 102.3, 87.7), 82.1, 64.8, 32.9, 25.9; HRMS (m/z): [M + Na]⁺calcd. for C₉H₁₂N₂O₄Na, 235.0695; found 235.0694.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-thymine (GBS-111-P1).

TLC diethyl ether/hexane (9:1); preparative TLC diethyl ether/hexane (1:1). Colorless syrup (16 mg, 13%). ½aꢂ²_D⁸-26.8 (C 0.7, CH₃Cl);

¹H NMR (500 MHz, CDCl₃) d 8.70 (s, 1H), 7.15 (s, 1H), 6.07 (dd, J = 6.3, J = 3.8 Hz, 1H), 4.41 (m, 1H), 3.68 (dd, J = 10.9, J = 4.3 Hz, 1H),

3.63 (dd, J = 10.9, J = 4.1 Hz, 1H), 2.53 – 2.45 (m, 1H), 2.06 – 1.95 (m, 3H), 1.93 (s, 3H), 0.90 (s, 9H), 0.07 (s, 6H); ¹³C NMR (125 MHz,

CDCl₃) d 163.9, 150.2, 135.3, 110.4, 87.5, 81.9, 65.4, 32.8, 26.0, 26.0, 18.4, 12.8, -5.20, -5.26. HRMS (m/z): [M + Na]⁺calcd. for

C₁₆H₂₈N₂O₄NaSi, 363.1716; found 363.1717.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-D-ribofuranosyl]-thymine (GBS-111-P2). 1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-

dideoxy-b-^D-ribofuranosyl]-thymine (GBS-111-P2) has been previously synthesized (Camarasa et al., 1990).

TLC diethyl ether/hexane (9:1); preparative TLC diethyl ether/hexane (1:1). White solid (28 mg, 22%). mp: 117-119^ꢁC (Camarasa

29

et al., 1990); ½aꢂ_D+11.4 (C 1, CH₃Cl) (Takahashi et al., 1995); ¹H NMR (500 MHz, CDCl₃) d 8.31 (s, 1H), 7.58 (d, J = 1.1 Hz, 1H), 6.07 (dd,

J = 6.4, J = 4.5 Hz, 1H), 4.19 – 4.11 (m, 1H), 3.99 (dd, J = 11.4, J = 2.6 Hz, 1H), 3.71 (dd, J = 11.4, J = 2.9 Hz, 1H), 2.43 – 2.29 (m, 1H),

2.02 – 1.96 (m, 3H), 1.92 (d, J = 1.1 Hz, 3H), 0.93 (s, 9H), 0.11 (s, 6H) (Takahashi et al., 1995); ¹³C NMR (125 MHz, CDCl₃) d 164.1,

150.5, 135.8, 110.3, 85.9, 81.1, 64.6, 32.7, 26.0, 25.5, 18.6, 12.7, -5.17, -5.20 (Audat et al., 2012); HRMS (m/z): [M + Na]⁺calcd.

for C₁₆H₂₈N₂O₄NaSi, 363.1716; found 363.1724.

2’,3’-dideoxy-a-^D-thymidine (GBS-130). 2’,3’-dideoxy-a-D-thymidine (GBS-130) has been previously synthesized (Agyei-Aye and

Baker, 1988).

Obtained as a white solid (6 mg, quant.) from GBS-111-P1 (9 mg, 0.026 mmol). TLC dichloromethane/methanol (9:1). mp:

29

102-104^ꢁC (Rassu et al., 1997); ½aꢂ_D-17.3 (C 0.2, MeOH) (Rassu et al., 1997); ¹H NMR (500 MHz, CDCl₃) d 8.48 (s, 1H), 7.15

(s, 1H), 6.12 (t, J = 5.7 Hz, 1H), 4.48 (m, 1H), 3.76 (dd, J = 11.9, J = 3.2 Hz, 1H), 3.58 (dd, J = 11.9, J = 5.7 Hz, 1H), 2.55 – 2.47

(m, 1H), 2.14 – 1.99 (m, 2H), 1.98 – 1.88 (m, 1H), 1.94 (s, 3H) 1.63 (s, 1H); ¹³C NMR (125 MHz, CDCl₃) d 163.7, 150.3, 135.2,

110.9, 87.2, 81.8, 64.9, 32.7, 26.1, 12.8. HRMS (m/z): [M + Na]⁺calcd. for C₁₀H₁₄N₂O₄Na, 249.0851; found 249.0837.

2’,3’-dideoxy-b-D-thymidine (GBS-196). 2’,3’-dideoxy-b-D-thymidine (GBS-196) has been previously synthesized (Michelson and

Todd, 1955).

e5 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Obtained as a white solid (10 mg, quant.) from GBS-111-P2 (15 mg, 0.026 mmol). TLC dichloromethane/methanol (9:1). mp:

28

150-152^ꢁC (Rassu et al., 1997); ½aꢂ_D+35.9 (c 0.6, MeOH) (Rassu et al., 1997); ¹H NMR (500 MHz, CDCl₃) d 8.88 (s, 1H), 7.52

(d, J = 1.1 Hz, 1H), 6.10 (dd, J = 7.0, J = 4.0 Hz, 1H), 4.20 – 4.15 (m, 1H), 3.99 (dd, J = 12.0, J = 2.7 Hz, 1H), 3.73 (dd, J = 12.0,

J = 4.0 Hz, 1H), 2.44 – 2.35 (m, 1H), 2.26 (s, 1H), 2.12 – 1.98 (m, 3H), 1.90 (d, J = 1.1 Hz, 3H) (Audat et al., 2012); ¹³C NMR

(125 MHz, CDCl₃) d 164.0, 150.5, 136.4, 110.7, 86.3, 81.3, 63.6, 32.2, 25.3, 12.7 (Audat et al., 2012); HRMS (m/z): [M + Na]⁺calcd.

for C₁₀H₁₄N₂O₄Na, 249.0851; found 249.0866.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-6-azauracil (GBS-121-P1).

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:2). Colorless syrup (28 mg, 23%). ½aꢂ²_D⁸+10.6 (C 1.1, CHCl₃);

¹H NMR (500 MHz, CDCl₃) d 9.35 (s, 1H), 7.43 (s, 1H), 6.44 (dd, J = 7.1, J = 2.7 Hz, 1H), 4.45 – 4.33 (m, 1H), 3.65 (dd, J = 10.8, J =

4.3 Hz, 1H), 3.61 (dd, J = 10.8, J = 4.0 Hz, 1H), 2.40 – 2.31 (m, 1H), 2.30 – 2.18 (m, 2H), 1.97 – 1.86 (m, 1H), 0.90 (s, 9H), 0.06 (s, 6H); ¹³C

NMR (125 MHz, CDCl₃) d 155.9, 147.8, 135.4, 87.7, 81.9, 65.5, 30.3, 26.8, 26.0, 18.5, -5.16, -5.25; HRMS (m/z): [M + Na]⁺calcd. for

C₁₄H₂₅N₃O₄NaSi, 350.1512; found 350.1506.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-6-azauracil (GBS-121-P2).

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:2). Colorless syrup (36 mg, 30%). ½aꢂ³_D⁰-69.6 (c 0.5, CHCl₃);

¹H NMR (500 MHz, CDCl₃) d 9.03 (s, 1H), 7.42 (s, 1H), 6.38 (dd, J = 6.6, J = 3.5 Hz, 1H), 4.17 – 4.11 (m, 1H), 3.72 (dd, J = 10.6, J =

5.3 Hz, 1H), 3.65 (dd, J = 10.6, J = 5.5 Hz, 1H), 2.32 – 2.23 (m, 2H), 2.07 – 1.99 (m, 2H), 0.88 (s, 9H), 0.04 (2s, 6H); ¹³C NMR (125 MHz,

CDCl₃) d 155.7, 147.8, 135.3, 86.8, 82.3, 65.6, 30.1, 27.4, 26.0, 18.5, -5.13, -5.17; HRMS (m/z): [M + Na]⁺calcd. for C₁₄H₂₅N₃O₄NaSi,

350.1512; found 350.1515.

2’,3’-dideoxy-a-^D-6-azauridine (GBS-133).

Obtained as a colorless syrup (14 mg, quant.) from GBS-121-P1 (21 mg, 0.064 mmol). TLC dichloromethane/methanol (9:1).

28

1

½aꢂ_D+128.3 (C 1, MeOH); H NMR (500 MHz, CDCl₃) d 9.95 (s, 1H), 7.43 (s, 1H), 6.46 (t, J = 5.4 Hz, 1H), 4.46 – 4.39 (m, 1H), 3.74

(dd, J = 12.0, J = 2.9 Hz, 1H), 3.53 (dd, J = 12.0, J = 5.4 Hz, 1H), 2.58 (s, 1H), 2.39 – 2.32 (m, 2H), 2.29 – 2.20 (m, 1H), 1.91 – 1.82

(m, 1H); ¹³C NMR (125 MHz, CDCl₃) d 156.2, 148.3, 135.7, 87.3, 81.9, 64.7, 30.0, 26.5; HRMS (m/z): [M + Na]⁺calcd. for

C₈H₁₁N₃O₄Na, 236.0647; found 236.0658.

2’,3’-dideoxy-b-^D-6-azauridine (GBS-179). 2’,3’-dideoxy-b-D-6-azauridine (GBS-179) has been previously synthesized (Rosowsky

and Pai, 1991).

Obtained as a colorless syrup (5 mg, quant.) from GBS-121-P2 (8 mg, 0.024 mmol). TLC dichloromethane/methanol (9:1).

28

½aꢂ_D-117.3 (C 0.2, MeOH); ¹H NMR (600 MHz, CDCl₃) d 8.80 (s, 1H), 7.46 (s, 1H), 6.40 (dd, J = 6.9, J = 3.8 Hz, 1H), 4.29 – 4.23

(m, 1H), 3.85 (dd, J = 12.0, J = 2.9 Hz, 1H), 3.61 (dd, J = 12.0, J = 4.9 Hz, 1H), 2.38 – 2.27 (m, 2H), 2.20 – 2.11 (m, 1H), 2.06 –

2.00 (m, 1H), 1.60 (s, 1H) (Rosowsky and Pai, 1991); ¹³C NMR (150 MHz, CDCl₃) d 155.4, 147.6, 135.8, 87.2, 82.4, 64.8, 31.0,

26.1; HRMS (m/z): [M - H]^-calcd. for C₈H₁₀N₃O₄, 212.0671; found 212.0666.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-5-bromouracil (GBS-124-P1).

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e6

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (24 mg, 16%). mp: 147-149^ꢁC; ½aꢂ_D²⁸-20.9 (C

0.7, CHCl₃); ¹H NMR (500 MHz, CDCl₃) d 8.84 (s, 1H), 7.67 (s, 1H), 6.02 (dd, J = 6.1, J = 3.0 Hz, 1H), 4.50 – 4.41 (m, 1H), 3.71 (dd, J =

11.0, J = 4.1 Hz, 1H), 3.64 (dd, J = 11.0, J = 4.0 Hz, 1H), 2.61 – 2.49 (m, 1H), 2.06 – 1.96 (m, 3H), 0.91 (s, 9H), 0.08 (s, 6H); ¹³C NMR

(125 MHz, CDCl₃) d 159.1, 149.5, 139.1, 96.3, 88.7, 82.4, 65.3, 33.2, 26.0, 25.6, 18.4, -5.21, -5.26; HRMS (m/z): [M - H]^-calcd. for

C₁₅H₂₄N₂O₄SiBr, 403.0689; found 403.0679.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-5-bromouracil (GBS-124-P2).

29

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (32 mg, 21%). mp: 153-155^ꢁC; ½aꢂ_D-3.5

1

(^C1.8, CHCl₃); H NMR (500 MHz, CDCl₃) d 9.44 (s, 1H), 8.17 (s, 1H), 6.02 (dd, J = 6.4, J = 4.3 Hz, 1H), 4.21 – 4.15 (m, 1H), 4.03

(dd, J = 11.6, J = 2.3 Hz, 1H), 3.70 (dd, J = 11.6, J = 2.7 Hz, 1H), 2.44 – 2.36 (m, 1H), 2.08 – 1.91 (m, 3H), 0.93 (s, 9H), 0.13

(s, 6H); ¹³C NMR (125 MHz, CDCl₃) d 159.4, 149.9, 139.8, 96.4, 87.0, 81.9, 64.4, 33.3, 26.2, 25.0, 18.7, -5.07, -5.09; HRMS (m/z):

[M + Na]⁺calcd. for C₁₅H₂₅N₂O₄NaSiBr, 427.0665; found 427.0671.

2’,3’-dideoxy-a-^D-5-bromouridine (GBS-128).

28

Obtained as a colorless syrup (13 mg, quant.) from GBS-124-P1 (18 mg, 0.044 mmol). TLC dichloromethane/methanol (9:1). ½aꢂ_D

-15.8 (C 1, MeOH); ¹H NMR (500 MHz, CDCl₃) d 9.07 (s, 1H), 7.67 (s, 1H), 6.07 (dd, J = 6.1, J = 4.4 Hz, 1H), 4.54 – 4.48 (m, 1H), 3.79 (dd,

J = 12.0, J = 3.2 Hz, 1H), 3.60 (dd, J = 12.0, J = 5.6 Hz, 1H), 2.62 – 2.51 (m, 1H), 2.14 – 2.01 (m, 2H), 2.00 – 1.90 (m, 1H), 1.70 (s, 1H); ¹³C

NMR (125 MHz, CDCl₃) d 159.2, 149.6, 139.1, 96.7, 88.2, 82.3, 64.7, 33.1, 25.7; HRMS (m/z): [M + H]⁺calcd. for C₉H₁₁N₂O₄Br,

312.9800; found 312.9785.

2’,3’-dideoxy-b-^D-5-bromouridine (GBS-197). 2’,3’-dideoxy-b-D-5-bromouridine (GBS-197) has been previously synthesized

(Furukawa et al., 1970).

Obtained as a colorless syrup (12 mg, quant.) from GBS-124-P2 (17 mg, 0.044 mmol). TLC dichloromethane/methanol (9:1). mp:

27

182-184^ꢁC (Furukawa et al., 1970); ½aꢂ_D+25.6 (C 0.7, MeOH); ¹H NMR (600 MHz, CD₃OD) d 8.64 (s, 1H), 6.00 (dd, J = 6.7, J = 2.9 Hz,

1H), 4.19 – 4.14 (m, 1H), 3.93 (dd, J = 12.3, J = 2.8 Hz, 1H), 3.68 (dd, J = 12.2, J = 3.2 Hz, 1H), 2.44 – 2.36 (m, 1H), 2.15 – 2.09 (m, 1H),

2.02 – 1.92 (m, 2H); ¹³C NMR (150 MHz, CD₃OD) d 161.8, 151.6, 142.4, 96.2, 88.3, 84.0, 63.0, 34.0, 25.2; HRMS (m/z): [M - H]^-calcd.

for C₉H₁₀N₂O₄Br, 288.9824; found 288.9823.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-D-ribofuranosyl]-5-ﬂuorouracil (GBS-135-P1).

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (19 mg, 15%). mp: 106-108^ꢁC (Lin et al.,

29

1

1994); ½aꢂ_D-43.3 (C 1, CHCl₃); H NMR (500 MHz, CDCl₃) d 9.53 (s, 1H), 7.42 (d, J = 6.1 Hz, 1H), 6.04 – 6.01 (m, 1H), 4.48 – 4.36

(m, 1H), 3.69 (dd, J = 11.0, J = 4.2 Hz, 1H), 3.63 (dd, J = 11.0, J = 4.1 Hz, 1H), 2.59 – 2.48 (m, 1H), 2.04 – 1.93 (m, 3H), 0.90

(s, 9H), 0.07 (s, 6H) (Lin et al., 1994); ¹³C NMR (125 MHz, CDCl₃) d 157.2 (d, J = 26.6 Hz), 148.9, 140.5 (d, J = 236.9 Hz), 123.8

(d, J = 33.7 Hz), 88.2, 82.3, 65.3, 32.9, 26.0, 25.7, 18.4, -5.23, -5.29; HRMS (m/z)=: [M + Na]⁺calcd. for C₁₅H₂₅N₂O₄NaFSi,

367.1465; found 367.1450.

e7 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-D-ribofuranosyl]-5-ﬂuorouracil (GBS-135-P2).

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (35 mg, 28%). mp: 144-146^ꢁC (Lin et al.,

29

1994); ½aꢂ_D+21.2 (C 1.25, CHCl₃); ¹H NMR (500 MHz, CDCl₃) d 9.00 (s, 1H), 8.26 (d, J = 6.4 Hz, 1H), 6.07 – 6.02 (m, 1H), 4.20 –

4.14 (m, 1H), 4.10 (dd, J = 11.7, J = 2.2 Hz, 1H), 3.71 (dd, J = 11.6, J = 2.1 Hz, 1H), 2.45 – 2.36 (m, 1H), 2.11 – 2.01 (m, 2H), 1.96

– 1.89 (m, 1H), 0.93 (s, 9H), 0.12 (2s, 6H) (Lin et al., 1994); ¹³C NMR (125 MHz, CDCl₃) d 157.1 (d, J = 27.1 Hz), 148.9, 140.3 (d,

J = 235.5 Hz), 125.0 (d, J = 34.3 Hz), 86.7, 82.3, 63.9, 33.6, 26.1, 24.4, 18.7, -5.4; HRMS (m/z): [M + Na]⁺calcd. for C₁₅H₂₅N₂O₄NaFSi,

367.1465; found 367.1450.

2’,3’-dideoxy-a-^D-5-ﬂuorouridine (GBS-191). 2’,3’-dideoxy-a-D-5-ﬂuorouridine (GBS-191) has been previously synthesized (Zhuk

et al., 1979).

Obtained as a white solid (20 mg, quant.) from GBS-135-P1 (30 mg, 0.087 mmol). TLC dichloromethane/methanol (9:1). mp: 132-

28

134^ꢁC (Zhuk et al., 1979); ½aꢂ_D-41.7 (C 1.25, MeOH); ¹H NMR (500 MHz, CD₃OD) d 7.80 (d, J = 6.6 Hz, 1H), 6.06 – 6.02 (m, 1H), 4.51 –

4.45 (m, 1H), 3.64 (dd, J = 11.9, J = 3.8 Hz, 1H), 3.52 (dd, J = 11.9, J = 5.1 Hz, 1H), 2.51 – 2.42 (m, 1H, H), 2.13 – 2.03 (m, 2H), 1.93 – 1.84

(m, 1H); ¹³C NMR (125 MHz, CD₃OD) d 159.6 (d, J = 26.0 Hz), 150.7, 141.8 (d, J = 232.7 Hz), 126.0 (d, J = 34.3 Hz), 89.1, 83.4, 65.1,

33.2, 26.7; HRMS (m/z): [M + Na]⁺calcd. for C₉H₁₁N₂O₄FNa, 253.0601; found 253.0604.

2’,3’-dideoxy-b-^D-5-ﬂuorouridine (GBS-192). 2’,3’-dideoxy-b-D-5-ﬂuorouridine (GBS-192) has been previously synthesized

(Khwaja and Heidelberger, 1967).

Obtained as a white solid (10 mg, quant.) from GBS-135-P2 (15 mg, 0.043 mmol). TLC dichloromethane/methanol (9:1). mp: 123-

28

125^ꢁC (Lin et al., 1994); ½aꢂ_D+59.4 (C 0.62, MeOH) (Lin et al., 1994); ¹H NMR (500 MHz, CD₃OD) d 8.39 (d, J = 7.0 Hz, 1H), 6.03 – 5.99

(m, 1H), 4.17 – 4.11 (m, 1H), 3.91 (dd, J = 12.3, J = 2.8 Hz, 1H), 3.68 (dd, J = 12.2, J = 3.3 Hz, 1H), 2.44 – 2.34 (m, 1H), 2.14 – 2.06

(m, 1H), 2.03 – 1.92 (m, 2H); ¹³C NMR (125 MHz, CD₃OD) d 159.7 (d, J = 26.1 Hz), 150.8, 141.5 (d, J = 231.3 Hz), 126.6 (d, J = 35.0 Hz),

87.9, 83.7, 63.3, 33.7, 25.4; HRMS (m/z): [M + Na]⁺calcd. for C₉H₁₁N₂O₄FNa, 253.0601; found 253.0625.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-D-ribofuranosyl]-5-chlorouracil (GBS-136-P1).

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (24 mg, 18%). mp = 157-159^ꢁC; ½aꢂ_D²⁸-39.0

(^C0.1, CHCl₃); ¹H NMR (500 MHz, CDCl₃) d 9.01 (s, 1H), 7.56 (s, 1H), 6.02 (dd, J = 6.1, J = 3.1 Hz, 1H), 4.49 – 4.42 (m, 1H), 3.71 (dd, J =

10.9, J = 4.1 Hz, 1H), 3.64 (dd, J = 11, J = 4.0 Hz, 1H), 2.60 – 2.50 (m, 1H), 2.06 – 1.96 (m, 3H), 0.90 (s, 9H), 0.08 (s, 6H); ¹³C NMR

(125 MHz, CDCl₃) d 159.1, 149.3, 136.5, 108.7, 88.6, 82.4, 65.3, 33.1, 26.0, 25.6, 18.4, -5.21, -5.27; HRMS (m/z): [M + Na]⁺calcd. for

C₁₅H₂₅N₂O₄NaClSi, 383.1170; found 383.1154.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-5-chlorouracil (GBS-136-P2).

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e8

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

TLC diethyl ether/hexane (5:1); preparative TLC diethyl ether/hexane (1:1). White solid (44 mg, 33%). mp = 183-185^ꢁC; ½aꢂ_D²⁸+2.45

(^C1.1, CH₃Cl); ¹H NMR (500 MHz, CDCl₃) d 8.93 (s, 1H), 8.15 (s, 1H), 6.03 (dd, J = 6.3, J = 4.0 Hz, 1H), 4.22 – 4.16 (m, 1H), 4.06 (dd, J =

11.6, J = 2.3 Hz, 1H), 3.71 (dd, J = 11.6, J = 2.5 Hz, 1H), 2.46 – 2.36 (m, 1H), 2.09 – 1.93 (m, 3H), 0.94 (s, 9H), 0.14 (2s, 6H); ¹³C NMR

(125 MHz, CDCl₃) d 159.1, 149.5, 137.4, 108.6, 87.0, 82.0, 64.3, 33.4, 26.1, 24.9, 18.7, -5.15, -5.16; HRMS (m/z): [M + Na]⁺calcd. for

C₁₅H₂₅N₂O₄NaClSi, 383.1170; found 383.1159.

2’,3’-dideoxy-a-^D-5-chlorouridine (GBS-147).

Obtained as a white solid (13 mg, quantitative) from GBS-136-P1 (19 mg, 0.053 mmol). TLC (dichloromethane/methanol 9:1). mp:

28

165-167^ꢁC; ½aꢂ_D-26.50 (c 0.7, MeOH); ¹H NMR (500 MHz, CD₃OD) d 7.87 (s, 1H), 6.03 (dd, J = 6.3, J = 4.1 Hz, 1H), 4.53 – 4.47 (m, 1H),

3.66 (dd, J = 11.9, J = 3.7 Hz, 1H), 3.54 (dd, J = 11.9, J = 5.2 Hz, 1H), 2.54 – 2.43 (m, 1H), 2.14 – 2.05 (m, 2H), 1.95 – 1.86 (m, 1H); ¹³C

NMR (126 MHz, CD₃OD) d 161.7, 151.3, 138.9, 109.1, 89.6, 83.6, 65.1, 33.4, 26.7; HRMS (m/z): [M + Na]⁺calcd. for C₉H₁₁N₂O₄NaCl,

269.0305; found 269.0328.

2’,3’-dideoxy-b-^D-5-chlorouridine (GBS-146). 2’,3’-dideoxy-b-D-5-chlorouridine (GBS-146) has been previously synthesized

(Van Aerschot et al., 1990).

Obtained as a white solid (13 mg, quantitative) from GBS-136-P2 (19 mg, 0.053 mmol). TLC (dichloromethane/methanol 9:1). mp:

28

159-161^ꢁC (Van Aerschot et al., 1990); ½aꢂ_D+40.87 (c 0.55, MeOH); ¹H NMR (400 MHz, CD₃OD) d 8.56 (s, 1H), 6.03 (dd, J = 6.7, J =

2.9 Hz, 1H), 4.23 – 4.14 (m, 1H), 3.95 (dd, J = 12.3, J = 2.8 Hz, 1H), 3.71 (dd, J = 12.3, J = 3.2 Hz, 1H), 2.49 – 2.36 (m, 1H), 2.20 – 2.10

(m, 1H), 2.05 – 1.94 (m, 2H); ¹³C NMR (100 MHz, CD₃OD) d 161.8, 151.3, 139.8, 108.6, 88.2, 83.9, 63.0, 34.0, 25.2; HRMS (m/z):

[M + Na]⁺calcd. for C₉H₁₁N₂O₄NaCl, 269.0305; found 269.0331.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-5-ﬂuorocytosine (GBS-138-P1).

TLC dichloromethane/methanol (19:1); preparative TLC acetone/dichloromethane (1:1). Colorless syrup (37 mg, 29%). ½aꢂ²_D⁹-59.0

(^C1, MeOH); ¹H NMR (500 MHz, CDCl₃) d 8.05 (s, 1H), 7.45 (d, J = 6.2 Hz, 1H), 6.02 – 5.94 (m, 1H), 5.54 (s, 1H), 4.45 – 4.35 (m, 1H), 3.69

– 3.60 (m, 2H), 2.59 – 2.48 (m, 1H), 2.07 – 1.97 (m, 1H), 1.97 – 1.87 (m, 2H), 0.89 (s, 9H), 0.06 (s, 6H) (Lin et al., 1994); ¹³C NMR (125

MHz, CDCl₃) d 158.1 (d, J = 13.5 Hz), 154.0, 136.5 (d, J = 240.9 Hz), 124.7 (d, J = 31.8 Hz), 88.8, 82.2, 65.4, 33.0, 26.0, 25.5, 18.4, -5.21,

-5.25; HRMS (m/z): [M + H]⁺calcd. for C₁₅H₂₇N₃O₃SiF, 344.1806; found. 344.1823.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-5-ﬂuorocytosine (GBS-138-P2).

TLC dichloromethane/methanol (19:1); preparative TLC acetone/dichloromethane (1:1). White solid (40 mg, 32%). mp: 180-182^ꢁC

29

(Lin et al., 1994); ½aꢂ_D+51.6 (C 0.75, MeOH); ¹H NMR (500 MHz, CDCl₃) d 8.28 (d, J = 6.6 Hz, 1H), 7.51 (s, 1H), 6.05 – 5.99 (m, 1H), 5.41

(s, 1H), 4.17 – 4.13 (m, 1H), 4.11 (dd, J = 11.5, J = 2.3 Hz, 1H), 3.72 (dd, J = 11.6, J = 2.2 Hz, 1H), 2.48 – 2.38 (m, 1H), 2.15 – 2.06 (m, 1H),

2.01 – 1.89 (m, 1H), 1.88 – 1.78 (m, 1H), 0.93 (s, 9H), 0.12 (2s, 6H) (Lin et al., 1994); ¹³C NMR (125 MHz, CDCl₃) d 157.9 (d, J = 13.7 Hz),

154.1, 136.3 (d, J = 239.0 Hz), 126.3 (d, J = 32.2 Hz), 87.2, 82.5, 63.6, 33.8, 26.1, 24.0, 18.7, -5.39, -5.42; HRMS (m/z): [M + H]⁺calcd.

for C₁₅H₂₇N₃O₃SiF, 344.1806; found 344.1824.

e9 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

2’,3’-dideoxy-a-D-5-ﬂuorocytidine (GBS-185).

Obtained as a colorless syrup (12 mg, quantitative) from GBS-138-P1 (18 mg, 0.052 mmol). TLC dichloromethane/methanol (9:1).

28

½aꢂ_D-86.1 (C 0.62, MeOH); ¹H NMR (500 MHz, CD₃OD) d 7.79 (d, J = 6.6 Hz, 1H), 6.02 – 5.97 (m, 1H), 4.52 – 4.45 (m, 1H), 3.64 (dd,

J = 11.8, J = 3.9 Hz, 1H), 3.53 (dd, J = 11.8, J = 5.3 Hz, 1H), 2.55 – 2.46 (m, 1H), 2.08 – 1.96 (m, 2H), 1.92 – 1.83 (m, 1H); ¹³C NMR

(125 MHz, CD₃OD) d 159.6 (d, J = 13.9 Hz), 156.5, 138.4 (d, J = 242.0 Hz), 126.2 (d, J = 32.4 Hz), 89.8, 83.4, 65.2, 33.8, 26.5. HRMS

(m/z): [M + H]⁺calcd. for C₉H₁₃N₃O₃F, 230.0941; found 230.0925.

2’,3’-dideoxy-b-^D-5-ﬂuorocytidine (GBS-186). 2’,3’-dideoxy-b-D-5-ﬂuorocytidine (GBS-186) has been previously synthesized (Kim

et al., 1987).

Obtained as a white foam (8 mg, quantitative) from GBS-138-P2 (12 mg, 0.035 mmol). TLC dichloromethane/methanol (9:1). mp:

28

157-159^ꢁC (Lin et al., 1994); ½aꢂ_D+96.4 (C 0.5, MeOH) (Lin et al., 1994); ¹H NMR (500 MHz, CD₃OD) d 8.41 (d, J = 7.0 Hz, 1H), 5.99 –

5.94 (m, 1H), 4.18 – 4.12 (m, 1H), 3.93 (dd, J = 12.2, J = 2.8 Hz, 1H), 3.70 (dd, J = 12.3, J = 3.3 Hz, 1H), 2.47 – 2.36 (m, 1H), 2.09 – 2.01

(m, 1H), 1.96 – 1.88 (m, 2H); ¹³C NMR (125 MHz, CD₃OD) d 159.5 (d, J = 14.1 Hz), 156.5, 138.2 (d, J = 240.7 Hz), 127.2 (d, J = 33.3 Hz),

88.6, 83.9, 63.2, 34.3, 25.1; HRMS (m/z): [M + H]⁺calcd. for C₉H₁₃N₃O₃F, 230.0941; found 230.0923.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-5-azacytosine (GBS-139-P1). 1-[5’-O-(tert-butyldimethylsilyl)-

2’,3’-dideoxy-b-^D-ribofuranosyl]-5-azacytosine (GBS-139-P1) has been previously synthesized (Lin et al., 1995).

TLC dichloromethane/methanol (19:1); preparative TLC dichloromethane/methanol (97:3). White solid (26 mg, 22%). mp = 183-

28

185^ꢁC (Lin et al., 1995); ½aꢂ_D+53.9 (C 0.25, CH₃Cl); ¹H NMR (500 MHz, CDCl₃) d 8.72 (s, 1H), 6.64 (s, 1H), 6.02 (dd, J = 6.6, J =

2.4 Hz, 1H), 5.65 (s, 1H), 4.23 – 4.16 (m, 1H), 4.08 (dd, J = 11.6, J = 2.5 Hz, 1H), 3.72 (dd, J = 11.6, J = 2.4 Hz, 1H), 2.54 – 2.42

(m, 1H), 2.20 – 2.13 (m, 1H), 2.01 – 1.92 (m, 1H), 1.91 – 1.84 (m, 1H), 0.92 (s, 9H), 0.11 (2s, 6H) (Lin et al., 1995); ¹³C NMR

(125 MHz, CDCl₃) d 166.6, 156.2, 154.3, 87.5, 82.9, 63.4, 33.9, 26.1, 23.9, 18.6, -5.28, -5.39; HRMS (m/z): [M + H]⁺calcd. for

C₁₄H₂₇N₄O₃Si, 327.1852; found 327.1862.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-D-ribofuranosyl]-5-azacytosine (GBS-139-P2). 1-[5’-O-(tert-butyldimethylsilyl)-

2’,3’-dideoxy-a-^D-ribofuranosyl]-5-azacytosine (GBS-139-P2) has been previously synthesized (Lin et al., 1995).

TLC dichloromethane/methanol (19:1); preparative TLC dichloromethane/methanol (97:3). White solid (26 mg, 22%). mp = 197-199^ꢁC

28

(Lin et al., 1995); ½aꢂ_D-50.7 (C 0.6, CH₃Cl); ¹H NMR (500 MHz, CDCl₃) d 8.10 (s, 1H), 6.85 (s, 1H), 6.01 (dd, J = 6.2, J = 2.9 Hz, 1H), 5.74 (s,

1H), 4.48 – 4.39 (m, 1H), 3.69 (dd, J = 10.9, J = 4.3 Hz, 1H), 3.64 (dd, J = 10.9, J = 4.2 Hz, 1H), 2.63 – 2.52 (m, 1H), 2.14 – 2.04 (m, 1H), 2.00

– 1.92 (m, 2H), 0.90 (s, 9H), 0.07 (s, 6H) (Lin et al., 1995); ¹³C NMR (125 MHz, CDCl₃) d 166.6, 154.8, 154.0, 89.1, 82.5, 65.3, 33.1, 26.0,

25.3, 18.4, -5.20, -5.26; HRMS (m/z): [M + H]⁺calcd. for C₁₄H₂₇N₄O₃Si, 327.1852; found 327.1841.

2’,3’-dideoxy-b-^D-5-azacytidine (GBS-149). 2’,3’-dideoxy-b-D-5-azacytidine (GBS-149) has been previously synthesized (Lin

et al., 1995).

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e10

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

Obtained as a white solid (8 mg, quantitative) from GBS-139-P1 (12 mg, 0.037 mmol). TLC dichloromethane/methanol (9:1). mp:

29

240^ꢁC (Lin et al., 1995); ½aꢂ_D+46.3 (C 0.1, MeOH) (Lin et al., 1995); ¹H NMR (300 MHz, D₂O) d 8.63 (s, 1H), 6.02 (dd, J = 6.9, J = 2.3 Hz,

1H), 4.36 – 4.25 (m, 1H), 3.93 (dd, J = 12.7, J = 3.0 Hz, 1H), 3.76 (dd, J = 12.7, J = 4.9, 1H), 2.59 – 2.43 (m, 1H), 2.28 – 2.17 (m, 1H), 2.11

– 1.99 (m, 1H), 1.93 – 1.75 (m, 1H); ¹³C NMR (150 MHz, CD₃OD) d 168.0, 157.4, 156.6, 88.8, 84.4, 63.1, 34.3, 25.0; HRMS (m/z): [M +

Na]⁺calcd. for C₈H₁₂N₄O₃Na, 235.0807; found 235.0809.

2’,3’-dideoxy-a-^D-5-azacytidine (GBS-148). 2’,3’-dideoxy-a-D-5-azacytidine (GBS-148) has been previously synthesized (Lin et al.,

1995).

Obtained as a white solid (8 mg, quantitative) from GBS-139-P2 (12 mg, 0.037 mmol). TLC dichloromethane/methanol (9:1). mp:

29

145-147^ꢁC (Lin et al., 1995); ½aꢂ_D-52.8 (C 0.2, MeOH) (Lin et al., 1995); ¹H NMR (500 MHz, CD₃OD) d 8.26 (s, 1H), 5.99 (dd, J = 6.3, J =

3.5 Hz, 1H), 4.53 – 4.48 (m, 1H), 3.65 (dd, J = 11.9, J = 3.9 Hz, 1H), 3.54 (dd, J = 11.9, J = 5.2 Hz, 1H), 2.57 – 2.49 (m, 1H), 2.16 – 2.03 (m,

2H), 1.95 – 1.88 (m, 1H); ¹³C NMR (125 MHz, CD₃OD) d 168.2, 156.62, 156.59, 90.1, 83.7, 65.1, 33.7, 26.4; HRMS (m/z): [M + Na]⁺

calcd. for C₈H₁₂N₄O₃Na, 235.0807; found 235.0811.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-b-^D-ribofuranosyl]-cytosine (GBS-145-P1). 1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-di-

deoxy-b-^D-ribofuranosyl]-cytosine (GBS-145-P1) has been previously synthesized (Okabe et al., 1988).

TLC dichloromethane/methanol (19:1); preparative TLC chloroform/isopropanol (90:10). White solid (27 mg, 23%). mp: 198-200^ꢁC

28

(Okabe et al., 1988); ½aꢂ_D+41.1 (C 1, MeOH) (Okabe et al., 1988); ¹H NMR (500 MHz, CDCl₃) d 8.10 (d, J = 7.4 Hz, 1H), 6.07 (dd, J = 6.6,

J = 2.8 Hz, 1H), 5.63 (d, J = 7.3 Hz, 1H), 4.15 – 4.09 (m, 1H), 4.04 (dd, J = 11.5, J = 2.6 Hz, 1H), 3.71 (dd, J = 11.5, J = 2.6 Hz, 1H), 2.46 –

2.35 (m, 1H), 2.10 – 2.02 (m, 1H), 1.95 – 1.88 (m, 1H), 1.87 – 1.79 (m, 1H), 0.91 (s, 9H), 0.09 (2s, 6H) (Okabe et al., 1988); ¹³C NMR

(125 MHz, CDCl₃) d 165.9, 156.1, 141.8, 93.3, 87.1, 82.2, 63.7, 33.9, 26.0, 24.3, 18.5, -5.29, -5.39; HRMS (m/z): [M + H]⁺calcd. for

C₁₅H₂₈N₃O₃Si, 326.1900; found 326.1891.

1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-dideoxy-a-^D-ribofuranosyl]-cytosine (GBS-145-P2). 1-[5’-O-(tert-butyldimethylsilyl)-2’,3’-di-

deoxy-a-^D-ribofuranosyl]-cytosine (GBS-145-P2) has been previously synthesized (Okabe et al., 1988).

TLC dichloromethane/methanol (19:1); preparative TLC chloroform/isopropanol (90:10). White solid (25 mg, 21%). mp: 186-

28

188^ꢁC (Okabe et al., 1988);½aꢂ_D-50.0 (C 0.75, MeOH) (Okabe et al., 1988); ¹H NMR (500 MHz, CDCl₃) d 7.43 (d, J = 7.4 Hz, 1H),

6.04 (dd, J = 6.1, J = 3.3 Hz, 1H), 5.74 (d, J = 7.4 Hz, 1H), 4.42 – 4.34 (m, 1H), 3.64 (d, J = 4.6 Hz, 2H), 2.56 – 2.47 (m, 1H), 2.06

– 1.95 (m, 1H), 1.94 – 1.87 (m, 2H), 0.89 (s, 9H), 0.06 (s, 6H) (Okabe et al., 1988); ¹³C NMR (125 MHz, CDCl₃) d 166.0, 156.1,

140.3, 93.8, 88.7, 82.0, 65.5, 33.0, 26.0, 25.5, 18.5, -5.19, -5.24; HRMS (m/z): [M + H]⁺calcd. for C₁₅H₂₈N₃O₃Si, 326.1900; found

326.1890.

2’,3’-dideoxy-b-D-cytidine (GBS-187). 2’,3’-dideoxy-b-D-cytidine (GBS-187) has been previously synthesized (Horwitz et al., 1967).

Obtained as a white solid (9 mg, quantitative) from GBS-145-P1 (14 mg, 0.043 mmol). TLC dichloromethane/methanol (9:1). mp:

27

223-225^ꢁC (Rassu et al., 1997);½aꢂ_D+82.1 (C 0.77, MeOH) (Rassu et al., 1997); ¹H NMR (500 MHz, CD₃OD) d 8.12 (d, J = 7.5 Hz, 1H),

6.02 (dd, J = 6.7, J = 3.2 Hz, 1H), 5.87 (d, J = 7.5 Hz, 1H), 4.18 – 4.11 (m, 1H), 3.87 (dd, J = 12.2, J = 3.1 Hz, 1H), 3.69 (dd, J = 12.2, J =

4.0 Hz, 1H), 2.46 – 2.37 (m, 1H), 2.05 – 1.83 (m, 3H) (Sivets et al., 2002); ¹³C NMR (125 MHz, CD₃OD) d 167.6, 158.3, 142.8, 95.2, 88.4,

83.6, 63.7, 34.1, 25.7; HRMS (m/z): [M + H]⁺calcd. for C₉H₁₄N₃O₃, 212.1035; found 212.1029.

e11 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

2’,3’-dideoxy-a-D-cytidine (GBS-188). 2’,3’-dideoxy-a-D-cytidine (GBS-188) has been previously synthesized (Okabe et al., 1988).

Obtained as a white solid (9 mg, quantitative) from GBS-145-P2 (14 mg, 0.043 mmol). TLC dichloromethane/methanol (9:1). mp:

27

168-170^ꢁC (Rassu et al., 1997); ½aꢂ_D-74.5 (C 0.77, MeOH) (Okabe et al., 1988); ¹H NMR (500 MHz, CD₃OD) d 7.68 (d, J = 7.5 Hz, 1H),

6.05 (dd, J = 6.2, J = 3.7 Hz, 1H), 5.91 (d, J = 7.5 Hz, 1H), 4.49 – 4.44 (m, 1H), 3.63 (dd, J = 11.8, J = 4.0 Hz, 1H), 3.54 (dd, J = 11.8, J =

5.2 Hz, 1H), 2.54 – 2.45 (m, 1H), 2.07 – 1.96 (m, 2H), 1.93 – 1.84 (m, 1H); ¹³C NMR (125 MHz, CD₃OD) d 167.56, 158.05, 142.10, 95.57,

89.69, 83.38, 65.22, 33.83, 26.51; HRMS (m/z): [M + H]⁺calcd. for C₉H₁₄N₃O₃, 212.1035; found 212.1028.

Expression Plasmids

Plasmids used in this study were propagated in Escherichia coli strain DH5a (ThermoFisher) and were puriﬁed using Plasmid Midi kits

from Qiagen following manufacturer instructions. Plasmid DNAs were analysed by electrophoresis (0.7% agarose-ethidium bromide

gels) and we only used highly supercoiled preparations of plasmid DNA for transfections.

**JM101/L1.3

(Human L1.3), has been described previously (Sassaman et al., 1997). It contains a full-length copy of the human L1.3 element (L1.3,

accession number #L19088) tagged with the mneoI indicator cassette (Freeman et al., 1994; Moran et al., 1996); it is cloned in vector

pCEP4 (Life Technologies).

**pCEPL1SM

(Mouse L1-T_F) has been described previously (Han and Boeke, 2004). It contains a full-length mouse T_FLINE-1 element (L1Md-L1_Orl

,

(Takahara et al., 1996)) where the coding sequence of the LINE-1 ORFs (L1-ORF1 and L1-ORF2) has been codon optimized, and is

tagged with the mneoI indicator cassette (Freeman et al., 1994). It is cloned in vector pCEP4 (Life Technologies).

**pCEP-TG_F21

(Mouse L1-G_F) has been described previously (Goodier et al., 2001). It contains a full-length mouse G_FLINE-1 element (L1Md-G_F21,

accession number #AC021631.6, positions 62229-68991) tagged with the mneoI indicator cassette (Freeman et al., 1994). It is cloned

in vector pCEP4 (Life Technologies).

**pCEP-A101

(Mouse L1-A) has been described previously (Goodier et al., 2001). It contains a full-length mouse A LINE-1 element (L1Md-A101,

accession number #AY053455) tagged with the mneoI indicator cassette (Freeman et al., 1994). It is cloned in vector pCEP4 (Life

Technologies).

**pCMV-MusD-6neo^TNF

(Mouse MusD) has been described previously (Ribet et al., 2004). It contains a nearly full-length copy of a mouse MusD element (lacks

the U3 sequence from the 5⁰LTR, accession number #AC124426, positions 9078–16,569 (+)) tagged with the neo^TNFindicator

cassette (Esnault et al., 2002) and is cloned in vector pCMVbeta (Clontech).

**pIAP-92L23neo^TNF

(Mouse IAP) has been described previously (Dewannieux et al., 2004). It contains a full-length copy of a mouse IAP element (acces-

sion number # AC012382, positions 161,601–168,684, (+)) tagged with the neo^TNFindicator cassette (Esnault et al., 2002) at IAP

nucleotide position 5744, and is cloned in vector pGL3basic (Promega).

**pU6ineo

**pU6ineo has been described previously (Richardson et al., 2014). It contains the neomycin phosphotransferase (NEO)

expression cassette from pEGFP-N1 (Clontech) cloned into a modiﬁed pBSKS-II(+) (Stratagene) that contains a U6 promoter in

the multi-cloning site.

**JJ101/L1.3

(Human L1.3) has been described previously (Kopera et al., 2011). It contains a full-length copy of the human L1.3 element (L1.3,

accession number #L19088) tagged with the mblastI indicator cassette (Goodier et al., 2007; Morrish et al., 2002) and is cloned in

pCEP4 (Life Technologies).

**JJL1SM

(Mouse L1-T_F) has been described previously (MacLennan et al., 2017). It contains a full-length mouse T_FLINE-1 element (L1Md-

L1_Orl, (Takahara et al., 1996)) where the coding sequence of the LINE-1 ORFs (L1-ORF1 and L1-ORF2) has been codon optimized,

and is tagged with the mblastI indicator cassette (Goodier et al., 2007; Morrish et al., 2002). It is cloned in vector pCEP4 (Life

Technologies).

**pXY014

(Human L1_RP) has been described previously (Xie et al., 2011). It contains a full-length copy of the human L1_RPelement (accession

number #AF148856.1, (Kimberland et al., 1999)) tagged with the mﬂucI indicator cassette (Xie et al., 2011) and is cloned in a modiﬁed

pCEP4 (Life Technologies) that contains a Renilla ﬁreﬂy expression cassette.

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e12

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

**pXY015

**pXY015 has been described previously (Xie et al., 2011). It is derived from plasmid pXY014 but the cloned L1_RPelement contains

two missense mutations in the RNA binding domain of L1-ORF1p (RR261/62AA). This plasmid was used as a negative control of the

luciferase-based retrotransposition assays.

Retrotransposition Assays

All retrotransposition and clonability assays conducted in this study were conducted at least in duplicate and several independent

times (>3). Clonability and retrotransposition assays using mneoI or neo^TNFtagged retrotransposons on HeLa cells were carried out

as previously described (Benitez-Guijarro et al., 2018; Heras et al., 2013; Wei et al., 2000). HeLa cells were plated in 6-well plates

(Corning) at the indicated number (2x10⁴cells for plasmids JM101/L1.3, pCEP-TG_F21, pCEP-A101, and pCMV-MusD-6neo^TNF

;

1x10⁴cells for plasmids pCEPL1SM, pIAP-92L23neo^TNF, and pU6ineo). Eighteen hours after plating, DNA transfections were carried

out using FuGene 6 transfection reagent (Promega) and Opti-MEM (Life Technologies) following the protocol provided by the manu-

facturer (for a well of a 6-well plate: 3 mL of FuGene, 97 mL of Opti-MEM and 1 mg of plasmid DNA). The day after transfection, media

was replaced with fresh media containing the indicated amount of each RTi (0, 5, and 25 mM unless otherwise indicated). Neomycin

selection was started 72 h post-transfection using 400 mg/mL G418 (Life Technologies) and the indicated amount of each RTi.

Selection media containing the indicated RTi was replaced every other day and selection was continued for 11 additional days.

HeLa cells were then washed with 1x PBS (Gibco), ﬁxed with 2% paraformaldehyde/0.4% glutaraldehyde, and stained with 0.1%

(w/v) crystal violet solution as described (Moran et al., 1996; Wei et al., 2000), to visualize and count foci representing successful

retrotransposition events.

Retrotransposition assays using mblastI tagged LINE-1 vectors (JJ101/L1.3 and JJL1SM) on HeLa cells were carried out as

previously described (Benitez-Guijarro et al., 2018; Heras et al., 2013; Morrish et al., 2007). 2x10⁴(JJ101/L1.3) or 1x10⁴(JJL1SM)

HeLa cells were plated per well of a 6-well tissue culture plate and transfected 18h later using 1 mg of each plasmid and 3 mL of

FuGene 6 as described above. The day after transfection, media was replaced with fresh media containing the indicated amount

of each RTi (0, 5, and 25 mM unless otherwise indicated), and cells cultured for 5 additional days changing the media every other

day. Blasticidin S selection (5 mg/mL, Life Technologies) in the presence of the indicated RTi was started 120 h post-transfection,

and selection was continued for 9 additional days. HeLa cells were then washed with 1x PBS (Gibco), ﬁxed with 2% paraformalde-

hyde/0.4% glutaraldehyde, and stained with 0.1% (w/v) crystal violet solution as described (Moran et al., 1996; Wei et al., 2000), to

visualize and count foci representing successful retrotransposition events.

Retrotransposition assays using mﬂucI tagged LINE-1 constructs (pX014 and pX015 as a negative control) were carried out in

HEK293T cells as previously described (Benitez-Guijarro et al., 2018). 1x10⁵cells per well were plated on 24-well tissue culture plates

(Corning), and cells transfected 16-18 hours later using Lipofectamine 2000 (Invitrogen) and Opti-MEM (Gibco), and following the

protocol provided by the manufacturer. Prior to transfection, the culture media was replaced with antibiotic-free culture media,

and 200 ng of each LINE-1 construct and 1 mL of Lipofectamine 2000 were used per well (of a 24-well tissue culture plate). 6 h after

transfection, media was replaced with fresh complete media containing the indicated amount of each RTi (0, 2,5, 5, 10, 15, and 20 mM

unless otherwise indicated). Puromycin selection (1 mg/mL, Sigma) was started 24 h post-transfection, using culture media

containing the indicated amount of each RTi. Selection was continued for 3 additional days, and then Fireﬂy and Renilla luciferase

activities were measured using the Dual-Luciferase Reporter Assay System (Promega) following manufacturer’s instructions and

a GloMax-Multi Detection System (Promega). Luciferase values for RTi untreated wells were designated as 1.

MTT Assays

Assays were conducted in triplicate using 1x10³cells/well (HeLa or PA-1 cells) plated on 96-well tissue culture plates (Corning).

16-18 h after plating, culture media was replaced with fresh media containing the indicated amount of each RTi (0, 5, and 25 mM

unless otherwise indicated), and cells cultured for 72 h. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, Life

Technologies) was dissolved in 1x PBS (5 mg/mL), and 10 mL/well were added to 96-well tissue culture plates. Plates were incubated

during 3 hours at 37^ꢁC, media removed, and 100 mL DMSO were then added to each well, followed by an incubation at 37^ꢁC during

15 minutes. After the incubation, the absorbance was measured using a GloMax-Multi Detection System (Promega) with a test

wavelength of 560 nm and a reference wavelength of 750 nm to obtain sample signal (OD₅₇₀-OD₆₃₀). Blank wells for background

containing only media were included as controls, as well as blank wells containing each RTi and culture media (to discard the possible

contribution of RTis to absorbance values). Data is represented as the mean values with standard deviation, where untreated cells

were arbitrarily designated as 1 for comparisons.

qPCR and RT-qPCR Control Assays

To determine whether RTi treatments affect the stability of LINE-1 constructs in cultured cells, we transfected a human L1 overex-

pression plasmid (JM101/L1.3) in HeLa cells, and we then quantiﬁed the amount of plasmid DNA after RTi treatment (see Figures

S5K–S5M). 8x10⁴HeLa cells were plated per well of a 6-well tissue culture plate in triplicate; after 16-18 hours, cells were transfected

with 1 mg of plasmid JM101/L1.3 using 3 mL of FuGene 6 (see above). After 24 h, cells were feed with fresh media containing 25 mM of

the indicated RTi (GBS-149, Emtricitabine, Lamivudine, Tenofovir, C5, and AZT) or vehicle, and cells cultured for 48h. After 48h,

genomic DNA from transfected cells was extracted using phenol:chloroform:isoamyl alcohol (25:24:1) as described (Benitez-Guijarro

et al., 2018). Next, 50 ng of each extracted DNA were used in qPCR reactions, using a StepOnePlus Real-Time PCR System

e13 Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019

Please cite this article in press as: Banuelos-Sanchez et al., Synthesis and Characterization of Speciﬁc Reverse Transcriptase Inhibitors for Mammalian

LINE-1 Retrotransposons, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.010

(Applied Biosystems), GoTaq qPCR Master Mix Kit (Promega) and the following program: 1x (95^ꢁC, 10 min); 40x (95^ꢁC, 15 s; 60^ꢁC,

60 s). To quantify the relative amount of L1 plasmids after RTi treatments, we ampliﬁed the unique EBNA-1 region included in

plasmid JM101/L1.3 (Figure S5K) and a portion of the human GAPDH gene to normalize for copy number differences, and using

pair of primers whose ampliﬁcation efﬁciencies do not differ more than 5%. To do that, we ﬁrst generated a standard curve by serially

diluting genomic DNA or plasmid JM101/L1.3, starting with 1 mg and making ﬁve ﬁve-fold dilutions. We then quantiﬁed copy numbers

from three technical replicates of each reaction using the StepOnePlus Software v2.3. We used the EBNA-1/GAPDH ratio to calculate

differences in copy number. Untransfected controls were used to discard plasmid DNA contaminations.

Similarly, and to analyse if RTi treatments affect the expression of L1 RNAs from transfected plasmids, we transfected a human L1

overexpression plasmid (JM101/L1.3) in HeLa cells, and we then quantiﬁed the amount of expressed L1 RNAs after RTi treatment

(see Figures S5K–S5N). To quantify expressed L1 RNAs, we used: i) a NEO primer pair designed to only amplify spliced mneoI-

tagged L1 transcripts; ii) a EBNA-1 primer pair designed to detect expressed EBNA-1 RNAs from transfected plasmids; and iii)

GAPDH to normalize for expression differences (Figure S5L). Brieﬂy, HeLa cells were plated, transfected and treated with RTis as

described above, and total RNA was isolated using TRIzol (Invitrogen). Next, 1 mg of total RNA from each treatment condition

(GBS-149, Emtricitabine, Lamivudine, Tenofovir, C5, AZT, or vehicle) was treated twice with 10 units of RNase-free DNaseI (Invitro-

gen), to completely remove the transfected plasmid DNA from extracted RNAs. cDNAs were then synthesized using a High-Capacity

cDNA Reverse Transcription kit (Applied Biosystems) following the instructions provided by the manufacturer. Diluted cDNAs

(1/5 and 1/10, and in triplicate) were then analyzed using a StepOne Real-Time PCR System (Applied Biosystems), GoTaq qPCR

MasterMix (Promega) and 0.15 mM of each primer (Sigma). We included an internal control (no RT added) in all subsequent qPCR

reactions. The qPCR cycling conditions were: 1x (95^ꢁC, 10 min); 40x (95^ꢁC, 15 s; 60^ꢁC, 60 s); a melting curve was recorded to conﬁrm

the identity of ampliﬁed products. To calculate differences in L1 RNA expression from transfected plasmids after RTi treatments, we

used the NEO/EBNA-1 ratio and the comparative C_T(DDC_T) method (Livak and Schmittgen, 2001).

Western Blot Analyses

PA-1 cells were plated (2x10⁵cells/well of a 6-well tissue culture plate) and treated with 25 mM of the indicated RTi during 96 h. After

the treatment, cells were harvested using a cell scrapper and duplicate Whole Cell Extracts (WCE) prepared using RIPA buffer

(Sigma) supplemented with 1x Complete Mini EDTA-free Protease Inhibitor cocktail (Roche), 0.1% Phosphatase Inhibitor 1&2

(Sigma), 1 mM (PMSF) (Sigma) and 0.25% b-mercaptoethanol (Sigma), by incubating cells during 10 min on ice. Cellular debris

was removed by centrifugation (1,000 g for 5 min at 4^ꢁC) and total protein concentration was determined using the Micro BCA Protein

Assay Kit (Thermo) following standard procedures. Equal amounts of protein lysates were run on 10% SDS-PAGE gels and

transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked in 5% milk/1x TBST (TBS + 0.2% Tween-20 (v/v))

and incubated with primary antibodies diluted in 5% milk/1xTBST overnight at 4^ꢁC. Membranes were then washed 3 times with

1xTBST, incubated with secondary antibodies for 1 h at RT, washed again and developed. A chemiluminescent detection system

(Clarity Western ECL Substrate, Bio-Rad; ImageQuant LAS 4000, GE Healthcare) was used, following manufacturer’s recommenda-

tions. The following antibodies were used for immunoblotting (at indicated dilutions): mouse anti-L1Hs-ORF1p (1:1000, Merck

Millipore); mouse anti-p53 (1:300; Santa Cruz Biotechnology); mouse anti–b-actin (1:20,000; Sigma); horse anti-mouse HRP-linked

secondary antibody (1:20,000, Cell Signaling Technology).

QUANTIFICATION AND STATISTICAL ANALYSIS

We used GraphPad Prism (version 6; GraphPad Software, Inc.) for statistical analyses. Data from multiple independent experiments

is reported as retrotransposition mean SD, and we arbitrarily designed untreated cells as 100% Retrotransposition. Student t-test

was used to calculate statistical signiﬁcance and * indicates p< 0.05; **, p< 0.01, ***, p< 0.001, and ****, p< 0.0001.

Cell Chemical Biology 26, 1–15.e1–e14, August 15, 2019 e14

Article Doi

Synthesis and Characterization of Specific Reverse Transcriptase Inhibitors for Mammalian LINE-1 Retrotransposons

DOI: 10.1016/j.chembiol.2019.04.010

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2019.04.010

Full text of DOI:10.1016/j.chembiol.2019.04.010

Products guided by the article

R&D Labs maybe for 69350-88-5

Relevant to this article

Hot Product