Conjugation of haloalkanes by bacterial and mammalian glutathione transferases: Mono- and vicinal dihaloethanes

Article abstract of DOI:10.1021/tx0100183

Glutathione (GSH) transferases are generally involved in the detoxication of xenobiotic chemicals. However, conjugation can also activate compounds and result in DNA modification. Activation of 1,2-dihaloethanes (BrCH₂CH₂Br, BrCH₂CH₂Cl, and ClCH₂CH₂Cl) was investigated using two mammalian theta class GSH transferases (rat GST 5-5 and human GST T1) and a bacterial dichloromethane dehalogenase (DM11). Although the literature suggests that the bacterial dehalogenase does not catalyze reactions with CH₃Cl, ClCH₂CH₂Cl, or CH₃CHCl₂, we found a higher enzyme efficiency for DM11 than for the mammalian GSH transferases in conjugating CH₃Cl, CH₃CH₂Cl, and CH₃CH₂Br. Enzymatic rates of activation of 1,2-dihaloethanes were determined in vitro by measuring S,S-ethylene-bis-GSH, the major product trapped by nonenzymatic reaction with the substrate GSH. Salmonella typhimurium TA 1535 systems expressing each of these GSH transferases were used to determine mutagenicity. Rates of formation of S,S-ethylene-bis-GSH by the GSH transferases correlated with the mutagenicity determined in the reversion assays for the three 1,2-dihaloethanes, consistent with the view that half-mustards are the mutagenic products of the GSH transferase reactions. Half-mustards [S-(2-haloethyl)GSH] containing either F, Cl, or Br (as the leaving group) were tested for their abilities to induce revertants in S. typhimurium, and rates of hydrolysis were also determined. GSH transferases do not appear to be involved in the breakdown of the half-mustard intermediates. A halide order (Br > Cl) was observed for both GSH transferase-catalyzed mutagenicity and S,S-ethylene-bis-GSH formation from 1,2-dihaloethanes, with the single exception (both assays) of BrCH₂CH₂Cl reaction with DM11, which was unexpectedly high. The lack of substrate saturation seen for conjugation of dihalomethanes with GSTs 5-5 and T1 was also observed with the mono- and 1,2-dihaloethanes [Wheeler, J. B., Stourman, N. V., Thier, R., Dommermuth, A., Vuilleumier, S., Rose, J. A., Armstrong, R. N., and Guengerich, F. P. (2001) Chem. Res. Toxicol. 14, 1118-1127], indicative of an inherent difference in the catalytic mechanisms of the bacterial and mammalian GSH transferases.

Full text of DOI:10.1021/tx0100183

Chem. Res. Toxicol. 2001, 14, 1107-1117
1107
Con ju ga tion of Ha loa lk a n es by Ba cter ia l a n d
Ma m m a lia n Glu ta th ion e Tr a n sfer a ses: Mon o- a n d
Vicin a l Dih a loeth a n es
J ames B. Wheeler, Nina V. Stourman,† Richard N. Armstrong,† and
F. Peter Guengerich*,†
Department of Biochemistry and Center in Molecular Toxicology,
Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0146
Received J anuary 26, 2001
Glutathione (GSH) transferases are generally involved in the detoxication of xenobiotic
chemicals. However, conjugation can also activate compounds and result in DNA modification.
Activation of 1,2-dihaloethanes (BrCH2CH2Br, BrCH2CH2Cl, and ClCH2CH2Cl) was investi-
gated using two mammalian theta class GSH transferases (rat GST 5-5 and human GST T1)
and a bacterial dichloromethane dehalogenase (DM11). Although the literature suggests that
the bacterial dehalogenase does not catalyze reactions with CH3Cl, ClCH2CH2Cl, or CH3CHCl2,
we found a higher enzyme efficiency for DM11 than for the mammalian GSH transferases in
conjugating CH3Cl, CH3CH2Cl, and CH3CH2Br. Enzymatic rates of activation of 1,2-dihalo-
ethanes were determined in vitro by measuring S,S-ethylene-bis-GSH, the major product
trapped by nonenzymatic reaction with the substrate GSH. Salmonella typhimurium TA 1535
systems expressing each of these GSH transferases were used to determine mutagenicity. Rates
of formation of S,S-ethylene-bis-GSH by the GSH transferases correlated with the mutagenicity
determined in the reversion assays for the three 1,2-dihaloethanes, consistent with the view
that half-mustards are the mutagenic products of the GSH transferase reactions. Half-mustards
[S-(2-haloethyl)GSH] containing either F, Cl, or Br (as the leaving group) were tested for their
abilities to induce revertants in S. typhimurium, and rates of hydrolysis were also determined.
GSH transferases do not appear to be involved in the breakdown of the half-mustard
intermediates. A halide order (Br > Cl) was observed for both GSH transferase-catalyzed
mutagenicity and S,S-ethylene-bis-GSH formation from 1,2-dihaloethanes, with the single
exception (both assays) of BrCH2CH2Cl reaction with DM11, which was unexpectedly high.
The lack of substrate saturation seen for conjugation of dihalomethanes with GSTs 5-5 and
T1 was also observed with the mono- and 1,2-dihaloethanes [Wheeler, J . B., Stourman, N. V.,
Thier, R., Dommermuth, A., Vuilleumier, S., Rose, J . A., Armstrong, R. N., and Guengerich,
F. P. (2001) Chem. Res. Toxicol. 14, 1118-1127], indicative of an inherent difference in the
catalytic mechanisms of the bacterial and mammalian GSH transferases.
concentrations (2, 3). The metabolism of 1,2-dihalo-
ethanes involves two major routes. Hydroxylation by
P450 enzymes yields a gem-halohydrin that dehydroha-
logenates to form a 2-haloacetaldelhyde. van Bladeren
and Breimer showed that ∼80% of the metabolism of
BrCH2CH2Br occurred via this route in rats (15). The
other route involves conjugation by GSH transferases
(GSTs)1 (Scheme 1). The initial conjugation product is a
half-mustard, which undergoes nonenzymatic dehaloge-
nation to yield an episulfonium ion (16, 17). The episul-
fonium ion reacts rapidly with H2O or other nucleophiles.
In tr od u ction
1,2-Dihaloethanes (vicinal dihalides) have been the
subject of considerable interest because of their high
volume use and potential toxicity. BrCH2CH2Br was
formerly used as a fumigant and an antiknock agent in
leaded gasoline. Deaths have occurred in humans ex-
posed to very high concentrations (1-4). The compound
produces tumors at a variety of sites in rats (5-7), and
primarily because of this issue, the industrial and
agricultural use of BrCH2CH2Br was curtailed (8). ClCH2-
CH2Cl is considerably less toxic than BrCH2CH2Br; this
compound is used in very high volume [∼8 × 109 kg/year
in U.S. (9)] as a precursor of vinyl chloride. Other vicinal
dihalides of interest include 1,2,3-trichloropropane (10,
11) and 1,2-dibromo-3-chloropropane (12-14), which
have issues of reproductive toxicity.
Both metabolic pathways yield electrophilic species.
Rannug (18, 19) first demonstrated the importance of the
GSH-dependent pathway in the activation of 1,2-diha-
loethanes to genotoxic products. The half-mustards (20)
and 2-haloacetaldehydes (21, 22) are capable of reacting
Metabolism of 1,2-dihaloethanes is generally agreed to
be critical for their toxicity, except possibly at very high
1
Abbreviations: GST, GSH transferase (designating a specific
enzyme); GST T1h, human GST T1 with C-terminal pentahistidine
tag; IPTG, isopropyl â-D-thiogalactoside; HEPES, N-(2-hydroxyethyl)-
piperazine-N′-(2-ethanesulfonic acid); DTT, dithiothreitol; PCR, poly-
merase chain reaction; TTBS, 20 mM Tris-HCl buffer (pH 7.6)
containing 0.05% Tween 20 (v/v) and 0.5 M NaCl.
* To whom correspondence should be addressed. Phone: (615)
322-2261. Fax: (615) 322-3141. E-mail: guengerich@toxicology.mc.
vanderbilt.edu.
† Vanderbilt University School of Medicine.
10.1021/tx0100183 CCC: $20.00 © 2001 American Chemical Society
Published on Web 07/18/2001

1108 Chem. Res. Toxicol., Vol. 14, No. 8, 2001
Wheeler et al.
other reagent-grade chemicals were purchased from Aldrich
Chemical Co. (Milwaukee, WI). Agar, nutrient broth, and other
Ames test reagents were obtained from VWR (South Plainfield,
NJ ). AccQFluor reagents were purchased from Waters (Milford,
MA) and used according to the manufacturer’s directions. DEAE
Fast-Flow Sepharose and hydroxylapatite were purchased from
Amersham/Pharmacia (Piscataway, NJ ) and Bio-Rad (Hercules,
CA), respectively. Ni2+-nitrilotriacetic acid agarose was obtained
from Qiagen (Valencia, CA). Chemiluminescent substrates were
obtained from Amersham/Pharmacia (Piscataway, NJ ).
Pfu polymerase and other reagents used for cloning and DNA
manipulation were purchased from Promega (Madison, WI).
Rabbit anti-rat GST 5-5 was a gift from Thomas Schultz
(Go¨ttingen, Germany). Horseradish peroxidase-conjugated goat
anti-rabbit secondary antibody was purchased from ICN (Irvine,
CA).
with DNA to generate miscoding adducts. However, the
rates of reaction of the haloacetaldehydes with DNA are
rather slow (23, 24). In addition, both dehydrogenases
and GSH transferases are capable of inactivating the
haolacetealdehyde intermediate (24). In previous work,
we have studied the DNA adducts derived from the
episulfonium ion pathway (16, 20, 25-37). S-[2-(N7-
Guanyl)ethyl]GSH is the major adduct (20, 26, 27) but
the N2- and O6-guanyl adducts (35-37) may also con-
tribute to explain the predominance of GC:AT transitions
in several organisms (35, 38-40). An unexpected and yet
unexplained observation is the increased bacterial mu-
tagenicity seen with expression of O6-alkyguanine trans-
ferase (41-43), which does not appear to be related to
the GSH conjugates.2
Syn t h esis of S-Ha loet h ylGSH Com p ou n d s. The halide
half-mustards (GSCH2CH2X) were prepared by reaction of
trisodium GSH with the appropriate haloethyl bromide in dry
CH3OH and the amounts of product were estimated using a 4-(4-
nitrobenzyl)-pyridine assay, with ꢀ560 ) 5700 mM-1 cm-1 (16,
31, 61).
Several mammalian GSH transferases can catalyze the
conjugation of GSH with haloalkanes (30, 44, 45); theta-
class GSH transferases are most active (45). Human GST
T1 is polymorphic in humans and, depending on race,
the lack of the GST T1 gene can vary from 20 to 80%.
Caucasians show ∼20% null phenotype (homozygotes)
whereas Asians are reportedly ∼80% null phenotype.
Individuals have either the null allele (nonconjugators),
one allele (conjugators), or both alleles (high conjugators)
based on their ability to conjugate CH3Cl (46-50).
Epidemiological studies have suggested an association
of the presence or absence of GST T1 with incidence of
certain forms of cancer, e.g., oral (51, 52), bladder (48,
53), and brain (54-56), although the involvement of
individual chemicals in the etiology is unknown.
The involvement of specific mammalian GSH trans-
ferases in the metabolism and activation of dihaloalkanes
is not fully understood. Interestingly, there exist bacterial
enzymes that efficiently metabolize haloalkanes. For
example, some bacteria (e.g., Methylophilus sp.) can use
CH2Cl2 as a carbon source because of the presence of a
specific GSH transferase. One of these GSH transferases
(DM11) exhibits 26% sequence identity with mammalian
theta class GSH transferases, including active site resi-
dues involved in the activation of GSH. For example, the
amino acid Ser12 of DM11 aligns with Ser10 of rat GST
5-5 suggesting a common function in both enzymes (57).
The side-chain hydroxyl group of Ser12 is believed to be
involved in the catalytic mechanism, as demonstrated by
site-directed mutagenesis (58).
A number of issues still exist regarding the activation
of 1,2-dihaloethanes via the GSH-dependent pathway.
The ability of the bacterial enzyme (DM11) isolated from
Methylophilus sp strain DM11 (59) to conjugate 1,2-
dihaloethanes was investigated along with the mam-
malian class theta enzymes in order to better understand
the mechanisms of mammalian activation of diahloal-
kanes to mutagenic species. Another issue of interest is
the halide reaction order in both the conjugation and the
mutagenicity of the 1,2-dihaloethanes. The studies with
different 1,2-dihaloethanes and GSH transferases are
considered in their relevance to other haloalkanes,
particularly mono- and dihalomethanes; also, see the
following paper in this issue (60).
S-(2-Acetoxyethyl)GSH was prepared by displacement of Br
from 2-bromoethyl acetate (Aldrich) by sodium GSH thiolate in
CH3OH using the general procedure described previously (31).
When the compound was subjected to electrospray MS (direct
infusion, capillary temperature 180-200 °C), the MH+ of S-(2-
hydroxyethyl)GSH was observed at m/z 394 (plus adducts with
1, 2, and 3 Na+). The compound formed a typical purple adduct
with 4-(4-nitrobenzyl)pyridine when heated and treated with
1
(C2H5)3N (16, 31). H NMR (D2O) indicated a singlet at δ 2.02,
assigned to the acetyl CH3 group and distinct from the δ 2.10
signal observed for CH3CO2H added to the sample. Other peaks
were those expected for GSH adducts (26).
GSH Tr a n sfer a se Exp r ession Con str u cts. (1) GST 5-5.
The GST 5-5 cDNA (44, 62) was expressed using the vector
pKK233-2 as described previously (44).
(2) Human GST T1 with C-Terminal Pentahistidine Tag (GST
T1h). Modification of human GST T1 cDNA (63) to add a
C-terminal (His)5 tag was done by polymerase chain reaction
(PCR) methods using one oligonucleotide primer (CAATTTCA-
CACAGGAAACAG) within pKK233-2, upstream of the 5′
end of the GST T1 start sequence, and a reverse primer
(GCGAAGCTTTATTAATGGTGATGGTGATGCCGGATCAT-
GGCTAGCACCCAG) containing a portion of the 3′ end of the
GST T1 cDNA and additional sequence encoding for the (His)5
region, a stop codon, and a HindIII restriction site. The PCR
product was digested with the restriction enzymes NcoI and
HindIII, purified, and subcloned into pET24d, obtained from
Novagen (Madison, WI) (which had also been digested with NcoI
and HindIII and purified). The plasmid was used to transform
Escherichia coli HMS174 DE3. The presence of the GST T1h
insert was confirmed by restriction digest mapping and nucle-
otide sequence analysis.
(3) DM11. Methylophilus sp. strain DM11 was obtained from
S. Vuilleumier (ETH-Zentrum, Zu¨rich) (57).
DM11 Exp r ession in S. typh im u r iu m . DM11 was sub-
cloned from pE 1962 into pTrc99A (Pharmacia, Piscataway, NJ ).
The original ATG start codon was located within an NdeI
restriction site, which was mutated by PCR methodology to an
NcoI site for introduction into pTrc99A. As a result of this
mutation, the amino acid sequence was changed from Met-Ser-
Thr to Met-Gly-Thr. PCR of the DM11 gene was done using one
primer (ATAACCATGGGTACTAAACTACGATATCTAC) con-
taining the NcoI restriction site and a reverse primer (AC-
GAAGCTTATCCGTGTTGAGTAACGAATG) that contained a
HindIII restriction site. The PCR product was digested with the
restriction enzymes NcoI and HindIII, purified, and subcloned
into pTrc99A which had also been digested with NcoI and
HindIII and purified. The plasmid was transformed into Sal-
monella typhimurium TA1535, and the presence of the DM11
gene was confirmed by restriction digest mapping and nucleotide
Exp er im en ta l P r oced u r es
Rea gen ts a n d Ch em ica ls. 2,4-Dinitro-1-fluorobenzene, di-
haloethanes, CH3CH2Br, and CH3CH2Cl (both gases), and all
2
Liu, L., Pegg, A. E., and Guengerich, F. P., unpublished results.

GSH Transferase Conjugation of Haloethanes
Chem. Res. Toxicol., Vol. 14, No. 8, 2001 1109
sequence analysis (done in the Vanderbilt Cancer Center facility,
USPHS P30 CA68485).
The protein concentration was determined using ꢀ280 ) 40 300
M-1 cm-1 based on the algorithm amino acid sequence biopoly-
mer calculator (http://paris.chem.yale.edu/).
P r otein Exp r ession a n d P u r ifica tion . (1) Rat GST 5-5.
Rat GST 5-5 was expressed in E. coli DH5R F′IQ (Gibco-BRL).
The cells were transformed with the plasmid pKK233-2 contain-
ing the GST 5-5 cDNA (44). The cells were grown to an OD600
of 0.4-0.6 and induced with 0.1 mM isopropyl â-D-thiogalacto-
side (IPTG). The culture was incubated for 18 h at 28 °C and
the cells were centrifuged at 3000g for 15 min. Bacteria were
resuspended in lysis buffer (75 mM Tris-HCl, pH 8.0, containing
0.25 M sucrose, 0.25 mM EDTA, and 20 µg of lysozyme /mL)
for 30 min at 4 °C. Lysed cells were centrifuged at 14000g for
15 min at 4 °C and the pellet was resuspended in sonication
buffer (20 mM sodium phosphate, pH 7.5, containing 25 µM
phenylmethanesulfonyl fluoride, 1 µg of leupeptin/mL, 20%
glycerol (v/v), and 2 mM 2-mercaptoethanol). Sonication was
performed for 4 × 15 s intervals, with 30 s intermittent periods.
The material was centrifuged at 105 × g for 45 min and the
supernatant was collected for purification.
Cytosol (50 mL) was loaded onto an 80 mL DEAE Sepharose
column equilibrated with 30 mM Tris-HCl buffer (pH 8.5)
containing 10% glycerol (v/v) and 2 mM 2-mercaptoethanol
(buffer A), at a flow rate of 4 mL/min. GST 5-5 was eluted from
the column with a 100 mM NaCl stepwise gradient in buffer A
(100 mL). Fractions containing the highest GSH transferase
activity based on the 1,2-epoxy-3-(p-nitropheoxy)propane con-
jugation assay (44) were pooled and concentrated to a total
volume of ∼2 mL using a PM10 Amicon filter (Mr 104 cutoff)
(Millipore-Amicon, Lexington, MA).
The pooled and concentrated DEAE eluant was diluted with
10 mM potassium phosphate (pH 7.5) containing 10% glycerol
(v/v) and 2 mM 2-mercaptoethanol (buffer B) and loaded onto a
5 mL hydroxyapatite column equilibrated with buffer B at a
flow rate of 1 mL/min. The column was washed with 5 column
volumes of buffer B (at pH 6.9) and the GSH S-transferase was
eluted with 20 mL of 80 mM potassium phosphate buffer (pH
6.9) containing 10% glycerol (v/v) and 2 mM 2-mercaptoethanol.
The fractions containing the greatest GSH S-transferase activity
were pooled and immediately dialyzed twice against 2 L of 30
mM potassium phosphate buffer (pH 8.0) containing 10%
glycerol (v/v) and 2 mM 2-mercaptoethanol for 2 h each time.
The purified GST 5-5 was frozen in aliquots and stored at -20
°C.
GST 5-5 enzyme concentrations were determined by quan-
titative amino acid analysis in the Vanderbilt facility. Highly
purified protein was subjected to sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (64) and the proteins were
transferred to polyvinylidiene fluoride membranes. The mem-
brane was stained with Coomassie brilliant blue R-250 and the
appropriate band corresponding to GST 5-5 was cut from the
membrane for amino acid analysis. Transfer efficiency was
estimated from a standard sample of bovine serum albumin
carried through the same procedure simultaneously.
(3) DM11. E. coli BL21(DE3)pLysS cells were transformed
with the expression plasmid pE 1962 (or dcmA). Transformed
cells were grown in Luria-Bertani media containing ampicillin
(100 mg/L) and chloramphenicol (30 mg/L) at 26 °C to an OD600
of 1.0. Protein expression was induced with 0.3 mM IPTG. The
culture was incubated for 16 h at 26 °C. Cells were harvested
by centrifugation at 6000g for 15 min, resuspended in ice-cold
100 mM potassium N-(2-hydroxyethyl)piperazine-N′-(2-ethane-
sulfonic acid) (HEPES) buffer (pH 7.0) containing 20% glycerol
(v/v), 1 mM EDTA, and 4 mM dithiothreitol (DTT) and disrupted
by sonication (4 × with 3 min intervals). Cell debris was
removed by centrifugation at 37000g for 40 min. (NH4)2SO4 was
added to the supernatant to 50% saturation and the suspension
was centrifuged at 49000g for 50 min; the pellet was discarded.
(NH4)2SO4 was added to the supernatant to 75% saturation. The
pellet recovered following centrifugation at 49000g for 75 min
was dissolved and dialyzed twice against 4 L of 20 mM HEPES
buffer (pH 7.0) containing 10% glycerol (v/v), 1 mM EDTA, and
4 mM DTT for 16 h each time.
The dialyzed protein was loaded on to a DEAE-cellulose
column (3 × 15 cm) equilibrated with 20 mM HEPES buffer
(pH 7.0) containing 10% glycerol (v/v), 1 mM EDTA, and 4 mM
DTT. DM11 was eluted with a linear gradient of 0 to 400 mM
NaCl in 20 mM HEPES buffer (pH 7.0) containing 10% glycerol,
1 mM EDTA, and 4 mM DTT. Fractions containing CH2Cl2
dehalogenase activity (i.e., formation of HCHO, Nash assay) (65,
66) were combined, dialyzed against 20 mM potassium phos-
phate buffer (pH 7.0) containing 10% glycerol (v/v), 1 mM EDTA,
and 4 mM DTT, concentrated, flash frozen, and stored at -80
°C.
GSCH2CH3 F or m a tion Assa ys (Sch em e 1). A typical 100
µL reaction included 100 mM sodium borate (pH 8.0), 5 mM
GSH, 0.5-5 µM enzyme, and 0-20 mM haloethane. Reactions
were started by adding the haloethane (preincubated at 37 °C)
to a mixed (37 °C preincubated) solution of enzyme, GSH, and
buffer. Reactions were stopped after 2 or 5 min with the addition
of 10 µL of 1 N HCl. After g5 min, each reaction was neutralized
with 10 µL of 1 N NaOH. Iodoacetate (7.5 µL of a 160 mM
solution) and a Val internal standard (15 µL of a 2 mM solution)
were added to a final volume of 0.15 mL, and the reactions were
incubated at room temperature for 1 h. A 10 µL aliquot of the
reaction was added to 80 µL of AccQFluor reagent buffer.
Derivatization of S-carboxymethylGSH, GSCH2CH3, and Val
was done by adding 10 µL of AccQFluor reagent. Samples were
analyzed in 1.5 mL autosampler vials containing volume-
reducing inserts; the amount of sample injected onto the HPLC
column was 10 µL. HPLC analysis was carried out using an
octadecylsilane (C18) column (YMC-ODS AQ, YMC, Wilmington,
NC). Elution was done using the following schedule (solvent A,
0.15 M NH4CH3CO2, pH 5.05; solvent B, 100% CH3CN): 0 to
15 min 15-35% gradient solvent B (v/v), 16-20 min, 90%
solvent B (v/v), 21-24 min, 15% solvent B (v/v). A standard
curve consisting of varying concentrations of GSCH2CH3 and
the derivatized Val internal standard was used to determine
the concentration in the enzyme reactions. Injections were made
by a Hitachi 7250 autosampler and products were detected using
a McPherson FL-750 HPLC fluorimeter (λexcitation 250 nm, λemission
389 nm cutoff filter). Quantitation and analysis were done using
Hitachi model D7000 Chromatography Data Station Software
(Hitachi, San J ose, CA).
(2) Human GST T1h. Human GST T1h was expressed in E.
coli HMS174 (DE3) cells. The cells were transformed with the
expression plasmid pET24d (Novagen) containing the GST T1h
cDNA. The expression conditions were the same as those
described for GST 5-5. All purification steps were done at 4 °C.
Cytosol (40 mL, prepared as with GST 5-5) was loaded onto
a 3 mL Ni2+-nitrilotriacetic acid column equilibrated with 20
mM sodium phosphate (pH 8.0) containing, 2 mM 2-mercapto-
ethanol, 20% glycerol (v/v), and 5 mM imidazole (buffer C) at a
flow rate of 2 mL/min. The column was washed with buffer C
containing 50 mM imidazole and adjusted to pH 7.0 until a
steady baseline at 280 nm was achieved. GST T1h was eluted
with buffer C containing 200 mM imidazole (pH 7.0). Fractions
were assayed using the 1,2-epoxy-3-(p-nitrophenoxy)propane
assay and those fractions containing the greatest activity were
pooled and dialyzed twice against 2 L of 30 mM potassium
phosphate buffer (pH 8.0) containing 10% glycerol (v/v) and 2
mM 2-mercaptoethanol for 2 h each time. The purified and
dialyzed material was frozen and stored in aliquots at -20 °C.
Hyd r olysis of Ha lf-Mu sta r d s. The experiments were per-
formed as described in Peterson et al. (16). 4-(4-Nitrobenzyl)-
pyridine was used to quantify the half-mustard remaining at
each time point.
S,S-Eth ylen e-bis-GSH Assa y. Enzymatic reactions were
carried out in amber 1.5 mL autosampler vials containing
volume-reducing inserts. A typical 100 µL reaction included 50
mM potassium phosphate (pH 8.0), 5 mM GSH, 0.5-5 µM
enzyme, and 0-3 mM dihaloethane. Dihaloethanes were added

1110 Chem. Res. Toxicol., Vol. 14, No. 8, 2001
Wheeler et al.
Ta ble 1. En zym e Efficien cies for Con ju ga tion of
to a 40% C2H5OH (v/v) solution to make 50 mM stock concentra-
tions, and C2H5OH was added to the reactions to adjust the final
concentration to 2.5% (v/v) in all cases. Reactions were started
by adding the 1,2-dihaloethane (preincubated at 37 °C) to a
mixed (37 °C-preincubated) solution of enzyme, GSH, and buffer.
Reactions were stopped after 15 min by the addition of 10 µL of
0.5 N HCl. After at least 5 min, each reaction was neutralized
with 10 µL of 0.5 N NaOH. Iodoacetate (10 mM, buffered with
50 mM NaHCO3) was added and the vials were incubated at
room temperature for 1 h. Derivatization of S-carboxymeth-
ylGSH, oxidized GSH, and S,S′-ethylene-bis-GSH was per-
formed by the addition of 66 µL of 39 mM 2,4-dinitro-1-
fluorobenzene in C2H5OH. The amount of sample used for each
analysis was 10 µL.
Mon oh a loeth a n es by GST 5-5 a n d GST T1h
catalytic efficiency
a
k
cat/Km (mM-1 min-1
)
ratio of efficiency
GST 5-5:GST T1h
substrate
GST 5-5
GST T1h
CH3CH2Br
CH3CH2Cl
190 ( 10
7.7 ( 0.2
31 ( 2
1.35 ( 0.02
6.2
5.7
a
(() SE from linear regression.
using a chemiluminescence method (Amersham/Pharmacia kit
no. RPN2209) and imaged using a Bio-Rad Fluor-S Multiimager;
quantitation was done with MaxS image quantitation software
(Bio-Rad, Hercules, CA).
HPLC analysis was carried out with an octadecylsilane (C18
)
Mu ta gen icity Assa ys. S. typhimurium TA1535 cells were
transformed with either the vector pKK233-2 expressing GST
5-5 or GST T1 (44) or pTrc99A expressing DM11. Control cells
contained either pKK233-2 or pTrc99A for the appropriate
experiment. S. typhimurium cells expressing either GST 5-5 or
GST T1 were grown in nutrient broth overnight at 37 °C prior
to mutagenesis experiments. S. typhimurium expressing DM11
were grown at 37 °C to an OD600 of 0.4 and induced with 0.1
mM IPTG. The cells were then incubated for 5.5 h at 27 °C
before mutagenesis experiments were performed. For experi-
ments in which untransformed S. typhimurium TA1535 were
used, the cells were grown overnight in nutrient broth in the
absence of antibiotics.
column (YMC-ODS AQ, YMC, Wilmington, NC) using the
following gradient with CF3CO2H in H2O (v/v), solvent A, 0.1%
CF3CO2H; solvent B, 100% CH3CN: 0 to 10 min, 40% solvent
B; 11 to 15 min, 90% solvent B; 16 to 22 min, 40% solvent B (all
v/v). An external standard curve prepared using varying con-
centrations of oxidized GSH (GSSG) was used to estimate the
concentration of S,S′-ethylene-bis-GSH. Oxidized GSH and S,S′-
ethylene-bis-GSH eluted at tR 8.5 and 9.9 min, respectively.
Injections were made with a Hitachi 7250 autosampler and
products were detected at 350 nm using a Spectromonitor 3100
UV detector (Milton Roy, Riviera Beach, FL). Quantitation and
analysis were done using Hitachi model D7000 Chromatography
Data Station software (Hitachi, San J ose, CA).
Mutagenesis tests were performed as previously described
(67). S. typhimurium culture (100 µL) was mixed with 100 µL
of the mutagen diluted in 0.2 M sodium phosphate buffer (pH
7.4) for 5 min at 37 °C in sealed 3 mL polypropylene tubes.
Dihaloethanes were dissolved in 40% Me2SO (v/v) at a concen-
tration of 50 mM and subsequently diluted in 0.2 M sodium
phosphate buffer (pH 7.4) for the mutagenesis tests. S-(2-
Haloethyl)GSH compounds and S-(2-acetoxyethyl)GSH were
incubated with the bacteria for 2 min at 22 °C prior to mixing
with top agar.
An tibod y P r od u ction . Rabbits were immunized by multiple
(5-7) dorsal injections (subcutaneously) twice with 0.5 nmol of
purified protein mixed with Titermax (CytRx Corp, Norcross,
GA) at 8 day intervals. A third set of (intramuscular) injections
was carried out 1 month after the second immunization with
0.1 nmol of purified protein in 12 mM phosphate buffer (pH 7.4)
containing 140 mM NaCl and 3 mM KCl. Rabbits were bled one
week after the last injection, and the serum was isolated and
tested by immunoblot analysis (vide infra) for sensitivity and
specificity. All rabbits immunized with DM11 protein produced
a similar antigenic response as judged by immunoblot analysis.
An a lysis. Linear and nonlinear regression analysis were
calculated using Prism 3 (Graphpad Software, San Diego, CA).
One rabbit immunized with GST T1h was injected subcuta-
neously and intramuscularly 3 months after the third injection
of the above schedule with 10 nmol of purified GST T1h mixed
with Titermax Gold (CytRx). The rabbit was bled one week later
and the serum isolated was subsequently used for all quantita-
tive experiments.
Resu lts
Kin etics of GSCH2CH3 F or m a tion . All of the GSH
transferases tested (DM11, rat GST 5-5, and human GST
T1h) accelerated the reaction of GSH with CH3CH2Br at
pH 8.0. A substantial nonenzymatic rate of reaction was
also observed and was subtracted from the rates in the
presence of enzyme. The nonenzymatic contribution in
the reaction with CH3CH2Cl was negligible.
Sensitivity of the antibodies was determined by titrating
purified protein until a signal was no longer detected by
immunoblot analysis. Specificity was determined by immunoblot
analysis, comparing S. typhimurium cell lysates containing
purified protein (GST T1h, DM11, or GST 5-5) against S.
typhimurium cell lysates alone.
Both rat GST 5-5 and human GST T1h showed
nonsaturating first-order kinetics with respect to the
concentration of either haloethane (Figure 1, panels A
and B). The catalytic efficiencies (kcat/Km) of the enzymes
for each of the compounds (based on the slopes of the
linear regression fits for the data) are shown in Table 1.
GST 5-5 was approximately 6-fold more efficient than
GST T1h in conjugating both of the compounds. The ratio
of kcat/Km for conjugation of CH3CH2Br was approximately
25-fold more efficient than for CH3CH2Cl in both enzyme
systems. DM11 exhibited typical Michaelis-Menten
(hyperbolic) kinetics with both compounds (Figure 1C).
Apparent kcat and Km values and catalytic efficiencies are
shown in Table 2. The kcat values for the substrates were
similar and the Km for CH3CH2Br was about 6-fold less
than for CH3CH2Cl.
Qu a n tita tive Im m u n oblot An a lysis of GSH Tr a n sfer a s-
es. Prior to performing genotoxicity tests, 0.6 mL of S. typh-
imurium culture was centrifuged (12000g, 3 min) and the media
was aspirated, frozen, and stored at -20 °C. Frozen cells were
resuspended in 150 µL of sodium dodecyl sulfate electrophoresis
sample buffer (64, 66) and incubated at 95 °C for 20 min.
Aliquots of the whole cell lysates (1-15 µL) were loaded onto a
12% (w/v) polyacrylamide gel for electrophoresis (66). A standard
curve of the appropriate purified enzyme was loaded into
separate lanes of the same gel. Proteins were transferred to
nitrocellulose (66). Nitrocellulose membranes were blocked with
20 mM Tris-HCl buffer (pH 7.6) containing 0.05% Tween 20
(v/v), 0.5 M NaCl (TTBS), and 3% bovine serum albumin (w/v)
for 1 h with shaking. Rabbit sera containing the primary
antibody (anti-DM11, anti-GST 5-5, or anti-GST T1) were
diluted 1:2000 (v/v) in TTBS-3% bovine serum albumin (w/v)
and incubated at 25 °C overnight with shaking. Membranes
were washed 3× with TTBS and incubated with goat anti-rabbit
immunoglobulin G (heavy and light chains, ICN catalog no. 67-
4371) diluted 1:60000 (v/v) in TTBS. The blots were developed
P r od u ct In h ibition . The enzymatic formation of
GSCH2CH3 from CH3CH2Cl was carried out in the
presence of varying concentrations of Cl- ion (0, 5, 10,

GSH Transferase Conjugation of Haloethanes
Chem. Res. Toxicol., Vol. 14, No. 8, 2001 1111
Sch em e 1. P a th w a y for Con ju ga tion of CH3CH2X
w ith GSH
Sch em e 2. P a th w a y for Con ju ga tion of XCH2CH2X
w ith GSH a n d Su bsequ en t Nu cleop h ilic
In ter a ction s
Hyd r olysis of Ha lf-Mu sta r d s. The reaction mecha-
nism for the formation of DNA adducts involves an S-(2-
haloethyl)GSH intermediate as the reaction product that
leads to interactions with DNA (Scheme 2) (16, 35). The
stability of the intermediate half-mustard may be im-
portant in determining the potential to form DNA ad-
ducts, particularly if the half-mustard is generated
outside the cells. To determine the half-life of the S-(2-
haloethyl)GSH compounds, each was dissolved in phos-
phate buffer and the rate of hydrolysis was determined,
using a previously described 4-(4-nitrobenzyl)pyridine
assay (16) (the same buffer was used as described in the
subsequently describe reversion assays). The half-lives
of the S-(2-haloethyl)GSH compounds followed the ex-
pected leaving group order, with the longest half-life for
S-(2-fluoroethyl)GSH and the shortest half-life for S-(2-
bromoethyl)GSH (Figure 2A). The stabilities of these
GSH half-mustards are somewhat greater than for any
of the Cys half-mustard analogues we examined earlier
(16).
In the mechanism proposed in Scheme 2, GSH trans-
ferases only catalyze the formation of the S-(2-haloethyl)-
GSH intermediate and the enzyme does not participate
in the removal of the second halogen. To test this
hypothesis, the rate of hydrolysis of S-(2-chloroethyl)GSH
was examined in the presence and absence of either
DM11 or rat GST 5-5. No significant difference between
the alkylation rates was detected (Figure 2B), indicating
that the GSH transferases are not involved in the
formation of the episulfonium ion (Scheme 2).3
F igu r e 1. Conjugation of CH3CH2Br and CH3CH2Cl as a
function of substrate concentration. Rates of GSCH2CH3 forma-
tion by GST 5-5 (9) and GST T1h (2) were determined for (A)
CH3CH2Br and (B) CH3CH2Cl. (C) Rates of DM11 GSCH2CH3
formation with CH3CH2Br (O) and CH3CH2Cl (b). Reactions
were carried out at 37 °C for 2 and 5 min for CH3CH2Br and
CH3CH2Cl, respectively. The background rate of GSCH2CH3
formation from CH3CH2Br was subtracted from the rates (CH3-
CH2Cl did not produce a measurable blank rate). Each point
represents the mean of results of duplicate reactions.
Acetate is generally a poorer leaving group than any
of the halides, even F, in aliphatic displacement reactions
(69). S-(2-Acetoxyethyl)GSH was prepared from 2-bro-
Ta ble 2. Stea d y-Sta te Ra te Con sta n ts for Con ju ga tion of
Mon oh a loeth a n es by DM11
3
An estimate of the limit of the contribution of GSH transferases
parameters for GSCH2CH3
formationa
to this step can be made by calculating an enzymatic rate constant
when the low limit of a 95% confidence interval (0.00181-0.00257 s-1
)
kcat
Km
(mM)
kcat/Km
of the known rate of GSCH2CH2Cl decomposition is used (in combina-
tion with a diffusion-limited rate for the formation of an ES complex,
E ) GSH transferase, S ) GSCH2CH2Cl, and P ) GSCH2CH2OH).
The mechanism S f P (k1), E + S f ES (k2), ES f P (k3), was set up
in DynaFit (68) with k1 ) 0.001 81 s-1 (Figure 1B), k2 ) 2.7 × 107 M-1
s-1 (104 s-1 at 2.7 mM, irreversible), [E] ) 1 µM, and [S] ) 2700 µM,
fitting k3 in plots of ([S] + [ES]) vs t. The calculated value of k3 was
0.0375 s-1 (2.3 min-1), which can be interpreted as an upper limit of
any contribution of GST 5-5 or DM11 to removal of Cl- from GSCH2-
CH2Cl. DM11 conjugates BrCH2CH2Cl to S,S-ethylene-bis-GSH at a
rate of at least 4.6 min-1, suggesting that DM11 does not catalyze Cl-
release as part of the enzymatic mechanism.
substrate
(min-1
)
(mM-1 min-1
)
CH3CH2Br
CH3CH2Cl
45 ( 3
42 ( 2
0.081 ( 0.03
0.49 ( 0.10
560 ( 210
86 ( 18
a
(() SE from nonlinear regression.
50, and 100 µM) or GSCH3 (0, 5, 10, 50, and 100 µM).
Neither GST 5-5 nor DM11 showed any detectable
inhibition from GSCH3 or Cl- (results not shown).

1112 Chem. Res. Toxicol., Vol. 14, No. 8, 2001
Wheeler et al.
F igu r e 3. Reversion tests with (A) S-(2-haloethyl)GSH com-
pounds and (B) S-(2-acetoxyethyl)GSH. The dry S-(2-haloethyl)-
GSH compounds were dissolved in cold H2O, diluted immedi-
ately into cold 0.20 M sodium phosphate buffer (pH 7.4), and
mixed with S. typhimurium TA 1535 before the top agar was
added. The process was performed as rapidly as possible to
minimize hydrolysis. The typical time elapsed before addition
to the bacteria was 2 min.
F igu r e 2. Rates of hydrolysis of S-(2-haloethyl)GSH com-
pounds. S-(2-Haloethyl)GSH compounds were dissolved in 0.2
M sodium phosphate buffer (pH 7.4) at 22 °C and aliquots were
removed at various time points and assayed for remaining S-(2-
haloethyl)GSH using 4-(4-nitrobenzyl)pyridine (16). (A) Hy-
drolysis rates of S-(2-bromoethyl)GSH (9), S-(2-chloroethyl)GSH
([), and S-(2-fluoroethyl)GSH (2) were estimated to be 1.6, 0.13,
and 0.019 min-1, respectively (with t1/2 ) 0.44, 5.3, and 37 min).
(B) S-(2-Chloroethyl)GSH hydrolysis in the absence or the
presence of either 1 µM DM11 or GST 5-5. The initial concen-
tration of S-(2-chloroethyl)GSH was 2.7 mM. The hydrolysis rate
was not enhanced in the presence of either enzyme.
Mu tagen icity Assays with 1,2-Dih aloeth an es. GSH
transferases were expressed within S. typhimurium TA
1535 and compared for their ability to produce revertants
in the Ames test. Antibodies were used to estimate the
GSH transferase expression levels within each set of
bacteria for normalization. For each GSH transferase
enzyme, the expression levels were relatively similar
between experiments. However, expression levels of the
different GSH transferases in S. typhimurium TA1535
varied greatly, i.e., DM11 was expressed in the 1-2 µM
range whereas GST 5-5 was expressed in the 60-250 nM
range. GST T1 had very low expression, in the 2-7 nM
range. The specificity of the rabbit serum and the relative
abundance of the GSH transferases in S. typhimurium
are shown in Figure 4.
moethyl acetate and characterized. This half-mustard
reacted with 4-(4-nitrobenzyl)pyridine under the usual
conditions (100 °C for 10 min, followed by addition of
base) to yield a purple adduct, but the apparent ꢀ560 was
only 1500 M-1 cm-1, ∼25% that determined for other
GSH and Cys half-mustards (31). The compound was
extremely stable in H2O; the intensity of the colored
product in the 4-(4-nitrobenzyl)pyridine reaction did not
decrease following incubation of S-(2-acetoxylethyl)GSH
at 23 °C over 30 h.
Rever sion Assa ys w ith Ha lf-Mu sta r d s. To examine
the relative mutagenicity of the half-mustards, S. typh-
imurium TA 1535 cells (without expressed GSH trans-
ferases) were incubated with S-(2-haloethyl)GSH com-
pounds containing either F, Cl, or Br (Figure 3A). At the
lower concentrations tested, there was an apparent
relationship between the leaving group and the number
of revertants. The order (from most to least revertants)
observed was S-(2-fluoroethyl)GSH > S-(2-chloroethyl)-
GSH > S-(2-bromoethyl)GSH. In contrast to the other
half-mustards, S-(2-acetoxyethyl)GSH did not cause a
significant increase in revertants with S. typhimurium
TA 1535 except at concentrations of >100 mM (Figure
3B).
For all of the dihaloethane compounds, a concentration-
dependent increase of revertants was observed with each
of the enzymes (Figure 5, Table 3). Bacteria that con-
tained only the expression plasmid pKK233-2 (Figure 4D)
did not show any increase in revertants over the range
of concentrations tested, indicating that GSH transferase
expression is required for activation of the 1,2-dihalo-
ethanes. At low concentrations of dihaloethanes, there
was a clear difference among the compounds. From most
to least revertants, the human and rat GSH transferases
produced a similar order for mutation rates, with BrCH2-
CH2Br > BrCH2CH2Cl > ClCH2CH2Cl (Figure 5, panels
B and C). The bacterial enzyme DM11 (Figure 5A)
differed in that BrCH2CH2Cl produced more revertants
than BrCH2CH2Br at the lower concentrations. At higher

GSH Transferase Conjugation of Haloethanes
Chem. Res. Toxicol., Vol. 14, No. 8, 2001 1113
sufficient to be detected in the assay system. DM11
showed Michaelis-Menten kinetics at the higher con-
centrations of ClCH2CH2Cl (Figure 6A). The order of
kcat/Km was BrCH2CH2Cl > BrCH2CH2Br > ClCH2CH2-
Cl (Table 4). In contrast, GST 5-5 and GST T1h showed
first-order kinetics in dihaloethane and did not saturate
(Figure 5, panels B and C); BrCH2CH2Br was the 1,2-
dihaloethane that was conjugated at the fastest rate.
Efficiencies (based on the slopes from the regression
lines) indicated that GST 5-5 efficiencies were ∼5-fold
greater than for GST T1h (Table 5).
Discu ssion
The analysis of products generated from monohaloet-
hanes by the GSH transferases DM11, 5-5, and T1h was
simplified in that only the direct conjugation products
are measured, avoiding postenzymatic chemical reactions
that complicate measurements of the initial products.
The relative catalytic efficiencies (kcat/Km) of the three
enzymes toward CH3CH2Br and CH3CH2Cl generally
reflect the expected halide order for leaving groups from
alkyl compounds (Br > Cl). Thus, GSTs 5-5 and T1
exhibit a ∼24-fold higher efficiency toward CH3CH2Br >
CH3CH2Cl. The difference with the DM11 enzyme is
somewhat less (∼6-fold). The kcat/Km values for the two
substrates reflect, at least in part, the chemical reactivity
of the compounds, which is not surprising because the
rate constant kcat/Km is influenced by the barriers on the
reaction coordinate up to and including the first irrevers-
ible step. The first irreversible step is almost certainly
the formation of the GSH-ethyl halide conjugate.
The kcat values for the mammalian enzymes could not
be accurately measured because saturation kinetics were
not observed, up to the solubility limits of the substrates.
However, the DM11 enzyme exhibited identical values
of kcat toward the two haloethane substrates. This result
suggests that the rate of catalytic turnover of the DM11
enzyme is not limited by the chemical reaction of GSH
with the alkyl halide but by another step in the reaction
such as product release, substrate binding, thiolate
formation, or an associated conformational transition of
the protein. Product release is unlikely to be rate limiting
because neither the halide ion nor GSCH2CH3 was a
potent product inhibitor. The consequence of nonsaturat-
ing kinetics is that the enzyme is never in a state of
maximum velocity. The lack of inhibition byproducts
indicates that catalytic turnover will not be hampered
by excess product, allowing time for further metabolism
of products by other enzymes or transport across a
membrane.
The accepted mechanism of activation and mutagen-
esis of 1,2-dihaloethanes is shown in Scheme 1 (16).
Protein adducts can also be formed (e.g., Cys) (71).
Because the strongest nucleophile present in the enzyme
assay is GSH, the major product is S,S-ethylene-bis-GSH;
however, a significant amount of S-(2-hydroxyethyl)GSH
is also formed (30). The role of the transferase in the
reaction was determined by examining the decomposition
of half-mustards in the presence or absence of one of the
GSH transferases. Because there was no appreciable
change in the rate of decomposition of S-chlorethylGSH
in the presence of DM11 or GST 5-5, the GSH trans-
ferases appear not to be involved in the removal of the
second halogen, and the process is considered to be
nonenzymatic.3
F igu r e 4. Immunoblots of S. typhimurium whole cell lysates
expressing GSH transferases. Whole cell lysates of S. typhimu-
rium expressing DM11, GST T1, or GST 5-5 were separated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis,
transferred to nitrocellulose, and probed with rabbit serum
raised against (A) DM11, (B) GST T1h, or (C) GST 5-5. The
rabbit serum raised against GST T1h reacted with several other
proteins in S. typhimurium. The two lanes on the right side
represent a comparison of whole cell lysates of S. typhimurium
expressing GST T1 or the plasmid pKK233-2. The arrows point
to the GSH transferases. An example of the relative amounts
of GST 5-5 expressed in S. typhimurium is shown in part C.
concentrations, there was no significant difference be-
tween BrCH2CH2Cl and BrCH2CH2Br with DM11.
Kin etics of S,S-eth ylen e-bis-GSH For m ation . GSH,
dihaloethane, and enzyme were combined, and the rate
of S,S-ethylene-bis-GSH formation (Scheme 2) was de-
termined following derivatization with 2,4-dinitro-1-
fluorobenzene (70) and HPLC. Because the dihaloethanes
are poorly soluble in H2O, an organic compound was
used as a cosolvent. Of the cosolvents tested [C2H5OH,
Me2SO, N,N-dimethylformamide, and acetone, 2.5%
(v/v)], only Me2SO exhibited any inhibition (results not
shown). C2H5OH was chosen as a cosolvent (final con-
centration did not exceed 2.5% (v/v) in any of the
experiments). The upper limit of concentrations was e3
mM for each 1,2-dihaloethane. In previous work with a
radiometric assay (30), we established that under these
conditions ∼60% of the episulfonium ion is trapped as
S,S-ethylene-bis-GSH and the remainder appears to react
with H2O to form S-hydroxyethylGSH.
With both GST 5-5 and GST T1h, the amount of S,S-
ethylene-bis-GSH generated from ClCH2CH2Cl was in-

1114 Chem. Res. Toxicol., Vol. 14, No. 8, 2001
Wheeler et al.
F igu r e 5. Reversion assays with 1,2-dihaloethanes. S. typhimurium TA 1535 transformed with either (A) DM11, (B) rat GST 5-5,
(C) human GST T1, or (D) control plasmid pKK233-2 were incubated with varying concentrations of BrCH2CH2Br (9), ClCH2CH2Cl
(1), or BrCH2CH2Cl ([) for 5 min at 37 °C prior to plating. Each point represents the mean of duplicate assays. The results were
normalized for enzyme concentration, determined from quantitative immunoblots for each enzyme and each assay.
Ta ble 3. Mu ta gen icity Obser ved w ith GSH Tr a n sfer a ses
halogenated ethanes are significantly greater than any
of the corresponding dihaloethanes.4 The decreased rates
due to the presence of a vicinal halide group may be the
result of an altered inductive effect in the substrates.
Alternatively, a decreased affinity for the GST may be a
possibility and cannot be dismissed in the absence of
more information about the catalytic mechanisms of the
enzymes. Conjugation of ClCH2CH2Cl was detected (in
vitro) with DM11 but not with the mammalian theta
GSH transferases. However, the GST 5-5-mediated reac-
tion is progressing below the (S,S-ethylene-bis-GSH)
assay detection limit, because reversion assays show
mutations in the presence of ClCH2CH2Cl, although at
significantly lower levels than for BrCH2CH2Br and
BrCH2CH2Cl.
GST 5-5 and GST T1 have similar, nonsaturating
reaction rate patterns (v vs S) for each of the dihaloet-
hanes (Figure 6), which are similar to the results
obtained for monohaloethanes (Figure 1) and dihalom-
ethanes (60, 72). For DM11, BrCH2CH2Cl was the most
rapidly conjugated substrate, rather than BrCH2CH2Br,
which differs from the situation observed with the
mammalian theta class GSH transferases. As with the
monohaloethanes (Figure 1), DM11 exhibited saturating
kinetics for the 1,2-dihaloethanes [Km values were sig-
nificantly higher for dihalomethanes than for monoha-
loethanes (60)]. For each of the enzymes, the substrate
that produced the highest conjugation rates in vitro
produced the highest reversion rates in the Ames test,
suggesting that the rate-limiting step in mutagenesis is
the initial GSH conjugation reaction carried out by the
in S. typh im u r iu m
mutation rate
(revertants µM-1 per plate)a,b
substrate
GST 5-5
GST T1
DM11
pKK
BrCH2CH2Cl
CH3CH2Br
ClCH2CH2Cl
45 ( 2
85 ( 6
7.1 ( 0.3
3.3 ( 0.3
10.3 ( 0.2
0.5 ( 0.04
2200 ( 1100 <0.1
1300 ( 140
170 ( 20
<0.1
<0.1
a
Calculated from linear regression of linear portion of data
b
points from normalized reversion test plots. (() SE from linear
regression.
The relationship between the decomposition rates for
each of the half-mustards and the mutations seen in the
reversion assays suggests that the first leaving group is
the main factor governing reversion rates and decompo-
sition rates. The relationship followed the halogen order
(from slowest to fastest decomposition) F > Cl > Br with
a slower decomposition rate corresponding to a higher
reversion rate in the mutagenicity assay. In previous
work (31), we established that these different S-(2-
haloethyl)GSH half-mustards yield equivalent amounts
of adducts when mixed directly with DNA (31). All of
these half-mustards generate the same episulfonium ion,
which then partitions between reaction with H2O and any
nucleophiles. Therefore, the stability of the half-mustards
must be a significant issue in determining their abilities
to enter cells and cause mutations (Figures 1 and 2).
However, S-(2-acetoxyethyl)GSH was very stable but only
weakly mutagenic (Figure 2B), consistent with its ex-
tremely low reactivity. Thus, of the half-mustards con-
sidered here, S-(2-fluoroethyl)GSH is optimized for sta-
bility and reactivity and is most mutagenic.
4
The lower rates of conjugation for the 1,2-dihaloethanes are not
The conjugation and decomposition of 1,2-dihaloet-
hanes is more complex than the conjugation of monoha-
loalkanes. The reaction rates estimated with the mono-
the result of inefficient trapping of the episulfonium ion by GSH
(Scheme 1), because previous work indicated that 60% of the product
was trapped as S,S-ethylene-bis-GSH under similar conditions (30).

GSH Transferase Conjugation of Haloethanes
Chem. Res. Toxicol., Vol. 14, No. 8, 2001 1115
to the intracellular target (DNA) and also suggest that
episulfonium ion formation occurs at a rate faster than
half-mustard formation (Figure 2). The in vitro assays
were carried out over a time course of 15 min, i.e., at least
three half-lives for S-(2-chloroethyl)GSH (an additional
10 min was added after the reactions were stopped to
allow complete formation of S,S-ethylene-bis-GSH).
DM11 did not follow the same substrate reaction rate
order as GST 5-5 and GST T1h. This result indicates a
difference between DM11 and mammalian GSH trans-
ferase reaction mechanisms, as noted with monohaloal-
kane conjugation (60). DM11 had equivalent kcat values
for CH3CH2Cl and CH3CH2Br, suggesting that the rate
of displacement of the halogen atom is not rate-limiting.
With the 1,2-dihaloethanes, the reactions are much
slower and there is a difference in kcat values for each of
the compounds. The higher rate observed with BrCH2-
CH2Cl than BrCH2CH2Br in the GSH trapping assay
(Table 3) is also observed in the reversion assays (Figure
5). One possible explanation is that BrCH2CH2Cl simply
fits better into the DM11 active site than BrCH2CH2Br.
With the exception of the anomaly regarding DM11
and BrCH2CH2Cl, the results can all be rationalized in
terms of halide order. In contrast, the halide order is
more complex in the conjugation of dihalomethanes. The
conjugation and mutagenicity of a set of dihalomethanes
is considered in the following paper in this issue (60).
Ack n ow led gm en t. This work was supported in part
by U.S. Public Health Service (USPHS) Grants R35
CA44353, R01 ES10546 (F.P.G.), R01 GM 30910 (R.N.A.),
and P30 ES00267 (F.P.G., R.N.A.). J .B.W. is the recipient
of USPHS postdoctoral fellowship F32 CA80376. We
thank K.M. Williams for acquiring the NMR spectra.
Refer en ces
F igu r e 6. Conjugation of 1,2-dihaloethanes as a function of
substrate concentration. Rates of S,S-ethylene-bis-GSH forma-
tion were determined for (A) DM11, (B) GST 5-5, and (C) GST
T1h for BrCH2CH2Br (9), BrCH2CH2Cl (1), and ClCH2CH2Cl
([). Reactions were carried out at 37 °C for 15 min. Each point
represents the mean of duplicate reactions. Neither GST 5-5
nor GST T1h produced sufficient S,S-ethylene-bis-GSH from
ClCH2CH2Cl to be detected in this assay.
(1) Hueper, W. C., and Smith, C. (1935) Fatal ethylene dichlorid
poisoning. Am. J . Med. Sci. 189, 778-784.
(2) Garrison, S. C., and Leadingham, R. S. (1954) A fatal case of
ethylene dichloride poisoning in an occupational therapy depart-
ment of a neuropsychiatric hospital. Phys. Med. 33, 230-237.
(3) Nouchi, T., Miura, H., Kanayama, M., Mizuguchi, O., and Takano,
T. (1984) Fatal intoxication by 1,2-dichloroethanesa case report.
Int. Arch. Occup. Environ. Health 54, 111-113.
(4) Letz, G. A., Pond, S. M., Osterloh, J . D., Wade, R. L., and Becker,
C. E. (1984) Two fatalities after acute occupational exposure to
ethylene dibromide. J . Am. Med. Assoc. 252, 2428-2431.
(5) Huff, J . E. (1983) 1,2-dibromoethane (ethylene dibromide). En-
viron. Health Perspect. 47, 359-363.
(6) Wong, L. C. K., Winston, J . M., Hong, C. B., and Plotnick, H.
(1982) Carcinogenicity and toxicity of 1,2-dibromoethane in the
rat. Toxicol. Appl. Pharmacol. 63, 155-165.
(7) NTP Technical Report on the Carcinogenesis Bioassay of 1,2-
Dibromoethane in F344 Rats and B6C3F1 Mice (Inhalation Study)
(1982) pp 1-163, U.S. Government Printing Office, Washington,
DC.
(8) Ethylene dibromide: worker exposure, use restricted. (1983)
Chem. Eng. News 61, 4.
(9) Top 50 chemicals: increases in output for past two years well
above average for past decade. (1989) Chem. Eng. News 67, 39.
(10) La, D. K., Lilly, P. D., Anderegg, R. J ., and Swenberg, J . A. (1995)
DNA adduct formation in B6C3F1 mice and Fischer-344 rats
exposed to 1,2,3-trichloropropane. Carcinogenesis 16, 1419-1424.
(11) Weber, G. L., and Sipes, I. G. (1990) Covalent interactions of 1,2,3-
trichloropropane with hepatic macromolecules: studies in the
male F-344 rat. Toxicol. Appl. Pharmacol. 104, 395-402.
(12) Pesticide suit hits Dow: six workers awarded $5 million. (1983)
Chem. Eng. News 61, 4.
Ta ble 4. Stea d y-Sta te Kin etic Con sta n ts for Con ju ga tion
of Dih a loeth a n es by DM11
S,S-ethylene-bis-GSH formationa
kcat
Km
(mM)
kcat/Km
substrate
(min-1
)
(mM-1 min-1
)
BrCH2CH2Cl
CH3CH2Br
ClCH2CH2Cl
4.5 ( 0.7
3.7 ( 1.5
1.3 ( 0.2
2.0 ( 0.6
3.8 ( 2.5
3.3 ( 1.0
2.2 ( 0.8
1.0 ( 0.7
0.4 ( 0.1
a
(() SE from nonlinear regression.
Ta ble 5. En zym e Efficien cies for Con ju ga tion of
Dih a loeth a n es by GSTs 5-5 a n d T1h
catalytic efficiency
a
k
cat/Km (mM-1 min-1
)
substrate
GST 5-5
GST T1h
CH3CH2Br
BrCH2CH2Cl
5.3 ( 0.5
1.8 ( 0.2
1.0 ( 0.02
0.54 ( 0.02
a
(() SE from linear regression.
(13) Omichinski, J . G., Brunborg, G., Søderlund, E. J ., Dahl, J . E.,
Bausano, J . A., Holme, J . A., Nelson, S. D., and Dybing, E. (1987)
Renal necrosis and DNA damage caused by selectively deuterated
and methylated analogs of 1,2-dibromo-3-chloropropane in the rat.
Toxicol. Appl. Pharmacol. 91, 358-370.
enzyme. This is in contrast to the half-mustard mutation
assays in which overall stability of the half-mustard
determined the number of mutations. These results imply
that degradation of the mustards occurs during transport

1116 Chem. Res. Toxicol., Vol. 14, No. 8, 2001
Wheeler et al.
(14) Pearson, P. G., Søderlund, E. J ., Dybing, E., and Nelson, S. D.
(1990) Metabolic activation of 1,2-dibromo-3-chloropropane: evi-
dence for the formation of reactive episulfonium ion intermedi-
ates. Biochemistry 29, 4971-4981.
(34) Oida, T., Humphreys, W. G., and Guengerich, F. P. (1991)
Preparation and characterization of oligonucleotides containing
S-[2-(N7-guanyl)ethyl]glutathione. Biochemistry 30, 10513-
10522.
(15) van Bladeren, P. J ., Breimer, D. D., van Huijgevoort, J . A. T. C.
M., Vermeulen, N. P. E., and van der Gen, A. (1981) The metabolic
formation of N-acetyl-S-2-hydroxyethyl-L-cysteine from tetradeu-
tero-1,2-dibromoethane. Relative importance of oxidation and
glutathione conjugation in vivo. Biochem. Pharmacol. 30, 2499-
2502.
(16) Peterson, L. A., Harris, T. M., and Guengerich, F. P. (1988)
Evidence for an episulfonium ion intermediate in the formation
of S-[2-(N7-guanyl)ethyl]glutathione in DNA. J . Am. Chem. Soc.
110, 3284-3291.
(17) Webb, W. W., Elfarra, A. A., Webster, K. D., Thom, R. E., and
Anders, M. W. (1987) Role for an episulfonium ion in S-(2-
chloroethyl)-DL-cysteine-induced cytotoxicity and its reaction with
glutathione. Biochemistry 26, 3017-3023.
(18) Rannug, U., Sundvall, A., and Ramel, C. (1978) The mutagenic
effect of 1,2-dichloroethane on Salmonella typhimurium. I. Acti-
vation through conjugation with glutathione in vitro. Chem.-Biol.
Interact. 20, 1-16.
(19) Rannug, U., and Beije, B. (1979) The mutagenic effect of 1,2-
dichloroethane on Salmonella typhimurium. II. Activation by the
isolated perfused rat liver. Chem.-Biol. Interact. 24, 265-285.
(20) Ozawa, N., and Guengerich, F. P. (1983) Evidence for formation
of an S-[2-(N7-guanyl)ethyl]glutathione adduct in glutathione-
mediated binding of 1,2-dibromoethane to DNA. Proc. Natl. Acad.
Sci. U.S.A. 80, 5266-5270.
(21) Barrio, J . R., Secrist, J . A., III, and Leonard, N. J . (1972)
Fluorescent adenosine and cytidine derivatives. Biochem. Biophys.
Res. Commun. 46, 597-604.
(22) Guengerich, F. P., and Persmark, M. (1994) Mechanism of
formation of ethenoguanine adducts from 2-haloacetaldehydes:
13C labeling patterns of 2-bromoacetaldehyde. Chem. Res. Toxicol.
7, 205-208.
(23) Guengerich, F. P., Mason, P. S., Stott, W. T., Fox, T. R., and
Watanabe, P. G. (1981) Roles of 2-haloethylene oxides and
2-haloacetaldehydes derived from vinyl bromide and vinyl chloride
in irreversible binding to protein and DNA. Cancer Res. 41, 4391-
4398.
(35) Cmarik, J . L., Humphreys, W. G., Bruner, K. L., Lloyd, R. S.,
Tibbetts, C., and Guengerich, F. P. (1992) Mutation spectrum and
sequence alkylation selectivity resulting from modification of
bacteriophage M13mp18 with S-(2-chloroethyl)glutathione. Evi-
dence for a role of S-[2-(N7-guanyl)ethyl]glutathione as a mu-
tagenic lesion formed from ethylene dibromide. J . Biol. Chem.
267, 6672-6679.
(36) Kim, M.-S., and Guengerich, F. P. (1997) Synthesis of oligonucle-
otides containing the ethylene dibromide-derived DNA adducts
S-[2-(N7-guanyl)ethyl]glutathione,
S-[2-(N2-guanyl)ethyl]glu-
tathione, and S-[2-(O6-guanyl)ethyl]glutathione at a single site.
Chem. Res. Toxicol. 10, 1133-1143.
(37) Kim, M.-S., and Guengerich, F. P. (1998) Polymerase blockage
and misincorporation of dNTPs opposite the ethylene dibromide-
derived DNA adducts S-[2-(N7-guanyl)ethyl]glutathione, S-[2-(N2-
guanyl)ethyl]glutathione, and S-[2-(O6-guanyl)ethyl]glutathione.
Chem. Res. Toxicol. 11, 311-316.
(38) Foster, P. L., Wilkinson, W. G., Miller, J . K., Sullivan, A. D., and
Barnes, W. M. (1988) An analysis of the mutagenicity of 1,2-
dibromoethane to Escherichia coli: influence of DNA repair
activities and metabolic pathways. Mutat. Res. 194, 171-181.
(39) Ballering, L. A. P., Nivard, M. J . M., and Vogel, E. W. (1994)
Mutation spectra of 1,2-dibromoethane, 1,2-dichloroethane and
1-bromo-2-chloroethane in excision repair proficient and repair
deficient strains of Drosophila melanogaster. Carcinogenesis 15,
869-875.
(40) Fossett, N. G., Byrne, B. J ., Tucker, A. B., Arbour-Reily, P., Chang,
S., and Lee, W. R. (1995) Mutation spectrum of 2-chloroethyl
methanesulfonate in Drosophila melanogaster premeiotic germ
cells. Mutat. Res. 331, 213-224.
(41) Abril, N., Luqueromero, F. L., Prieto-Alamo, M. J ., Margison, G.
P., and Pueyo, C. (1995) ogt alkyltransferase enhances dibro-
moalkane mutagenicity in excision repair-deficient Escherichia
coli K-12. Mol. Carcinogen. 12, 110-117.
(42) Abril, N., Ferrezuelo, F., Prieto-Alamo, M. J ., Rafferty, J . A.,
Margison, G. P., and Pueyo, C. (1996) Contribution of ogt-encoded
alkyltransferase to resistance to chloroethylnitrosoureas in nucle-
otide excision repair-deficient Escherichia coli. Carcinogenesis 17,
1609-1614.
(43) Abril, N., Luque-Romero, F. L., Prieto-Alamo, M.-J ., Rafferty, J .
A., Margison, G. P., and Pueyo, C. (1997) Bacterial and mam-
malian DNA alkyltransferases sensitize Escherichia coli to the
lethal and mutagenic effects of dibromoalkanes. Carcinogenesis
18, 1883-1888.
(24) Guengerich, F. P. (1992) Roles of the vinyl chloride oxidation
products 1-chlorooxirane and 2-chloroacetaldehyde in the in vitro
formation of etheno adducts of nucleic acid bases. Chem. Res.
Toxicol. 5, 2-5.
(25) Inskeep, P. B., and Guengerich, F. P. (1984) Glutathione-mediated
binding of dibromoalkanes to DNA: specificity of rat glutathione
S-transferases and dibromoalkane structure. Carcinogenesis 5,
805-808.
(44) Thier, R., Pemble, S. E., Taylor, J . B., Humphreys, W. G.,
Persmark, M., Ketterer, B., and Guengerich, F. P. (1993) Expres-
sion of mammalian glutathione S-transferase 5-5 in Salmonella
typhimurium TA1535 leads to base-pair mutations upon exposure
to dihalomethanes. Proc. Natl. Acad. Sci. U.S.A. 90, 8576-8580.
(45) Ploemen, J . H. T. M., Wormhoudt, L. W., van Ommen, B.,
Commandeur, J . N. M., Vermeulen, N. P. E., and van Bladeren,
P. J . (1995) Polymorphism in the glutathione conjugation activity
of human erythrocytes towards ethylene dibromide and 1,2-epoxy-
3-(p-nitrophenoxy)-propane. Biochim. Biophys. Acta 1243, 469-
476.
(46) Pemble, S., Schroeder, K. R., Spencer, S. R., Meyer, D. J ., Hallier,
E., Bolt, H. M., Ketterer, B., and Taylor, J . B. (1994) Human
glutathione S-transferase theta (GSTT1): cDNA cloning and the
characterization of a genetic polymorphism. Biochem. J . 300,
271-276.
(47) Warholm, M., Rane, A., Alexandrie, A. K., Monaghan, G., and
Rannug, A. (1995) Genotypic and phenotypic determination of
polymorphic glutathione transferase T1 in a Swedish population.
Pharmacogenetics 5, 252-254.
(48) Kempkes, M., Golka, K., Reich, S., Reckwitz, T., and Bolt, H. M.
(1996) Glutathione S-transferase GSTM1 and GSTT1 null geno-
types as potential risk factors for urothelial cancer of the bladder.
Arch. Toxicol. 71, 123-126.
(26) Koga, N., Inskeep, P. B., Harris, T. M., and Guengerich, F. P.
(1986) S-[2-(N7-Guanyl)ethyl]glutathione, the major DNA adduct
formed from 1,2-dibromoethane. Biochemistry 25, 2192-2198.
(27) Inskeep, P. B., Koga, N., Cmarik, J . L., and Guengerich, F. P.
(1986) Covalent binding of 1,2-dihaloalkanes to DNA and stability
of the major DNA adduct, S-[2-(N7-guanyl)ethyl]glutathione.
Cancer Res. 46, 2839-2844.
(28) Kim, D. H., and Guengerich, F. P. (1989) Excretion of the
mercapturic acid S-[2-(N7-guanyl)ethyl]-N-acetylcysteine in urine
following administration of ethylene dibromide to rats. Cancer
Res. 49, 5843-5851.
(29) Kim, D.-H., and Guengerich, F. P. (1990) Formation of the DNA
adduct S-[2-(N7-guanyl)ethyl]glutathione from ethylene dibro-
mide: effects of modulation of glutathione and glutathione
S-transferase levels and the lack of a role for sulfation. Carcino-
genesis 11, 419-424.
(30) Cmarik, J . L., Inskeep, P. B., Meyer, D. J ., Meredith, M. J .,
Ketterer, B., and Guengerich, F. P. (1990) Selectivity of rat and
human glutathione S-transferases in activation of ethylene di-
bromide by glutathione conjugation and DNA binding and induc-
tion of unscheduled DNA synthesis in human hepatocytes. Cancer
Res. 50, 2747-2752.
(31) Humphreys, W. G., Kim, D.-H., Cmarik, J . L., Shimada, T., and
Guengerich, F. P. (1990) Comparison of the DNA alkylating
properties and mutagenic responses caused by a series of S-(2-
haloethyl)-substituted cysteine and glutathione derivatives. Bio-
chemistry 29, 10342-10350.
(32) Kim, D.-H., Humphreys, W. G., and Guengerich, F. P. (1990)
Characterization of S-[2-(N1-adenyl)ethyl]glutathione formed in
DNA and RNA from 1,2-dibromoethane. Chem. Res. Toxicol. 3,
587-594.
(49) Nelson, H. H., Wiencke, J . K., Christiani, D. C., Cheng, T. J ., Zuo,
Z.-F., Schwartz, B. S., Lee, B.-K., Spitz, M. R., Wang, M., Xu, X.,
and Kelsey, K. T. (1995) Ethnic differences in the prevalence of
the homozygous deleted genotype of glutathione S-transferase
theta. Carcinogenesis 16, 1243-1254.
(50) Peter, H., Deutschmann, S., Reichel, C., and Hallier, E. (1989)
Metabolism of methyl chloride by human erythrocytes. Arch.
Toxicol. 63, 351-355.
(33) Humphreys, W. G., Kim, D. H., and Guengerich, F. P. (1991)
Isolation and characterization of N7-guanyl adducts derived from
1,2-dibromo-3-chloropropane. Chem. Res. Toxicol. 4, 445-453.
(51) Hung, H.-C., Chuang, J ., Chien, Y.-C., Chern, H.-D., Chiang, C.-
P., Kuo, Y.-S., Hildesheim, A., and Chen, C.-J . (1997) Genetic

GSH Transferase Conjugation of Haloethanes
Chem. Res. Toxicol., Vol. 14, No. 8, 2001 1117
polymorphisms of CYP2E1, GSTM1, and GSTT1: environmental
factors and risk of oral cancer. Cancer Epidem. Biomarker. Prev.
6, 901-905.
(61) Epstein, J ., Rosenthal, R. W., and Ess, R. J . (1955) Use of p-(4-
nitrobenzyl)pyridine as analytical reagent for ethylenimines and
alkylating agents. Anal. Chem. 27, 1435-1439.
(52) Nair, U. J ., Nair, J ., Mathew, B., and Bartsch, H. (1999)
Glutathione S-transferase M1 and T1 null genotypes as risk
factors for oral leukoplakia in ethnic Indian betel quid/tobacco
chewers. Carcinogenesis 20, 743-748.
(62) Pemble, S. E., and Taylor, J . B. (1992) An evolutionary perspective
on glutathione transferases inferred from class-Theta glutathione
transferase cDNA sequences. Biochem. J . 287, 957-963.
(63) Thier, R., Pemble, S. E., Kramer, H., Taylor, J . B., Guengerich,
F. P., and Ketterer, B. (1996) Human glutathione S-transferase
T1-1 enhances mutagenicity of 1,2-dibromoethane and 1,2,3,4-
diepoxybutane in the Salmonella typhimurium mutagenicity
assay. In Proceedings, Fifth International Sympos. Biological
Reactive Intermediates, 4-8 J anuary, Munich.
(64) Laemmli, U. K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680-685.
(65) Nash, T. (1953) The colorimetric estimation of formaldehyde by
means of the Hantzsch reaction. Biochem. J . 55, 416-421.
(66) Guengerich, F. P. (1994) Analysis and characterization of en-
zymes. In Principles and Methods of Toxicology, 3rd ed. (Hayes,
A. W., Ed.) pp 1259-1313, Raven Press: New York.
(67) Maron, D. M., and Ames, B. N. (1983) Revised methods for the
Salmonella mutagenicity test. Mutation Res. 113, 173-215.
(68) Kuzmic, P. (1996) Program DYNAFIT for the analysis of enzyme
kinetic data: application to HIV protease. Anal. Biochem. 237,
260-273.
(69) March, J . (1992) Advanced Organic Chemistry: Reactions, Mech-
anisms, and Structure, 4th ed., p 357, Wiley, New York.
(70) Reed, D. J ., Babson, J . R., Beatty, P. W., Brodie, A. E., Ellis, W.
W., and Potter, D. W. (1999) High-performance liquid chroma-
tography analysis of nanomole levels of glutathione, glutathione
disulfide, and related thiols and disulfides. Anal. Biochem. 106,
55-62.
(53) Brockmo¨ller, J ., Cascorbi, I., Kerb, R., and Roots, I. (1996)
Combined analysis of inherited polymorphisms in arylamine
N-acetyltransferase 2, glutathione S-transferases M1 and T1,
microsomal epoxide hydrolase, and cytochrome P450 enzymes as
modulators of bladder cancer risk. Cancer Res. 56, 3915-3925.
(54) Hand, P. A., Inskip, A., Gilford, J ., Alldersea, J ., Elexpuru-
Camiruaga, J ., Hayes, J . D., J ones, P. W., Strange, R. C., and
Fryer, A. A. (1996) Allelism at the glutathione S-transferase
GSTM3 locus: interactions with GSTM1 and GSTT1 as risk
factors for astrocytoma. Carcinogenesis 17, 1919-1922.
(55) Elexpuru-Camiruaga, J ., Buxton, N., Kandula, V., Dias, P. S.,
Campbell, D., McIntosh, J ., Broome, J ., J ones, P., Inskip, A.,
Alldersea, J ., Fryer, A. A., and Strange, R. C. (1995) Susceptibility
to astrocytoma and meningioma: influence of allelism at glu-
tathione S-transferase (GSTT1 and GSTM1) and cytochrome
P-450 (CYP2D6) loci. Cancer Res. 55, 4237-4239.
(56) Stroombergen, M. C. M. J ., and Waring, R. H. (1999) Determi-
nation of glutathione S-transferase µ and θ polymorphisms in
neurological disease. Hum. Exp. Toxicol. 18, 141-145.
(57) Bader, R., and Leisinger, T. (1994) Isolation and characterization
of the Methylophilus sp. strain DM11 gene encoding dichlo-
romethane dehalogenase/glutlathione S-transferase. J . Bacteriol.
176, 3466-3473.
(58) Vuilleumier, S., and Leisinger, T. (1996) Protein engineering
studies of dichloromethane dehalogenase/glutathione S-trans-
ferase from Methylophilus sp. strain DM11. Ser12 but not Tyr6
is required for enzyme activity. Eur. J . Biochem. 239, 410-417.
(59) Scholtz, R., Wackett, L. P., Egli, C., Cook, A. M., and Leisinger,
T. (1988) Dichloromethane dehalogenase with improved catalytic
activity isolated from a fast-growing dichloromethane-utilizing
bacterium. J . Bacteriol. 170, 5698-5704.
(60) Wheeler, J . B., Stourman, N. V., Thier, R., Dommermuth, A.,
Vuilleumier, S., Rose, J . A., Armstrong, R. N., and Guengerich,
F. P. (2001) Conjugation of haloalkanes by bacterial and mam-
malian glutathione transferases: mono- and dihalomethanes.
Chem. Res. Toxicol. 14, 1118-1127.
(71) Erve, J . C. L., Barofsky, E., Barofsky, D. F., Deinzer, M. L., and
Reed, D. J . (1995) Alkylation of Escherichia coli thioredoxin by
S-(2-chloroethyl)glutathione and identification of the adduct on
the active site cysteine-32 by mass spectrometry. Chem. Res.
Toxicol. 8, 934-941.
(72) Reitz, R. H., Mendrala, A., and Guengerich, F. P. (1989) In vitro
metabolism of methylene chloride in human and animal tissues:
use in physiologically based pharmacokinetic models. Toxicol.
Appl. Pharmacol. 97, 230-246.
TX0100183