A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic Activity

Brief Communication

A Potent and Selective PARP11 Inhibitor Suggests

Coupling between Cellular Localization and Catalytic

Activity

Graphical Abstract

Authors

Ilsa T. Kirby, Ana Kojic,

Moriah R. Arnold, ..., Carsten Schultz,

€

Herwig Schuler, Michael S. Cohen

Correspondence

cohenmic@ohsu.edu

In Brief

Kirby et al. use a structure-guided design

strategy to develop a selective and potent

inhibitor of PARP11. Cellular studies

using this inhibitor revealed the surprising

ﬁnding that PARP11 nuclear envelope

localization is linked to its catalytic

activity. This inhibitor will be useful for

unraveling the cellular roles of PARP11.

Highlights

d

Structure-guided design of PARP inhibitors

d

Identiﬁcation of a potent and selective PARP11

inhibitor (ITK7)

d

ITK7 inhibits PARP11 auto-MARylation in cells

ITK7 causes PARP11 to dissociate from the nuclear envelope

Kirby et al., 2018, Cell Chemical Biology 25, 1–7

December 20, 2018 ª 2018 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2018.09.011

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Cell Chemical Biology

Brief Communication

A Potent and Selective PARP11 Inhibitor

Suggests Coupling between Cellular Localization

and Catalytic Activity

Ilsa T. Kirby,^1,2Ana Kojic,^3,4Moriah R. Arnold,²Ann-Gerd Thorsell,⁵Tobias Karlberg,⁵Anke Vermehren-Schmaedick,²

5

1 ,2 ,6 ,

Raashi Sreenivasan,²Carsten Schultz,^1,2,3Herwig Schuler, and Michael S. Cohen

€

*

¹Program in Chemical Biology, Oregon Health & Science University, Portland, OR 97210, USA

²Department of Physiology and Pharmacology, Oregon Health & Science University, Portland, OR 97210, United States

³European Molecular Biology Laboratory (EMBL), Cell Biology and Biophysics Unit, Meyerhofstrasse 1, 69117 Heidelberg, Germany

⁴EMBL, Heidelberg University, Heidelberg, Germany

5

€

Department of Biosciences and Nutrition, Karolinska Institutet, Halsovagen 7c, 14157, Huddinge, Sweden

⁶Lead Contact

*Correspondence: cohenmic@ohsu.edu

https://doi.org/10.1016/j.chembiol.2018.09.011

SUMMARY

position of the triad. Recently, all H-Y-F PARPs were shown

to catalyze mono-ADP-ribosylation (MARylation) (Vyas et al.,

Poly-ADP-ribose polymerases (PARPs1-16) play 2014). Unlike H-Y-E PARPs, H-Y-F PARPs remain largely

uncharacterized.

Selective inhibitors of PARP1,2 (e.g., veliparib) (Donawho

pivotal roles in diverse cellular processes. PARPs

that catalyze poly-ADP-ribosylation (PARylation)

are the best characterized PARP family members

because of the availability of potent and selec-

tive inhibitors for these PARPs. There has been

comparatively little success in developing selective

small-molecule inhibitors of PARPs that catalyze

mono-ADP-ribosylation (MARylation), limiting our

et al., 2007) have validated the roles for these PARPs in the

DNA damage response pathway. Likewise, selective inhibitors

of PARP5a,b (AZ6102) (Johannes et al., 2015) demonstrated

roles for PARP5a,b in Wnt signaling (Huang et al., 2009). Similar

to selective inhibitors of H-Y-E PARPs, selective inhibitors of in-

dividual H-Y-F PARPs would be useful in elucidating the function

of MARylation. Unfortunately, the dearth of inhibitors that

potently and selectively inhibit the H-Y-F PARP subfamily has

hindered our understanding of H-Y-F PARPs (Wahlberg et al.,

understanding of the cellular role of MARylation.

Here we describe the structure-guided design of in-

hibitors of PARPs that catalyze MARylation. The 2012). Recent studies demonstrate that H-Y-F PARPs (e.g.,

PARP14) are therapeutic targets for several cancers (Barbarulo

et al., 2013; Iansante et al., 2015) as well as allergic asthma (Meh-

most selective analog, ITK7, potently inhibits the

MARylation activity of PARP11, a nuclear envelope-

localized PARP. ITK7 is greater than 200-fold

selective over other PARP family members. Using

live-cell imaging, we show that ITK7 causes

PARP11 to dissociate from the nuclear envelope.

These results suggest that the cellular localization

of PARP11 is regulated by its catalytic activity.

rotra et al., 2013), highlighting the need to develop selective in-

hibitors of H-Y-F PARPs.

Thus far, the only published small-molecule inhibitors targeting

H-Y-F PARPs are against PARP10 (e.g., OUL35) (Ekblad et al.,

2015; Venkannagari et al., 2016) and PARP14 (Ekblad et al.,

2015; Peng et al., 2016; Upton et al., 2017; Yoneyama-Hirozane

et al., 2017). While OUL35 was shown to be selective for

PARP10 over several other PARP family members, the recently

described PARP14 are either not selective over H-Y-E PARPs

or their selectivity has not been fully determined. One major chal-

INTRODUCTION

lenge in developing inhibitors of H-Y-F PARPs is identifying com-

Poly-ADP-ribose polymerases (PARPs1-16) are key regulators pounds that do not inhibit H-Y-E PARPs yet are potent enough to

of diverse cellular processes, including DNA repair, transcription, be used in cellular studies. Here we describe a structure-guided

the unfolded protein response, and RNA processing (Gupte approach for developing small-molecule inhibitors designed to

et al., 2017). PARPs catalyze ADP-ribosylation, which involves exploit unique features found in H-Y-F PARPs. This strategy

the transfer of ADP-ribose from nicotinamide adenine dinucleo- led to a selective, cell-active small-molecule inhibitor of PARP11.

tide (NAD⁺) to amino acids in proteins. Active PARPs can be

divided into two subfamilies based on a shared active site triad RESULTS

motif: the H-Y-E PARPs (PARP1-4, 5a, and 5b) and the H-Y-F

PARPs (PARP 6–8, 10–12, and 14–16) (Hottiger et al., 2010). Structure-Guided Design Leads to Small Molecule

The glutamate in the H-Y-E motif is necessary for the poly- Inhibitors Selective for H-Y-F PARPs

ADP-ribosylation (PARylation) activity of several H-Y-E PARPs We sought to identify amino acid differences in the active site

(Marsischky et al., 1995; Rolli et al., 1997). In contrast, the between H-Y-E PARPs and H-Y-F PARPs that we could exploit

H-Y-F PARPs contain a hydrophobic (F) amino acid in the third for inhibitor design. One major difference between H-Y-E PARPs

Cell Chemical Biology 25, 1–7, December 20, 2018 ª 2018 Elsevier Ltd.

1

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Figure 1. Structure-Guided Design of Selective H-Y-F PARP Inhibitors

(A) Structure-based sequence alignment of the PARPs. PARylating PARPs contain a glutamate (Glu988, human PARP1 numbering) in the third position of the

H-Y-E triad, while MARylating PARPs contain a hydrophobic (F) amino acid at this position.

(B) The crystal structure of QDR1 bound to the catalytic domain of PARP14 (PDB: 3SMI) shows that substituents at the C-7 position of the QDR scaffold would

clash with the glutamate (purple) in the third position of the H-Y-E triad but interact favorably with hydrophobic amino acids in the third position (Leu1701, teal) of

the H-Y-F triad.

(C) Chemical structure of QDR-based inhibitors described in this study.

and H-Y-F PARPs is the identity of the amino acid at the third po- Table S1) using histones as protein substrates and a clickable

sition in the triad motif (position 988, human PARP1 numbering, NAD⁺analog to monitor ADP-ribosylation in vitro (Carter-O’Con-

Figure 1A). We reasoned that the major difference (i.e., acidic nell et al., 2014; Morgan et al., 2015). QDR2 was moderately

versus hydrophobic) in the amino acid at the third position of potent against PARP1 (half maximal inhibitory concentration

the conserved triad could potentially be exploited for the devel- [IC₅₀] = 1.3 mM) and PARP2 (IC₅₀= 0.8 mM), while ITK1 only

opment of selective inhibitors of H-Y-F PARPs.

weakly inhibited PARP2 (IC₅₀= 17.4 mM) and did not inhibit

To this end, we needed an appropriate scaffold as a starting PARP1 at concentrations up to 30 mM. ITK1 did not inhibit

point for H-Y-F PARP-selective inhibitors. We scrutinized the PARP3 or the catalytic domain of PARP5b (PARP5b_cat) at con-

structure of a pan-PARP inhibitor with a quinazolin-4(3H)-one centrations up to 10 mM. Thus, the replacement of a hydrogen

scaffold (QDR1) bound to the nicotinamide binding site of atom for a methyl group at the C-7 position of the QDR scaffold

PARP14 (Wahlberg et al., 2012). By overlaying the PARP14- decreases potency against H-Y-E PARPs.

QDR1 structure with that of PARP1 we hypothesized that small,

We next determined if ITK1 inhibited H-Y-F PARPs, and if it was

aliphatic substituents at the C-7 position of the QDR scaffold more potent than the des-methyl analog QDR2. We note that for

would interact favorably with hydrophobic amino acids (F) in several PARPs used for these assays, the catalytic domain alone

the third position of H-Y-F PARPs, but would sterically clash or a combination with another domain was used because of our

with the glutamic acid in H-Y-E PARPs (Figures 1B and 1C).

inability to generate, in E. coli, sufﬁcient quantity and purity of

To test this hypothesis, we synthesized a QDR-based com- several of the full-length PARPs. We focused initially on the

pound with a methyl group at the C-7 position and the des- H-Y-F PARP PARP14 because our structural analysis was based

methyl version (ITK1 and QDR2, Figure 1C; Data S2 [Scheme on the crystal structure of PARP14 bound to QDR1. We tested

S1]). We initially tested ITK1 and QDR2 against the well-charac- ITK1 against PARP14 containing the catalytic and WWE domains

terized H-Y-E PARPs PARP1 and PARP2 (Figures 2 and S1; (PARP14_cat-wwe) (Figure S1) using the promiscuous H-Y-F PARP

2

Cell Chemical Biology 25, 1–7, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

C-2 position of ITK1 (Figure 3C). Given the lack of sequence con-

servation within the D-loop of H-Y-F PARPs we envisaged that

modiﬁcations at this position could result in selective inhibition

of individual H-Y-F PARP family members. We synthesized three

C-7 methyl QDR analogs with various substituents at C-2 (ITK2,

adenosine; ITK3, 3-amino-triazole; ITK4, p-benzoic acid) (Fig-

ure 1C; Data S2 [Scheme S1]). We screened these compounds

against the H-Y-E PARPs (PARP1-3 and PARP5b_cat) and the

H-Y-F PARPs (PARP10_cat, PARP11, PARP14_cat-wwe, and

PARP15_cat) (Figure 2 and S1; Table S1). None of these QDR an-

alogs inhibited PARPs 1–3 or 5b_cat(up to 30 and 10 mM, respec-

tively) except ITK4, which modestly inhibited PARP2 (IC₅₀

=

8.5 mM). Therefore, the methyl substituent at C-7 decreases

binding of QDR analogs to H-Y-E PARPs. Among the H-Y-F

PARPs, ITK2-4 did not exhibit improved potency or selectivity

over ITK1. This indicates that selectivity for PARP11 can be

achieved with a pyrimidine at the C-2 position of the QDR scaf-

fold. This selectivity is likely due to speciﬁc interactions between

the pyrimidine and amino acids in the D-loop of PARP11.

Figure 2. Inhibitor Screen across the PARP Family

Heatmap depicting the IC₅₀values determined for the ITK series, olaparib, and

rucaparib against the PARPs. Values based on at least three replicates.

Further Modiﬁcation of the C-7 Position of the QDR

Scaffold Improves Potency

substrate SRSF protein kinase 2 (SRPK2) (Morgan et al., 2015;

Venkannagari et al., 2013). We found that ITK1 was 2-fold more

potent than QDR2 against PARP14_cat-wwe(IC₅₀= 8.6 versus

16 mM) (Figures 2 and S1; and Table S1). ITK1 also exhibited

moderate potency against the H-Y-F PARPs PARP10_catand

PARP15_cat, and sub-micromolar potency against PARP11. This

suggests that modiﬁcation at the C-7 position is a promising

approach toward selectively inhibiting H-Y-F PARPs but not

H-Y-E PARPs.

We hypothesized that modiﬁcation at the C-7 position with a

larger substituent would yield increases in potency by extending

further into the hydrophobic sub-pocket. We synthesized two

compounds containing either an alkynyl (ITK5) or a propynyl

(ITK6) substituent at the C-7 position and a p-benzoic acid at

the C-2 position (Figure 1; Data S2 [Scheme S2]). Compared

with ITK4, ITK6 exhibited substantially improved potency against

PARP10_cat(60-fold) and PARP11 (55-fold), while modestly

improving potency against PARP14_cat-wwe(10-fold) and

PARP15_cat(15-fold). Importantly, ITK6 did not inhibit PARP1-4

and PAR5b up to 30 mM. We obtained a crystal structure of

ITK6 bound to the catalytic domain of PARP14, which conﬁrmed

that the propynyl substituent projects further into the hydrophobic

sub-pocket (Figure 3D). These results show that targeting the hy-

drophobic sub-pocket found in the H-Y-F PARPs is a viable strat-

egy for the development for H-Y-F PARP-selective inhibitors.

Structural Studies of ITK1 Reveal a Hydrophobic Sub-

pocket in an H-Y-F PARP

We next solved the crystal structure of ITK1 bound to PARP14_cat

.

PARP14 was used for structural studies so we could directly

compare the PARP14-ITK1 structure with the previously deter-

mined PARP14-QDR1 structure. Comparing the PARP14-ITK1

structure with the PARP14-QDR1 structure revealed that

Leu1701 rotates toward the methyl group at the C-7 position of

QDR2 (Figure 3A). The C-7 methyl group also points toward a hy-

drophobic sub-pocket lined by Leu1701, Val1626, Ala1627, and

Tyr1628 at the C terminus of the donor loop (D-loop) (Figure 3A).

The D-loop—a ﬂexible loop that abuts the NAD⁺binding site—is

one of the least conserved elements in the PARP catalytic do-

Design of a Potent and Selective PARP11 Inhibitor

The structure-activity relationship study exploring the C-2 posi-

tion of the QDR scaffold demonstrated that the pyrimidine at

the C-2 position of ITK1 yielded selectivity for PARP11 (Figure 2;

Table S1). We reasoned that replacing the C-7 methyl in ITK1

with a propynyl group (ITK7, Figure 1; Data S2 [Scheme S2])

would yield a more potent and selective PARP11 inhibitor.

€

mains (Figure 3B) (Pinto and Schuler, 2015). While the exact

function of the D-loop is unclear, studies of related bacterial

toxins suggest its involvement in NAD⁺binding (Jørgensen

et al., 2005, 2008). While structural comparison of various

H-Y-F PARPs highlight D-loop ﬂexibility, the hydrophobic sub-

pocket appears to be a static feature of H-Y-F PARPs (Wahlberg

et al., 2012). The hydrophobic sub-pocket is sterically occluded

by the glutamate in H-Y-E PARPs and could potentially serve as

a selectivity ﬁlter within the H-Y-F PARP active site.

Indeed, we found that ITK7 potently inhibited PARP11 (IC₅₀

=

14 nM), and with greater than 200-fold selectivity over other

H-Y-F PARPs, while not inhibiting any of the H-Y-E PARPs (Fig-

ures 2 and S1; Table S1). ITK7 exhibited similar potency against

PARP11 using nuclear export factor 1, a previously identiﬁed

cellular target of PARP11 (Carter-O’Connell et al., 2016), as a

substrate instead of the pan-substrate SRPK2 (Figure S1C).

Furthermore, ITK7 exhibited similar potency against PARP11

when native NAD⁺was used instead of 6-a-NAD⁺(Figure S1).

Compared with two US Food and Drug Administration-approved

drugs, olaparib and rucaparib (Bitler et al., 2017; Menear et al.,

Exploiting Differences in the D-Loop to Discriminate

among H-Y-F PARPs

In the PARP14-ITK1 structure the N-terminal region of the 2008; Thomas et al., 2007), which potently inhibit several

PARP14 D-loop interacts with the pyrimidine substituent at the H-Y-E PARPs (Thorsell et al., 2017; Wahlberg et al., 2012), and

Cell Chemical Biology 25, 1–7, December 20, 2018

3

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Figure 3. Exploiting a Hydrophobic Sub-pocket in H-Y-F PARPs with C-7-Substituted QDR Analogs

(A) Crystal structure of ITK1 (magenta) (PDB: 6FYM) bound to PARP14_cat. Leu1701 rotates toward the C-7 methyl group of ITK1 to make hydrophobic contacts

compared with its position bound to QDR1 (violet, Leu1701 in the QDR1 bound structure; teal, Leu1701 in ITK1 bound structure). The C-7 methyl group of ITK1

projects into a hydrophobic sub-pocket formed by Leu1701 and amino acids located at the C terminus of the D-loop.

(B) Structure-based sequence alignment showing the amino acids in the D-loop. Tyr1620 and Ala1621 in PARP14 are highlighted in pink, Val1626, Ala1627, and

Tyr1628 in PARP14 are highlighted in yellow.

(C) Interactions between the amino acids (Ala1621 and Tyr1620, in particular) in the N terminus of the D-loop (teal) and the C-2 substituent of ITK1.

(D) Crystal structure of ITK6 (violet) (PDB: 6FZM) bound to PARP14_cat. The propynyl substituent at the C-2 position of ITK6 occupies the hydrophobic sub-pocket.

modestly inhibit a few H-Y-F PARPs (Figure 2; Table S1), ITK7 is et al., 2015) and MARylates several nuclear pore complex (NPC)

one of the most potent and selective PARP inhibitors described proteins in HEK293T cells (Carter-O’Connell et al., 2016). Here,

to date.

we conﬁrmed that GFP-PARP11 localizes to the nuclear enve-

lope, where it colocalizes with an mRuby2-tagged NPC protein

NUP50 in HeLa cells (Figure S3A). A previous study showed

that PARP11 nuclear envelope localization requires the presence

of the catalytic domain (Meyer-Ficca et al., 2015). Similarly,

ITK7 Inhibits PARP11 Auto-MARylation Activity in Cells

and Causes PARP11 to Dissociate from the Nuclear

Envelope

We next examined the effects of ITK7 on PARP11 activity in cells. we found that a GFP-tagged PARP11 mutant with severely

Similar to other PARPs, PARP11 undergoes auto-MARylation compromised catalytic activity—I313G (IG) GFP-PARP11

(Carter-O’Connell et al., 2016; Vyas et al., 2014). Because there (Carter-O’Connell et al., 2016)—exhibited substantially reduced

are no validated cell-based assays for examining endogenous nuclear envelope localization compared with wild-type GFP-

PARP11 activity or function, we used HeLa cells expressing PARP11 (Figure 4C). These results suggest that the catalytic ac-

full-length GFP-PARP11 to test ITK7. HeLa cells were treated tivity of PARP11 is required for nuclear envelope localization.

with increasing concentrations of ITK7 for 3 hr (Figure 4A).

We next treated GFP-PARP11-transfected HeLa cells with

ITK7 exhibited a dose-dependent inhibition of PARP11-depen- ITK7 (1 mM) and used live-cell imaging to monitor GFP-

dent auto-MARylation (EC₅₀= 13 nM) (Figures 4A and 4B). PARP11 localization. We found that GFP-PARP11 dissociated

Importantly, ITK7 did not inhibit H₂O₂-activated PARP1 auto- from the nuclear pore within 30 min of treatment with ITK7

PARylation (Figure S2A). Unlike our pan-H-Y-F PARP inhibitor (1 mM), while treatment with DMSO had no effect (Figures 4D

ITK6, ITK7 did not inhibit PARP10 auto-MARylation in cells (Fig- and 4E; Videos S1 and S2). Upon longer treatment (18 hr),

ures S2B and S2C), further demonstrating the speciﬁcity of ITK7 GFP-PARP11 could no longer be detected at the nuclear enve-

for PARP11.

lope and appeared to accumulate in the nucleus (Figure S3B).

We and others have demonstrated that PARP11 localizes to These results support the hypothesis that the catalytic activity

the nuclear envelope (Carter-O’Connell et al., 2016; Meyer-Ficca of PARP11 is required for localization to the nuclear envelope.

4

Cell Chemical Biology 25, 1–7, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Figure 4. PARP11 Catalytic Activity Is Required for Nuclear Envelope Localization

(A) ITK7 inhibits GFP-PARP11 auto-MARylation activity in a dose-dependent manner in HeLa cells. The signal for PARP11 auto-MARylation does not disappear

completely, which is likely due to incomplete removal of MAR on PARP11.

(B) Quantiﬁcation of results shown in (A). Error bars represent SEM from three replicates (Prism 7).

(C) A catalytically compromised PARP11 mutant (I313G [IG] GFP-PARP11) does not localize to the nuclear envelope. HeLa cells were transfected with either

wild-type or IG GFP-PARP11 and imaged 20 hr post-transfection.

(D) Treatment of HeLa cells with ITK7 caused PARP11 to dissociate from the nuclear envelope. HeLa cells transfected with GFP-PARP11 were treated with either

ITK7 or DMSO, and images were acquired every 20 s. Scale bars, 10 mm.

(E) Quantiﬁcation of results shown in (C).

Related to Videos S1 and S2.

DISCUSSION

the H-Y-E PARPs. Our structural studies reveal that inhibitor

selectivity is due to the exploitation of a hydrophobic sub-pocket

Using structure-guided design we developed QDR-based inhib- unique to the H-Y-F PARPs. Our most potent compound, ITK7,

itors that selectively inhibit H-Y-F PARPs. Substitution of the C-7 is remarkably selective for PARP11. Future studies will explore

position of the QDR scaffold is an effective strategy to improve the hydrophobic sub-pocket in PARP11 and other H-Y-F PARPs

potency against H-Y-F PARPs and decrease potency against to increase the potency and selectivity of our QDR analogs.

Cell Chemical Biology 25, 1–7, December 20, 2018

5

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

SUPPLEMENTAL INFORMATION

This study demonstrates that the selectivity within the H-Y-F

PARP subfamily can be optimized by varying the substituent

Supplemental Information includes four ﬁgures, one table, two videos, and two

emanating from the C-2 position of the QDR scaffold. This is

data ﬁles and can be found with this article online at https://doi.org/10.1016/j.

presumably due to differences in the D-loop between H-Y-F

PARPs as the amino acids in the active site that are oriented

chembiol.2018.09.011.

toward the C-2 substituent are not conserved across the

H-Y-F PARP family. Two out of the three amino acids

ACKNOWLEDGMENTS

We thank members of the Cohen laboratory for many helpful discussions. We

(Ala229 and Val230, human PARP11 numbering) that line the

thank K. Rodriguez (Cohen lab) for her support in the synthesis of 6-alkyne-

hydrophobic sub-pocket are not well conserved across the

NAD⁺. We thank R. Morgan for PARP15cat and PARP10cat used in this study.

H-Y-F PARP family (Figure 3B). This lack of conservation within

We thank J. Matthews (University of Oslo) for the GST-PARP7FL plasmid. We

the D-loop will be exploited to improve selectivity for a given

thank A. DeBarber and the OHSU Bioanalytical Shared Resource Facility for

H-Y-F PARPs in future studies.

high-resolution mass spectrometry analysis of our compounds. We thank S.

We previously demonstrated that PARP11 is a nuclear enve-

lope-localized PARP and modiﬁes several NPC family members

(Carter-O’Connell et al., 2016). How PARP11 regulates NPC pro-

teins is unclear. Our work reveals that ITK7 causes PARP11 to

dissociate from the envelope within 30 min. Moreover, a catalyt-

ically compromised mutant does not localize to the nuclear

envelope. This links the catalytic activity of PARP11 to nuclear

envelope localization; future studies will focus on understanding

how catalytic activity, and in particular auto-MARylation, regu-

lates PARP11 localization. Given that many PARPs exhibit

distinct localization patterns in cells (Vyas et al., 2014) it will be

interesting to determine if catalytic activity generally regulates

PARP localization. These studies will be greatly facilitated by se-

lective and potent inhibitors of individual PARP family members.

Ferrara for advice regarding synthesis. This work was supported by the Pew

Foundation and Startup funds from OHSU (to M.S.C.), the Swedish Research

Council, the Swedish Cancer Society, and the Swedish Foundation for Stra-

tegic Research (to H.S.), and by TRR186 of the German Research Council

(DFG) (to C.S.).

AUTHOR CONTRIBUTIONS

I.T.K. and M.S.C. designed the experiments. I.T.K. synthesized all reported

compounds and conducted all experiments with the exceptions of the live-

cell imaging performed by A.K. M.R.A. conducted studies using ITK7 in cells.

A.-G.T., T.K., and H.S. conducted crystallography studies. A.V.-S. conducted

immunoprecipitation assays. R.S. prepared the PARP11 construct for bacte-

rial expression. I.T.K. and M.S.C. wrote the manuscript with input from the

other authors.

DECLARATION OF INTERESTS

STAR+METHODS

I.T.K. and M.S.C. are co-inventors on a provisional patent describing the inhib-

itors in this study.

Detailed methods are provided in the online version of this paper

and include the following:

Received: June 13, 2017

Revised: June 8, 2018

Accepted: September 24, 2018

Published: October 18, 2018

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

d METHOD DETAILS

REFERENCES

B Cloning

Barbarulo, A., Iansante, V., Chaidos, A., Naresh, K., Rahemtulla, A., Franzoso,

G., Karadimitris, A., Haskard, D.O., Papa, S., and Bubici, C. (2013). Poly(ADP-

ribose) polymerase family member 14 (PARP14) is a novel effector of the JNK2-

dependent pro-survival signal in multiple myeloma. Oncogene 32 , 4231–4242.

B Expression and Puriﬁcation of Human PARP1-3,

PARP10_cat, PARP15_cat, and SRPK2

B Expression and Puriﬁcation of Human Full Length

PARP11_FLand PARP4_brct-cat

Bitler, B.G., Watson, Z.L., Wheeler, L.J., and Behbakht, K. (2017). PARP inhib-

itors: clinical utility and possibilities of overcoming resistance. Gynecol. Oncol.

147 , 695–704.

B Expression and Puriﬁcation of Human PARP7_FL

B Expression and Puriﬁcation of Human PARP14_cat-wwe

B Histone H1 Plate Assays

Carter-O’Connell, I., Jin, H., Morgan, R.K., David, L.L., and Cohen, M.S.

(2014). Engineering the substrate speciﬁcity of ADP-ribosyltransferases for

identifying direct protein targets. J. Am. Chem. Soc. 136 , 5201–5204.

B SRPK2 Plate Assays

B NXF1 Plate Assay

Carter-O’Connell, I., Jin, H., Morgan, R.K., Zaja, R., David, L.L., Ahel, I., and

Cohen, M.S. (2016). Identifying family-member-speciﬁc targets of mono-

ARTDs by using a chemical genetics approach. Cell Rep. 14 , 621–631.

B Auto-modiﬁcation Plate Assay for PARP4_brct-cat

B Auto-modiﬁcation Plate Assay for PARP7_FL

B Native NAD⁺Plate Assay

Donawho, C.K., Luo, Y., Luo, Y., Penning, T.D., Bauch, J.L., Bouska, J.J.,

Bontcheva-Diaz, V.D., Cox, B.F., DeWeese, T.L., Dillehay, L.E., et al. (2007).

ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potenti-

ates DNA-damaging agents in preclinical tumor models. Clin. Cancer Res.

13 , 2728–2737.

B PARP Immunoprecipitation auto-MARylation Activ-

ity Assay

B GFP-PARP10 MARylation in Cells

B H₂O₂-stimulated H-Y-E PARP Activation

B GFP-PARP11 auto-MARylation in Cells

B Imaging Experiments in HeLa Cells

B Chemical Synthesis

Ekblad, T., Lindgren, A.E.G., Andersson, C.D., Caraballo, R., Thorsell, A.-G.,

€

Karlberg, T., Spjut, S., Linusson, A., Schuler, H., and Elofsson, M. (2015).

Towards small molecule inhibitors of mono-ADP-ribosyltransferases. Eur. J.

Med. Chem. 95 , 546–551.

B Crystallography Studies

Gibson, B.A., Conrad, L.B., Huang, D., and Kraus, W.L. (2017). Generation and

characterization of recombinant antibody-like ADP-ribose binding proteins.

Biochemistry 56 , 6305–6316.

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND SOFTWARE AVAILABILITY

6

Cell Chemical Biology 25, 1–7, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Gupte, R., Liu, Z., and Kraus, W.L. (2017). PARPs and ADP-ribosylation: recent

advances linking molecular functions to biological outcomes. Genes Dev. 31 ,

101–126.

Morgan, R.K., and Cohen, M.S. (2015). A clickable aminooxy probe for moni-

toring cellular ADP-ribosylation. ACS Chem. Biol. 10 , 1778–1784.

Morgan, R.K., Carter-O’Connell, I., and Cohen, M.S. (2015). Selective inhibi-

tion of PARP10 using a chemical genetics strategy. Bioorg. Med. Chem.

Lett. 25 , 4770–4773.

€

Hottiger, M.O., Hassa, P.O., Luscher, B., Schuler, H., and Koch-Nolte, F.

(2010). Toward a uniﬁed nomenclature for mammalian ADP-ribosyltrans-

ferases. Trends Biochem. Sci. 35 , 208–219.

€

Peng, B., Thorsell, A.-G., Karlberg, T., Schuler, H., and Yao, S.Q. (2016). Small

Huang, J.Y., Wang, K., Vermehren Schmaedick, A., Adelman, J.P., and Cohen,

M.S. (2016). PARP6 is a regulator of hippocampal dendritic morphogenesis.

Sci. Rep. 6 , 208.

molecule microarray based discovery of PARP14 inhibitors. Angew. Chem. Int.

Ed. 56 , 248–253.

€

Pinto, A.F., and Schuler, H. (2015). Comparative structural analysis of the pu-

Huang, S.-M.A., Mishina, Y.M., Liu, S., Cheung, A., Stegmeier, F., Michaud,

G.A., Charlat, O., Wiellette, E., Zhang, Y., Wiessner, S., et al. (2009).

Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature

461 , 614–620.

tative mono-ADP-ribosyltransferases of the ARTD/PARP family. Curr. Top.

Microbiol. Immunol. 384 , 153–166.

´

Rolli, V., O’Farrell, M., Menissier-de Murcia, J., and de Murcia, G. (1997).

Random mutagenesis of the poly(ADP-ribose) polymerase catalytic domain

reveals amino acids involved in polymer branching. Biochemistry 36 ,

12147–12154.

Iansante, V., Choy, P.M., Fung, S.W., Liu, Y., Chai, J.-G., Dyson, J., Del Rio, A.,

D’Santos, C., Williams, R., Chokshi, S., et al. (2015). PARP14 promotes the

Warburg effect in hepatocellular carcinoma by inhibiting JNK1-dependent

PKM2 phosphorylation and activation. Nat. Commun. 6 , 7882.

Thomas, H.D., Calabrese, C.R., Batey, M.A., Canan, S., Hostomsky, Z., Kyle,

S., Maegley, K.A., Newell, D.R., Skalitzky, D., Wang, L.Z., et al. (2007).

Preclinical selection of a novel poly(ADP-ribose) polymerase inhibitor for clin-

ical trial. Mol. Cancer Ther. 6 , 945–956.

Johannes, J.W., Almeida, L., Barlaam, B., Boriack-Sjodin, P.A., Casella, R.,

Croft, R.A., Dishington, A.P., Gingipalli, L., Gu, C., Hawkins, J.L., et al.

(2015). Pyrimidinone nicotinamide mimetics as selective tankyrase and Wnt

pathway inhibitors suitable for in vivo pharmacology. ACS Med. Chem. Lett.

6 , 254–259.

Thorsell, A.-G., Ekblad, T., Karlberg, T., L o ¨ w, M., Pinto, A.F., Tr e ´ saugues, L.,

€

Moche, M., Cohen, M.S., and Schuler, H. (2017). Structural basis for potency

and promiscuity in poly(ADP-ribose) polymerase (PARP) and tankyrase inhib-

Jørgensen, R., Merrill, A.R., Yates, S.P., Marquez, V.E., Schwan, A.L., Boesen,

T., and Andersen, G.R. (2005). Exotoxin A–eEF2 complex structure indicates

ADP ribosylation by ribosome mimicry. Nature 436 , 979–984.

itors. J. Med. Chem. 60 , 1262–1271.

Upton, K., Meyers, M., Thorsell, A.-G., Karlberg, T., Holechek, J., Lease, R.,

Schey, G., Wolf, E., Lucente, A., Sch ler, H., et al. (2017). Design and synthesis

of potent inhibitors of the mono(ADP-ribosyl)transferase, PARP14. Bioorg.

Med. Chem. Lett. 27 , 2907–2911.

Jørgensen, R., Wang, Y., Visschedyk, D., and Merrill, A.R. (2008). The nature

and character of the transition state for the ADP-ribosyltransferase reaction.

EMBO Rep. 9 , 802–809.

€

¨

Venkannagari, H., Fallarero, A., Feijs, K.L.H., Luscher, B., and Lehtio, L. (2013).

Activity-based assay for human mono-ADP-ribosyltransferases ARTD7/

PARP15 and ARTD10/PARP10 aimed at screening and proﬁling inhibitors.

Eur. J. Pharm. Sci. 49 , 148–156.

Langelier, M.-F., Riccio, A.A., and Pascal, J.M. (2014). PARP-2 and PARP-3

are selectively activated by 5⁰phosphorylated DNA breaks through an allo-

steric regulatory mechanism shared with PARP-1. Nucleic Acids Res. 42 ,

7762–7775.

Venkannagari, H., Verheugd, P., Koivunen, J., Haikarainen, T., Obaji, E.,

Marsischky, G.T., Wilson, B.A., and Collier, R.J. (1995). Role of glutamic acid

988 of human poly-ADP-ribose polymerase in polymer formation. Evidence

for active site similarities to the ADP-ribosylating toxins. J. Biol. Chem. 270 ,

3247–3254.

€

¨

Ashok, Y., Narwal, M., Pihlajaniemi, T., Luscher, B., and Lehtio, L. (2016).

Small-molecule chemical probe rescues cells from mono-ADP-ribosyltrans-

ferase ARTD10/PARP10-induced apoptosis and sensitizes cancer cells to

DNA damage. Cell Chem. Biol. 23 , 1251–1260.

Mehrotra, P., Hollenbeck, A., Riley, J.P., Li, F., Patel, R.J., Akhtar, N., and

Goenka, S. (2013). Poly (ADP-ribose) polymerase 14 and its enzyme activity

regulates TH2 differentiation and allergic airway disease. J. Allergy Clin.

Immunol. 131 , 521–531.e1–12.

Vyas, S., Matic, I., Uchima, L., Rood, J., Zaja, R., Hay, R.T., Ahel, I., and Chang,

P. (2014). Family-wide analysis of poly(ADP-ribose) polymerase activity. Nat.

Commun. 5 , 4426.

Wahlberg, E., Karlberg, T., Kouznetsova, E., Markova, N., Macchiarulo, A.,

Menear, K.A., Adcock, C., Boulter, R., Cockcroft, X.-L., Copsey, L., Cranston,

A., Dillon, K.J., Drzewiecki, J., Garman, S., Gomez, S., et al. (2008). 4-[3-(4-cy-

clopropanecarbonylpiperazine-1-carbonyl)-4-ﬂuorobenzyl]-2H-phthalazin-1-

one: a novel bioavailable inhibitor of poly(ADP-ribose) polymerase-1. J. Med.

Chem. 51 , 6581–6591.

˚

¨

€

Thorsell, A.-G., Pol, E., Frostell, A., Ekblad, T., Oncu, D., et al. (2012).

Family-wide chemical proﬁling and structural analysis of PARP and tankyrase

inhibitors. Nat. Biotechnol. 30 , 283–288.

Yoneyama-Hirozane, M., Matsumoto, S.-I., Toyoda, Y., Saikatendu, K.S.,

Zama, Y., Yonemori, K., Oonishi, M., Ishii, T., and Kawamoto, T. (2017).

Identiﬁcation of PARP14 inhibitors using novel methods for detecting auto-ri-

bosylation. Biochem. Biophys. Res. Commun. 486 , 626–631.

Meyer-Ficca, M.L., Ihara, M., Bader, J.J., Leu, N.A., Beneke, S., and Meyer,

R.G. (2015). Spermatid head elongation with normal nuclear shaping requires

ADP-ribosyltransferase PARP11 (ARTD11) in mice1. Biol. Reprod. 92 , 80.

Cell Chemical Biology 25, 1–7, December 20, 2018

7

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies

Polyclonal anti-GFP produced in chicken

HRP-conjugated streptavidin antibody

Abcam

Cat# ab13970, RRID:AB_300798

Cat# 016-030-084; RRID:AB_2337238

Cat# 83732S; RRID:AB_2749864

Jackson Immuno Research

Cell Signaling Technology

Monoclonal anti-poly/mono-ADP Ribose produced

in rabbit

Monoclonal anti-b-Actin produced in mouse

Polyclonal anti-GFP produced in rabbit

pan-ADP-ribose binding reagent

Santa Cruz Biotechnology

ChromoTek

Cat# sc-47778, RRID:AB_2714189

Cat# PABG1; RRID:AB_2749857

Cat# MABE1016; RRID:AB_2665466

Milipore

Bacterial and Virus Strains

Escherichia coli BL21 (DE3) competent cells

Chemicals, Peptides, and Recombinant Proteins

Millipore

Cat# 69450

Custom

6-alkyne-nicotinamide adenine dinucleotide

(N-6 alkyne-NAD⁺) (Carter-O’Connell et al., 2014)

Synthesized according to

published literature

Ampicillin

Fisher Scientiﬁc

BD Biosciences

Click chemistry tools

Fisher Scientiﬁc

IDT

Cat# BP1760-5

Cat# 211699

Cat# AZ104

Bacto Tryptone

Biotin-PEG3-azide

Chloramphenicol

Cat# BP904-100

Cat# D16500

Custom

Dextrose

Dnick 5’P for PARP3 activation (Langelier et al., 2014)

DMEM

Thermo-Fisher

VWR

Cat# 11965092

Cat# 10790-710

Cat# BP381-1

Cat# BP310-1

Cat# H325-100

Cat# BP9065

Cat# 507517565

Formaldehyde, 37% solution

Glycine

Fisher Scientiﬁc

Sigma

HEPES

Hydrogen peroxide, 30%

Kanamycin

NP-40 Substitute

Phosphatase inhibitor cocktails 2 and 3

Cat# P5726-1ML,

Cat# P0044-1ML

Potassium phosphate dibasic

Potassium phosphate monobasic

ProLong Diamond Antifade Mountant with DAPI

Strep-HRP

Sigma-Aldrich

Invitrogen

Cat# P3786-500g

Cat# P9791-100G

Cat# P36966

Fisher Scientiﬁc

Click chemistry tools

Fisher Scientiﬁc

Selleck Chemicals

Fisher Scientiﬁc

Sigma-Aldrich

Cat# NC9705430

Cat# PI-20490

TCEP

Tris[(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA)

Triton X-100

Cat# 1061-100

Cat# BP151-500

Cat# S1004

Veliparib (ABT-888)

Yeast extract

Cat# DF0127-07-1

Cat# M3148-100mL

b-mercaptoethanol

Critical Commercial Assays

QuantaRedꢀ Enhanced Chemiﬂuorescent HRP Substrate

CalPhos mammalian transfection kit

ECL HRP substrate (SuperSignalTM West Fempto)

ECL HRP substrate (SuperSignalTM West Pico)

GFP-Trap magnetic beads

Thermo-Fisher

Fischer Scientiﬁc

Chromotek

Cat# 15159

Cat# NC9567834

Cat# PI34095

Cat# PI34080

Cat# gtm-20

Lipofectamine 2000

Invitrogen

Cat# 11668027

(Continued on next page)

e1 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Continued

REAGENT or RESOURCE

Lipofectamine 3000

Glutatione Sepharose 4B

Ni-NTA Agarose

SOURCE

IDENTIFIER

Thermo-Fisher

Fisher Scientiﬁc

Qiagen

Cat# L3000008

Cat# 50-197-954

Cat# 30210

Deposited Data

RCSB Protein Data Bank

Experimental Models: Cell Lines

HEK 293T cells

This paper

PDB: 6FYM and 6FZM

PDB: 3SMI

Wahlberg et al., 2012

ATCC

Cat# CRL-3216

HeLa

Gift from the Schultz

lab (OHSU)

Cat# RRID:CVCL_0058

Oligonucleotides

ATCGAGGAAAACCTGTACTTCCAATCCAATTTT

CACAAAGCAGAAGAATTATTTTCT

Euroﬁns Genomics

Forward primer PARP11

Reverse primer PARP11

Forward primer for PARP4

Reverse primer PARP4

CTCGAATTCGGATCCGTTATCCACTTCCAATT

CAATGAAAGTCTATCAAGTACTCAGGAT

TACTTCCAATCCAATGCAGTGATGGGAATCTTT

GCAAATTG

TTATCCACTTCCAATGTTATTAGTCCTTTATCTG

ATCTCCAGGCAT

Recombinant DNA

mRuby2-Nup50-N-10

Software and Algorithms

GraphPad Prism

Addgene

Cat# 55908

GraphPad Software Inc

https://www.graphpad.com/scientiﬁc-

software/prism/

Biorad ChemiDock MP (gel imaging)

Image lab 4.0.1

Biorad

Bio-Rad

http://www.bio-rad.com/en-us/product/

image-lab-software?ID=KRE6P5E8Z

MacPymol educational v1.74

Mnova NMR

Schrodinger

https://pymol.org/2/

Mestrelab Research

ImageJ developers

Olympus Life Science

http://mestrelab.com/software/mnova/nmr/

https://imagej.net

ImageJ v1.51s

Olympus ﬂuoview v4.2a

https://www.olympus-lifescience.com/

en/software/cellsens/

Other

96-well Histone H1 strip plate

96-well nickel coated plate

Lab-Tek dishes

Trevigen

Cat# 4678-096-P

Cat# 15242

Thermo Scientiﬁc

Fisher Scientiﬁc

Thermo Scientiﬁc

Cat# 12-565-7

Cat# 12-545-81

Cat# 3050

Microscope cover glass

Miscroscope slides

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the corresponding author,

Michael S. Cohen (cohenmic@ohsu.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

All bacterial strains used in this study are listed in the Key Resources Table with their source and genotypes. For E. coli, unless stated

otherwise, the strains were grown in TB media supplemented with the appropriate antibiotics.

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e2

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

METHOD DETAILS

Cloning

cDNA encoding full length human PARP1, full length human PARP2, human PARP10 catalytic domain, human PARP15 catalytic

domain, GFP-PARP11^WT, GFP-PARP11^IG, NXF1, and SRPK2 were obtained as previously described (Carter-O’Connell et al.,

2014; Meyer-Ficca et al., 2015; Morgan and Cohen, 2015; Carter-O’Connell et al., 2016). cDNA encoding full length human

PARP11 and cDNA encoding the human PARP4 catalytic and BRCT domains (aa1-572, PARP4_brct-cat) were obtained using gBlock

gene fragments containing the PARP11 gene as template (IDT) and the following primers (IDT) for subsequent Gibson assembly

cloning: Forward- ATCGAGGAAAACCTGTACTTCCAATCCAATTTTCACAAAGCAGAAGAATTATTTTCT, Reverse CTCGAATTCG

GATCCGTTATCCACTTCCAATTCAATGAAAGTCTATCAAGTACTCAGGAT (PARP11) and forward- TACTTCCAATCCAATGCAGT

GATGGGAATCTTTGCAAATTG and reverse- TTATCCACTTCCAATGTTATTAGTCCTTTATCTGATCTCCAGGCAT (PARP4_brct-cat).

The ampliﬁed fragments were gel puriﬁed and cloned into a pET-His-SUMO-TEV LIC cloning vector (1B), a gift from Scott Gradia

(Addgene plasmid # 29653) by an isothermal assembly protocol using the Gibson assembly mix (NEB). cDNA encoding the human

PARP14 catalytic and WWE domains (aa1459-1801, PARP14_cat-wwe) was cloned into the pNIC-Bsa4 vector using standard

procedures.

Expression and Puriﬁcation of Human PARP1-3, PARP10_cat, PARP15_cat, and SRPK2

N-terminal hexahistidine (His₆) human PARP1, PARP2, PARP5b_cat, PARP10_cat, PARP15_cat, and SRPK2 were expressed as previ-

ously described (Carter-O’Connell et al., 2014; Morgan and Cohen, 2015). Greater than or equal to 90% purity was achieved for

human PARP1, PARP2, PARP10_cat, and PARP15_cat. PARP3_FLGreater than or equal to 70% purity was achieved for SRPK2. Protein

concentration and purity were determined by comparison to an in-gel standard curve of BSA (Bio-Rad). Purity of all proteins is shown

in Figure S1.

Expression and Puriﬁcation of Human Full Length PARP11_FLand PARP4_brct-cat

pET-His-SUMO-TEV-PARP11_FLor -PARP4_brct-catplasmid was transformed into Escherichia coli BL21 (DE3) competent cells (Milli-

pore) for His₆-SUMO-PARP4/11 expression and grown on LB agar plates (with kanamycin and chloramphenicol) overnight at 37^ꢀC.

A swath of cells was inoculated into a 10 mL starter culture of LB media (with 50 mg/mL kanamycin, 34 mg/mL chloramphenicol) at

225 rpm, 37^ꢀC overnight. One or more liters of terriﬁc broth (TB) media (12 g bacto tryptone, 24 g yeast extract, 0.4% glycerol,

17 mM KH₂PO_4,72 mM K₂HPO_4,1% glucose, 50 mg/mL kanamycin, 34 mg/mL chloramphenicol) was inoculated with the starter cul-

ture and grown to an OD = 0.4-0.5 at 37^ꢀC, 225 rpm. Isopropyl-b-thiogalactoside, IPTG (Sigma-Aldrich) was added to 0.4 mM to

induce protein expression for 2.5-3 hrs at 37^ꢀC, 225 rpm. Cells were harvested by centrifuging, resuspended in lysis buffer

(20 mM HEPES, pH 7.5, 1 mM b-mercaptoethanol, 1 mM benzamidine, 0.2% NP-40, 0.2% TWEEN-20, 500 mM NaCl, 1 mM phenyl-

methylsulfonyl ﬂuoride (PMSF), 8.3 mg/L DNAse I (Roche)) and lysed by sonication at 0^ꢀC (Branson soniﬁer 450). The lysate contain-

ing the soluble protein was clariﬁed by centrifugation (12,000g, 30 min at 4^ꢀC). PARP11 was puriﬁed in a single step using immobilized

metal afﬁnity chromatography (Ni-NTA resin, Qiagen). ꢁ70% purity was achieved for PARP11 and ꢁ90% purity for PARP4.

Expression and Puriﬁcation of Human PARP7_FL

GST-PARP7_FLwas expressed in Escherichia coli BL21 (DE3) competent cells (Millipore). Cells were ﬁrst cultured in LB media over-

night at 225 rpm and 37^ꢀC in an Excellaꢁ E24 Incubator (New Brunswick Scientiﬁc). Two liters of TB media (12 g bacto tryptone, 24 g

yeast extract, 0.4% glycerol, 17 mM KH₂PO_4,72 mM K₂HPO_4,1% glucose, 100 mg/mL ampicillin, mg/mL chloramphenicol) was inoc-

ulated with the starting culture and grown to OD₆₀₀= 1.0 at 225 rpm and 37^ꢀC. The temperature was reduced to 16^ꢀC and expression

was induced by adding isopropyl b-d-thiogalactoside (IPTG) to 0.4 mM. After incubation at 16^ꢀC for 24 h, cells were harvested by

centrifugation, resuspended in lysis buffer (20 mM HEPES, pH 7.5, 1 mM b-mercaptoethanol, 1 mM benzamidine, 0.2% NP-40,

0.2% TWEEN-20, 500 mM NaCl, 1 mM phenylmethylsulfonyl ﬂuoride (PMSF), 8.3 mg/L DNAse I (Roche)) at 4^ꢀC, and lysed by son-

ication at 0^ꢀC, and the resulting lysate was clariﬁed by centrifugation at 12,000 G for 30 min at 4^ꢀC. PARP7_FLwas puriﬁed in a single

step using immobilized afﬁnity chromatography (Glutathione Sepharose 4B, Fisher Scientiﬁc). Greater than or equal to 90% purity

was achieved.

Expression and Puriﬁcation of Human PARP14_cat-wwe

N-terminal His₆-PARP14_cat-wwewas expressed in the Escherichia coli BL21 (DE3) competent cells (Millipore). Cells were ﬁrst

cultured in LB media overnight at 225 rpm and 37^ꢀC in an Excellaꢁ E24 Incubator (New Brunswick Scientiﬁc). Two liters of TB media

(12 g bacto tryptone, 24 g yeast extract, 0.4% glycerol, 17 mM KH₂PO_4,72 mM K₂HPO_4,1% glucose, 50 mg/mL kanamycin, 34 mg/mL

chloramphenicol) was inoculated with the starting culture and grown to OD₆₀₀= 1.0 at 225 rpm and 37^ꢀC. The temperature was

reduced to 16^ꢀC and expression was induced by adding isopropyl b-d-thiogalactoside (IPTG) to 0.4 mM. After incubation at 16^ꢀC

for 24 h, cells were harvested by centrifugation, resuspended in lysis buffer (20 mM HEPES, pH 7.5, 1 mM b-mercaptoethanol,

1 mM benzamidine, 0.2% NP-40, 0.2% TWEEN-20, 500 mM NaCl, 1 mM phenylmethylsulfonyl ﬂuoride (PMSF), 8.3 mg/L DNAse I

(Roche)) at 4^ꢀC, and lysed by sonication at 0^ꢀC, and the resulting lysate was clariﬁed by centrifugation at 12,000 G for 30 min at

4^ꢀC. PARP14_cat-wwewas puriﬁed in a single step using immobilized metal afﬁnity chromatography (Ni-NTA resin, Qiagen). Greater

than or equal to 90% purity was achieved.

e3 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Histone H1 Plate Assays

52 nM PARP1 or 46 nM PARP2 in pB (20 mM HEPES pH 7.5, 5 mM MgCl₂, 5 mM CaCl₂, 0.01% NP-40, 25 mM KCl, 0.5 mM TCEP,

0.1 mg/mL activated DNA (Sigma) were added to individual wells of an 96-well Histone H1 strip plate (Trevigen). Varying concentra-

tions of each inhibitor (0-200 mM) were pre-incubated with 200 mM 6-a-NAD⁺in pB at RT for 5-10 min, then added to the histone plate.

Final reaction concentrations: 26 nM PARP1, 23 nM PARP2, 0-100 mM inhibitor, and 100 mM 6-a-NAD⁺. This reaction proceeded for

30 min at 30^ꢀC, then the plate was washed three times with 1X PBS, three times with 1X PBST (1X PBS, 0.1% Triton X-100), once with

1X PBS, then click conjugation was performed in CB (100 mM biotin-PEG3-azide, 100 mM Tris[(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]

amine (TBTA, Sigma), 1 mM CuSO₄, 1 mM TCEP, 1X PBS) for 30 min at RT. The plate was then washed three times with 1X PBS, three

times with 1X PBST, once with 1X PBS, and then blocked with 1% milk (Carnation) in 1X PBST for 30 min at RT. The plate was then

washed three times with 1X PBS, three times with 1X PBST, once with 1X PBS, and then incubated with Strep-HRP (300 ng/mL BSA,

0.05 ng/mL Strep-HRP, 1X PBS) for 30 min at RT. The plate was then washed three times with 1X PBS, three times with 1X PBST, once

with 1X PBS, and then developed with QuantaRedꢀ Enhanced Chemiﬂuorescent HRP Substrate (Thermo) for 30-45 s before

quenching with Quanta Red Stop Solution. Fluorescence for each sample and control was read at excitation 570 nM and emission

600 nM with a Spectra Max i3 (Molecular Devices) within ﬁve min of development. Inhibitor dose response curves were ﬁt using linear

regression in Prism 7 (GraphPadꢀ Software). The mean IC₅₀for each compound was calculated from at least three independent

assays.

SRPK2 Plate Assays

96-well nickel coated plate (Pierce) was incubated with 350 ng His₆-tagged SRPK2 in hB (50 mM HEPES pH 7.5, 100 mM NaCl,

4 mM MgCl₂, 0.2 mM TCEP) for 60 min at RT. After extensively washing the plate, 2-600 ng (2x) of H-Y-F PARPs (PARP10, 11,

14, and 15) and H-Y-E PARPs (PARP3_FLand PARP5b_cat) in hB were added to individual wells of the 96-well plate. PARP3_FLwas acti-

vated by Dnick 5’P as described previously (Langelier et al., 2014). Varying concentrations of each inhibitor (0-200 mM) were pre-incu-

bated with 200 mM 6-a-NAD⁺(2x) in hB at room temperature for 5-10 min, then added to the plate. This reaction proceeded for 60 min

at 30^ꢀC, the plate was then washed three times with 1X PBST (1X PBS, 0.01% Tween-20), once with 1X PBS, then click conjugation

was performed in CB (100 mM biotin-PEG3-azide, 100 mM Tris[(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA, Sigma), 1 mM

CuSO₄, 1 mM TCEP, 1X PBS) for 30 min at RT. The plate was then washed three times with 1X PBST, once with 1X PBS, and

then blocked with 1% milk (Carnation) in 1X PBST for 30 min at RT. The plate was then washed three times with 1X PBST, once

with 1X PBS, and then incubated with Strep-HRP (300 ng/mL BSA, 0.05 ng/mL Strep-HRP, 1X PBS) for 30 min at RT. The plate

was then washed three times with 1X PBST, once with 1X PBS, and then developed with QuantaRedꢀ Enhanced Chemiﬂuorescent

HRP Substrate (Thermo) for 30-45 s before quenching with Quanta Red Stop Solution. Fluorescence for each sample and control was

read at excitation 570 nM and emission 600 nM with a Spectra Max i3 (Molecular Devices) within ﬁve min of development. Inhibitor

dose response curves were ﬁt using linear regression in Prism 7 (GraphPadꢀ Software). The mean IC₅₀for each compound was

calculated from at least three independent assays.

NXF1 Plate Assay

96-well nickel coated plate (Pierce) was incubated with 350 ng His₆tagged NXF1 in hB (50 mM HEPES pH 7.5, 100 mM NaCl,

4 mM MgCl₂, 0.2 mM TCEP) for 60 min at RT. The rest of this assay was carried out according to the above procedure for SRPK2

plate assays for H-Y-F PARPs.

Auto-modiﬁcation Plate Assay for PARP4_brct-cat

96-well nickel coated plate (Pierce) was incubated with 500 ng His₆-SUMO tagged PARP4_brct-catin hB (50 mM HEPES pH 7.5,

100 mM NaCl, 4 mM MgCl₂, 0.2 mM TCEP) for 60 min at RT. After extensively washing the plate, 660 ng of PARP4_CBin hB was added

to individual wells of the 96-well plate. Varying concentrations of each inhibitor (0-200 mM) were pre-incubated with 200 mM 6-a-NAD⁺

in hB at room temperature for 5-10 min, then added to the plate. The rest of this assay is carried according to the above procedure for

SRPK2 Plate Assays for H-Y-F PARPs.

Auto-modiﬁcation Plate Assay for PARP7_FL

96-well glutathione coated plate (Pierce) was incubated with 250 ng GST tagged PARP7_FLin hB (50 mM HEPES pH 7.5,

100 mM NaCl, 4 mM MgCl₂, 0.2 mM TCEP) for 60 min at RT. After extensively washing the plate, 100 ng of PARP7_FLin hB was added

to individual wells of the 96-well plate. Varying concentrations of each inhibitor (0-200 mM) were pre-incubated with 200 mM 6-a-NAD⁺

in hB at room temperature for 5-10 min, then added to the plate. The rest of this assay is carried according to the above procedure for

SRPK2 Plate Assays for H-Y-F PARPs.

Native NAD⁺Plate Assay

96-well nickel coated plate (Pierce) was incubated with 350 ng His₆-tagged SRPK2 in hB (50 mM HEPES pH 7.5, 100 mM NaCl,

4 mM MgCl₂, 0.2 mM TCEP) for 60 min at RT. After extensively washing the plate, 2-660 ng (2x) of H-Y-F PARPs (PARP10, 11,

14, and 15) and H-Y-E PARPs (PARP3_FLand PARP5b_cat) in hB were added to individual wells of the 96-well plate. PARP3_FLwas

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e4

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

activated by Dnick 5’P as described previously ((Langelier et al., 2014). Varying concentrations of each inhibitor (0-200 mM) were pre-

incubated with 200 mM NAD+ (2x) in hB at room temperature for 5-10 min, then added to the plate. This reaction proceeded for 60 min

at 30^ꢀC, the plate was then washed three times with 1X PBST (1X PBS, 0.01% Tween-20), then blocked with 1% milk (Carnation) in 1X

PBST for 30 min at RT. The plate was then washed three times with 1X PBST, once with 1X PBS, and then incubated with a pan-ADP-

ribose binding reagent (MABE1016, Millipore) (Gibson et al., 2017) for 30 h at RT The plate was then washed three times with 1X

PBST, once with 1X PBS, and then incubated with HRP-conjugated secondary antibodies. The plate was then washed three times

with 1X PBST, once with 1X PBS, and then developed with QuantaRedꢀ Enhanced Chemiﬂuorescent HRP Substrate (Thermo) for

30-45 s before quenching with Quanta Red Stop Solution. Fluorescence for each sample and control was read at excitation 570 nM

and emission 600 nM with a Spectra Max i3 (Molecular Devices) within ﬁve min of development. Inhibitor dose response curves were

ﬁt using linear regression in Prism 7 (GraphPadꢀ Software).

PARP Immunoprecipitation auto-MARylation Activity Assay

PARP immunoprecipitation auto-MARylation activity assays were performed as previously described (Huang et al., 2016), with

some modiﬁcations. HEK 293T cells were transfected with GFP-tagged PARP6, PARP7, PARP8, PARP12 and PARP16 expression

plasmids (generated in house) containing an N-terminus GFP epitope. HEK 293T cells plated on 6-well plates (Greiner Bio-One)

were transfected with 3.5 mg plasmid per well using CalPhos mammalian transfection kit (Clontech). Cells were collected 24 h

post-transfection and lysed in 250 mL per well with cytosolic lysis buffer (CLB: 50mM HEPES [pH 7.4], 150 mM NaCl, 1 mM

MgCl₂, 1 mM TCEP, 1% Triton X-100; complemented with complete protease inhibitors (Roche), phosphatase inhibitor cocktails

2 and 3 (Sigma), and 1 mM veliparib, a PARP1/2-selective inhibitor). Lysates were centrifuged at 10,000 rpm for 10 min at 4^ꢀC and

supernatants were transferred to new sample tubes. 40 mL of suspended GFP-Trap magnetic bead slurry (Chromotek) were added

to 1 mg protein lysates for 1 h at 4^ꢀC with constant rotation to immunoprecipitate GFP-PARPs. Following removal of supernatant,

beads were washed three times with CLB, and once with PARP reaction buffer (PRB: 50 mM Tris-HCl [pH 7.5], 50 mM NaCl, 0.5 mM

TCEP, 0.1% Triton X- 100; complemented with complete TM protease inhibitors phosphatase inhibitor cocktails 2 and 3, and 1 mM

veliparib), for 5 min per wash, and splitting the samples into two during the last PRB wash. For the ADPr labeling, 100 mM 6-alkyne-

nicotinamide adenine dinucleotide (6-a-NAD⁺) ((Carter-O’Connell et al., 2014)) in 50 ul PRB was added to beads and incubated for

1.5 h at 25^ꢀC/650 rpm (400mM of 6-a-NAD+ for GFP-PARP16), in the presence or absence of 30 mM ITK7 inhibitor. Following

removal of 6-a-NAD⁺, beads were washed twice with PRB and once with PBS for 5 min per wash. Click reaction mixture

(1 mM CuSO4, 1 mM TCEP, 100 mM TBTA, 100 mM biotin-azide; 25 mL volume) was added to beads and incubated for 1 h at

25^ꢀC/650 rpm. Following removal of click reaction mixture, 40 mL of 1.5X LaemmLi sample buffer with 5% b-mercaptoethanol

was added to beads. Samples were heated at 95^ꢀC for 5 min and supernatants were resolved by SDS-PAGE and transferred

onto 0.45 mm nitrocellulose membranes (GE healthcare bio-sciences). Membrane blots were blocked with 5% milk-TBST for

1 h at room temperature. Blots were probed for PARP6 expression with anti-GFP primary antibody (chicken polyclonal, Abcam

clone ab13970, 1:5000) for 2 h at room temperature and HRP-conjugated goat anti-chicken IgG secondary antibody for 1 h at

room temperature. To detect PARP6 auto-MARylation activity, blots were probed for biotinylated proteins with HRP-conjugated

streptavidin antibody (Jackson ImmunoResearch, 0.4 mg/mL) for 60 min at room temperature. ECL HRP substrate (SuperSignalTM

West Pico, ThermoFisher) was added to detect protein targets by chemiluminescence. Blots were imaged for chemiluminescent

signal on a ChemiDoc MP system (Bio-Rad).

GFP-PARP10 MARylation in Cells

HEK 293T cells were transfected with GFP-PARP10 using the calcium phosphate method (Clontech). 24 h post transfection,

cells were treated with increasing concentrations of ITK6 (90 min) in serum-free media at 37^ꢀC. Cells were washed with PBS,

and lysed (CLB: 50 mM HEPES [pH 7.4], 150 mM NaCl, 1 mM MgCl₂, 1 mM TCEP, 1% Triton X-100) with protease inhibitors

(Roche). Lysates were centrifuged at 14,000 rpm for 10 min at 4^ꢀC and supernatants were transferred to a new tube with 2x

LaemmLi sample buffer with 5% b-mercaptoethanol. Samples were resolved by SDS-PAGE and transferred onto nitrocellulose

membranes. Membrane blots were blocked with 5% milk-TBST for 60 min at RT, followed by incubation with a pan-ADP-ribose

binding reagent (MABE1016, Millipore) or a chicken GFP antibody (ab13970, Abcam) for 60 min at RT, followed by incubation

with HRP-conjugated secondary antibodies. Proteins were detected by chemiluminescence and imaged on a ChemiDoc MP

system (Bio-Rad).

H₂O₂-stimulated H-Y-E PARP Activation

HEK 293T cells were pre-treated with the indicated concentrations of ITK7 or veliparib for 15 min at 37^ꢀC, followed by incubation with

H₂O₂(500 mM) for an additional 15 min. Cells were washed with PBS, lysed in CLB (50 mM HEPES [pH 7.4], 150 mM NaCl, 1 mM

MgCl₂, 1 mM TCEP, 1% Triton X-100), and prepared for Western blot analysis as described above.

GFP-PARP11 auto-MARylation in Cells

HeLa cells were transfected with 3 mg of WT GFP-PARP11 using Lipofectamine 3000 (Thermo Fisher). 24 h post transfection, cells

were treated with increasing concentrations of ITK7 in serum-free media at 37^ꢀC for 3 h. Cells were lysed in cytosolic lysis buffer

e5 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

(CLB: 50 mM HEPES [pH 7.4], 150 mM NaCl, 1 mM MgCl₂, 1% Triton X-100) in the presence of protease inhibitors (Roche),

phosphatase inhibitor cocktails 2 and 3 (Sigma), 3 mM veliparib, 1.2 mM phenylmethylsulfonyl ﬂuoride (Thermo Fisher), and 1mM

Tris(2-carboxyethyl)phosphine hydrochloride (Thermo Scientiﬁc). Lysates were centrifuged at 10,000 rpm for 10 min at 4^ꢀC and

supernatants were transferred to a new tube. Protein concentrations were determined via the Bradford Assay (Bio-Rad). Each sam-

ple was added to 4X sample buffer with 5% b-mercaptoethanol and brought to a ﬁnal volume of 20 mL. Samples were heated at 95^ꢀC

for 5 min and supernatants were resolved by SDS-PAGE before being transferred onto nitrocellulose membranes (Bio-Rad). Mem-

brane blots were blocked with 5% milk-TBST for 1 h at RT, followed by probing with a pan-ADP-ribose antibody (Cell Signaling mAb

83732, 1:1000), GFP primary antibody (ChromoTek, PABG1, 1:1000), or b-actin primary antibody (Santa Cruz Biotechnology 47778,

1:1000) for 2 h at RT. Blots were then incubated with HRP-conjugated secondary antibodies for 1 h at RT. Blots were exposed to ECL

HRP substrate (SuperSignalTM West Pico PLUS, ThermoFisher) to detect protein targets by chemiluminescence and imaged on a

ChemiDoc MP system (Bio-Rad).

Imaging Experiments in HeLa Cells

All images were acquired on an Olympus FV1200 microscope with a PLAPON 60x/1.4NA oil objective. Live cell imaging was

performed in DMEM on 37C with 5% CO₂. Cells were grown in NUNC glass bottom 8-well Lab-Tek dishes (Fisher). 25,000

cells were seeded per well, transfected using Lipofectamine2000 (Invitrogen) and imaged the next day. An image was ac-

quired every 20 s in the GFP channel, and cells were treated with DMSO or ITK7 directly in the Lab-Tek after the acquisition

of the 1^stframe. For ﬁxed samples, cells were seeded on glass coverslips (Fisher) and transfected using Lipofectamine2000

(Invitrogen). After treatments with ITK7 cells were ﬁxed with 5% PFA for 5 min. The ﬁxation was stopped by washing the

cells with 30 mM glycine (Fisher). After PBS wash coverslips were mounted on slides with ProLong Diamond Antifade

Mountant with DAPI (Invitrogen).

Chemical Synthesis

General

¹H NMR spectra were recorded on a Bruker DPX spectrometer at 400 MHz. Chemical shifts are reported as parts per million

(ppm) downﬁeld from an internal tetramethylsilane standard or solvent references. For air- and water-sensitive reactions, glass-

ware was ﬂame- or oven-dried prior to use and reactions were performed under argon. Dimethylformamide was dried using the

solvent puriﬁcation system manufactured by Glass Contour, Inc. (Laguna Beach, CA). All other solvents were of ACS chemical

grade (Fisher Scientiﬁc) and used without further puriﬁcation unless otherwise indicated. Commercially available starting re-

agents were used without further puriﬁcation. Analytical thin-layer chromatography was performed with silica gel 60 F254 glass

plates (SiliCycle). Flash column chromatography was conducted self-packed columns containing 200-400 mesh silica gel

(SiliCycle) on a Combiﬂash Companion puriﬁcation system (Teledyne ISCO). High performance liquid chromatography (HPLC)

was performed on a Varian Prostar 210 (Agilent) using Polaris 5 C18-A columns (Analytical: 150 x 4.6 mm, 3 mm; Preparative:

150 x 21.2 mm, 5 mm) (Agilent). All ﬁnal products were R95% pure as assessed by analytical HPLC (mobile phase A: 0.1% for-

mic acid (aq), mobile phase B: 0.1% formic acid in acetonitrile; ﬂow rate = 1.0 mL/min; conditions: pre-run A = % B = 30%,

10 min A = 5% B = 95%, 12 min A = 5% B = 95%, 13 min A = 70% B = 30%; UV-Vis detection: l₁= 254 nm, l₂= 220 nm.

Retention times (R_t) refer to UV = 254 nm.

2-hydroxyimino-N-(2-methyl-3-bromo-phenyl)-acetamide. Trichloroacetylaldehyde hydrate (976 mg, 5.92 mmol) and anhydrous

sodium sulfate (4.5 mg, 32 mmol) were dissolved in water (15 mL), and a suspension of 3-bromo-2-methylaniline (0.67 mL,

5.38 mmol) and hydroxylamine sulfate (4.4 g, 27 mmol) in 1 N HCl (6 mL) was added. The resultant suspension of white solids in clear

solution was stirred at 35^ꢀC for 1 h, then 52^ꢀC for 1.5 h, and ﬁnally 75^ꢀC for 1 h. The reaction mixture was cooled to RT and the

product isolated as pale tan solids by vacuum ﬁltration: 1.61 g (117% crude); ¹H NMR (400 MHz, Chloroform-d) d 8.23 (s, 1H),

7.88 (d, J = 8.1 Hz, 1H), 7.83 (s, 1H), 7.61 (s, 1H), 7.41 (d, J = 8.0 Hz, 1H), 7.10 (t, J = 8.1 Hz, 1H), 2.39 (s, 3H).

6-bromo-7-methylindoline-2,3-dione. 2-hydroxyimino-N-(2-methyl-3-bromo-phenyl)-acetamide (1.61 g, 6.24 mmol) was added

in small portions to 60^ꢀC sulfuric acid and stirred at 80^ꢀC for 1 h. The reaction mixture was cooled to RT and the product

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e6

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

isolated as bright orange solids by vacuum ﬁltration: 649 mg (50% crude); ¹H NMR (400 MHz, DMSO-d₆) d 11.28 (s, 1H), 7.34

(d, J = 8.0 Hz, 1H), 7.28 (d, J = 8.0 Hz, 1H), 2.24 (s, 3H).

2-amino-4-bromo-3-methylbenzoic acid. 6-bromo-7-methylindoline-2,3-dione (649 mg, 2.70 mmol) dissolved in 1.3 N NaOH

(135 mL) was combined with 30% H₂O₂(7.0 mL) and water (70 mL) and stirred RT for 1 h. The reaction mixture was acidulated

with 1 N HCl and the product precipitated as a white solid: 620 mg (99% crude, 45% over three steps); ¹H NMR (400 MHz,

DMSO-d₆) d 7.52 (d, J = 8.6 Hz, 1H), 6.78 (d, J = 8.7 Hz, 1H), 2.22 (s, 2H).

General Procedure for Synthesis of Benzoates

To a solution of the appropriate benzoic acid in methanol was added concentrated sulfuric acid (1% v/v) at RT. The reaction mixture

was reﬂuxed at 90^ꢀC for 18 h, monitored by TLC analysis (20% EtOAc in hexanes). Once complete the reaction mixture was poured

over saturated aqueous sodium bicarbonate and separated with EtOAc. The aqueous layer was extracted with EtOAc (3x). The

combined organic layers were washed with sat. aqueous sodium bicarbonate (1x), water (1x), and brine (1x), then dried over sodium

sulfate and concentrated in vacuo to yield desired benzoate.

Methy 2-amino-3-methylbenzoate. From 2-amino-3-methylbenzoic acid (500 mg, 3.3 mmol); yield 348 mg (64%); ¹H NMR

(400 MHz, Chloroform-d) d 7.77 (ddd, J = 8.1, 1.6, 0.6 Hz, 1H), 7.19 (ddq, J = 7.2, 1.7, 0.8 Hz, 1H), 6.59 (dd, J = 8.1, 7.2 Hz, 1H),

5.83 (s, 2H), 3.87 (s, 3H), 2.17 (d, J = 0.7 Hz, 3H).

Methyl 2-amino-3,4-dimethylbenzoate. From 2-amino-3,4-dimethylbenzoic acid (500 mg, 3.0 mmol); yield 400 mg (75%);

¹H NMR (400 MHz, Chloroform-d) d 7.67 (d, J = 8.2 Hz, 1H), 6.52 (d, J = 8.3 Hz, 1H), 5.86 (s, 2H), 3.86 (s, 3H), 2.29 (s, 3H), 2.07

(s, 3H).

Methyl 2-amino-4-bromo-3-methylbenzoate. From 2-amino-4-bromo-3-methylbenzoic acid (620 mg, 2.69 mmol); yield 454 mg

(69%); ¹H NMR (400 MHz, DMSO-d₆) d 7.52 (dd, J = 8.7, 4.5 Hz, 1H), 6.85 (s, 2H), 6.83–6.79 (m, 1H), 3.79 (d, J = 1.4 Hz, 3H),

2.23 (d, J = 5.4 Hz, 3H).

Methyl 2-amino-4-ethynyl-3-methylbenzoate. TMS-acetylene (0.85 mL, 6.15 mmol) and CuI (78 mg, 0.41 mmol) were dissolved in

anhydrous DMF (2 mL) in an oven dried bomb ﬂask (15 mL capacity) and stirred under argon at RT for 30 min; solution went from clear

e7 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

to orange. Pd(PPh₃)₂Cl₂(144 mg, 0.205 mmol), TEA (0.36 mL, 4.10 mmol), and Methyl 2-amino-4-bromo-3-methylbenzoate (500 mg,

2.05 mmol), and additional anhydrous DMF (10 mL) were quickly added and the ﬂask sealed under argon. The reaction proceeded at

110^ꢀC for 18 h, solution turned black over several h. The ﬂask was cooled to RT and the reaction mixture was diluted in EtOAc (20 mL)

and ﬁltered through celite. Organics were washed with water (100 mL, 3x), and brine (100 mL, 3x). The reaction was concentrated

in vacuo and the residue puriﬁed on a Combiﬂash Companion system (4 g Redisep silica column; 0-10% EtOAc in hexanes).

A mixture of the product (70%) and starting material (30%) was obtained as a yellow oil and taken on crude: 328 mg.¹H NMR

(400 MHz, DMSO-d₆) d 7.53 (d, J = 8.6 Hz, 1H), 6.85 (s, 2H), 6.81 (dd, J = 8.7, 1.5 Hz, 1H), 3.79 (d, J = 1.5 Hz, 3H), 2.23

(d, J = 1.4 Hz, 3H).

Methyl 2-amino-3-methyl-4-(prop-1-yn-1-yl)benzoate. Methyl 2-amino-3-methyl-4-bromobenzoate (200 mg, 0.99 mmol) was dis-

solved in anhydrous toluene and concentrated (3x 4 mL) then dried under vacuum for 1 h. The ﬂask was evacuated and reﬁlled with

argon gas (3x), then anhydrous toluene (8 mL) was added via syringe and the solution degassed with argon 10 min. Tributyl(1-pro-

pynyl)tin (0.36 mL, 1.20 mmol) was added via syringe and the solution degassed 5 min. Palladium tetrakis (124 mg, 0.11 mmol) was

added quickly and the solution degassed with argon for 3 min. The reaction mixture was reﬂuxed at 115^ꢀC for 2.5 h. TLC analysis

(10% EtOAc in hexanes) showed consumption of starting benzoate. The reaction was cooled to RT and concentrated in vacou.

The crude residue was puriﬁed via a Combiﬂash Companion system (4 g Redispe silica column; 0-20% EtOAc in hexanes). Product

was isolated as a solid: 130 mg (80%); ¹H NMR (400 MHz, Chloroform-d) d 7.68 (d, J = 8.3 Hz, 1H), 6.71 (d, J = 8.4 Hz, 1H), 5.88 (s, 2H),

3.86 (s, 3H), 2.28 (s, 3H), 2.11 (s, 3H).

General Procedure for Synthesis of quinazolin-4(3H)-ones

The appropriate benzoate was added to a ﬂame-dried ﬂask and dissolved in 4 M HCl (1,4-dioxane) under argon. To this

solution was added chloroacetonitrile (3 eqv.), and the reaction mixture was reﬂuxed under argon at 125^ꢀC overnight.

Once TLC analysis revealed consumption of the starting benzoate the reaction was cooled to RT and poured over cold

sat. Aqueous sodium bicarbonate and left to stand at 4^ꢀC. The desired quinazolin-4(3H)-one readily precipitated and was

collected by vacuum ﬁltration.

2-(chloromethyl)-8-methylquinazolin-4(3H)-one. From methyl 2-amino-3-methylbenzoate (250 mg, 1,52 mmol); yield 210 mg

(48%); ¹H NMR (400 MHz, DMSO-d₆) d 12.57 (s, 1H), 7.97 (d, J = 7.9 Hz, 1H), 7.70 (d, J = 7.5 Hz, 1H), 7.44 (t, J = 7.6 Hz, 1H),

4.56 (d, J = 1.3 Hz, 2H), 2.53 (d, J = 9.2 Hz, 3H).

2-(chloromethyl)-7,8-dimethlyquinazolin-4(3H)-one). From methyl 2-amino-3,4-dimethylbenozate (400 mg, 2.23 mmol); yield

343 mg (69%); ¹H NMR (400 MHz, Chloroform-d) d 9.53 (s, 1H), 8.05 (d, J = 8.1 Hz, 1H), 7.33 (d, J = 8.1 Hz, 1H), 4.60 (s, 2H), 2.54

(s, 3H), 2.44 (s, 3H).

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e8

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

2-(chloromethyl)-7-ethynyl-8-methylquinazolin-4(3H)-one. From methyl 2-amino-4-ethynyl-3-methylbenzoate (117 mg,

0.45 mmol); yield 80 mg (77%); ¹H NMR (400 MHz, Chloroform-d) d 10.48 (s, 1H), 8.10 – 8.05 (m, 1H), 7.55 (d, J = 8.3 Hz, 1H),

4.61 (s, 2H), 2.71 (s, 3H), 0.30 (s, 9H).

2-(chloromethyl)-8-methyl-7-(prop-1-yn-1-yl)quinazolin-4(3H)-one. From methyl 2-amino-3-methyl-4-(prop-1-yn-1-yl)benzoate

(125 mg, 0.62 mmol); yield 115 mg (82%).¹H NMR (400 MHz, DMSO-d₆) d 12.64 (s, 1H), 7.90 (d, J = 8.2 Hz, 1H), 7.47 (d,

J = 8.2 Hz, 1H), 4.56 (s, 2H), 2.62 (s, 3H), 2.16 (s, 3H).

General Procedure for Synthesis of ((pyrimidin-2-ylthio)methyl)quinazolin-4(3H)-ones

The appropriate thiol (2 eqv.) and sodium hydride (2 eqv.) were dissolved in anhydrous DMF and stirred at RT for 20 min. The appro-

priate quinazolin-4(3H)-one was added as a solid and the reaction mixture stirred at RT for 20 min. Once complete by TLC analysis

(100% EtOAc) the reaction was poured over water, isolated, and puriﬁed as indicated.

8-methyl-2-((pyrimidin-2-ylthio)methyl)quinazolin-4(3H)-one,

QDR2. From

2-(chloromethyl)-8-methylquinazolin-4(3H)-one

1

(112 mg, 0.54 mmol); reaction was concentrated in vacuo and product recovered as a white solid; yield 55.3 mg (36%); H NMR

(400 MHz, DMSO-d₆) d 12.46 (s, 1H), 8.70 (d, J = 4.9 Hz, 2H), 7.98 – 7.94 (m, 1H), 7.70 – 7.64 (m, 1H), 7.40 (t, J = 7.6 Hz, 1H),

7.29 (t, J = 4.9 Hz, 1H), 4.48 (s, 2H), 2.48 (s, 3H); R_t: 5.81 min. HRMS m/z [M+H] ⁺for C₁₄H₁₃N₄OS: 285.08046, found 285.08128.

7,8-dimethyl-2-((pyrimidin-2-ylthio)methyl)quinazolin-4(3H)-one,

ITK1. From

2-(chloromethyl)-7-methylquinazolin-4(3H)-one

(18 mg, 0.08 mmol) and 2-mercaptopyrimidine; product precipitated as ﬁne white solids in water; yield 15 mg (63%); 1H NMR

(400 MHz, Chloroform-d) d 10.96 (s, 1H), 8.68 (d, J = 4.9 Hz, 2H), 8.01 (d, J = 8.0 Hz, 1H), 7.17 (t, J = 4.9 Hz, 1H), 4.33 (s, 2H),

2.56 (s, 3H), 2.43 (s, 3H); R_t: 7.58 min. HRMS m/z [M+H] ⁺for C₁₅H₁₆N₄OS: 299.09611, found 299.09727.

2-(((7H-purin-6-yl)thio)methyl)-7,8-dimethylquinazolin-4(3H)-one, ITK2. From 2-(chloromethyl)-7,8-dimethylquinazolin-4(3H)-one

(25 mg, 0.11 mmol) and mercaptopurine; product precipitated as a white solid partition between water and EtOAc; yield 9.9 mg

(27%); 1H NMR (400 MHz, DMSO-d6) d 8.73 (s, 1H), 8.54 (s, 1H), 7.84 (d, J = 8.0 Hz, 1H), 7.30 (d, J = 7.7 Hz, 1H), 4.68 (s, 2H),

3.57 (d, J = 1.8 Hz, 2H), 2.39 (s, 6H); R_t: 5.84 min. HRMS m/z [M-H]⁺for C₁₆H₁₅N₆OS: 337.08661, found 337.08676.

e9 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

2-(((5-amino-4H-1,2,4-triazol-3-yl)thio)methyl)-7,8-dimethylquinazolin-4(3H)-one, ITK3. From 2-(chloromethyl)-7,8-dimethylquina-

zolin-4(3H)-one (25 mg, 0.11 mmol) and 3-Amino-5-mercapto-1,2,4-triazole; product precipitated as ﬁne white solids in water; yield

25 mg (76%); 1H NMR (400 MHz, DMSO-d6) d 12.28 (s, 1H), 12.09 (s, 1H), 7.84 (d, J = 8.1 Hz, 1H), 7.31 (d, J = 8.1 Hz, 1H), 6.20 (s, 2H),

4.19 (s, 2H), 2.44 (s, 3H), 2.38 (s, 3H;. R_t: 4.76 min. HRMS m/z [M-H] ⁺for C₁₃H₁₅N₆OS: 301.08661, found 301.08712.

4-(((7,8-dimethyl-4-oxo-3,4-dihydroquinazolin-2-yl)methyl)thio)benzoic acid, ITK4. From 2-(chloromethyl)-7,8-dimethylquinazolin-

4(3H)-one (25 mg, 0.11 mmol) and 4-mercaptobenzoic acid; product precipitated as pale yellow solids in water; yield 27 mg (73%);

1H NMR (400 MHz, DMSO-d6) d 12.95 (s, 1H), 12.33 (s, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.83 (t, J = 7.2 Hz, 2H), 7.63 (d, J = 8.1 Hz, 2H),

7.29 (d, J = 8.1 Hz, 1H), 4.26 (s, 2H), 2.41 (s, 3H), 2.36 (s, 3H); R_t: 6.70 min. HRMS m/z [M-H]⁺for C₁₈H₁₆N₂O₃S: 339.07979, found

339.08030.

4-(((7-ethynyl-8-methyl-4-oxo-3,4-dihydroquinazolin-2-yl)methyl)thio)benzoic acid, ITK5. From 2-(chloromethyl)-7-ethynyl-8-

methylquinazolin-4(3H)-one (10 mg, 0.043 mmol); crude product precipitated as ﬁne white solids in water then puriﬁed by HPLC (mo-

bile phase A: water; mobile phase B: methanol; ﬂow rate: 20 mL/min; conditions: pre-run A = 5% B =95%, 7 min: A = 5% B = 95%,

10 min: A = 5% B = 95%, 11 min: A = 35% B = 65%, 15 min: A = 35% B = 95; Retention time: 4.29 min; UV-Vis detection: l₁254 nm,

l₂= 220 nm. Yield 6.1 mg (42%); ¹H NMR (400 MHz, DMSO-d₆) d 12.55 (s, 1H), 7.89 (d, J = 8.2 Hz, 1H), 7.85 (d, J = 8.1 Hz, 2H), 7.62

(d, J = 8.0 Hz, 2H), 7.49 (d, J = 8.2 Hz, 1H), 4.70 (s, 1H), 4.26 (s, 2H), 2.56 (s, 3H); R_t: 8.21 min. HRMS m/z [M-H]⁺for C₁₉H₁₄N₂O₃S:

349.06414, found 349.06489.

4-(((8-methyl-4-oxo-7-(prop-1-yn-1-yl)-3,4-dihydroquinazolin-2-yl)methyl)thio)benzoic acid, ITK6. From 2-(chloromethyl)-8-

methyl-7-(prop-1-yn-1-yl)quinazolin-4(3H)-one (90 mg, 0.39 mmol); product precipitated as a white solid in water; yield 80.2 mg

(56%); ¹H NMR (400 MHz, DMSO-d₆) d 12.96 (s, 1H), 12.50 (s, 1H), 7.88 – 7.82 (m, 3H), 7.62 (d, J = 8.3 Hz, 2H), 7.40 (d,

J = 8.2 Hz, 1H), 4.25 (s, 3H), 2.14 (s, 3H); R_t: 8.85 min. HRMS m/z [M+H]⁺for C₂₀H₁₇N₂O₃S: 365.09544, found 365.09574.

8-methyl-7-(prop-1-yn-1-yl)-2-((pyrimidin-2-ylthio)methyl)quinazolin-4(3H)-one, ITK7. From 2-(chloromethyl)-8-methyl-7-(prop-1-

yn-1-yl)quinazolin-4(3H)-one one (15 mg, 0.06 mmol); reaction poured over water and extracted with EtOAc (3x), combined organic

layers were washed with sat. aqueous sodium bicarbonate (2x), and brine (2x), then dried over sodium sulfate and concentrated in

vacuo to give tan solids; yield 15.1 mg (76%); ¹H NMR (400 MHz, DMSO-d₆) d 12.49 (s, 1H), 8.66 (d, J = 4.9 Hz, 2H), 7.87 (d, J = 8.0 Hz,

1H), 7.41 (d, J = 8.2 Hz, 1H), 7.25 (t, J = 4.9 Hz, 1H), 4.44 (s, 2H), 2.53 (s, 3H), 2.14 (s, 3H). R_t: 8.90 min. HRMS m/z [M+H]⁺for

C₁₇H₁₅N₄O₁S₁: 323.09611, found 323.09656.

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e10

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Crystallography Studies

Molecular Cloning, Protein Expression, and Puriﬁcation

A synthetic cDNA fragment encoding a C-terminal segment of human PARP14 (Q460N5-6), codon optimized for expression in Es-

cherichia coli, was obtained from Genscript. The fragment encoding Asp1611 – Lys1801 was inserted into pNIC-NHD (GenBank:

FN677494.1). The expression construct included an N-terminal afﬁnity tag consisting of a hexahistidine sequence separated from

the protein sequence by a TEV (tobacco etch virus) protease cleavage site (sequence: MHHHHHHSSGVDLGTENLYFQSM). Escher-

ichia coli BL21 (DE3) R3 pRARE cells transformed with the expression construct were used to inoculate 3 l Terriﬁc Broth medium

supplemented with 8 g/L glycerol, 50 mg/mL kanamycin and Antifoam 204 (Sigma). Cultures were grown in Tune Air shake ﬂasks

at 37^ꢀC. When OD₆₀₀of approximately 1.5 was reached the temperature was lowered to 18^ꢀC and protein expression was induced

by addition of 0.5 mM isopropyl b-D-thiogalactopyranoside and continued for approximately 20 hrh. Cells were harvested by centri-

fugation at 4430 g for 10 min in a Sorvall SLC-6000 rotor. The resulting pellet was suspended in 80 mL lysis buffer (100 mM Hepes,

500 mM NaCl, 10% glycerol, 10 mM Imidazole, 0.5 mM TCEP, pH 8.0) supplemented with 1 tablet of Complete EDTA-free Protease

Inhibitor (Roche Biosciences) and 8 mL benzonase (2000 U). Suspended cells were stored at -80^ꢀC. The cells were thawed and son-

icated on ice (Sonics VibraCell) at 80% amplitude, pulse: 4’’ on and 4’’ off, for a total time of 3 mins, followed by centrifugation at

49000 x g in a Sorvall SA-800 rotor, 20 mins at 4^ꢀC. The soluble fraction was decanted and ﬁltered through a 0.45 mm ﬁlter. Protein

puriﬁcation using immobilized metal afﬁnity chromatography followed by size exclusion chromatography were carried out as previ-

ously described³. Target protein mass was veriﬁed by mass spectrometry.

Protein Crystallization

Crystals of the PARP14-ITK1 complex were obtained by the sitting-drop vapor-diffusion method in a 96-well plate (Corning) by mix-

ing 0.2 ml of protein at a concentration of 28 mg/ml including ITK1 dissolved in dimethyl sulfoxide (DMSO) and 0.2 mL of reservoir

solution containing 20% poly(ethylene glycol) 3350, 0.2M sodium nitrate. The plate was incubated at 20^ꢀC. After three weeks without

any signs of crystal growth the plate was moved to 4^ꢀC and small rod crystals appeared within ﬁve days. Crystals were quickly

soaked in cryo solution supplemented with 20 % glycerol, 300mM sodium chloride and 0.2mM ITK1 and then stored under liquid

nitrogen.

Crystals of PARP14-ITK6 complex were obtained by mixing 0.1 ml of protein at a concentration of 30 mg/ml including ITK6 dis-

solved in dimethyl sulfoxide (DMSO) and 0.2 ml of reservoir solution containing 20% Poly(ethylene glycol) 3350, 0.2 M sodium nitrate

and 0.1 M Bis-Tris-Propane pH 6.5. The plate was incubated at 4^ꢀC. Plate-shaped crystals appeared within seven weeks. Crystals

were brieﬂy soaked in cryo solution supplemented with 20 % Glycerol, 200 mM sodium chloride and 4 mM ITK6 and then stored

under liquid nitrogen.

Crystallographic Data Collection, Phasing, and Reﬁnement

˚

A data set extending to 2.15 A resolution was collected on a PARP14-ITK1 crystal at 0.92819 A wavelength on a Dectris Pilatus 6M

detector at beamline i04-1 at the Diamond Light Source (Oxfordshire, UK). The data were integrated and scaled using xia2. The crys-

tal belonged to space group P1, and the Matthew’s coefﬁcient suggested the presence of four monomers in the asymmetric unit. The

structure was solved using molecular replacement using Phaser and a previous structure of human PARP14 (PDB: 4F1L) as search

model. Density for the ligand was observed in all chains and manual model building was done using COOT. Structure reﬁnement was

˚

done using data in the interval 30.92 - 2.15 A resolution with Buster and the progress of reﬁnement was followed by decreasing R and

R_freevalues. Grade was used to obtain ligand restraints.

˚

A data set extending to 2.67 A resolution was collected on the best PARP14-ITK6 crystal at 0.96858 A wavelength on a Dectris

Pilatus3 6M detector at beamline i24 at Diamond Light Source (Oxfordshire, UK). The data were integrated and scaled using

XDSAPP. The crystal belonged to space group P6₁22, and the Matthew’s coefﬁcient suggested the presence of two monomers

in the asymmetric unit. The structure was solved using molecular replacement using Phaser and the PARP14,ITK1 structure as

search model. Density for the ligand was observed in both chains and manual model building was done using COOT. Structure reﬁne-

˚

ment was done using Buster. In the reﬁnement, data in the interval 49.76 - 2.67 A resolution was used and the progress of reﬁnement

was followed by decreasing R and R_freevalues. Grade was used to obtain ligand restraints.

Summary of Crystallographic Data Collection and Reﬁnement Statistics for PARP14,IT_ꢀK_ꢀ1_ꢀ(6FYM) Data Collection

˚ ˚ ˚ ˚

Beam line: Diamond i04-1; wavelength (A): 0.92819; space group: P1; unit cell dimensions (A,A,A, , , ): 40.37, 84.04, 84.44, 119.77,

˚

100.01, 91.44; resolution (A): 36.7-2.15 (2.21-2.15); unique reﬂections: 47400 (3487); R(merge): 0.093 (0.94); completeness (%): 92.6

˚

(91.8); redundancy: 3.6 (3.6); <I>/<SIGMAI>: 9.5 (1.2); CC(1/2): 0.996 (0.513). Reﬁnement: resolution (A): 30.9-2.15 (2.21-2.15); R-fac-

tor (%): 19.06 (22.60); reﬂections used for R-factor: 36637; R-free (%): 22.39 (26.50); reﬂections used for R-free: 1932; r.m.s.d. bond

a

2

ꢀ

˚

length (A) : 0.010; r.m.s.d. bond angle ( ) : 1.0; Wilson B-factor (A ): 41.49; Mean B-factor (A ): 46.74; most favoured (%): 98.1; dis-

allowed (%): 0.

Summary of Crystallographic Data Collection and Reﬁnement Statistics for PARP14,IT_ꢀK_ꢀ6_ꢀ(6FZM) Data Collection

˚ ˚ ˚ ˚

Beam line: Diamond i24; wavelength (A): 0.96858; space group: P6₁22; unit cell dimensions (A,A,A, , , ): 83.88, 83.88, 204.91, 90, 90,

˚

120; resolution (A): 49.76- 2.67 (2.83 -2.67); unique reﬂections: 12549 (1739); R(merge): 0.453 (1.95); completeness (%): 97.8 (86.9);

˚

redundancy: 34.8 (30.5); <I>/<SIGMAI>: 10.6 (2.0); CC(1/2): 0.994 (0.769). Reﬁnement: resolution (A): 49.76-2.67 (2.92-2.67); R-factor

(%): 23.46 (27.30); reﬂections used for R-factor: 12505; R-free (%): 28.88 (35.80); reﬂections used for R-free: 626; r.m.s.d. bond length

a

2

ꢀ

˚

(A) : 0.010; r.m.s.d. bond angle ( ) : 1.1; Wilson B-factor (A ): 66.30; Mean B-factor (A ): 51.93; most favoured (%): 90.6; disallowed

(%): 0.3.

e11 Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018

Please cite this article in press as: Kirby et al., A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic

Activity, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.09.011

Crystallographic Data Deposition

Coordinates and structure factors for the crystal structures have been deposited in the RCSB Protein Data Bank under accession

codes 6FYM and 6FZM.

QUANTIFICATION AND STATISTICAL ANALYSIS

All assays were performed at least in triplicate (nR3). SEM were calculated in Microsoft Excel and curves were generated in Prism 7.

DATA AND SOFTWARE AVAILABILITY

All software used in this study is reported in Method Details and indicated in the Key Resources Table.

Cell Chemical Biology 25, 1–7.e1–e12, December 20, 2018 e12

Article Doi

A Potent and Selective PARP11 Inhibitor Suggests Coupling between Cellular Localization and Catalytic Activity

DOI: 10.1016/j.chembiol.2018.09.011

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2018.09.011

Full text of DOI:10.1016/j.chembiol.2018.09.011

Products guided by the article

R&D Labs maybe for 851045-38-0

Relevant to this article

Hot Product