Aza-peptidyl Michael acceptors. A new class of potent and selective inhibitors of asparaginyl endopeptidases (legumains) from evolutionarily diverse pathogens

Article abstract of DOI:10.1021/jm701311r

Aza-peptide Michael acceptors with the general structure of Cbz-Ala-Ala-AAsn-trans-CH=CHCOR are a new class of inhibitors specific for the asparaginyl endopeptidases (AE) (legumains). Structure-activity relationships (SARs) were characterized for a set of 31 aza-peptide Michael acceptors with AEs derived from three medically important parasites: the protist Trichomonas vaginalis, the hard tick Ixodes ricinus, and the flatworm Schistosoma mansoni. Despite arising from phylogenetically disparate organisms, all three AEs shared a remarkably similar SAR with lowest IC₅₀ values extending into the picomolar range. The results suggest an evolutionary constraint on the topography of the prime side of the active site. SAR also revealed that esters in the P1′ position are more potent than disubstituted amides and that monosubstituted amides and alkyl derivatives show little or no inhibition. The preferred P1′ residues have aromatic substituents. Aza-asparaginyl Michael acceptors react with thiols, which provides insight into the mechanism of their inhibition of asparaginyl endopeptidases.

Full text of DOI:10.1021/jm701311r

2816
J. Med. Chem. 2008, 51, 2816–2832
Aza-peptidyl Michael Acceptors. A New Class of Potent and Selective Inhibitors of Asparaginyl
Endopeptidases (Legumains) from Evolutionarily Diverse Pathogens
Marion G. Götz,†,¶ Karen Ellis James,† Elizabeth Hansell,‡ Jan Dvorˇa´k,‡ Amritha Seshaadri,‡ Daniel Sojka,§,‡ Petr Kopácˇek,§
James H. McKerrow,‡ Conor R. Caffrey,‡ and James C. Powers*,†
School of Chemistry and Biochemistry and the Petit Institute for Bioscience and Bioengineering, Georgia Institute of Technology,
Atlanta, Georgia 30332-0400, Sandler Center for Basic Research in Parasitic Diseases, Byers Hall, UniVersity of California San Francisco,
San Francisco, California 94158, Institute of Parasitology, Biology Centre of the Academy of Sciences of the Czech Republic,
ˇ
Ceské BudeˇjoVice, CZ-370 05, Czech Republic, and Department of Chemistry, Whitman College, 345 Boyer AVenue,
Walla Walla, Washington 99362
ReceiVed October 18, 2007
Aza-peptide Michael acceptors with the general structure of Cbz-Ala-Ala-AAsn-trans-CHdCHCOR are a
new class of inhibitors specific for the asparaginyl endopeptidases (AE) (legumains). Structure–activity
relationships (SARs) were characterized for a set of 31 aza-peptide Michael acceptors with AEs derived
from three medically important parasites: the protist Trichomonas Vaginalis, the hard tick Ixodes ricinus,
and the flatworm Schistosoma mansoni. Despite arising from phylogenetically disparate organisms, all three
AEs shared a remarkably similar SAR with lowest IC50 values extending into the picomolar range. The
results suggest an evolutionary constraint on the topography of the prime side of the active site. SAR also
revealed that esters in the P1′ position are more potent than disubstituted amides and that monosubstituted
amides and alkyl derivatives show little or no inhibition. The preferred P1′ residues have aromatic substituents.
Aza-asparaginyl Michael acceptors react with thiols, which provides insight into the mechanism of their
inhibition of asparaginyl endopeptidases.
Introduction
“caspase-hemoglobinase fold” with members distributed in
Archaea, bacteria, and Eukarya.7 A simple BLASTp search of
the NCBI nonredundant protein sequence database with an S.
mansoni AE sequence (CAB71158) reveals many orthologous
proteins, including those in organisms causing disease in humans
and animals. In blood-feeding parasites, such as Schistosoma8,9
and the hard tick Ixodes ricinus,10 AEs are part of a proteolytic
network incorporating clan AA (aspartic) and CA (cysteine)
proteases that are associated with digestion of the blood meal
(primarily hemoglobin and albumin) (Sojka, unpublished re-
sults). Given the specificity of AEs for Asn at P1,11,12 one
hypothesis as to their function in these parasites is the discrete
processing and activation of clan AA and CA zymogens
involved in alimentary degradation of host proteins.13 The
hypothesis has been substantiated in vitro with the finding that
recombinant AE from both S. mansoni AE (SmAE) and I.
ricinus (IrAE) can trans-process and activate a gut-associated
S. mansoni cathepsin B zymogen to its mature catalytic
form.10,14 Cathepsin B is a major proteolytic activity in the gut
of both organisms (Sojka, unpublished results).14,15 Accordingly,
if AE-mediated trans-activation is a key step by which pro-
teolysis is regulated in vivo, inhibition of AE activity would
represent a logical strategy to interfere with the parasite’s ability
to feed and, consequently, thrive. In the case of the Ixodes hard
tick, the subsequent benefit would be a disruption or interruption
of its position as a vector of various viral and bacterial diseases,
not the least is Lyme disease.16
Asparaginyl endopeptidases (AEsa or legumains (EC.3.4.22.34))
belong to the C13 family of clan CD cysteine proteases that
also includes caspases, gingipains, clostripain, and separase. On
the basis of homology modeling, all apparently share the same
catalytic-site motif and a common scaffold within their catalytic
domains.1 The first AE for which a cDNA clone was derived
was isolated from the parasitic bloodfluke Schistosoma mansoni
in 1987.2 However, it was not until 1993 that the protein was
identified as a protease homologous to “legumains” that had
just been characterized in plant seeds.3 Subsequently, described
in mammals,4 AEs have been linked to osteoclast formation
and bone resorption5 and the processing of bacterial antigens.6
With the availability of genome sequence information, it has
become clear that AEs and other clan CD enzymes form part
of a much larger group of proteins containing a minimal
* To whom correspondence should be addressed. Phone: (404) 894-4038.
Fax: (404) 894-2295. E-mail: james.powers@chemistry.gatech.edu.
†
Georgia Institute of Technology.
Whitman College.
University of California San Francisco.
Biology Centre of the Academy of Sciences of the Czech Republic.
¶
‡
§
a Abbreviations: AAsn, aza-asparagine; AAsp, aza-asparagine; Ac, acetyl;
AcOH, acetic acid; AE, asparaginyl endopeptidase; AMC, 7-amino-4-
methylcoumarin; Boc, tert-butoxycarbonyl; Bzl, benzyl, CH2Ph; Cbz,
benzyloxycarbonyl; CDCl3, deuterated chloroform; CHAPS, 3-[(3-chola-
midopropyl)dimethylammonio]-1-propanesulfonate; DCC, dicyclohexyl-
carbodiimide; DMF, N,N-dimethylformamide; DMSO, dimethyl sulfoxide;
DMSO-d6, deuterated dimethyl sulfoxide-d6; DTT, dithiothreitol; E-64c,
N-(L-3-trans-carboxyoxiran-2-carbonyl)-L-leucyl-3-methylbutanamide; EDC,
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; EDTA, eth-
ylenediaminetetraacetic acid; EP, epoxide; EtOAc, ethyl acetate; EtOH,
ethanol; HEPES, N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid;
HOBt, N-hydroxybenzotriazole; iBCF, isobutyl chloroformate; iBu, isobutyl;
IrAE, I. ricinus asparaginyl endopeptidase; MeOH, methanol; NMM,
N-methylmorpholine; OBzl, benzyloxy; Pipes, 1,4-piperazinediethane-
sulfonic acid; PhPr, 3-phenylpropanoyl; pNA, p-nitroanilide; SmAE, S.
mansoni asparaginyl endopeptidase; tBu, tert-butyl; TFA, trifluoroacetic
acid; TvAE1, Trichomonas Vaginalis asparaginyl endopeptidase.
The synthetic AE inhibitors reported so far have only been
tested against mammalian AEs.17 These include aza-Asn ha-
lomethylketones (Cbz-Ala-Ala-AAsn-CH2Cl, kobs/[I] ) 139 000
M
-1 s-1, Cbz ) benzyloxycarbonyl), Michael acceptors derived
from Asn (Cbz-Ala-Ala-NHCH(CH2CONH2)CHdCHCO2-
CH2CHdCH2, kobs/[I] up to 766 M-1 s-1),18 and acyloxy-
methylketones (kobs/[I] from 769 up to 109 000 M-1 s-1).
10.1021/jm701311r CCC: $40.75
2008 American Chemical Society
Published on Web 04/17/2008

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2817
Scheme 1. Synthesis of Fumarate Precursorsa
a Reagents: (i) NMM, iBCF, CH2Cl2, HNR1R2; (ii) (1) NaOH, (2) HCl,
MeOH. NMM ) N-methylmorpholine. iBCF ) isobutylchloroformate.
Scheme 2. Synthesis of the Aza-peptide Precursora
a Reagents: (i) H2NNH2, MeOH; (ii) BrCH2COOEt, NMM, DMF; (iii)
NH3, cat. NaCN, MeOH, DMF; (iv) HCl ·H2NNHCH2COOEt, NMM,
MeOH. Cbz ) Ph-CH2-OCO-. DMF ) dimethylformamide. NMM )
N-methylmorpholine.
Figure 1. Design of aza-peptide Michael acceptors is derived from
aza-peptidyl epoxides, the fumarate derivative of E-64c, and the
C-terminal vinyl sulfone design. The aza-peptide Michael acceptors
contain a nitrogen instead of the R-carbon at the P1 asparagine residue.
Thus, the resulting aza-amino acid is referred to as aza-asparagine
(AAsn). The numbering of epoxides and Michael acceptors is reversed.
Thus, attack at C-2 of a Michael acceptor inhibitor would correspond
to attack at C-3 of an epoxide inhibitor.
pastoris and characterization with the present inhibitors are
described here for the first time. We also provide evidence for
the mechanism of inhibition of AEs by aza-peptide Michael
acceptors. In addition we have synthesized a biotinylated
derivative of one of the better Michael acceptor inhibitors. A
preliminary report of the aza-peptide Michael acceptor design
has been published.35
Aspartyl peptidyl fluoromethyl ketones designed specifically for
caspase inhibition are also moderate inhibitors of mammalian
AE.19 In addition, fluorescein aspartyl peptidyl acyloxymeth-
ylketones have been used as efficient and selective labels of
legumain in intact cells.20 We recently reported the synthesis
of aza-asparaginyl epoxide inhibitors specific for S. mansoni
and mammalian AEs (Figure 1).21 These epoxides were orig-
inally evaluated as inhibitors of caspases and other clan CD
proteases.22 In an effort to synthesize more potent inhibitors of
AEs, we designed a new class of aza-peptidyl inhibitors by
replacing the epoxide moiety with a double bond moiety to
generate a Michael acceptor warhead (Figure 1).
Chemistry
The synthesis of the aza-peptide fumarate analogues is based
on our previous synthesis of aza-peptide epoxide inhibitors21
and involves coupling a peptidyl hydrazide to a fumarate or
propenoic acid derivative. The fumaric acid monoamide precur-
sors (2a-x) were prepared from monoethyl fumarate and the
corresponding primary or secondary amines by standard mixed
anhydride coupling using NMM and iBCF followed by depro-
tection of the ethyl ester in methanol using aqueous NaOH
(Scheme 1). The various disubstituted aromatic amines were
synthesized by reductive amination starting with aromatic
aldehyde precursors and an aromatic primary amine. The
monobenzyl fumarate derivative was formed from fumaric acid
and benzyl alcohol using NMM and DCC as the coupling
reagent.
The preparation of the aza-peptidyl precursor is shown in
Scheme 2. There are two possible routes to incorporate the aza
moiety into the peptide backbone. The hydrazide can be
prepared by conversion of the peptide methyl ester to the
peptidyl hydrazide, followed by alkylation to introduce the
asparagine side chain. Thus, we synthesized the asparaginyl side
chain from Cbz-Ala-Ala-OMe (3) using excess hydrazine in
methanol with subsequent alkylation of the hydrazide with ethyl
bromoacetate and NMM followed by ammonolysis. We have
previously used this route for the synthesis of the aza-peptidyl
functionality with other amino acid analogues, such as aza-
ornithine, aza-lysine, and aza-aspartate analogues.22 A second
approach is to directly add the aza-asparagine residue to the
starting peptide Cbz-Ala-Ala-OMe (3) using a substituted
hydrazide moiety. The reactivity of the hydrazide moiety
depends on the nature of the substituent. An electron withdraw-
ing substituent, such as an ester or amide, places a higher
nucleophilic character on the primary hydrazide nitrogen. An
electron donating substituent shifts the reactivity to the second-
ary nitrogen.36,37 Therefore, we could also introduce the AAsn
side chain by coupling the peptide precursor (3) to ethyl
hydrazinoacetate in a one-step reaction. However, we did not
observe an improvement in the overall yield. Subsequent
Michael acceptors have previously been employed as war-
heads in inhibitors of several cysteine proteases.23–25 The
fumarate derivative (trans-HOOCCHdCHCO-Leu-NH(CH2)2-
CH(CH3)2) of E-64c is one of the first Michael acceptor
inhibitors reported and contains the fumarate warhead at the
N-terminus of a peptidyl inhibitor (Figure 1).26 The same
fumarate inhibits clan CA cysteine proteases such as cathepsins
B, H, and L but not clan CD proteases. Hanzlik et al. reported
the first replacement of a carbonyl group of a cysteine protease
substrate with a Michael acceptor moiety in order to trap the
active site nucleophile of cysteine or serine proteases. They
attached an R,ꢀ-unsaturated carbonyl moiety at the C-terminus
of a peptide substrate.23 This strategy was then applied in the
design of peptidyl vinyl sulfones27 and other R,ꢀ-unsaturated
carbonyl derivatives (Figure 1).28,29 The C-terminal Michael
acceptor design has proven to be very successful, as two peptidyl
Michael acceptor inhibitors, ruprintrivir and the homophenyl-
alanine vinyl sulfone 1 (K11777, CRA-3316, or APC-3316),30
31,32
are currently in clinical trials for rhinitis
and late-stage
preclinical trials for Chagas’ disease, respectively.33
For this communication, we describe a new class of inhibitors
of AEs by applying the Michael acceptor fumarate warhead of
E-64c to our previous design of the potent and specific aza-
peptide epoxides (Figure 1).21 We report the design, synthesis,
and evaluation of 31 aza-peptide Michael acceptors as potent
and specific inhibitors of three AEs (SmAE, IrAE, and TvAE1)
from medically important and phylogenetically divergent patho-
gens. TvAE1was one of two legumains originally identified in
the sexually transmitted protist parasite, Trichomonas Vaginalis,
by Léon-Félix et al.,34 but its functional expression in Pichia

2818 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
a
Scheme 3. Coupling of Fumarate and Propenoate Precursors to Cbz-Ala-Ala-NHNHCH2CONH2
a HOBt ) 1-hydroxybenzotriazole hydrate. EDC ) 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride. DMF ) dimethylformamide. Cbz )
Ph-CH2-OCO-.
Scheme 4. Preparation of a Biotinylated Michael Acceptor Inhibitora
a Boc ) tert-butyloxycarbonyl. TFA ) trifluoroacetic acid. DMF ) dimethylformamide.
conversion of the ethyl ester to the amide (4) by ammonolysis
with catalytic amounts of NaCN followed the procedure
described by Hogberg et al.38
no cyclization was observed during the course of the synthesis.
Niestroj et al. have previously reported the synthesis of aza-
asparaginyl chloromethyl ketones.18 In their synthetic approach,
they employed a trityl protected amide on the Asn side chain.
The peptide hydrazide precursor was then coupled to a variety
of substituted fumaric acid monoamides (2a-x), monoalkyl and
monoaryl fumarate esters, or commercially available propenoic
acid derivatives (6a-f) using HOBt and EDC. This completes
the synthesis of the various aza-peptide fumaric acid or
propenoic acid derivatives (5a-x and 7a-f) (Scheme 3).
A possible side chain reaction that arose while planning the
synthetic strategy was the intramolecular cyclization of the aza-
asparagine’s side chain with the Michael acceptor warhead.
However, we speculated that the rigidity of the aza-peptide
backbone probably prevents this intramolecular cyclization.
Thus, we did not protect the Asn side chain, and as predicted,
The synthesis of the biotinylated inhibitor (12) is shown in
Scheme 4. The Boc-protected aza-peptide Michael acceptor (10)
was synthesized by hydrazinolysis of Boc-Ala-Ala-OMe (9)
following the procedure in Scheme 1. We chose to replace the
Cbz protecting group with the Boc protecting group, since Cbz
deprotection requires catalytic hydrogenation, which could affect
the double bond of the fumarate moiety. The Boc group can
then be removed with dilute TFA. The N-hydroxysuccinimide
ester of biotin (8) prepared by DCC coupling was reacted with
the TFA salt of the aza-peptide Ala-Ala-AAsn-CHdCHCOOEt

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2819
Table 1. Inhibition of AEs from Three Parasitic Organisms by Aza-peptide Michael Acceptors
IC50 (nM)a
IrAE
SmAE kobs/[I]b
inhibitor
TvAE1
SmAE
(M-1 s-1
17420
)
7a
7b
5a
5b
5c
5d
5e
5f
5g
5h
5i
5j
5k
5l
5m
5n
5o
5p
5q
5r
5s
Cbz-Ala-Ala-AAsn-CHdCHCOOEt
Cbz-Ala-Ala-AAsn-CHdCHCOOBzl
Cbz-Ala-Ala-AAsn-CHdCHCONEt2
Cbz-Ala-Ala-AAsn-CHdCHCON(nBu)2
Cbz-Ala-Ala-AAsn-CHdCHCO-Pip
4.5
5
4.5
<1
2700
100
31
38
2000
1000
500
20
NIc
550
1000
700
1000
800
600
60
Cbz-Ala-Ala-AAsn-CHdCHCONHPh
Cbz-Ala-Ala-AAsn-CHdCHCONHBzl
10
10
75
10
5
0.55
<1
50
<1
10
200
250
350
1.8
<1
5.5
Cbz-Ala-Ala-AAsn-CHdCHCONHBzl-4-F
Cbz-Ala-Ala-AAsn-CHdCHCONHCH2CH2Ph
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)Ph
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)Bzl
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)CH2-1-Napth
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)CH2CH2Ph
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)Ph
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)2
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl-4-OMe)Bzl
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl-4-F)Bzl
Cbz-Ala-Ala-AAsn-CHdCHCON(CH2-2-furyl)2
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)-CH2-2-Napth
Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)-CH2-1-Napth
Cbz-Ala-Ala-AAsn-CHdCHCO-tetrahydroquinoline
Cbz-Ala-Ala-AAsn-CHdCHCO-tetrahydroisoquinoline
Cbz-Ala-Ala-AAsn-CHdCHCO-indoline
Cbz-Ala-Ala-AAsn-CHdCHCO-isoindoline
Cbz-Ala-Ala-AAsn-CHdCHCO-(Py-4-Ph)
Cbz-Ala-Ala-AAsn-CHdCHCO-MePhe-N(CH3)CH2CH2Phd
Cbz-Ala-Ala-AAsn-CHdCHCOPh
55
35
600
70
45
90
60
900
70
62
16930
5800
<1
450
12
700
15000
8
6
4
25
18
4.5
85
300
>20000
2.3
<1
5000
6
6100
6180
<1
3.5
10
50
20
70
200
70
5t
5u
5v
5w
5x
7c
7d
7e
7f
300
750
750
NIc
NIc
>2000
>2000
10
10
80
g10000
8000
Cbz-Ala-Ala-AAsn-CHdCH-CHdCH-CH3
Cbz-Ala-Ala-AAsn-CHdCH-2-furyl
Cbz-Ala-Ala-AAsn-CHdCH-3-Py
7500
15000
2.8
8000 to >10000
<10
12
biotinyl-Ala-Ala-AAsn-CHdCHCOOEt
a AEs from Trichomonas Vaginalis, Ixodes ricinus, and Schistosoma mansoni were expressed in Pichia pastoris and, if necessary, activated as described
previously or herein.53 Inhibition assays were performed in 0.1 M citrate phosphate, 4 mM DTT, pH 6.8, for SmAE and TvAE1, or pH 5.5 for IrAE, with
b
a final concentration of 10 µM Cbz-Ala-Ala-Asn-AMC (Cbz ) PhCH2-OCO-; AMC ) 7-amino-4-methylcoumarin) as substrate. kobs/[I] values of the
inhibitors were determined in 0.1 M citrate phosphate buffer, pH 6.8, containing 2 mM DTT and 20 µM Cbz-Ala-Ala-Asn-AMC substrate. The progress of
inhibition was followed every 2 s for 30 min at 25 °C. The apparent kobs/[I] values were determined using nonlinear regression analysis (GraphPad Prism
20
3.X) and corrected for substrate (1 + S/KM: 1 +
/
) 1.33). c NI ) no inhibition after 20 min of preincubation with inhibitor. d MePhe )
60
N-methylphenylalanine. Cbz ) Ph-CH2-OCO-. AAsn ) aza-Asn.
(11) in the presence of triethylamine to give the biotinylated
aza-peptidyl Michael acceptor (12) in good yield.39,40
to perform an extensive SAR study with a variety of new
inhibitor structures.
Inhibition of SmAE, TvAE1, and IrAE. The IC50 values
for 31 aza-peptide Michael acceptors are reported in Table 1.
In addition, we measured kobs/[I] values for the better inhibitors
of SmAE. Strikingly, all three AEs show a similar SAR based
on IC50 values across the inhibitor series tested. The more
effective inhibitors inhibit SmAE in the mid to low nanomolar
range, whereas for TvAE1 and IrAE the lowest IC50 values are
less than 1 nM. The monobenzyl and monoethyl esters (7a, 7b)
are among the most potent inhibitors for all three AEs.
Replacement of the ethoxycarbonyl group in (7a) or the
benzyloxycarbonyl group in (7b) with another double bond (7d),
a benzoyl group (7c), or aryl groups (7e, 7f) effectively results
in a loss of inhibition against all three enzymes. We attribute
the loss of potency to a requirement for a second electron
withdrawing group on the propenoyl functionality of the
inhibitor. The ester derivatives such as (7a) and (7b) meet this
requirement. The benzoyl derivative Cbz-Ala-Ala-AAsn-
CHdCHCOPh (7c) also has an electron withdrawing group but
does not inhibit any of the AEs, probably because of crowding
or insufficient electronegativity.
Results and Discussion
Synthetic Design. Aza-peptide active esters are known to
act as acylating inhibitors of both serine and cysteine
proteases.41–44 Aza-peptide chloromethyl ketones and acyl-
oxymethyl ketones have been observed to alkylate the active
site cysteine of mammalian AE.35 In our design, we have
incorporated a Michael acceptor into an aza-peptide structure.
We used the optimal substrate sequence Cbz-Ala-Ala-Asn-AMC
(AMC ) 7-amino-4-methylcoumarin) for AEs determined by
Mathieu et al. as the basis for the peptide backbone of our
Michael acceptor inhibitors.11 Replacing the R-carbon of the
P1 asparaginyl residue with a nitrogen provides a practical
synthetic route for coupling peptide hydrazides to readily
available fumaric acid derivatives or substituted propenoic acid
analogues. Because of its planarity, the aza-peptide functionality
changes the orientation of the scissile peptide bond and,
therefore, restricts the conformation and rotational freedom of
the original peptide bond. The fumaroyl carbonyl is now in the
exact place as the scissile peptide carbonyl of an AE substrate.
The P′ side of the inhibitor can be easily modified so that it is
possible to scan for increased potency and specificity of
interactions with the S′ subsites of the enzyme. Fumaric acid
and propenoic acid derivatives are easily synthesized prior to
coupling with the peptide hydrazide and, therefore, allowed us
The monobenzyl amide derivative (5e) is a weak inhibitor
of all three AEs, even though it is a direct analogue of the potent
benzyl ester derivative (7b). Furthermore, we found that all
monosubstituted amides (5e, 5f, 5g) and the alkyl substituted
propenoyl derivatives (7d, 7e, 7f) were weaker or extremely

2820 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Table 2. AE Inhibitors Reported in the Literature
Götz et al.
SmAE
)
mammalian AE
inhibitor
kobs/[I] (M-1 s-1
IC50(nM)
ref
kobs/[I]a (M-1 s-1
)
Cbz-Ala-Ala-NHCH(CH2CONH2)-CHdCHCO2CH2CHdCH2
Cbz-Ala-Ala-AAsn-CH2Cl
Cbz-Ala-Ala-AAsn-CH2OC(O)Ph
Cbz-Asn-CH2OC(O)-Ph-2,5-dimethyl
Cbz-Ala-Ala-AAsn-(S,S)-EP-COOEt
776b
139088b
13b
18
18
18
17
22
109000c
43000d
17400e
53 ( 25e
a All inhibitors were assayed using Cbz-Ala-Ala-Asn-AMC (Cbz ) PhCH2-OCO-; AMC ) 7-amino-4-methylcoumarin) as the substrate. b Inhibition was
determined using pig AE. Inhibition buffer was 39.5 mM citric acid, 121 mM Na2HPO4, 1 mM EDTA, 0.1% (w/v) CHAPS, 0.015% Brij, and 1 mM DTT
(dithiothreitol). c Inhibition was determined using human AE. Inhibitors were incubated in assay buffer (20 mM citric acid, 60 mM Na2HPO4, 1 mM EDTA,
0.1% (w/v) CHAPS, pH 5.8) at 25 °C with the substrate prior to addition of mammalian AE. d Inhibition was determined with pig kidney AE. Inhibition
buffer was 39.5 mM citric acid, 121 mM Na2HPO4, pH 5.8, containing 1 mM EDTA, 1 mM TCEP (tris-(2-carboxyethyl)phosphine), and 0.01% CHAPS.
e For detailed assay conditions, see Table 1.
poor inhibitors, respectively. We conclude that the hydrogen
bonding network between the inhibitor and the active sites of
the AEs is optimal with the additional carbonyl of the esters
(7a and 7b) next to the double bond and without the H-bond
donor present in monosubstituted amides. TvAE1 on the other
hand seems to be less affected by the additional H-bond donor
of the monosubstituted amides (5d, 5e, 5f, 5g) in contrast to
IrAE and SmAE.
Disubstituted amide derivatives are much more effective than
monosubstituted amide derivatives. In particular, the disubsti-
tuted amides with aromatic groups (5h, 5i) give lower IC50
values than the alkyl derivatives (5a NEt2, 5b N(nBu)2, 5c Pip).
We speculate that increased π-stacking of the aromatic residues
in either the S1′ or S2′ pocket improves binding of the inhibitor.
Unexpectedly, however, the aromatic bisfurylmethyl Michael
acceptor (5p) was a poor inhibitor.
The positioning and orientation of the phenyl or naphthyl
rings play an important role in the inhibitors’ potency for all
three AEs. The N-methyl-N-phenyl analogue (5h) is as effective
(TvAE1 IC50 ) 5 nM, IrAE IC50 ) 1.8 nM, SmAE IC50 ) 60
nM) as the N-methyl-N-benzyl analogue (5i, TvAE1 IC50 ) 0.55
nM, IrAE IC50 < 1 nM, SmAE IC50 ) 55 nM). However,
extending the alkyl spacer by one additional methylene group
from the N-methyl-N-benzyl analogue to the N-methyl-N-
phenethyl analogue (5k) decreases the inhibition potency against
TvAE1 (IC50 ) 50 nM) and SmAE (IC50 ) 600 nM). This
decreased potency is reversed, however, when the terminal
N-methyl-N-phenyl groups of (5k) are replaced by an N,N-
methyl-1-naphthylmethyl substituent (5j; TvAE1 IC50 <1 nM,
IrAE IC50 ) 5.5 nM, SmAE IC50 ) 35 nM, kobs/[I] )16 930
M-1 s-1). This analogue is one of three and four most effective
inhibitors of SmAE and TvAE1, respectively. For SmAE, the
dibenzyl amide (5m, SmAE IC50 ) 45 nM, kobs/[I] ) 5800)
has the lowest IC50 of the aromatic disubstituted amides. In
contrast, the active sites of IrAE and to some extent TvAE1
seem unable to accommodate the second methylene extended
aromatic substituent of (5m). This is reflected in the IC50 values,
which drop by 10- and 500-fold compared to (5j) for TvAE1
and IrAE, respectively. The less flexible N-benzyl-N-phenyl-
amide derivative (5l), however, furnished excellent IC50 values
against TvAE1 and IrAE with less than 1 nM for both enzymes.
Compared to the unsubstituted dibenzyl analogue (5m), the
substitution of one of the benzyl rings with an electron-donating
methoxy (5n) or an electron-withdrawing fluorine (5o) did not
significantly alter inhibition values for all three AEs except in
the case of IrAE and (5n) for which a 10-fold smaller IC50 value
was recorded.
the N,N-benzyl-1-naphthylmethyl analogue (5r) did not overall
improve the IC50 for SmAE but increased the potency for
TvAE1 and IrAE. Constraining the orientation and flexibility
of the benzyl group led to the design of analogues such as
quinoline (5s), isoquinoline (5t), indoline (5u), and isoindoline
(5v). Both quinoline and indoline exhibited good potency but
were less potent compared to the benzylamide (5i). The aromatic
ring is much less flexible in the indoline and quinoline bicyclic
system. The orientation of the aromatic ring in the isoindoline
(5v) and isoquinoline (5t) compounds is also different from their
indoline and quinoline parent compounds (5u and 5s) because
of the different location of the nitrogen. This altered orientation
of the aromatic ring lowers their inhibitory potency by 3- to
6-fold for all three AEs. For IrAE and TvAE1, however,
changing the indoline (5u) to the isoindoline (5v) resulted in
slightly improved IC50 values, whereas the opposite was the
case for SmAE. Additional studies showed that the 4-phenyltet-
rahydropyridine derivative (5w) and the amino acid derivative
(5x) did not improve the effectiveness of the Michael acceptor
warhead. The biotinylated analogue of (7a), biotin-Ala-Ala-
AAsn-CHdCHCOOEt (12), remained an effective inhibitor of
all three AEs.
In summary, the aza-peptide esters are more potent than their
amide analogues. However, the difficulty of their preparation
limits the variety of possible compounds. Also, the similarity
of the SAR between these AEs arising from such phylogeneti-
cally disparate organisms is quite remarkable and suggests an
evolutionary constraint on the structural topography on the prime
side of the AE active site to perform such prescribed functions
as protein processing and zymogen activation.
Table 2 presents inhibition data obtained with other AE
inhibitors reported in the literature. Direct comparison with our
results is not possible in most cases, as most of the reported
second-order inhibition rate constants (kobs/[I]) were obtained
with mammalian AEs and not with SmAE. We have previously
studied aza-peptide epoxide inhibitors with both pig kidney AE
and SmAE.21 In general the pig kidney enzyme was inhibited
2- to 3-fold faster than the SmAE, but this could be due to
different subsite preferences of the two enzymes. Overall, aza-
peptide Michael acceptors are very similar in reactivity to aza-
peptide epoxides with SmAE. For example, the epoxide
analogue (Cbz-Ala-Ala-AAsn-(S,S)-EP-COOEt, Table 2, kobs
/
[I] ) 17 400 M-1 s-1) inhibits SmAE with the same rate as
the corresponding Michael acceptor monoethyl ester (7a, Table
1, kobs/[I] ) 17 420 M-1 s-1) but inhibits pig kidney AE more
rapidly (kobs/[I] ) 43 000 M-1 s-1).
Aza-peptidyl Inhibitors and Clan CD Specificity. Repre-
sentative aza-peptide Michael acceptor inhibitors displayed in
Table 1 were further tested with other clan CD cysteine proteases
including caspases-3, -6, and -8, clostripain, and gingipain K
The next step was to combine the potent effects of the
naphthyl group and the benzyl substituent. Compared to
dibenzylamide (5m) the N,N-benzyl-2-naphthylmethyl (5q) and

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2821
Table 3. Inhibition of Various Clan CD and Clan CA Cysteine Proteases by AE Specific Aza-peptide Michael Acceptors
kobs/[I] (M-1 s-1 a
)
inhibitor Cbz-Ala-Ala-AAsn-R with R )
caspases -3, -6, -8b
calpain Ic
papaind
cathepsin Be
gingipain Kf
clostripaing
7a
5i
5m
5u
5j
-CHdCHCOOEth
-CHdCHCON(CH3)Bzl
-CHdCHCON(Bzl)2
-CHdCHCO-indoline
-CHdCHCON(CH3)CH2-1-Napth
-CHdCHCONHCH2CH2Ph
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
<1
NIi
NIi
NIi
NIi
NIi
1
1
6
1
2
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
NIi
12
1
6
5g
NIi
a kobs is the pseudo-first-order rate constant obtained from plots of ln Vt/V0 vs time unless indicated otherwise. b Inhibition buffer was 40 mM Pipes, 200
mM NaCl, 0.2% (w/v) CHAPS, sucrose 20% (w/v), and 10 mM DTT (dithiothreitol), at pH 7.2, with Ac-Asp-Glu-Val-Asp-AMC as the substrate. c Inhibition
buffer was 50 mM Hepes buffer (pH 7.5) containing 10 mM cysteine and 5 mM CaCl2. d Inhibition buffer was 50 mM Hepes and 2.5 mM EDTA, at pH
7.5, and 25 µL of DTT (0.1 M). e Inhibition buffer was 0.1 M K2HPO4, 1.25 mM EDTA, 0.01% Brij, pH 6.0 buffer and at 23 °C. f Inhibition buffer was
0.2 M Tris-HCl, 0.1 M NaCl, 5 mM CaCl2, 2 mM DTT at pH 8.0 with Suc-Ala-Phe-Lys-AMC as the substrate with gingipain K. g Inhibition buffer was 20
mM Tris-HCl, 10 mM CaCl2, 0.005% Brij 35, 2 mM DTT at pH 7.6 with Cbz-Phe-Arg-AMC as the substrate. h Cbz ) Ph-CH2-OCO-. AAsn ) aza-Asn.
i NI ) no inhibition.
Figure 2. Two possible sites for the thioalkylation of aza-peptide Michael acceptor inhibitors with the enzyme cysteine residue, benzyl thiol, or
DTT.
Table 4. Rates of Degradation and Half-Lives of Various Inhibitors in the Presence of DTT
pH 5.8
pH 6.8
inhibitor, R ) Cbz-Ala-Ala-AAsn
kobs (s-1 a
)
t1/2 (min)
kobs (s-1 a
)
t1/2 (min)
7a
7b
5i
5m
7d
R-CHdCHCOOEt
R-CHdCHCOOBzl
R-CHdCHCON(CH3)Bzl
R-CHdCHCON(Bzl)2
R-CHdCH-CHdCH-CH3
6.06 × 10-4
3.07 × 10-5
no reaction
19
3.10 × 10-3
4.60 × 10-3
5.78 × 10-4
6.73 × 10-4
no reaction
3.7
2.5
20
376
17
a An aliquot (15 µL) of 10 mM aza-peptidyl Michael acceptors in DMSO (dimethyl sulfoxide) was added to buffer (485 µL, 0.1 M citrate phosphate, pH
5.8 or 6.8) containing 3.4 mM DTT (dithiothreitol), and the reaction of the double bond of the inhibitor with DTT was monitored spectrophotometrically at
250 nm over time. The kobs was obtained from pseudo-first-order rate plots of ln(At/A0) versus time, and the half-lives were derived from t1/2 ) ln 2/kobs
.
(Table 3). Caspases require Asp at P1 of the substrate and prefer
tri- and tetrapeptides over dipeptides.45 Clostripain and gingi-
pains require peptides with Arg, Lys, or Orn at P1.46 It is,
therefore, not surprising that the present AE inhibitors neither
inhibit the caspases nor clostripains, whereas compounds (7a)
and (5j) inhibit gingipain at low rates (kobs/[I] <6 M-1 s-1).
Thus, the present data confirm the unique P1 specificity of each
family member of the clan CD cysteine proteases, which
facilitates the design of selective inhibitors.
Aza-peptidyl Michael Acceptors Essentially Do Not
React with Clan CA Cysteine Proteases. The aza-peptide
Michael acceptors were also tested with the clan CA cysteine
proteases calpain I, papain, and cathepsin B and showed little
to no inhibition after 30 min of incubation (Table 3). The fastest
rate measured was for compound (5g) with papain at 12 M-1
s-1. Otherwise, the ethyl ester derivative (7a) was essentially
unreactive with cathepsin B (<1 M-1 s-1). A similar rate was
also observed with (5m) and calpain I (<1 M-1 s-1). Unlike
clan CD proteases, the specificity of clan CA enzymes is
strongly influenced by the S2 subsite. We hypothesize that the
lack of inhibition of clan CA proteases by the present inhibitor
series arises from the rigid nature of the aza-peptide moiety,
which most likely prevents effective binding of the warhead
close to the enzyme’s catalytic residues. Consistent with the
current data, our previously reported aza-peptide epoxide
inhibitors of AEs21 and caspases22 also did not inhibit clan CA
proteases.
Mechanism of Inhibition. The mechanism of inhibition of
cysteine proteases by Michael acceptors involves a nucleophilic
attack of the catalytic cysteine residue on the ꢀ-carbon of the
Michael acceptor double bond.47 A covalent bond forms, and
the inhibitor is irreversibly bound to the enzyme. With the
present inhibitors, nucleophilic attack of the active site cysteine
thiol could occur at either carbon (C-2 or C-3) of the double
bond (Figure 2). With the related aza-peptidyl epoxide inhibitors
also shown in Figure 1, X-ray crystal structures of caspase-1
inhibited by PhPr-Val-Ala-AAsp-EP-COOCH2Ph and PhPr-Val-
Ala-AAsp-EP-CH2CH2Ph revealed that the attack of the cysteine
thiol occurred at the C-2 carbon of the epoxide moiety, although
this is not based on a refined structure.48 In contrast, more recent
refined X-ray studies of aza-peptide epoxide inhibitors that were
specifically designed to inhibit caspase-3 demonstrated that the
cysteine thiol attack occurs at the C-3 carbon of the epoxide
moiety.49 It should be noted that attack on the C-3 of the epoxide
corresponds to attack at C-2 of the Michael acceptor inhibitor
due to different number schemes (Figure 1).

2822 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
In order to investigate the point of attack of the active site
cysteine thiol, we studied the reactivity of the aza-peptidyl
Michael acceptors with the small thiols DTT and benzylmer-
Factors Influencing Reactivity and Half-Life of
Aza-peptide Michael Acceptors. Aza-peptide Michael accep-
tors react with DTT in the assay buffer at variable rates
depending on pH and the nature of the substituents on the double
bond (Table 4). Lowering the pH of the assay decreases the
rate of reactivity dramatically. For example, the ethyl ester has
a half-life of 3.7 min in the presence of DTT at pH 6.8. At pH
5.8, the half-life increases to 19 min. With the amide derivatives,
the effect of pH on the stability is more pronounced. Thus, the
half-life of compound (5i) increases from 20 to 376 min when
lowering the pH from 6.8 to 5.8. In a previous study with
caspase-specific, tetrapeptidyl, aza-aspartyl Michael acceptors,35
we found that the half-life of the caspase-specific ethyl ester
analogue in the presence of DTT was 10 min at pH 7.2. At the
same pH, the N-methylbenzylamide had a half-life of 116 min.
Accordingly, we suspect that the length of the peptidyl inhibitor
and the size of the side chains have an effect on the degradation
rate. All of the above influencing factors, therefore, need to be
taken into account when evaluating inhibitor potency.
1
captan using H NMR and UV spectroscopy (Table 4). We
predicted C-2 thioalkylation due to the difference in potency
between the ester, amide, and alkyl aza-peptidyl Michael
acceptor inhibitors. Upon incubation of various Michael acceptor
inhibitors with DTT in the SmAE/TvAE1 assay buffer, we
observed the disappearance of the Michael acceptor double bond
over time. The potent inhibitor (7a) reacted with excess DTT
in assay buffer at pH 6.8 and room temperature with a first-
order rate constant of 3.10 × 10-3 s-1 (t1/2 ) 3.7 min; Table
4). Michael acceptors with a terminal amide rather than an ester
react with DTT at much slower rates. Thus, the rate constants
for reaction of (5i) and (5m) with DTT were 5.78 × 10-4 s-1
(t1/2 ) 20 min) and 6.73 × 10-4 s-1 (t1/2 ) 17 min), respectively.
Overall, the order of reactivity of the various Michael acceptors
with differing terminal substituents was esters > amides >
alkyls (Table 4). Freidig et al. (1999) also reported the reaction
rates of ethyl acrylate and acrylamide with glutathione. Ethyl
acrylate reacts 85 times more quickly than acrylamide with
Conclusions
second-order rate constants of 0.66 and 7.8 × 10-3 M-1 s-1
,
Aza-peptidyl Michael acceptors are a recently discovered
class of inhibitors of AEs.35 The present report describes a
unique and comprehensive set of comparative analyses for three
AEs from disparate pathogenic organisms. On the basis of their
similar SAR, the data suggest that the topography on the prime
side of the active site is evolutionarily constrained, perhaps
contributing to the maintenance of such critical functions as
protein/peptide (hormone) processing and zymogen activation.
The inhibitors are both potent and selective toward AEs among
other clan CD proteases and clan CA cysteine proteases. The
SAR study of the P1′ specificity discovered that AEs prefer
aromatic residues and that the orientation and extension of such
residues into the S1′ subsite play an important role. In addition,
the strength of the electron withdrawing group on the P1′
position of the double bond controls the potency of the inhibitor.
We determined that the inhibitor warhead reacts with thiols and
that the progress of this decay reaction is dependent on both
pH and the electron-withdrawing nature of the P1′ substituent.
Mechanistic and NMR studies with simple thiols indicate that
the most likely reaction mechanism involves attack of the active
site cysteine on the carbon (C-2) immediately next to the scissile
bond. X-ray analysis of Michael acceptor inhibitors to the active
sites of caspase-3 and caspase-8 also show C-2 thioalkylation.52
respectively.50 Acrylates are more reactive toward nucleophilic
attack than acrylamides because of differences in the electron
withdrawing properties of esters and amides. Our thiol reactivity
data in combination with the results by Freidig et al. suggest
that simple thiols react at C-2 (Michael addition to an acrylate)
rather than at C-3 (Michael addition to an acrylamide). This
suggests that the enzyme is also likely to attack C-2 of the
Michael addition inhibitor.
In order to obtain additional evidence for the site of alkylation,
we studied the products in a model system by proton NMR
spectroscopy. We chose benzyl thiol as the model nucleophile
and studied its reaction with the Michael acceptor (7a). We
followed the reaction of 7a with benzylmercaptan in DMSO-
1
d6 by H NMR for 48 h and observed the expected gradual
disappearance of the vinyl proton at 6.59 ppm together with a
simultaneous increase of a new signal at 4.05 ppm. The NMR
additivity rules51 as used by ChemDraw were applied in
estimating the chemical shifts of the two possible thioalkylation
products. The estimated chemical shift for a C-2 thioalkylation
of the Michael acceptor double bond by benzylmercaptan
predicts the shift of the proton on the C-2 carbon of the thioether
product at 4.11 ppm. A C-3 thioalkylation would result in an
estimated chemical shift of 3.59 ppm (Figure 2). Unfortunately,
the new signal coincides with the R-H of the inhibitor peptide
backbone, which scrambles the multiplicity of the peak.
However, the chemical shift of the new signal closely corre-
sponds to the predicted shift for a C-2 thioalkylation. Similar
results have been obtained with Michael acceptor inhibitors of
caspases.35 Thus, the data from the NMR study also suggest
that the C-2 carbon is the site of attack on the Michael accep-
tor.
Experimental Section
Material and Methods. Materials were obtained from Acros,
Bachem Bioscience Inc., or Sigma Aldrich and used without further
purification. The purity of each compound was confirmed by TLC,
1H NMR, MS, and elemental analysis. Chemical shifts are reported
in ppm relative to an internal standard (trimethylsilane). TLC was
performed on Sorbent Technologies (250 µm) silica gel plates. The
1H NMR spectra were obtained on a Varian Mercury 400 MHz
spectrometer. Electrospray ionization (ESI), fast-atom-bombardment
(FAB), and high-resolution mass spectrometry were obtained using
Micromass Quattro LC and VG Analytical 70-SE instruments.
Elemental analysis was carried out by Atlantic Microlab Inc.,
Norcross, GA.
Experiments. AE Assays. The zymogen forms of SmAE and
IrAE were expressed in Pichia pastoris as previously described.12,53
For expression of TvAE1 in Pichia, T. Vaginalis (G3 strain)
genomic DNA was kindly provided by Dr. Kirkwood Land,
Department of Biological Sciences, University of the Pacific,
Stockton, CA, and was used as a template to PCR-amplify the
putative TvAE1 zymogen. The start position of the zymogen was
estimated by amino acid sequence alignments with the S. mansoni
Several Michael acceptor inhibitors specific for caspase-3 and
caspase-8 have recently been analyzed by X-ray crystal-
lography.52 This Michael acceptor warhead is identical to the
warhead of the AE inhibitors used here and was found to be
thioalkylated by the active site cysteine thiol at the C-2 carbon
of the reactive moiety. Thus, we conclude that it is likely that
AEs are also alkylated at the C-2 carbon, which corresponds to
the C-3 carbon of aza-peptide epoxide inhibitors. Thus, the site
of alkylation in both aza-peptide epoxides and aza-peptide
Michael acceptor inhibitors is located at approximately the same
distance from the aza-peptide nitrogen atom.

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2823
and human AEs using the deposited TvAE1 sequence (GenBank
accession number AY326446).34 PCR primers were forward, 5′f3′
ATACTGCAGCACAGCTCGCAAGGTGTGATAG that contained
a PstI restriction endonuclease site (italicized) and two additional
nucleotides (underlined) to preserve the in-frame translation, and
reverse, 5′f3′ TATGCGGCCGCTTAGCAGATGGCATCAAT-
AGCAGC that contained a NotI endonuclease site (italicized) and
a translation termination codon (underlined). PCR amplification,
cloning into the expression vector pPICZR B, and expression under
methanol induction were as described.53,54 Induction medium was
lyophilized and stored indefinitely at -20 °C. To autoactivate
recombinant SmAE and TvAE1, lyophilized induction medium
(50–100 mg) was reconstituted in 1.5 mL of 0.5 M sodium acetate,
4 mM DTT, pH 4.5, and left to stand at 37 °C for 3 h to overnight.
Autoactivation was not required for IrAE produced in P. pastoris.12
AE activity in the induction medium was measured with the
substrate Cbz-Ala-Ala-Asn-AMC as described.10,53 In a black 96-
well microtiter plate, 50 µL of activated enzyme was added to an
equal volume of 0.1 M citrate phosphate, 4 mM DTT, pH 6.8 for
SmAE and TvAE1 or pH 5.5 for IrAE. Aza-peptidyl inhibitors were
added as 1 µL aliquots (serial water dilutions of a 10 mM DMSO
stock solution) to give a final concentration range of between 2.0
and 0.0002 µM and allowed to incubate at room temperature for
20 min. Then, 100 µL of the same buffer containing 20 µM Cbz-
Ala-Ala-Asn-AMC was added and the reaction allowed to proceed
for 20 min. Plotting the relative fluorescence units (RFU)/min
against the inhibitor concentration (µM) permitted calculation of
the IC50 value.
The standard 100 µL reaction was started by adding 40 µL of assay
buffer, 5 µL of various amounts of inhibitor (stock solution
concentrations varied from 5 × 10-3 to 4.84 × 10-7 M in DMSO),
and 5 µL of substrate in DMSO (100 µM final concentration) at
37 °C. Enzyme stock solution (50 µL of 2 nM; final concentration
of 1 nM) was added to the mixture after 1 min, and measurements
were started immediately for 20 min at 37 °C. Inhibition experi-
ments were repeated in duplicate, and standard deviations were
determined.
Caspase-6 kinetic assays were performed using the same condi-
tions and the same substrate (Ac-Asp-Glu-Val-Asp-AMC, 2 mM
stock solution in DMSO). The enzyme stock solution was 10 nM
(final concentration in the well, 5 nM) in the assay buffer. The
inhibitor stock solution concentrations varied from 5 × 10-3 to
2.42 × 10-6 M in DMSO.
Caspase-8 kinetic assays were performed using the same condi-
tions and the same substrate (Ac-Asp-Glu-Val-Asp-AMC, 2 mM
stock solution in DMSO). The enzyme stock solution was 100 nM
(final concentration in the well, 50 nM) in the assay buffer. The
inhibitor stock solution concentrations varied from 5 × 10-3 to
2.42 × 10-6 M in DMSO.
KM values for Ac-Asp-Glu-Val-Asp-AMC with caspase-3 (KM
) 9.7 µM), caspase-6 (KM ) 236.35 µM), and caspase-8 (KM
)
6.79 µM) were determined (G. Salvesen, personal communication).
The k2 values are 11.3-fold higher than the apparent rate for
caspase-3 because [S] was 100 mM and KM ) 9.7 µM. The k2
values are 1.4-fold higher than the apparent rate for caspase-6
because [S] was 100 mM and KM ) 236.35 µM. The k2 values are
15.7-fold higher than the apparent rate for caspase-8 because [S]
was 100 mM and KM ) 6.79 µM.
Second-order inhibition rates were determined for SmAE with
some of the more reactive inhibitors. Zymogen SmAE was
autoactivated as described above. Inhibitor (1 µL) at six concentra-
tions (to yield 0-1 µM final concentrations) was spotted into a
96-well black microtiter plate. Then, 180 µL of 0.1 M citrate
phosphate, 2 mM DTT, pH 6.8, containing 20 µM Cbz-Ala-Ala-
Asn-AMC was added. Activated AE (20 µL) was added to the mix
and the progress of inhibition followed every 2 s for 30 min at 25
°C (Molecular Devices Flex Station fluorometer in injection mode;
excitation at 355 nm, emission at 460 nm). The kinact/Ki values were
Gingipain K and Clostripain Assays. Clostripain was purchased
from Sigma Chemical Co. (St. Louis, MO) as a solid which was
dissolved in an activation solution of 8 mM DTT at a concentration
of 5.962 µM and stored at -20 °C prior to use. The inhibition of
clostripain began with the addition of 25 µL of stock inhibitor
solution (concentration varies by inhibitor) in DMSO to a solution
of 250 µL of 20 mM Tris-HCl, 10 mM CaCl2, 0.005% Brij 35, 2
mM DTT buffer at pH 7.6 (clostripain buffer), and 5 µL of the
stock enzyme solution. Aliquots (25 µL) of this incubation mixture
were taken at various time points and added to a solution containing
100 µL of the clostripain buffer and 5 µL of Cbz-Phe-Arg-AMC
substrate solution (139 µM) in DMSO. The enzymatic activity was
monitored by following the change in fluorescence at 465 nm. All
data obtained were processed by pseudo-first-order kinetics.
Gingipain K stock solution was obtained from J. Potempa
(University of Georgia, Athens, GA) in a buffer containing 20 mM
Bis-Tris, 150 mM NaCl, 5 mM CaCl2, 0.02% NaN3, at pH 8.0, at
a concentration of 9 µM. The solution was stored at -20 °C prior
to use. Before the enzyme was used, an aliquot (1 µL) of the stock
enzyme was diluted to a concentration of 4.61 nM in 1.951 mL of
0.2 M Tris-HCl, 0.1 M NaCl, 5 mM CaCl2, 2 mM DTT at pH 8.0
(gingipain K buffer) and kept at 0 °C. This solution was used only
for 1 day, as freezing the enzyme at this concentration destroyed
all activity. The inhibition of gingipain K began with the addition
of 25 µL of stock inhibitor solution (concentration varies by
inhibitor) in DMSO to 244 µL of the diluted enzyme solution (4.61
nM) in gingipain K buffer warmed to room temperature. Aliquots
(20 µL) of this inhibition mixture were taken at various time points
and added to a solution containing 100 µL of the gingipain K buffer
and 5 µL of Suc-Ala-Phe-Lys-AMC ·TFA as the substrate (910 µM
stock) in DMSO. Activity was monitored by following the change
in fluorescence at 465 nm. The data for gingipain K were processed
by pseudo-first-order kinetics.
determined using nonlinear regression analysis (GraphPad Prism
20
3.X) and corrected for substrate (1 + S/KM: 1 +
/ ) 1.33).
60
Cathepsin B and Papain Assays. The incubation method was
used to measure the irreversible inhibition of papain and cathepsin
B. For cathepsin B, 30 µL of a stock inhibitor solution (1.19 g/mL)
was added to 300 µL of 0.1 M potassium phosphate, 1.25 mM
EDTA, 0.01% Brij 35, pH 6.0. Then, 30 µL of a freshly prepared
cathepsin B solution (approximate concentration of 6.98 × 10-3
µg/µL) in the same buffer with 1 mM DTT was added. Aliquots
(50 µL) of the inhibition mixture were withdrawn at various time
intervals and added to 200 µL of the above buffer containing 499
µM Cbz-Phe-Arg-AMC. The release of AMC was measured at
room temperature in a Tecan Spectra Fluor microplate reader (λex
) 360 nm, λem ) 465 nm). Pseudo-first-order inactivation rate
constants were obtained from plots of ln Vt/Vo versus time, where
Vo is the rate of hydrolysis of fluorogenic substrate and Vt the rate
of hydrolysis of substrate in presence of the inhibitor.
For papain, a similar incubation method was used with 50 mM
Hepes, 2.5 mM DTT, 2.5 mM EDTA, pH 7.5, and approximately
0.29 mg/mL papain in the buffer. The substrate used was Cbz-
Phe-Arg-pNA at 53.7 µM in the same buffer. The release of
p-nitroanilide was measured at 405 nm and room temperature with
a Molecular Devices Thermomax microplate reader.
Caspase-3, -6, and -8 Assays. Assays using the fluorogenic
substrate Ac-Asp-Glu-Val-Asp-AMC (λex ) 360 nm, λem ) 465
nm) were carried out in a Tecan Spectra Fluor microplate reader
at 37 °C. Inhibition rates were determined by the progress curve
method. The concentration of the caspase-3 stock solution was 2
nM in the assay buffer. Assay buffer consists of a 1:1 mixture of
40 mM Pipes, 200 mM NaCl, 0.2% (w/v) CHAPS, and 20% (w/v)
sucrose to 20 mM DTT solution in H2O at pH 7.2. The concentra-
tion of the substrate stock solution was 2 mM in DMSO. The
enzyme was preactivated for 10 min at 37 °C in the assay buffer.
Stability Studies of Aza-peptidyl Michael Acceptors. An
aliquot (15 µL) of 10 mM aza-peptidyl Michael acceptors in DMSO
was added to AE buffer (485 µL, pH 5.8 or 6.8) containing DTT
(3.4 mM) and the reaction of the double bond of the inhibitor with
DTT monitored spectrophotometrically at 250 nm over time. The
kobs was obtained from pseudo-first-order rate plots of ln(At/A0)
versus time and the half-lives were derived from t1/2 ) ln 2/kobs
.

2824 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
1H NMR Study. The progress of thioalkylation of Cbz-Ala-
Ala-AAsn-CHdCHCOOEt (7a) by benzylmercaptan was followed
by 1H NMR on a 400 MHz Varian spectrometer in DMSO-d6 over
a period of 48 h. All solutions were purged with argon and a 10
equiv excess of benzylmercaptan over the peptidyl inhibitor was
used. A spectrum was taken every 5 h.
(CDCl3): 2.16 (s, 1H, CH2NHCH2), 3.74 (s, 3H, CH3O), 3.78–3.86
(m, 4H, CH2NHCH2), 6.83–6.97 (m, 2H, MeO-Ph), 7.24–7.33 (m,
7H, Ph).
Benzyl-(4-fluorobenzyl)amine (Bzl(4-F-Bzl)NH). The amine
was prepared from 4-fluorobenzylamine and benzaldehyde follow-
ing the reductive amination procedure (89% yield). 1H NMR
(CDCl3): 2.05 (s, 1H, CH2NHCH2), 3.77–3.79 (d, 4H, CH2NHCH2),
6.96–7.02 (m, 4H, F-Ph), 7.19–7.23 (m, 5H, Ph).
Benzyl-(1-naphthylmethyl)amine (Bzl(1-Napth-CH2)NH). The
amine was prepared from 1-naphthaldehyde and benzylamine
following the reductive amination procedure (97% yield). 1H NMR
(CDCl3): 2.03 (s, 1H, CH2NHCH2), 3.91 (s, 2H, NHCH2Ph), 4.24
(s, 2H, Napth-CH2NH), 7.22–7.51 (m, 10H, Ph, Napth), 7.71–7.85
(m, 2H, Napth).
Cbz-Ala-Ala-AAsn-CHdCHCOOEt (7a). Time 0 h. 1H NMR
(DMSO-d6): 1.15–1.3 (m, 9H, CH3), 3.3 (m, 2H, NCH2CO), 4.05
(m, 1H, R-H), 4.1–4.2 (q, 2H, OCH2CH3), 4.3 (m, 1H, R-H), 5.0
(m, 2H, Cbz), 6.55–6.65 (d, 1H, CHdCH), 7.5 (s, 1H, NH), 8.15
(d, 1H, NH). Benzylmercaptan signals are dominant in the aromatic
region and are therefore not included.
1
Time 48 h. H NMR (DMSO-d6): 1.15–1.3 (m, 9H, CH3), 3.3
(m, 2H, NCH2CO), 4.05 (m, 2H, R-H and CH-S), 4.1–4.2 (q, 2H,
OCH2CH3), 4.3 (m, 1H, R-H), 5.0 (m, 2H, Cbz), 7.6 (s, 1H, NH),
8.15 (d, 1H, NH). Benzylmercaptan signals are dominant in the
aromatic region and are therefore not included. Changes in the
spectrum are as follows: The vinyl proton at 6.55–6.65 ppm has
disappeared. A new peak has formed at 4.05 ppm.
N-Benzyloxycarbonylalanylalanyl Hydrazide (3, Cbz-Ala-
Ala-NHNH2). 3 was synthesized from Cbz-Ala-Ala-OMe by
hydrazinolysis. Anhydrous hydrazine (10 equiv) was added to a
solution of Cbz-Ala-Ala-OMe (1 equiv) in MeOH at room
temperature, and the resulting mixture was then stirred at room
temperature for 16 h. Excess hydrazine and solvent were removed
by evaporation. The resulting residue was washed with ethanol and
ether to give Cbz-Ala-Ala-NHNH2 as a white solid (57% yield).
1H NMR (DMSO-d6): 1.1–1.3 (d, CH3), 4.0–4.1 (m, 1H, R-H),
4.1–4.3 (m, 2H, R-H and NH), 5.05 (s, 2H, Cbz), 7.3–7.4 (m, 5H,
Ph), 7.5 (d, 1H, NH), 7.9 (d, 1H, NH), 9.05 (s, 1H, NH).
N1-(N-Benzyloxycarbonylalanylalanyl)-N2-ethoxycarbonyl-
methylhydrazine (Cbz-Ala-Ala-NHNHCH2COOEt). Ethyl bro-
moacetate (1.1 equiv) was added dropwise to a stirred solution of
Cbz-Ala-Ala-NHNH2 (1 equiv) and NMM (1.1 equiv) in DMF that
was cooled to -10 °C. The resulting solution was stirred for 30
min at -10 °C, after which the mixture was allowed to react at
room temperature for 36 h. The DMF was evaporated, and the
residue was purified on a silica gel column using 1:9 MeOH/CH2Cl2
as the eluting solvent system to give the ethyl ester as a white solid
General Procedure for the Synthesis of Aza-peptide
Michael Acceptors: HOBt/EDC Coupling Method. To a stirred
solution of the peptidyl hydrazide precursor (4, 1 equiv) and the
fumaric acid or propenoic acid precursor (2a-x or 6a-f, 2 equiv),
HOBt (2 equiv) and EDC (2 equiv) were added. The mixture was
allowed to react for 16 h at room temperature. The DMF was
evaporated, and the residue was redissolved in EtOAc. The organic
layer was washed with 2% citric acid, saturated NaHCO3, saturated
NaCl, dried over MgSO4, and concentrated. Chromatography on a
silica gel column using 10% MeOH/CH2Cl2 as the eluent afforded
the aza-peptidyl fumarate or acrylate derivatives. MS and 1H NMR
(CDCl3 or DMSO-d6) data were consistent with the proposed
structures.
General Procedure for the Synthesis of Fumaric Acid
Monoamides: Mixed Anhydride Coupling Method. Coupling of
the amine precursors to monoethyl fumarate was accomplished
using the mixed anhydride coupling method. To a solution of the
monoethyl fumarate (1 equiv) in CH2Cl2 at -20 °C was added
N-methylmorpholine (NMM, 1 equiv) followed by isobutyl chlo-
roformate (iBCF, 1 equiv). After the reaction mixture was allowed
to stir for 30 min, the amine (1 equiv) was added to the mixture.
Hydrochloride salts of the amine were pretreated with NMM (1
equiv) at -20 °C in CH2Cl2 prior to addition. After 30 min the
mixture was stirred for 4 h at room temperature. The DMF was
evaporated, and the residue was washed and purified using the same
procedure as described above for the EDC/HOBt coupling method.
MS and 1H NMR (DMSO-d6 or CDCl3) results were consistent
with the proposed structures.
1
(yield 36%). H NMR (DMSO-d6): 1.18 (t, 9H, CH3), 3.5 (d, 2H,
NCH2COOEt), 4.0–4.15 (m, 3H, R-H and OCH2CH3), 4.2 (m, 1H,
R-H), 5.03 (m, 2H, Cbz), 5.18 (m, 1H, NH), 7.22–7.40 (m, 5H,
Ph), 7.4–7.5 (d, 1H, NH), 7.9 (m, 1H, NH), 9.35 (m, 1H, NH). MS
(FAB) m/z 395 [(M + 1)+].
N1-(N-Benzyloxycarbonylalanylalanyl)-N2-carbamoylmethyl-
hydrazine (4, Cbz-Ala-Ala-NHNHCH2CONH2). The ethyl ester
Cbz-Ala-Ala-NHNHCH2COOEt (1 equiv) was dissolved in a 9 M
solution (100 equiv) of NH3 in methanol and a small amount of
DMF and allowed to stir on an ice bath. To this solution was added
catalytic NaCN (0.1 equiv). The flask was closed with a rubber
septum and allowed to stir at 0 °C for 3 days. The solvent was
evaporated and the product was precipitated with 1:9 MeOH/CH2Cl2
and methanol to yield a white solid (68% yield). 1H NMR (DMSO-
d6): 1.18 (d, 6H, CH3), 3.2 (d, 2H, NCH2CONH2), 4.0–4.12 (m,
1H, R-H), 4.2 (m, 1H, R-H), 5.03 (m, 2H, Cbz), 5.22 (m, 1H, NH),
7.18 (d, 1H, NH), 7.3–7.5 (m, 6H, Ph and NH), 8.0 (m, 1H, NH),
9.38 (m, 1H, NH). MS (FAB) m/z 366 [(M + 1)+]. HRMS (FAB)
calculated for C16H24N5O5: 366.177 74. Observed m/z 366.176 65.
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-ethoxycarbonylpropenoyl)hydrazine (7a, Cbz-Ala-
Ala-AAsn-CHdCHCOOEt). 7a was synthesized using the EDC/
HOBt coupling method, purified by chromatography on a silica
gel column using 1:13 MeOH/CH2Cl2 as the eluent, and then
recrystallized from EtOAc/hexane; white solid, yield 33%. 1H NMR
(DMSO-d6): 1.15–1.3 (m, 9H, CH3), 3.3 (m, 2H, NCH2CO), 4.05
(m, 1H, R-H), 4.1–4.2 (q, 2H, OCH2CH3), 4.3 (m, 1H, R-H), 5.0
(m, 2H, Cbz), 6.55–6.65 (d, 1H, CHdCH), 7.1–7.2 (m, 2H, NH
and CHdCH), 7.2–7.4 (m, 5H, Ph), 7.5 (s, 1H, NH), 8.15 (d, 1H,
NH). HRMS (FAB) calculated for C22H30N5O8: 492.209 44. Ob-
served m/z 492.205 65.
Benzyl-(2-naphthylmethyl)amine (Bzl(2-Napth-CH2)NH).
Reductive Amination Procedure. Benzylamine (1 equiv) was
dissolved in absolute ethanol. A solution of 2-naphthaldehyde (1
equiv) in absolute ethanol was added dropwise via an addition
funnel to the benzylamine solution while stirring. The mixture was
heated at reflux for 2 h. Sodium borohydride (2.1 equiv) was added
to the mixture. The mixture was heated at reflux for 2 h. The solvent
was removed under reduced pressure. The residue was dissolved
in dichloromethane. The solution was washed with aqueous base
(NaOH, 1 M) and dried (MgSO4). The solvent was removed under
reduced pressure to give a clear, colorless oil (90% yield). 1H NMR
(CDCl3): 2.37 (s, 1H, CH2NHCH2), 3.84 (s, 2H, NHCH2PH), 3.97
(s, 2H, Napth-CH2NH), 7.23–7.50 (m, 8H, Ph, Napth), 7.76–7.81
(m, 4H, Napth).
Bis-(2-furylmethyl)amine ((2-furyl-CH2)2NH). The amine was
prepared from 2-furylaldehyde and 2-fufurylamine following the
reductive amination procedure (89% yield). 1H NMR (CDCl3): 3.84
(s, 4H, CH2NHCH2), 6.29–6.33 (2 dd, 4H, furyl), 7.37–7.38 (dd,
2H, furyl).
Benzyl-(4-methoxybenzyl)amine (Bzl(Bzl-4-OMe)NH). The
amine was prepared prepared from p-anisaldehyde and benzylamine
following the reductive amination procedure (98% yield). 1H NMR
trans-3-Benzyloxycarbonylpropenoic Acid or Monobenzyl
Fumarate (HOOCCHdCHCOOBzl). Equimolar amounts of
fumaric acid and benzyl alcohol were dissolved in anhydrous DMF.
NMM (1 equiv) was added at 0 °C followed by EDC after 15 min.
The mixture was stirred overnight at room temperature. DMF was
evaporated, and the crude residue was redissolved in EtOAc. The

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2825
product was extracted with saturated aqueous NaHCO3. The
aqueous layer was then acidified with 1 N HCl to pH 2. The product
was extracted with EtOAc, and the organic layer was washed with
water and dried (MgSO4). The solvent was evaporated and the crude
residue was subjected to column chromatography (MeOH/CH2Cl2)
column chromatography on silica gel using 10% MeOH/CH2Cl2
as the eluent and then recrystallized from EtOAc/hexane to give a
white powder (15% yield). H NMR (DMSO-d6): 0.95 (m, 6H, 2
1
× nBu-CH3), 1.11–1.27 (m, 6H, 2 × Ala-CH3), 1.30–1.37 (m, 4H,
2 × CH2CH2CH2CH3), 1.53–1.59 (m, 4H, 2 × CH2CH2CH2CH3),
3.20–3.32 (d, 6H, NCH2CO and 2 × N-CH2), 4.00–4.01 (m, 1H,
R-H), 4.25–4.30 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 7.00–7.04 (d,
1H, CHdCHCON), 7.21 (s, 1H, NH), 7.33 (m, 6H, Ph and
CHdCHCON), 7.42 (d, 1H, NH), 8.20 (d, 1H, NH), 10.73 (s, 1H,
NH). MS (FAB) m/z 575 [(M + 1)+]. HRMS (FAB) calculated
for C28H43N6O7: 575.320 52. Observed m/z 575.319 32.
trans-3-(1-Piperidylcarbonyl)propenoic Acid Ethyl Ester
(EtOOCCHdCHCO-Pip). This compound was obtained by mixed
anhydride coupling of equimolar amounts of monoethyl fumarate
and piperidine to give a clear syrup (99% yield).
trans-3-(1-Piperidylcarbonyl)propenoic Acid (2c, HOOC-
CHdCHCO-Pip). EtOOCCHdCHCO-Pip was hydrolyzed in
MeOH using NaOH (1 M aqueous, 1.1 equiv) under standard
deblocking conditions to give a clear, colorless syrup which was
recrystallized overnight from hexane/EtOAc to give a white powder
(27% yield). 1H NMR (DMSO-d6): 1.46–1.60 (m, 6H, 3 ×
piperidine CH2), 3.45–3.49 (m, 4H, CH2-N-CH2), 6.41–6.44 (d, 1H,
J ) 15.2 Hz, CHdCHCON), 7.33–7.37 (d, 1H, J ) 15.2 Hz,
CHdCHCON).
1
to give a white powder (51% yield). H NMR (DMSO-d6): 5.21
(s, 2H, CHdCH-COOCH2Ph), 6.73 (s, 2H, CHdCH-COOCH2Ph),
7.29–7.43 (m, 5H, Ph). MS (ESI) m/z 207 [(M + 1)+].
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-trans-(3-benzyloxy-
carbonylpropenoyl)-N1-carbamoylmethylhydrazine (7b, Cbz-
Ala-Ala-AAsn-CHdCHCOOBzl). This compound was obtained
using the HOBt/EDC coupling method and purified by column
chromatography on silica gel using 10% MeOH/CH2Cl2 as the
eluent and then recrystallized from EtOAc/hexane to give a white
powder (20% yield). 1H NMR ((CD3)2CO): 1.37 (m, 6H, 2 × Ala-
CH3), 2.88 (s, 2H, NCH2CO), 4.21–4.24 (m, 1H, R-H), 4.50 (m,
1H, R-H), 5.10 (m, 2H, Cbz), 5.24 (s, 2H, O-CH2-Ph), 6.58–6.33
(m, 2H, NH and CHdCH), 6.74–6.88 (d, 1H, CHdCH), 7.31–7.44
(m, 11H, 2 × Ph and NH), 7.76 (s, 1H, NH), 8.16 (d, 1H, NH),
9.89 (s, 1H, NH). MS (ESI) m/z 554 [(M + 1)+]. HRMS (ESI)
calculated for C27H32N5O8: 554.2219. Observed m/z 554.225 088.
trans-3-Diethylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCONEt2). This compound was obtained by
mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and diethylamine. The crude product was recrystallized
from hexane/EtOAc to give a white powder (95% yield). 1H NMR
(CDCl3): 1.17–1.21 (t, 3H, N-CH2CH3), 1.22–1.24 (t, 3H,
N-CH2CH3), 1.32 (t, 3H, CH3CH2O), 3.40–3.47 (m, 4H, 2 ×
N-CH2), 4.24–4.26 (q, 2H, CH3CH2O), 6.78–6.82 (d, 1H, J ) 14.8
Hz, CHdCHCON), 7.31–7.35 (d, 1H, J ) 14.8 Hz, CHdCHCON).
trans-3-Diethylcarbamoylpropenoic Acid (2a, HOOCCHd
CHCONEt2). EtOOCCHdCHCONEt2 was hydrolyzed in MeOH
using NaOH (1 M aqueous, 1.1 equiv) under standard deblocking
conditions to give a white crystalline solid (53% yield).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(1-piperidylcarbonyl)propenoyl)hydrazine (5c, Cbz-
Ala-Ala-AAsn-CHdCHCO-Pip). This compound was obtained
using the HOBt/EDC coupling method and purified by column
chromatography on silica gel using 10% MeOH/CH2Cl2 as the
eluent and recrystallized from hexane/EtOAc to give a white powder
1
(10% yield). H NMR ((CD3)CO): 1.28 (m, 2H, piperidine-CH2),
1.37 (d, 3H, Ala-CH3), 1.41 (d, 3H, Ala-CH3), 1.52–1.67 (m, 4H,
2 × piperidine-CH2), 2.80 (s, 2H, NCH2CO), 3.55 (m, 4H, CH2-
N-CH2), 4.24 (m, 1H, R-H), 4.50 (m, 1H, R-H), 5.10 (m, 2H, Cbz),
7.11–7.15 (d, 1H, J ) 14.8 Hz, CHdCHCON), 7.30–7.44 (m, 7H,
CHdCHCON and Ph and NH), 7.77 (s, 1H, NH), 9.82 (s, 1H, NH).
MS (ESI) m/z 531 [(M + 1)+]. HRMS (ESI) calculated for
C25H35N6O7: 531.2532. Observed m/z 531.256 723.
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-diethylcarbamoylpropenoyl)hydrazine (5a, Cbz-Ala-
Ala-AAsn-CHdCHCONEt2). This compound was obtained using
the HOBt/EDC coupling method and purified by column chroma-
tography on silica gel using 10% MeOH/CH2Cl2 as the eluent and
then recrystallized from EtOAc/hexane to give a white powder (11%
yield). 1H NMR (DMSO-d6): 1.02–1.05 (t, 3H, NCH2CH3),
1.08–1.11 (t, 3H, NCH2CH3), 1.17–1.19 (d, 2H, Ala-CH3), 1.24–1.26
(d, 2H, Ala-CH3), 3.20–3.32 (d, 6H, NCH2CO and 2 × N-CH2),
4.02–4.07 (m, 1H, R-H), 4.27–4.31 (m, 1H, R-H), 4.99 (m, 2H,
Cbz), 7.00–7.04 (d, 1H, CHdCHCON), 7.18 (s, 1H, NH), 7.33
(m, 6H, Ph and CHdCHCON), 7.39 (d, 1H, NH), 8.20 (d, 1H, NH),
10.68 (s, 1H, NH). MS (ESI) m/z 519 [(M + 1)+]. HRMS (ESI)
calculated for C24H35N6O7: 519.2608. Observed m/z 519.2657.
trans-3-Dibutylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCON(nBu)2). This compound was obtained by
mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and dibutylamine. The crude product was recrystallized
from hexane/EtOAc to give a white powder (95% yield). 1H NMR
(CDCl3): 0.95 (m, 6H, 2 × nBu-CH3), 1.32 (m, 7H, 2 ×
CH2CH2CH2CH3 and CH3CH2O), 1.51–1.59 (m, 4H, 2 ×
CH2CH2CH2CH3), 3.33 (t, 2H, N-CH2), 3.39 (t, 2H, N-CH2), 4.24
(q, 2H, CH3CH2O), 6.76–6.81 (d, 1H, J ) 15.6 Hz, CHdCHCON),
7.33–7.36 (d, 1H, J ) 15.2 Hz, CHdCHCON).
trans-3-Phenylcarbamoylpropenoic Acid Ethyl Ester (EtOOC-
CHdCHCONHPh). This compound was obtained by mixed
anhydride coupling of equimolar amounts of monoethyl fumarate
1
and aniline to give a white solid (59% yield). H NMR (CDCl3):
1.34 (t, 3H, CH3CH2), 4.29 (q, 2H, CH3CH2), 6.93–6.97 (d, 1H, J
) 15.2 Hz, CHdCHCON), 7.10–7.14 (d, 1H, J ) 15.2 Hz,
CHdCHCON), 7.15 (t, 1H, Ph), 7.34 (t, 2H, Ph), 7.61 (d, 2H, Ph),
7.85 (s, 1H, NH).
trans-3-Phenylcarbamoylpropenoic Acid (2d, HOOCCHd
CHCONHPh). EtOOCCHdCHCONHPh was hydrolyzed in MeOH
using NaOH (1 M aqueous, 1.1 equiv) under standard deblocking
1
conditions to give a white solid (81% yield). H NMR (DMSO-
d6): 6.61–6.65 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.02–7.14 (m,
1H, CHdCHCON), 7.14–7.31 (m, 2H, Ph), 7.32 (t, 2H, Ph), 7.66
(d, 2H, Ph), 10.47 (s, 1H, NH).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-phenylcarbamoylpropenoyl)hydrazine (5d, Cbz-Ala-
Ala-AAsn-CHdCHCONHPh). This compound was obtained
using the HOBt/EDC coupling method with minimal NaHCO3
washing during the workup. The product was isolated as a yellow
solid without chromatography by recrystallization from 10%
trans-3-Dibutylcarbamoylpropenoic Acid (2b, HOOCCHd
CHCON(nBu)2). EtOOCCHdCHCON(nBu)2 was hydrolyzed in
MeOH using NaOH (1 M aqueous, 1.1 equiv) under standard
deblocking conditions to give a clear, colorless syrup (80% yield).
1H NMR (CDCl3): 0.95 (m, 6H, 2 × nBu-CH3), 1.30–1.37 (m,
4H, 2 × CH2CH2CH2CH3), 1.53–1.59 (m, 4H, 2 × CH2CH2-
CH2CH3), 3.33 (t, 2H, N-CH2), 3.39 (t, 2H, N-CH2), 6.79–6.83 (d,
1H, J ) 15.6 Hz, CHdCHCON), 7.33–7.36 (d, 1H, J ) 15.2 Hz,
CHdCHCON).
1
MeOH/CH2Cl2 (21% yield). H NMR (DMSO-d6): 1.18–1.27 (m,
6H, 2 × Ala-CH3), 3.20–3.32 (d, 2H, NCH2CO), 4.04–4.08 (m,
1H, R-H), 4.28–4.31 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 7.05–7.42
(m, 11H, 2 × Ph, NH CHdCHCON and CHdCHCON), 7.63–7.65
(d, 2H, Ph), 7.52 (s, 1H, NH), 8.15 (d, 1H, NH), 10.42 (s, 1H,
NH), 10.72 (s, 1H, NH). MS (ESI) m/z 539 [(M + 1)+]. HRMS
(ESI) calculated for C26H31N6O7: 539.2208. Observed m/z 539.2254.
trans-3-Benzylcarbamoylpropenoic Acid Ethyl Ester (EtOOC-
CHdCHCONHBzl). This compound was obtained by mixed
anhydride coupling of equimolar amounts of monoethyl fumarate
and benzylamine to give a white powder (72% yield).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-dibutylcarbamoylpropenoyl)hydrazine (5b, Cbz-
Ala-Ala-AAsn-CHdCHCON(nBu)2). This compound was ob-
tained using the HOBt/EDC coupling method and purified by

2826 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
trans-3-Benzylcarbamoylpropenoic Acid (2e, HOOCCHd
CHCONHBzl). EtOOCCHdCHCONHBzl was hydrolyzed in
MeOH using NaOH (1 M aqueous, 1.1 equiv) under standard
deblocking conditions to give a white solid (81% yield). 1H NMR
(DMSO-d6): 4.37 (d, 2H, N-CH2-Ph), 6.52–6.56 (d, 1H, J ) 15.2
Hz, CHdCHCON), 6.94–6.98 (d, 1H, J ) 15.6 Hz, CHdCHCON),
7.14–7.31 (m, 5H, Ph), 8.97 (t, 1H, NH).
N-CH2CH2Ph), 3.20–3.32 (d, 2H, NCH2CO), 3.52–3.58 (m, 2H,
N-CH2CH2Ph), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H, R-H),
4.99 (m, 2H, Cbz), 6.86–6.89 (d, 1H, J ) 14.4 Hz, CHdCHCON),
7.04–7.08 (d, 1H, J ) 14.8 Hz, CHdCHCON), 7.16–7.41 (m, 11H,
2 × Ph and NH), 7.50 (d, 1H, NH), 8.16 (d, 1H, NH), 8.53 (s, 1H,
NH), 10.72 (s, 1H, NH). MS (ESI) m/z 567 [(M + 1)+]. HRMS
(ESI) calculated for C28H35N6O7: 567.2596. Observed m/z
567.256 723.
trans-N-Methylphenylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCON(CH3)Ph). This compound was obtained by
mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and N-methylaniline to give a white solid (99% yield).
1H NMR (CDCl3): 1.25 (t, 3H, CH3CH2), 3.39 (s, 3H, N-CH3),
4.17 (q, 2H, CH3CH2), 6.93–6.97 (d, 1H, J ) 15.2 Hz,
CHdCHCON), 7.10–7.14 (d, 1H, J ) 15.2 Hz, CHdCHCON),
7.15 (t, 1H, Ph), 7.34 (t, 2H, Ph), 7.61 (d, 2H, Ph).
trans-N-Methylphenylcarbamoylpropenoic Acid (2h, HOOC-
CHdCHCON(CH3)Ph). EtOOCCHdCHCON(CH3)Ph was hy-
drolyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv) under
standard deblocking conditions to give a white solid (29% yield).
1H NMR (DMSO-d6): 3.14 (s, 3H, N-CH3), 6.50–6.54 (d, 1H, J )
15.2 Hz, CHdCHCON), 6.60–6.64 (d, 1H, J ) 15.2 Hz,
CHdCHCON), 7.32 (t, 2H, Ph), 7.40 (d, 1H, Ph), 7.47 (d, 1H,
Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-benzylcarbamoylpropenoyl)hydrazine (5e, Cbz-Ala-
Ala-AAsn-CHdCHCONHBzl). This compound was obtained
using the HOBt/EDC coupling method with minimal washing
during the workup and purified by recrystallization from ice-cold
EtOAc without column chromatography (18% yield). 1H NMR
(DMSO-d6): 1.17–1.26 (m, 6H, 2 × Ala-CH3), 3.30–3.32 (d, 2H,
NCH2CO), 4.02–4.07 (m, 1H, R-H), 4.27–4.32 (m, 1H, R-H),
4.35–4.36 (d, 2H, CH2Ph), 4.99 (m, 2H, Cbz), 6.89–6.92 (d, 1H, J
) 14.2 Hz, CHdCHCON), 7.06–7.10 (d, 1H, J ) 14.8 Hz,
CHdCHCON), 7.16–7.41 (m, 11H, 2 × Ph and NH), 7.42 (d, 1H,
NH), 8.16 (d, 1H, NH), 8.94 (t, 1H, NH), 10.72 (s, 1H, NH). MS
(ESI) m/z 553 [(M + 1)+]. HRMS (ESI) calculated for C27H33N6O7:
553.2397. Observed m/z 553.2411.
trans-3-(4-Fluorobenzylcarbamoyl)propenoic Acid Ethyl Es-
ter (EtOOCCHdCHCONH-Bzl-4-F). This compound was ob-
tained by mixed anhydride coupling of equimolar amounts of
monoethyl fumarate and 4-fluorobenzylamine to give a pink solid
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(methylphenylcarbamoyl)propenoyl)hydrazine (5h,
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)Ph). This compound was
obtained using the HOBt/EDC coupling method. The product was
isolated by chromatography with 10% MeOH/CH2Cl2 as the eluent
and recrystallized from hexane/EtOAc to give a white powder (34%
1
(66% yield). H NMR (CDCl3): 1.32 (t, 3H, CH2CH3), 4.21 (q,
2H, CH2CH3), 4.47 (d, 2H, N-CH2-Ph), 6.52–6.56 (d, 1H, J ) 15.2
Hz, CHdCHCON), 6.94–6.98 (d, 1H, J ) 15.6 Hz, CHdCHCON),
6.99–7.04 (m, 2H, Ph), 7.20–7.27 (m, 2H, Ph).
trans-3-(4-Fluorobenzylcarbamoyl)propenoic Acid (2f, HOOC-
CHdCHCONH-Bzl-4-F). EtOOCCHdCHCONH-Bzl-4-F was
hydrolyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv) under
standard deblocking conditions to give a clear, colorless syrup (45%
yield). 1H NMR (DMSO-d6): 4.34–4.35 (d, 2H, N-CH2-Ph),
6.52–6.55 (d, 1H, J ) 15.2 Hz, CHdCHCON), 6.93–6.94 (d, 1H,
J ) 15.6 Hz, CHdCHCON), 7.14–7.16 (t, 2H, Ph), 7.27–7.31 (t,
2H, Ph), 8.99 (t, 1H, NH).
1
yield). H NMR (DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3),
3.20–3.32 (m, 5H, NCH2CO and N-CH3), 4.02–4.07 (m, 1H, R-H),
4.30 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 6.56 (d, 1H, CHdCHCON),
7.06–7.10 (d, 1H, CHdCHCON ), 7.14 (s, 1H, NH), 7.29–7.46
(m, 11H, 2 × Ph, NH), 8.14 (d, 1H, NH), 10.65 (s, 1H, NH). MS
(ESI) m/z 553 [(M + 1)+]. HRMS (ESI) calculated for C27H33N6O7:
553.2356. Observed m/z 553.2411.
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(4-fluorobenzyl)carbamoylpropenoyl)hydrazine (5f,
Cbz-Ala-Ala-AAsn-CHdCHCONH-Bzl-4-F). This compound
was obtained using the HOBt/EDC coupling method and purified
by column chromatography using 10% MeOH/CH2Cl2 as the eluent
to give a pink powder (8% yield). 1H NMR (DMSO-d6): 1.17–1.26
(m, 6H, 2 × Ala-CH3), 3.30–3.32 (d, 2H, NCH2CO), 4.02–4.07
(m, 1H, R-H), 4.27–4.35 (m, 3H, R-H and CH2PhF), 4.99 (m, 2H,
Cbz), 6.88–6.92 (d, 1H, J ) 16 Hz, CHdCHCON), 7.06–7.32 (m,
11H, CHdCHCON and NH and 2 × Ph), 7.43 (d, 1H, NH), 7.53
(s, 1H, NH), 8.19 (d, 1H, NH), 8.97 (t, 1H, NH), 10.72 (s, 1H,
NH). MS (ESI) m/z 571 [(M + 1)+]. HRMS (ESI) calculated for
C27H32N6O7F: 571.2323. Observed m/z 571.231 651.
trans-3-Benzylmethylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCON(CH3)Bzl). This compound was obtained
by mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and N-methylbenzylamine to give a clear, pink syrup (76%
yield).
trans-3-Benzylmethylcarbamoylpropenoic Acid (2i, HOOC-
CHdCHCON(CH3)Bzl). EtOOCCHdCHCON(CH3)Bzl was hy-
drolyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv) under
standard deblocking conditions to give a clear, colorless syrup (77%
yield). 1H NMR (CDCl3): 3.03 (s, 3H, N-CH3), 4.62–4.67 (d, 2H,
N-CH2-Ph), 6.83–6.87 (d, 1H, J ) 16 Hz, CHdCHCON), 7.15–7.17
(d, 1H, J ) 8 Hz, CHdCHCON), 7.25–7.50 (m, 5H, Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-benzylmethylcarbamoylpropenoyl)hydrazine (5i, Cbz-
Ala-Ala-AAsn-CHdCHCON(CH3)Bzl). This compound was syn-
thesized using the HOBt/EDC coupling method and purified by
column chromatography on silica gel using 10% MeOH/CH2Cl2
as the eluent and then recrystallized from EtOAc/hexane to give a
trans-3-Phenethylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCONHCH2CH2Ph). This compound was ob-
tained by mixed anhydride coupling of equimolar amounts of
monoethyl fumarate and phenethylamine to give a clear colorless
syrup (78% yield).
trans-3-Phenethylcarbamoylpropenoic Acid (2g, HOOC-
CHdCHCONHCH2CH2Ph). EtOOCCHdCHCONHCH2CH2Ph
was hydrolyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv)
under standard deblocking conditions to give a clear, colorless syrup
1
white powder (54% yield). H NMR (DMSO-d6): 1.18–1.27 (m,
6H, 2 × Ala-CH3), 2.89 (s, 3H, N-CH3), 3.20–3.32 (d, 2H,
NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H, R-H), 4.57
(m, 2H, N-CH2-Ph), 4.99 (m, 2H, Cbz), 7.05–7.41 (m, 13H,
CHdCHCON and CHdCHCON and 2 × Ph and NH), 7.49 (d,
1H, NH), 8.16 (d, 1H, NH), 10.72 (s, 1H, NH). MS (ESI) m/z 567
[(M + 1)+]. HRMS (ESI) calculated for C28H35N6O7: 567.2604.
Observed m/z 567.256 723.
trans-3-(Methyl-1-naphthylmethylcarbamoyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCON(CH3)CH2-1-Napth). This
compound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and N-methyl-1-naphthylmethyl-
amine hydrochloride to give a clear, colorless syrup (99% yield).
1H NMR (CDCl3): 1.31 (t, 3H, CH3CH2), 3.03 (s, 3H, N-CH3) 4.29
(q, 2H, CH3CH2), 5.30 (s, 2H, N-CH2-naphthyl), 6.92 (d, 1H, J )
1
(81% yield). H NMR (DMSO-d6): 3.54 (t, 2H, N-CH2-CH2-Ph),
3.61 (t, 2H, N-CH2-CH2-Ph) 6.43–6.47 (d, 1H, J ) 15.2 Hz,
CHdCHCON), 6.98–7.02 (d, 1H, J ) 15.6 Hz, CHdCHCON),
7.14–7.31 (m, 5H, Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-phenethylcarbamoylpropenoyl)hydrazine (5g, Cbz-
Ala-Ala-AAsn-CHdCHCONHCH2CH2Ph). This compound was
obtained using the HOBt/EDC coupling method with minimal
washing during the workup and purified by column chromatography
on silica gel using 10% MeOH/CH2Cl2 as the eluent and then
washed with EtOAc to give a white powder (12% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 2.74 (m, 2H,

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2827
15.2 Hz, CHdCHCON), 7.10–7.52 (m, 5H, naphthyl and
CHdCHCON), 7.81–7.91 (m, 2H, naphthyl), 7.85 (d, 1H, naph-
thyl).
obtained using the HOBt/EDC coupling method and purified by
column chromatography on silica gel using 10% MeOH/CH2Cl2
as the eluent to give a white powder (14% yield). 1H NMR (DMSO-
d6): 1.20–1.21 (d, 3H, Ala-CH3), 1.26 (d, 3H, Ala-CH3), 3.31 (s,
2H, NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H, R-H),
4.96–4.99 (d, 4H, N-CH2-Ph and Cbz), 6.57–6.61 (d, 1H, J ) 15.2
Hz, CHdCHCON), 7.14–7.45 (m, 18H, CHdCHCON and 3 ×
Ph and 2 × NH), 8.16 (d, 1H, NH), 10.71 (s, 1H, NH). MS (ESI)
m/z 629 [(M + 1)+]. HRMS (ESI) calculated for C33H37N6O7:
629.2691. Observed m/z 629.272 373.
trans-3-Dibenzylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCON(Bzl)2). This compound was obtained by
mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and dibenzylamine to give a clear, pink syrup (87% yield).
trans-3-(Methyl-1-naphthylmethylcarbamoyl)propenoic Acid
(2j, HOOCCHdCHCON(CH3)CH2-1-Napth). EtOOCCHd
CHCON(CH3)CH2-1-Napth was hydrolyzed in MeOH using NaOH
(1 M aqueous, 1.1 equiv) under standard deblocking conditions to
give a white solid after recrystallization from cold EtOAc (13%
yield). 1H NMR (DMSO-d6): 3.01 (s, 3H, CH3), 5.01 (s, 2H, CH2),
6.61–6.65 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.17–7.21 (d, 1H,
CHdCHCON), 7.37–7.60 (m, 4H, naphthyl), 7.85–8.01 (m, 3H,
naphthyl).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(methyl-1-naphthylmethylcarbamoyl)prope-
noyl)hydrazine (5j, Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)CH2-
1-Napth). This compound was obtained using the HOBt/EDC
coupling method and purified by column chromatography on silica
gel using 10% MeOH/CH2Cl2 as the eluent and then recrystallized
from EtOAc/hexane to give a yellow powder (31% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 3.10 (s, 3H, N-CH3),
3.20–3.32 (d, 2H, NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.28–4.31
(m, 1H, R-H), 4.99 (m, 4H, Cbz and N-CH2-naphthyl), 7.07–7.61
(m, 12H, naphthyl and Ph CHdCHCON and CHdCHCON and
NH), 7.85–8.10 (m, 3H, naphthyl), 8.15 (d, 1H, NH), 10.42 (s, 1H,
NH), 10.72 (s, 1H, NH). MS (ESI) m/z 617 [(M + 1)+]. HRMS
(ESI) calculated for C32H37N6O7: 617.265. Observed m/z 617.2724.
trans-3-Dibenzylcarbamoylpropenoic Acid (2m, HOOCCHd
CHCON(Bzl)2). EtOOCCHdCHCON(Bzl)2 was hydrolyzed in
MeOH using NaOH (1 M aqueous, 1.1 equiv) under standard
deblocking conditions to give a clear, colorless syrup which was
recrystallized overnight from hexane/EtOAc (30% yield). 1H NMR
(DMSO-d6): 4.57 (s, 2H, N-CH2-Ph), 4.65 (s, 2H, N-CH2-Ph),
6.59–6.63 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.15–7.17 (d, 1H,
J ) 8 Hz, CHdCHCON), 7.25–7.50 (m, 10H, 2 × Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-dibenzylcarbamoylpropenoyl)hydrazine (5m, Cbz-
Ala-Ala-AAsn-CHdCHCON(Bzl)2). This compound was obtained
using the HOBt/EDC coupling method and purified by column
chromatography on silica gel using 10% MeOH/CH2Cl2 as the
eluent to give a white powder (34% yield). 1H NMR (DMSO-d6):
1.19 (d, 3H, Ala-CH3), 1.26 (d, 3H, Ala-CH3), 3.31 (s, 2H,
NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H, R-H), 4.56
(s, 2H, N-CH2-Ph), 4.63 (s, 2H, N-CH2-Ph), 5.00 (m, 2H, Cbz),
7.13–7.41 (m, 17H, CHdCHCON and CHdCHCON and 3 × Ph
and NH), 7.48 (s, 1H, NH), 8.14 (d, 1H, NH), 10.71 (s, 1H, NH).
MS (ESI) m/z 643 [(M + 1)+]. HRMS (ESI) calculated for
C34H39N6O7: 643.2843. Observed m/z 643.288 023.
trans-3-(Methylphenethylcarbamoyl)propenoic Acid Ethyl
Ester (EtOOCCHdCHCON(CH3)CH2CH2Ph). This compound
was obtained by mixed anhydride coupling of equimolar amounts
of monoethyl fumarate and N-methylphenethylamine to give a clear
colorless syrup (64% yield).
trans-3-(Methylphenethylcarbamoyl)propenoic Acid (2k,
HOOCCHdCHCON(CH3)CH2CH2Ph).EtOOCCHdCHCON(CH3)-
CH2CH2Ph was hydrolyzed in MeOH using NaOH (1 M
aqueous, 1.1 equiv) under standard deblocking conditions to
1
give a clear, colorless syrup (81% yield). H NMR (DMSO-d6):
trans-3-(Benzyl-4-methoxybenzylcarbamoyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCON(Bzl-4-OMe)Bzl). This com-
pound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and 4-methoxybenzylbenzylamine
to give a clear colorless syrup (91% yield).
2.82 (s, 3H, N-CH3), 3.54 (t, 2H, N-CH2-CH2-Ph), 3.61 (t, 2H,
N-CH2-CH2-Ph), 6.43–6.47 (d, 1H, J ) 15.2 Hz, CHdCHCON),
6.98–6.7.02 (d, 1H, J ) 15.6 Hz, CHdCHCON), 7.14–7.31 (m,
5H, Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(methylphenethylcarbamoyl)propenoyl)hydrazine (5k,
Cbz-Ala-Ala-AAsn-CHdCHCON(CH3)CH2CH2Ph). This com-
pound was obtained using the HOBt/EDC coupling method and
purified by column chromatography on silica gel using 10% MeOH/
CH2Cl2 as the eluent and then recrystallized from EtOAc/hexane
to give a white powder (28% yield). 1H NMR (DMSO-d6):
1.18–1.27 (m, 6H, 2 × Ala-CH3), 2.74–2.82 (m, 2H, N-CH2CH2Ph),
2.86 (s, 3H, N-CH3), 3.20–3.32 (d, 2H, NCH2CO), 3.52–3.58 (m,
2H, N-CH2CH2Ph), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H,
R-H), 4.99 (m, 2H, Cbz), 6.86–6.89 (d, 1H, J ) 14.4 Hz,
CHdCHCON), 7.04–7.08 (d, 1H, J ) 14.8 Hz, CHdCHCON),
7.16–7.41 (m, 11H, 2 × Ph and NH), 7.50 (d, 1H, NH), 8.16 (d,
1H, NH), 10.72 (s, 1H, NH). MS (ESI) m/z 581 [(M + 1)+].
HRMS (ESI) calculated for C29H37N6O7: 581.2717. Observed m/z
581.272 373.
trans-3-(Benzyl-4-methoxybenzylcarbamoyl)propenoic Acid
(2n,HOOCCHdCHCON(Bzl-4-OMe)Bzl).EtOOCCHdCHCON(Bzl-
4-OMe)Bzl was hydrolyzed in MeOH using NaOH (1 M aqueous,
1.1 equiv) under standard deblocking conditions to give a clear,
1
colorless syrup (44% yield). H NMR (DMSO-d6): 3.73 (s, 3H,
OCH3), 4.50–4.54 (d, 2H, N-CH2-Ph), 4.56–4.61 (d, 2H, N-CH2-
Ph), 6.59–6.63 (d, 1H, J ) 15.2 Hz, CHdCHCON), 6.86–6.92 (2
× d, 2H, Ph), 7.07–7.09 (d, 1H, J ) 8 Hz, CHdCHCON),
7.14–7.39 (m, 7H, 2 × Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-trans-(3-benzyl-(4-
methoxybenzyl)carbamoyl)propenoyl-N1-carbamoylmethylhy-
drazine (5n, Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl-4-OMe)Bzl).
This compound was obtained using the HOBt/EDC coupling
method and purified by recrystallization from 10% MeOH/CH2Cl2
to give a yellow powder (9% yield). 1H NMR (DMSO-d6):
1.19–1.20 (d, 3H, Ala-CH3), 1.26–1.28 (d, 3H, Ala-CH3), 3.32 (s,
2H, NCH2CO), 3.72 (s, 3H, OCH3), 4.04–4.09 (m, 1H, R-H),
4.28–4.32 (m, 1H, R-H), 4.48–4.54 (d, 2H, N-CH2-Ph), 4.54–4.59
(d, 2H, N-CH2-Ph), 5.00 (m, 2H, Cbz), 6.84–6.91 (2 × d, 2H, Ph),
7.06–7.08 (d, 1H, J ) 8.8 Hz, CHdCHCON), 7.12–7.42 (m, 14H,
CHdCHCON and 3 × Ph and NH), 7.50 (s, 1H, NH), 8.16–8.17
(d, 1H, NH), 10.71 (s, 1H, NH). MS (ESI) m/z 673 [(M + 1)+].
HRMS (ESI) calculated for C35H41N6O8: 673.3001. Observed m/z
673.298 588. Anal. Calcd for C35H40N6O8 ·0.5CH2Cl2: C, 59.61;
H, 5.78; N, 11.75. Found: C, 59.76; H, 5.71; N, 11.54.
trans-3-Phenylbenzylcarbamoylpropenoic Acid Ethyl Ester
(EtOOCCHdCHCON(Bzl)Ph). This compound was obtained by
mixed anhydride coupling of equimolar amounts of monoethyl
fumarate and phenylbenzylamine to give an orange oil (87% yield).
trans-3-Phenylbenzylcarbamoylpropenoic Acid (2l, HOOC-
CHdCHCON(Bzl)Ph). EtOOCCHdCHCON(Bzl)Ph was hydro-
lyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv) under
standard deblocking conditions to give a clear, colorless syrup (74%
1
yield). H NMR (DMSO-d6): 4.97 (s, 2H, N-CH2-Ph), 6.61–6.62
(d, 1H, CHdCHCON), 7.15–7.43 (m, 11H, CHdCHCON and 2
× Ph).
trans-3-Benzyl(4-fluorobenzyl)carbamoylpropenoic Acid Eth-
yl Ester (EtOOCCHdCHCON(Bzl-4-F)Bzl). This compound was
obtained by mixed anhydride coupling of equimolar amounts of
monoethyl fumarate and 4-fluorobenzylbenzylamine to give a clear,
colorless syrup (95% yield).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-phenylbenzylcarbamoylpropenoyl)hydrazine (5l, Cbz-
Ala-Ala-AAsn-CHdCHCON(Bzl)Ph). This compound was

2828 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
trans-3-Benzyl(4-fluorobenzyl)carbamoylpropenoic Acid (2o,
HOOCCHdCHCON(Bzl-4-F)Bzl). EtOOCCHdCHCON(Bzl-4-
F)Bzl was hydrolyzed in MeOH using NaOH (1 M aqueous, 1.1
equiv) under standard deblocking conditions to give a clear,
(1 M aqueous, 1.1 equiv) under standard deblocking conditions to
give a white solid after recrystallization from cold EtOAc (13%
yield). H NMR (DMSO-d6): 4.82 (d, 2H, N-CH2), 5.01 (d, 2H,
N-CH2), 6.61–6.65 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.17–7.21
(d, 1H, CHdCHCON), 7.37–7.60 (m, 9H, naphthyl and Ph),
7.85–8.01 (m, 3H, naphthyl).
1
1
colorless syrup (44% yield). H NMR (DMSO-d6): 4.50–4.54 (d,
2H, N-CH2-Ph), 4.56–4.61 (d, 2H, N-CH2-Ph), 6.59–6.63 (d, 1H,
J ) 15.2 Hz, CHdCHCON), 6.99–7.44 (m, 11H, CHdCHCON
and CHdCHCON and 2 × Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-trans-(3-benzyl-2-
naphthylmethylcarbamoylpropenoyl)-N1-carbamoylmethylhy-
drazine (5q, Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)-CH2-2-
Napth). This compound was obtained using the HOBt/EDC
coupling method and purified by column chromatography on silica
gel using 10% MeOH/CH2Cl2 as the eluent and then recrystallized
from EtOAc/hexane to give a yellow powder (11% yield). 1H NMR
(DMSO-d6): 1.18–1.28 (m, 6H, 2 × Ala-CH3), 3.29–3.32 (d, 2H,
NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.28–4.31 (m, 1H, R-H),
4.63–4.69 (d, 2H, N-CH2), 4.73–4.80 (d, 2H, N-CH2), 4.99 (m,
2H, Cbz), 7.14–7.48 (m, 18H, naphthyl and 2 × Ph and
CHdCHCON and CHdCHCON and 2 × NH), 7.84–7.90 (m, 3H,
naphthyl), 8.15 (d, 1H, NH), 10.72 (s, 1H, NH). MS (ESI) m/z 693
[(M + 1)+]. HRMS (ESI) calculated for C38H41N6O7: 693.2998.
Observed m/z 693.303 673.
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-trans-(3-benzyl(4-
fluorobenzyl)carbamoylpropenoyl)-N1-carbamoylmethylhydra-
zine (5o, Cbz-Ala-Ala-AAsn-CHdCH-CON(Bzl-4-F)Bzl). This
compound was obtained using the HOBt/EDC coupling method
and purified by column chromatography using 10% MeOH/CH2Cl2
as the eluent. Recrystallization with hexane/EtOAc gave a white
powder (11% yield). 1H NMR (DMSO-d6): 1.19–1.20 (d, 3H, Ala-
CH3), 1.26–1.28 (d, 3H, Ala-CH3), 3.32 (s, 2H, NCH2CO),
4.05–4.09 (m, 1H, R-H), 4.28–4.32 (m, 1H, R-H), 4.35 (s, 2H,
CH2Ph), 4.62–4.64 (d, 2H, N-CH2-Ph), 5.00 (m, 2H, Cbz),
7.09–7.34 (m, 17H, CHdCHCON and CHdCHCON and 3 × Ph
and NH), 7.40–7.42 (d, 1H, NH), 7.50 (s, 1H, NH), 8.15–8.16 (d,
1H, NH), 10.71 (s, 1H, NH). MS (ESI) m/z 661 [(M + 1)+]. HRMS
(ESI) calculated for C34H38N6O7F: 661.2781. Observed m/z
661.278 601.
trans-3-(Benzyl-1-naphthylmethylcarbamoyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCON(Bzl)-CH2-1-Napth). This
compound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and benzyl-1-naphthylmethylamine
trans-3-(Bis-(2-furylmethyl)carbamoyl)propenoic Acid Eth-
yl Ester (EtOOCCHdCHCON(CH2-2-furyl)2). This compound
was obtained by mixed anhydride coupling of equimolar amounts
of monoethyl fumarate and bis-2-furylmethylamine to give a brown
syrup (83% yield). 1H NMR (CDCl3): 1.26 (t, 3H, CH3CH2), 2.94
(d, 1H, J ) 3.2 Hz, furyl), 3.47 (t, 1H, furyl), 3.64 (d, 1H, N-CH2),
3.97 (d, 1H, N-CH2), 4.12 (q, 2H, CH3CH2), 4.36 (d, 1H, N-CH2),
4.71 (d, 1H, N-CH2), 5.25 (d, 1H, furyl), 6.26–6.33 (m, 3H, furyl),
6.51–6.53 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.37 (s, 1H,
CHdCHCON).
trans-3-(Bis-(2-furylmethyl)carbamoyl)propenoic Acid (2p,
HOOCCHdCHCON(CH2-2-furyl)2). EtOOCCHdCHCON(CH2-
2-furyl)2 was hydrolyzed in MeOH using NaOH (1 M aqueous,
1.1 equiv) under standard deblocking conditions to give a brown
solid (91% yield). 1H NMR (DMSO-d6): 2.73 (d, 1H, J ) 3.6 Hz,
furyl), 3.13 (t, 1H, furyl), 3.49 (d, 1H, N-CH2), 4.03 (d, 1H, N-CH2),
4.35–4.49 (dd, 2H, N-CH2), 5.17 (d, 1H, furyl), 6.30–6.40 (m, 3H,
furyl), 6.63–6.64 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.60 (s, 1H,
CHdCHCON).
1
to give a yellow oil (79% yield). H NMR (CDCl3): 1.31 (t, 3H,
CH3CH2), 4.23 (q, 2H, CH3CH2), 4.55–4.69 (d, 2H, N-CH2),
4.71–4.81 (d, 2H, N-CH2), 6.95–6.91 (d, 1H, J ) 14.4 Hz,
CHdCHCON), 7.16–7.18 (d, 1H, CHdCHCON), 7.23–7.57 (m,
10H, naphthyl and Ph), 7.85 (m, 2H, naphthyl).
trans-3-(Benzyl-1-naphthylmethylcarbamoyl)propenoic Acid
(2r, HOOCCHdCHCON(Bzl)-CH2-1-Napth). EtOOCCHd
CHCON(Bzl)-1-CH2-Napth was hydrolyzed in MeOH using NaOH
(1 M aqueous, 1.1 equiv) under standard deblocking conditions to
give a white solid after recrystallization from cold EtOAc (62%
1
yield). H NMR (DMSO-d6): 4.82 (d, 2H, N-CH2), 5.01 (d, 2H,
N-CH2), 6.61–6.65 (d, 1H, J ) 15.2 Hz, CHdCHCON), 7.17–7.21
(d, 1H, CHdCHCON), 7.37–7.60 (m, 9H, naphthyl and Ph),
7.85–8.01 (m, 3H, naphthyl).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-trans-(3-benzyl-1-
naphthylmethylcarbamoylpropenoyl)-N1-carbamoylmethylhy-
drazine (5r, Cbz-Ala-Ala-AAsn-CHdCHCON(Bzl)-CH2-1-
Napth). This compound was obtained using the HOBt/EDC
coupling method and purified by column chromatography on silica
gel using 10% MeOH/CH2Cl2 as the eluent and then recrystallized
from EtOAc/hexane to give a white powder (17% yield). 1H NMR
(DMSO-d6): 1.19–1.29 (m, 6H, 2 × Ala-CH3), 3.30–3.32 (d, 2H,
NCH2CO), 4.04–4.08 (m, 1H, R-H), 4.29–4.33 (m, 1H, R-H),
4.64–4.67 (d, 2H, N-CH2), 4.99 (m, 2H, Cbz), 5.06–5.17 (d, 2H,
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-bis-(2-furylmethyl)carbamoylpropenoyl)hydrazine
(5p, Cbz-Ala-Ala-AAsn-CHdCHCON(CH2-2-furyl)2). This
compound was obtained using the HOBt/EDC coupling
method. The product was isolated by chromatography with
10% MeOH/CH2Cl2 as the eluent and recrystallized from
hexane/EtOAc to give a white powder (34% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 2.92 (d, 1H, furyl),
3.28–3.38 (m, 4H, N-CH2 and NCH2CO and furyl), 3.47–
3.50 (d, 1H, N-CH2), 3.99–4.07 (m, 2H, R-H and N-CH2), 4.30–
4.49 (m, 2H, R-H and N-CH2), 4.99 (m, 2H, Cbz), 6.02
(s, 1H, NH), 6.11 (s, 1H, NH), 6.31(s, 1H, CHdCHCON),
6.39 (s, 1H, CHdCHCON), 6.55 (t, 1H, furyl), 7.12 (s, 1H, NH), 7.32
(m, 5H, Ph), 7.41–7.59 (m, 3H, furyl), 8.21 (d, 1H, NH), 10.58 (s,
1H, NH). MS (ESI) m/z 623 [(M + 1)+]. HRMS (ESI) calculated for
C30H35N6O9: 623.2486. Observed m/z 623.2466.
N-CH2), 7.14–7.48 (m, 18H, naphthyl and
2
×
Ph and
CHdCHCON and CHdCHCON and 2 × NH), 7.84–7.90 (m, 3H,
naphthyl), 8.15 (d, 1H, NH), 10.72 (s, 1H, NH). MS (ESI) m/z 693
[(M + 1)+].
trans-3-(3,4-Dihydro-2H-quinolin-1-ylcarbonyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCO-tetrahydroquinoline). This
compound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and 1,2,3,4-tetrahydroquinoline to
trans-3-(Benzyl-2-naphthylmethylcarbamoyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCON(Bzl)-CH2-2-Napth). This
compound was obtained by mixed anhydride coupling of equi-
molar amounts of monoethyl fumarate and benzyl-2-naph-
1
give a brown syrup (83% yield). H NMR (CDCl3): 1.29 (t, 3H,
CH3CH2OC), 1.99–2.02 (m, 2H, N-CH2-CH2-CH2), 2.73–2.76 (t,
1H, N-CH2-CH2-CH2), 3.86–3.98 (t, 1H, N-CH2-CH2-CH2), 4.24–4.30
(q, 2H, CH3CH2OOC), 6.78–6.82 (dd, 1H, J ) 14.8 Hz,
CHdCHCON), 7.18–7.22 (m, 4H, quinoline), 7.44–7.48 (d, 1H, J
) 14.8 Hz, CHdCHCON).
trans-3-(3,4-Dihydro-2H-quinolin-1-ylcarbonyl)propenoic Acid
(2s, HOOCCHdCHCO-tetrahydroquinoline). EtOOCCHdCHCO-
tetrahydroquinoline was hydrolyzed in MeOH using NaOH (1 M
aqueous, 1.1 equiv) under standard deblocking conditions to give
a clear syrup, which was recrystallized using cold EtOAc to give
a yellow powder (68% yield).
1
thylmethylamine to give a clear colorless syrup (87% yield). H
NMR (CDCl3): 1.31 (t, 3H, CH3CH2), 4.23 (q, 2H, CH3CH2),
4.55–4.69 (d, 2H, N-CH2), 4.71–4.81 (d, 2H, N-CH2), 6.95–6.91
(d, 1H, J ) 14.4 Hz, CHdCHCON), 7.16–7.18 (d, 1H,
CHdCHCON), 7.23–7.57 (m, 10H, naphthyl and Ph), 7.85 (m, 2H,
naphthyl).
trans-3-(Benzyl-2-naphthylmethylcarbamoyl)propenoic Acid
(2q, HOOCCHdCHCON(Bzl)-CH2-2-Napth). EtOOCCHd
CHCON(Bzl)-2-CH2-Napth was hydrolyzed in MeOH using NaOH

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2829
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(3,4-dihydro-2H-quinolin-1-ylcarbonyl)propenoyl)hy-
drazine (5s, Cbz-Ala-Ala-AAsn-CHdCHCO-tetrahydroquinoline).
This compound was obtained using the HOBt/EDC coupling
method and purified by column chromatography on silica gel using
10% MeOH/CH2Cl2 as the eluent and then recrystallized from
EtOAc/hexane to give a yellow powder (28% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 1.87 (m, 2H, N-CH2-
CH2-CH2), 2.70 (t, 2H, N-CH2-CH2-CH2), 3.29–3.32 (d, 2H,
NCH2CO), 3.73 (m, 2H, N-CH2-CH2), 4.02–4.06 (m, 1H, R-H),
4.31 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 7.02–7.07 (dd, 2H, J )
14.8 Hz, CHdCHCON), 7.15–7.41 (m, 11H, quinoline and Ph and
NH and CHdCHCON), 7.49 (s, 1H, NH), 8.16 (d, 1H, NH), 10.73
(s, 1H, NH). MS (ESI) m/z 579 [(M + 1)+]. HRMS (ESI) calculated
for C29H35N6O7: 579.2525. Observed m/z 579.2567.
trans-3-(3,4-Dihydro-2H-quinolin-1-ylcarbonyl)propenoic Acid
Ethyl Ester (EtOOCCHdCHCO-tetrahydroisoquinoline). This
compound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and 1,2,3,4-tetrahydroisoquinoline
to give a brown syrup (83% yield). 1H NMR (CDCl3): 1.29 (t, 3H,
CH3CH2OC), 1.99–2.02 (m, 2H, N-CH2-CH2-CH2), 2.73–2.76 (t,
1H, N-CH2-CH2-CH2), 3.86–3.98 (t, 1H, N-CH2-CH2-CH2), 4.24–4.30
(q, 2H, CH3CH2OOC), 6.78–6.82 (dd, 1H, J ) 14.8 Hz,
CHdCHCON), 7.18–7.22 (m, 4H, quinoline), 7.44–7.48 (d, 1H, J
) 14.8 Hz, CHdCHCON).
R-H), 4.99 (m, 2H, Cbz), 7.02 (t, 1H, indoline-H), 7.13–7.41 (m,
10H, indoline and Ph and NH and CHdCHCON and
CHdCHCON), 7.52 (s, 1H, NH), 8.13 (d, 1H, NH), 8.15–8.16 (d,
1H, indoline-H), 10.76 (s, 1H, NH). MS (ESI) m/z 565 [(M + 1)+].
HRMS (ESI) calculated for C28H33N6O7: 565.2416. Observed m/z
565.241 073.
trans-3-(1,3-Dihydroisoindol-2-ylcarbonyl)propenoic Acid Eth-
yl Ester (EtOOCCHdCHCO-isoindoline). This compound was
obtained by mixed anhydride coupling of equimolar amounts of
monoethyl fumarate and isoindoline to give a brown solid (86%
yield).
trans-3-(1,3-Dihydroisoindol-2-ylcarbonyl)propenoic Acid
(2v, HOOCCHdCHCO-isoindoline). EtOOCCHdCHCO-isoin-
doline was then hydrolyzed in MeOH using NaOH (1 M aqueous,
1.1 equiv) under standard deblocking conditions to give a white
solid after recrystallization with cold EtOAc (37% yield). 1H NMR
(DMSO-d6): 4.73 (s, 2H, NCH2), 5.02 (s, 2H, NCH2), 6.58–6.62
(d, 1H, J ) 15.2 Hz, CHdCHCON), 7.25 (m, 5H, isoindoline and
CHdCHCON).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(1,3-dihydroisoindol-2-ylcarbonyl)propenoyl)hydra-
zine (5v, Cbz-Ala-Ala-AAsn-CHdCHCO-isoindoline). This com-
pound was obtained using the HOBt/EDC coupling method and
purified by column chromatography on silica gel using 10% MeOH/
CH2Cl2 as the eluent and then recrystallized from EtOAc/hexane
to give a bright-yellow, flaky powder (15% yield). 1H NMR
(DMSO-d6): 1.18–1.19 (d, 3H, Ala-CH3), 1.27–1.28 (d, 3H, Ala-
CH3), 3.20–3.31 (d, 2H, NCH2CO), 4.04–4.07 (m, 1H, R-H),
4.29–4.33 (m, 1H, R-H), 4.72 (s, 2H, NCH2), 4.99 (m, 2H, Cbz
and NCH2), 7.11–7.32 (m, 11H, indoline and Ph and NH and
CHdCHCON and CHdCHCON), 7.39 (d, 1H, NH), 7.52 (s, 1H,
NH), 8.14 (d, 1H, NH), 10.76 (s, 1H, NH). MS (ESI) m/z 565 [(M
+ 1)+]. HRMS (ESI) calculated for C28H33N6O7: 565.2414.
Observed m/z 565.241 073.
trans-3-(4-Phenyl-5,6-dihydro-2H-pyridin-1-ylcarbonyl)pro-
penoic Acid Ethyl Ester (EtOOCCHdCHCO-(Py-4-Ph)). This
compound was obtained by mixed anhydride coupling of equimolar
amounts of monoethyl fumarate and 4-phenyl-1,2,3,6-tetrahydro-
pyridine hydrochloride to give a pink solid (80% yield). 1H NMR
(CDCl3): 1.32 (t, 3H, CH2CH3), 2.64 (s, 2H, pyridyl-CH2),
3.78–3.81 (t, 1H, pyridyl-CH2), 3.90–3.93 (t, 1H, pyridyl-CH2),
4.24–4.33 (m, 4H, CH2CH3 and pyridyl-CH2), 6.02–6.09 (d, 1H,
pyridyl-CHd), 6.78–6.82 (d, 1H, J ) 15.6 Hz, CHdCHCON),
6.99–7.49 (m, 6H, Ph and CHdCHCON).
trans-3-(3,4-Dihydro-1H-1soquinolin-2-ylcarbonyl)propeno-
ic Acid (2t, HOOCCHdCHCO-tetrahydroisoquinoline). EtOOC-
CHdCHCO-tetrahydroquinoline was hydrolyzed in MeOH using
NaOH (1 M aqueous, 1.1 equiv) under standard deblocking
conditions to give a clear syrup, which was recrystallized using
cold EtOAc to give a yellow powder (68% yield).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(3,4-dihydro-1H-quinolin-2-ylcarbonyl)propenoyl)hy-
drazine (5t, Cbz-Ala-Ala-AAsn-CHdCHCO-tetrahydroisoquino-
line). This compound was obtained using the HOBt/EDC coupling
method and purified by column chromatography on silica gel using
10% MeOH/CH2Cl2 as the eluent and then recrystallized from
EtOAc/hexane to give a yellow powder (28% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 1.87 (m, 2H, N-CH2-
CH2-CH2), 2.70 (t, 2H, N-CH2-CH2-CH2), 3.29–3.32 (d, 2H,
NCH2CO), 3.73 (m, 2H, N-CH2-CH2), 4.02–4.06 (m, 1H, R-H),
4.31 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 7.02–7.07 (dd, 2H, J )
14.8 Hz, CHdCHCON), 7.15–7.41 (m, 11H, isoquinoline and Ph
and NH and CHdCHCON), 7.49 (s, 1H, NH), 8.16 (d, 1H, NH),
10.73 (s, 1H, NH). MS (ESI) m/z 579 [(M + 1)+]. HRMS (ESI)
calculated for C29H35N6O7: 579.2525. Observed m/z 579.2567.
trans-3-(2,3-Dihydroindol-1-ylcarbonyl)propenoic Acid Eth-
yl Ester (EtOOCCHdCHCO-indoline). This compound was
obtained by mixed anhydride coupling of equimolar amounts of
monoethyl fumarate and indoline to give a bright-yellow solid (84%
yield).
trans-3-(4-Phenyl-5,6-dihydro-2H-pyridin-1-ylcarbonyl)pro-
penoic Acid (2w, HOOCCHdCHCO-(Py-4-Ph)). EtOOCCHdCH-
CO-(4-Ph-Py) was hydrolyzed in MeOH using NaOH (1 M
aqueous, 1.1 equiv) under standard deblocking conditions to give
a white solid (59% yield). 1H NMR (DMSO-d6): 2.57 (s, 2H,
pyridyl-CH2), 3.73–3.76 (t, 2H, pyridyl-CH2), 4.17–4.26 (d, 2H,
pyridyl-CH2), 6.14–6.17 (d, 1H, pyridyl CHd), 7.23–7.27 (t, 1H,
Ph), 7.31–7.35 (t, 2H, Ph), 7.39–7.48 (m, 3H, CHdCHCON and
Ph).
trans-3-(2,3-Dihydroindol-1-ylcarbonyl)propenoic Acid (2u,
HOOC-CHdCHCO-indoline). EtOOC-CHdCHCO-indoline was
hydrolyzed in MeOH using NaOH (1 M aqueous, 1.1 equiv) under
standard deblocking conditions to give a clear syrup, which was
washed several times with CH2Cl2 to give a bright-yellow solid
(40% yield). 1H NMR (DMSO-d6): 3.16 (t, 2H, N-CH2-CH2), 4.27
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(4-phenyl-5,6-dihydro-2H-pyridin-1-ylcarbonyl)pro-
penoyl)hydrazine (5w, Cbz-Ala-Ala-AAsn-CHdCHCO-(Py-4-
Ph)). This compound was obtained using the HOBt/EDC coupling
method and purified by column chromatography using 10% MeOH/
(t, 1H, N-CH2-CH2), 6.64–6.67 (dd, 1H,
J ) 15.2 Hz
1
CHdCHCON), 7.03 (t, 1H, indoline-H), 7.17 (t, 1H, indoline-H),
7.24–7.26 (d, 1H, J ) 7.2 Hz, indoline-H), 7.28–7.32 (d, 1H, J )
15.2 Hz, CHdCHCON), 8.11–8.13 (d, 1H, J ) 8 Hz, indoline-H).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(2,3-dihydroindol-1-ylcarbonyl)propenoyl)hydra-
zine (5u, Cbz-Ala-Ala-AAsn-CHdCHCO-indoline). This com-
pound was obtained using the HOBt/EDC coupling method and
purified by column chromatography on silica gel using 10% MeOH/
CH2Cl2 as the eluent and then recrystallized from EtOAc/hexane
to give a bright-yellow, flaky powder (15% yield). 1H NMR
(DMSO-d6): 1.18–1.19 (d, 3H, Ala-CH3), 1.27–1.28 (d, 3H, Ala-
CH3), 3.15 (t, 2H, N-CH2CH2), 3.20–3.31 (d, 2H, NCH2CO),
4.02–4.06 (m, 1H, R-H), 4.06 (t, 2H, N-CH2-CH2), 4.31 (m, 1H,
CH2Cl2 as the eluent to give a white solid (11% yield). H NMR
(DMSO-d6): 1.15–1.26 (m, 6H, 2 × Ala-CH3), 2.56 (s, 2H, pyridyl-
CH2), 3.30–3.32 (d, 2H, NCH2CO), 3.74 (t, 2H, pyridyl-CH2),
4.02–4.07 (m, 1H, R-H), 4.17 (s, 2H, pyridyl-CH2), 4.27–4.35 (m,
1H, R-H), 4.99 (m, 2H, Cbz), 6.16 (s, 1H, pyridyl-CHd), 7.02–7.06
(d, 1H, J ) 15.2 Hz, CHdCHCON), 7.19 (s, 1H, NH), 7.23–7.42
(m, 11H, CHdCHCON and 2 × Ph), 7.51 (d, 1H, NH), 8.14–8.15
(d, 1H, NH), 10.72 (s, 1H, NH). MS (ESI) m/z 605 [(M + 1)+].
HRMS (ESI) calculated for C31H37N6O7: 605.2757. Observed m/z
605.272 373.
tert-Butyloxycarbonyl-N-methylphenylalanine Methylphen-
ethylamide (Boc-MePhe-N(CH3)(CH2)2Ph). This compound was
obtained by mixed anhydride coupling of equimolar amounts of

2830 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
Boc-MePhe-OH and N-methylphenethylamine. The product was
1H, NH), 10.53 (s, 1H, NH). MS (ESI) m/z 460 [(M + 1)+]. HRMS
(ESI)calculatedforC22H30N5O6: 460.2157.Observedm/z460.219 609.
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(2-furyl)propenoyl)hydrazine (7e, Cbz-Ala-Ala-
AAsn-CHdCH-2-furyl). This compound was obtained using the
HOBt/EDC coupling method starting with the peptide precursor
Cbz-Ala-Ala-NHNHCH2CONH2 and commercially available 3-(2-
furyl)propenoic acid and purified by column chromatography on
silica gel using 10% MeOH/CH2Cl2 as the eluent. Recrystallization
purified by column chromatography using hexane/EtOAc (1:1) as
1
the eluent to give a colorless oil (89% yield). H NMR (CDCl3):
1.14–1.35 (m, 9H, tBu), 2.73–2.98 (m, 10H, Phe-CH2 and CH2Ph
and 2 × Me), 3.40–3.51 (m, 2H, N-CH2), 5.20 (m, 1H, R-H),
7.10–7.33 (m, 10H, 2 × Ph).
N-Methylphenylalanine Methylphenethylamide Hydrochlo-
ride (MePhe-N(CH3)(CH2)2Ph). Boc-MePhe-N(CH3)(CH2)2Ph was
hydrolyzed under standard deblocking conditions using 12 equiv
of HCl in EtOAc (4 N) to give a white powder (100% yield).
1
from hexane/EtOAc gave a white powder (23% yield). H NMR
((CD3)CO): 1.37 (d, 3H, Ala-CH3), 1.44 (d, 3H, Ala-CH3), 2.88
(s, 2H, NCH2CO), 4.24 (m, 1H, R-H), 4.52 (m, 1H, R-H), 5.10 (m,
2H, Cbz), 6.41 (m, 1H, furyl-H), 6.55 (m, 1H, furyl-H), 6.68 (m,
1H, CHdCHCON), 6.88 (s, 2H, NH2), 7.31–7.36 (m, 5H, Ph),
7.39–7.43 (d, 1H, J ) 15.6 Hz, CHdCHCON), 7.48 (s, 1H, NH),
7.65 (s, 1H, furyl-H), 7.81 (s, 1H, NH), 9.83 (s, 1H, NH). MS (ESI)
m/z 486 [(M + 1)+]. HRMS (ESI) calculated for C23H28N5O7:
486.1957. Observed m/z 486.198 874.
N-(3-Ethoxycarbonylpropenoyl)-N-methylphenylalanine Me-
thylphenethylamide (EtOOCCHdCH-MePhe-N(CH3)(CH2)2-
Ph). This compound was obtained by mixed anhydride coupling
of equimolar amounts of monoethyl fumarate and MePhe-
1
N(CH3)(CH2)2Ph to give a clear colorless syrup (52% yield). H
NMR (CDCl3): 1.20–1.25 (t, 3H, CH3CH2O), 2.73–2.98 (m, 10H,
Phe-CH2 and CH2Ph and 2 × Me), 3.40–3.51 (m, 2H, N-CH2),
4.19–4.34 (q, 2H, CH3CH2O), 5.20 (m, 1H, R-H), 6.63–5.78 (2 ×
t, 1H,CHdCHCON), 6.80–6.99 (m, 1H, CHdCHCON), 7.10–7.33
(m, 10H, 2 × Ph).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-(3-pyridyl)propenoyl)hydrazine (7f, Cbz-Ala-Ala-
AAsn-CHdCH-3-Py). This compound was obtained using the
HOBt/EDC coupling method starting from the peptide precursor
Cbz-Ala-Ala-NHNHCH2CONH2 and commercially available 3-(3-
pyridyl) propenoic acid. Upon completion of the reaction saturated
NaHCO3 was added, and the volatiles were evaporated. Without
further workup, the crude product was chromatographed on silica
gel using 10-20% MeOH/CH2Cl2 as the eluent and recrystallized
N-Fumaroyl-N-methylphenylalanine Methylphenethylamide
(2x, HOOCCHdCH-MePhe-N(CH3)(CH2)2Ph). (HOOCCHdCH-
MePhe-N(CH3)(CH2)2Ph) was hydrolyzed in MeOH using NaOH
(1 M aqueous, 1.1 equiv) under standard deblocking conditions to
give a clear, colorless syrup (75% yield).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-3-(N-methyl-N-(1-(N-methyl-N-phenethylcarbamoyl)phe-
nylethyl)carbamoylpropenoyl)hydrazine (5x, Cbz-Ala-Ala-AAsn-
CHdCHCO-MePhe-N(CH3)(CH2)2Ph). This compound was
obtained using the HOBt/EDC coupling method and purified by
column chromatography using 10% MeOH/CH2Cl2 as the eluent.
Recrystallization with hexane/EtOAc gave a yellow powder (11%
yield). 1H NMR (DMSO-d6): 1.19–1.20 (d, 3H, Ala-CH3), 1.26–1.28
(d, 3H, Ala-CH3), 2.61–2.95 (m, 10H, Phe-CH2 and CH2Ph and 2
× N-Me), 3.32 (s, 2H, NCH2CO), 3.62 (m, 2H, N-CH2), 4.05–4.09
(m, 1H, R-H), 4.28–4.32 (m, 1H, R-H), 4.99 (m, 2H, Cbz), 5.52
(m, 1H, R-H), 6.93–7.32 (m, 18H, CHdCHCON and CHdCHCON
and 3 × Ph and NH), 7.40–7.42 (d, 1H, NH), 7.50 (s, 1H, NH),
8.15–8.16 (d, 1H, NH), 10.71 (s, 1H, NH). MS (ESI) m/z 607 [(M
- HN(CH3)CH2CH2Ph + 1, 100%)+]. HRMS (ESI) calculated for
C39H48N7O8: 742.3575. Observed m/z 742.3564.
trans-N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoyl-
methyl-N1-trans-(3-benzoylpropenoyl)hydrazine (7c, Cbz-Ala-
Ala-AAsn-CHdCHCOPh). This compound was obtained using
the HOBt/EDC coupling method starting from the peptide precursor
Cbz-Ala-Ala-NHNHCH2CONH2 and commercially available trans-
3-benzoylpropenoic acid. The workup omitted the NaHCO3 wash-
ings. The crude product was purified by column chromatography
on silica gel using 10% MeOH/CH2Cl2 as the eluent and then
washed with EtOAc to give a white powder (39% yield). 1H NMR
(DMSO-d6): 1.18–1.27 (m, 6H, 2 × Ala-CH3), 3.20–3.32 (d, 2H,
NCH2CO), 3.98–4.05 (m, 1H, R-H), 4.26–4.29 (m, 1H, R-H), 4.99
(m, 2H, Cbz), 7.14–7.21 (m, 2H, CHdCHCOPh and NH),
7.32–7.35 (m, 5H, Ph), 7.54 (t, 2H, Ph), 7.69 (t, 1H, Ph), 7.76–7.80
(d, 1H, J ) 15.6 Hz, CHdCHCOPh), 7.97–7.99 (d, 2H, Ph), 8.14
(d, 1H, NH), 10.77 (s, 1H, NH). MS (ESI) m/z 524 [(M + 1)+].
HRMS (ESI) calculated for C26H30N5O7: 524.2056. Observed m/z
524.2145.
1
from hexane/EtOAc to give a white powder (7% yield). H NMR
((CD3)CO): 1.37 (d, 3H, Ala-CH3), 1.44 (d, 3H, Ala-CH3), 2.91
(s, 2H, NCH2CO), 4.24 (m, 1H, R-H), 4.42 (m, 1H, R-H), 5.10 (m,
2H, Cbz), 6.53 (m, 1H, pyridine-H), 6.68 (d, 1H, CHdCHCON),
7.31–7.36 (m, 5H, Ph), 7.59–7.64 (m, 1H, NH and CHdCHCON),
7.98 (s, 1H, pyridine-H), 8.32 (s, 1H, NH), 7.53 (s, 1H, pyridine-
H), 8.90 (s, 1H, pyridine-H), 10.08 (s, 1H, NH). MS (ESI) m/z
497 [(M + 1)+]. HRMS (ESI) calculated for C24H29N6O6: 497.2078.
Observed m/z 497.2149.
N-tert-Butyloxycarbonylalanylalanyl Hydrazide (Boc-Ala-
Ala-NHNH2). This compound was synthesized from Boc-Ala-Ala-
OMe by hydrazinolysis. Anhydrous hydrazine (10 equiv) was added
to a solution of Boc-Ala-Ala-OMe (1 equiv) in MeOH at room
temperature, and the resulting mixture was then stirred at room
temperature for 16 h. Excess hydrazine and solvent were removed
by evaporation. The resulting residue was washed with ethanol and
ether to give Boc-Ala-Ala-NHNH2 as a white solid (95% yield).
1H NMR (DMSO-d6): 1.1–1.3 (d, 6H, CH3), 1.36 (s, 9H, Boc),
4.0–4.1 (m, 1H, R-H), 4.1–4.3 (m, 2H, R-H and NH), 7.5 (d, 1H,
NH), 7.9 (d, 1H, NH), 9.05 (s, 1H, NH).
N1-(N-tert-Butyloxycarbonylalanylalanyl)-N2-ethoxycarbon-
ylmethylhydrazine (Boc-Ala-Ala-NHNHCH2COOEt). Ethyl bro-
moacetate (1.1 equiv) was added dropwise to a stirred solution of
Boc-Ala-Ala-NHNH2 (1 equiv) and NMM (1.1 equiv) in DMF that
was cooled to -10 °C. The resulting solution was stirred for 30
min at -10 °C, after which the mixture was allowed to react at
room temperature for 36 h. The DMF was evaporated, and the
residue was purified on a silica gel column using 1:9 to 2:8 MeOH/
CH2Cl2 as the eluting solvent system to give the ethyl ester as a
white solid (yield 34%). 1H NMR (DMSO-d6): 1.18 (t, 9H, CH3),
1.41 (s, 9H, Boc), 3.5 (d, 2H, NCH2COOEt), 4.0–4.15 (m, 3H,
R-H and OCH2CH3), 4.2 (m, 1H, R-H), 5.18 (m, 1H, NH),
7.22–7.40 (m, 5H, Ph), 7.4–7.5 (d, 1H, NH), 7.9 (m, 1H, NH),
9.35 (m, 1H, NH).
N2-(N-Benzyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-trans-hexa-2,4-dienoylhydrazine (7d, Cbz-Ala-Ala-
AAsn-CHdCHCHdCHCH3). This compound was synthesized by
coupling the peptide precursor Cbz-Ala-Ala-NHNHCH2CONH2 and
commercially available 2,4-hexadienoic acid using HOBt/EDC and
was purified by column chromatography on silica gel using 10%
MeOH/CH2Cl2 as the eluent and then recrystallized from CH2Cl2/
hexane to give a white powder (14% yield). 1H NMR (DMSO-d6):
1.18–1.24 (m, 6H, 2 × Ala-CH3), 1.79 (d, 3H, CH3-CHdCH-),
3.30–3.32 (d, 2H, NCH2CO), 4.06 (m, 1H, R-H), 4.25 (m, 1H, R-H),
4.98 (m, 2H, Cbz), 6.19 (m, 3H, CH3-CHdCH-CH), 7.21 (m, 2H,
NH and CHdCH-CO), 7.33 (m, 5H, Ph), 7.5 (d, 1H, NH), 8.19 (d,
N1-(N-tert-Butyloxycarbonylalanylalanyl)-N2-carbamoyl-
methylhydrazine (Boc-Ala-Ala-NHNHCH2CONH2). The ethyl
ester Boc-Ala-Ala-NHNHCH2COOEt (1 equiv) was dissolved in
a 9 M solution (100 equiv) of NH3 in methanol and a small amount
of DMF and allowed to stir on an ice bath. To this solution was
added catalytic NaCN (0.1 equiv). The flask was closed with a
rubber septum and allowed to stir at 0 °C for 5 days. The solvent
was evaporated and the crude product was purified by column
chromatography (1:9 MeOH/CH2Cl2) to yield a white solid (53%
yield). 1H NMR (DMSO-d6): 1.15 (2d, 6H, CH3), 1.36 (s, 9H, Boc),

Aza-peptidyl Michael Acceptors
Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9 2831
3.3 (d, 2H, NCH2CONH2), 3.9–4.0 (m, 1H, R-H), 4.1–4.2 (m, 1H,
R-H), 5.22 (m, 1H, NH), 6.93 (d, 1H, NH), 7.1 (s, 1H, NH), 7.4 (s,
1H, NH), 7.85 (d, 1H, NH), 9.3 (s, 1H, NH).
Supporting Information Available: Results from elemental
analysis of target componds. This material is available free of charge
via the Internet at http://pubs.acs.org.
N2-(N-tert-Butyloxycarbonylalanylalanyl)-N1-carbamoylmethyl-
N1-trans-(3-ethoxycarbonylpropenoyl)hydrazine (10, Boc-Ala-
Ala-AAsn-CHdCHCOOEt). This compound was synthesized
using the EDC/HOBt coupling method, purified by chromatography
on a silica gel column using 1:9 MeOH/CH2Cl2 as the eluent, and
then recrystallized from EtOAc/hexane to give a white solid, yield
17%. 1H NMR (DMSO-d6): 1.14–1.16 (d, 3H, Ala-CH3), 1.21–1.24
(t, 3H, OCH2CH3), 1.24–1.26 (d, 3H, Ala-CH3), 1.36 (s, 9H, Boc),
3.33 (m, 2H, NCH2CO), 3.96 (m, 1H, R-H), 4.07–4.11 (q, 2H,
OCH2CH3), 4.26–4.29 (m, 1H, R-H), 6.56–6.60 (d, 1H, J ) 15.6
Hz, CHdCH,), 7.16–7.20 (m, 2H, NH and CHdCH), 7.51 (s, 1H,
NH), 8.03–8.04 (d, 1H, NH), 10.78 (s, 1H, NH).
References
(1) Chen, J. M.; Rawlings, N. D.; Stevens, R. A.; Barrett, A. J.
Identification of the active site of legumain links it to caspases,
clostripain and gingipains in a new clan of cysteine endopeptidases.
FEBS Lett. 1998, 441, 361–365.
(2) Davis, A. H.; Nanduri, J.; Watson, D. C. Cloning and gene expression
of Schistosoma mansoni protease. J. Biol. Chem. 1987, 262, 12851–
12855.
(3) Hara-Nishimura, I.; Takeuchi, Y.; Nishimura, M. Molecular charac-
terization of a vacuolar processing enzyme related to a putative cysteine
proteinase of Schistosoma mansoni. Plant Cell 1993, 5, 1651–1659.
(4) Chen, J. M.; Dando, P. M.; Stevens, R. A.; Fortunato, M.; Barrett,
A. J. Cloning and expression of mouse legumain, a lysosomal
endopeptidase. Biochem. J. 1998, 335 (Part 1), 111–117.
(5) Choi, S. J.; Reddy, S. V.; Devlin, R. D.; Menaa, C.; Chung, H.; Boyce,
B. F.; Roodman, G. D. Identification of human asparaginyl endopep-
tidase (legumain) as an inhibitor of osteoclast formation and bone
resorption. J. Biol. Chem. 1999, 274, 27747–27753.
N2-(Alanylalanyl)-N1-carbamoylmethyl-N1-trans-(3-ethoxy-
carbonylpropenoyl)hydrazine Trifluoroacetate Salt (11, TFA ·Ala-
Ala-AAsn-CHdCHCOOEt). Boc-Ala-Ala-AAsn-CHdCHCOOEt
was deblocked with trifluoroacetic acid/methylene chloride (1:5)
for 3 h at room temperature. The volatiles were evaporated, and
(6) Manoury, B.; Hewitt, E. W.; Morrice, N.; Dando, P. M.; Barrett, A. J.;
Watts, C. An asparaginyl endopeptidase processes a microbial antigen
for class II MHC presentation. Nature 1998, 396, 695–699.
(7) Aravind, L.; Koonin, E. V. Classification of the caspase-hemoglobinase
fold: detection of new families and implications for the origin of the
eukaryotic separins. Proteins 2002, 46, 355–367.
(8) Caffrey, C. R.; McKerrow, J. H.; Salter, J. P.; Sajid, M. Blood “n”
guts: an update on schistosome digestive peptidases. Trends Parasitol.
2004, 20, 241–248.
(9) Delcroix, M.; Sajid, M.; Caffrey, C. R.; Lim, K. C.; Dvorak, J.; Hsieh,
I.; Bahgat, M.; Dissous, C.; McKerrow, J. H. A multienzyme network
functions in intestinal protein digestion by a platyhelminth parasite.
J. Biol. Chem. 2006, 281, 39316–39329.
(10) Sojka, D.; Hajdusek, O.; Dvorak, J.; Sajid, M.; Franta, Z.; Schneider,
E. L.; Craik, C. S.; Vancova, M.; Buresova, V.; Bogyo, M.; Sexton,
K. B.; McKerrow, J. H.; Caffrey, C. R.; Kopacek, P. IrAE: an
asparaginyl endopeptidase (legumain) in the gut of the hard tick Ixodes
ricinus. Int. J. Parasitol. 2007, 37, 713–724.
(11) Mathieu, M. A.; Bogyo, M.; Caffrey, C. R.; Choe, Y.; Lee, J.;
Chapman, H.; Sajid, M.; Craik, C. S.; McKerrow, J. H. Substrate
specificity of schistosome versus human legumain determined by P1-
P3 peptide libraries. Mol. Biochem. Parasitol. 2002, 121, 99–105.
(12) Rotari, V. I.; Dando, P. M.; Barrett, A. J. Legumain forms from plants
and animals differ in their specificity. Biol. Chem. 2001, 382, 953–
959.
(13) Dalton, J. P.; Brindley, P. J. Schistosome asparaginyl endopeptidase
Sm32 in hemoglobin digestion. Parasitol. Today 1996, 12, 125.
(14) Sajid, M.; McKerrow, J. H.; Hansell, E.; Mathieu, M. A.; Lucas, K. D.;
Hsieh, I.; Greenbaum, D.; Bogyo, M.; Salter, J. P.; Lim, K. C.;
Franklin, C.; Kim, J. H.; Caffrey, C. R. Functional expression and
characterization of Schistosoma mansoni cathepsin B and its trans-
activation by an endogenous asparaginyl endopeptidase. Mol. Biochem.
Parasitol. 2003, 131, 65–75.
(15) Caffrey, C. R.; Rheinberg, C. E.; Mone, H.; Jourdane, J.; Li, Y. L.;
Ruppel, A. Schistosoma japonicum, S. mansoni, S. haematobium, S.
intercalatum, and S. rodhaini: cysteine-class cathepsin activities in
the vomitus of adult worms. Parasitol. Res. 1997, 83, 37–41.
(16) Swanson, S. J.; Neitzel, D.; Reed, K. D.; Belongia, E. A. Coinfections
acquired from ixodes ticks. Clin. Microbiol. ReV. 2006, 19, 708–27.
(17) Loak, K.; Li, D. N.; Manoury, B.; Billson, J.; Morton, F.; Hewitt, E.;
Watts, C. Novel cell-permeable acyloxymethylketone inhibitors of
asparaginyl endopeptidase. Biol. Chem. 2003, 384, 1239–1246.
(18) Niestroj, A. J.; Feussner, K.; Heiser, U.; Dando, P. M.; Barrett, A.;
Gerhartz, B.; Demuth, H. U. Inhibition of mammalian legumain by
Michael acceptors and AzaAsn-halomethylketones. Biol. Chem. 2002,
383, 1205–1214.
(19) Rozman-Pungercar, J.; Kopitar-Jerala, N.; Bogyo, M.; Turk, D.;
Vasiljeva, O.; Stefe, I.; Vandenabeele, P.; Bromme, D.; Puizdar, V.;
Fonovic, M.; Trstenjak-Prebanda, M.; Dolenc, I.; Turk, V.; Turk, B.
Inhibition of papain-like cysteine proteases and legumain by caspase-
specific inhibitors: when reaction mechanism is more important than
specificity. Cell Death Differ. 2003, 10, 881–888.
the crude TFA salt was washed several times with to give a white
1
solid, yield 99%. H NMR (DMSO-d6): 1.14–1.16 (d, 3H, Ala-
CH3), 1.21–1.24 (t, 3H, OCH2CH3), 1.24–1.26 (d, 3H, Ala-CH3),
3.41 (m, 2H, NCH2CO), 3.83 (m, 1H, R-H), 4.14–4.19 (q, 2H,
OCH2CH3), 4.38–4.39 (m, 1H, R-H), 6.63–6.67 (d, 1H, J ) 15.6
Hz, CHdCH,), 7.16–7.23 (m, 2H, NH and CHdCH), 7.54 (s, 1H,
NH), 8.07 (s, 2H, 2 × NH), 10.97 (s, 1H, NH).
Biotin N-Hydroxysuccinimide (8, Biotin-OSu). This compound
was prepared by dissolving biotin (1 equiv) in DMF at 80 °C. Upon
cooling to room temperature N-hydroxysuccinimde (1.3 equiv) was
added together with DCC (1 equiv). The mixture was stirred for
12 h at room temperature. Dicyclohexylurea was filtered off, and
the solution was evaporated to dryness. The residue was taken up
in boiling isopropanol, and the resulting suspension was cooled to
room temperature. The solid was filtered and characterized, yield
1
72%. H NMR (DMSO-d6): 1.31–1.55 (m, 4H, biotin-CH2CH2),
1.55–1.69 (m, 2H, biotin-CH2), 2.54–2.57 (d, 1H, CHS), 2.63–2.70
(t, 2H, biotin-CH2CO), 2.78–2.90 (m, 7H, CH2S and Su-CH2CH2,
and CHS), 4.1–4.2(m, 1H, biotin-CH), 4.25–4.31 (m, 1H, biotin-
CH), 6.35 (s, 1H, biotin-NH), 6.41 (s, 1H, biotin-NH).
N2-(N-Biotinylalanylalanyl)-N1-carbamoylmethyl-N1-trans-(3-
ethoxycarbonylpropenoyl)hydrazine (12, Biotin-Ala-Ala-AAsn-
CHdCHCOOEt). To
a solution of TFA ·Ala-Ala-AAsn-
CHdCHCOOEt (1 equiv) in DMF, triethylamine (1 equiv) and
biotin N-hydroxysuccinimide (1.5 equiv) in DMF were added. The
mixture was stirred overnight at room temperature. The solvent
was evaporated, and the crude residue was washed several times
with cold methanol to give biotin-Ala-Ala-AAsn-CHdCHCOOEt
1
as a white solid, yield 31%. H NMR (DMSO-d6): 1.14–1.16 (d,
3H, Ala-CH3), 1.19–1.23 (t, 3H, OCH2CH3), 1.23–1.24 (d, 3H, Ala-
CH3), 1.27–1.28 (m, 2H, biotin-CH2), 1.45–1.64 (m, 4H, biotin-
CH2CH2), 2.06–2.10 (t, 2H, biotin-CH2CO), 2.54–2.57 (d, 1H,
CHS), 2.78–2.82 (dd, 1H, CH2S, J ) 5.2 and 12.4 Hz), 3.05–3.10
(m, 1H, CH2S), 3.31 (s, 2H, NCH2CO), 4.08–4.13 (m, 2H, biotin-
CH and R-H), 4.13–4.19 (q, 2H, OCH2CH3), 4.23–4.30 (m, 1H,
biotin-CH and R-H), 6.35 (s, 1H, biotin-NH), 6.41 (s, 1H, biotin-
NH), 6.57–6.61 (d, 1H, J ) 15.2 Hz, CHdCH,), 7.16–7.23 (m,
2H, NH and CHdCH), 7.51 (s, 1H, NH), 7.92 (d, 1H, NH),
8.15–8.16 (d, 1H, NH), 10.76 (s, 1H, NH). MS (ESI) m/z 584 [(M
+ 1)+]. HRMS (ESI) calculated for C24H38N7O8S: 584.2447.
Observed m/z 584.249 71.
Acknowledgment. The research was supported by grants
from the National Institute of General Medical Sciences (Grants
GM54401 and GM61964), the National Institute of Allergy and
Infectious Diseases (Grant AI053247), and the Sandler Family
Supporting Foundation. D.S. and P.K. were supported by Grant
206/06/0865 from the Grant Agency of the Czech Republic and
the Research Centre LC06009. We thank Amy Campbell and
Tiffany Stark for the preparation of disubstituted amines.
(20) Sexton, K. B.; Witte, M. D.; Blum, G.; Bogyo, M. Design of cell-
permeable, fluorescent activity-based probes for the lysosomal cysteine
protease asparaginyl endopeptidase (AEP)/legumain. Bioorg. Med.
Chem. Lett. 2007, 17, 649–653.
(21) James, K. E.; Götz, M. G.; Caffrey, C. R.; Hansell, E.; McKerrow,
J. H.; Carter, W.; Barrett, A.; Powers, J. C. Aza-peptide epoxides:
potent and selective inhibitors of Schistosoma mansoni and pig kidney

2832 Journal of Medicinal Chemistry, 2008, Vol. 51, No. 9
Götz et al.
legumains (asparaginyl endopeptidases). Biol. Chem. 2003, 384, 1613–
1618.
(22) Asgian, J. L.; James, K. E.; Li, Z. Z.; Carter, W.; Barrett, A. J.;
Mikolajczyk, J.; Salvesen, G. S.; Powers, J. C. Aza-peptide epoxides:
a new class of inhibitors selective for clan CD cysteine proteases.
J. Med. Chem. 2002, 45, 4958–4960.
(23) Hanzlik, R. P.; Thompson, S. A. Vinylogous amino acid esters: a new
class of inactivators for thiol proteases. J. Med. Chem. 1984, 27, 711–
712.
(24) Thompson, S. A.; Andrews, P. R.; Hanzlik, R. P. Carboxyl-modified
amino acids and peptides as protease inhibitors. J. Med. Chem. 1986,
29, 104–111.
(25) Liu, S.; Hanzlik, R. P. Structure-activity relationships for inhibition
of papain by peptide Michael acceptors. J. Med. Chem. 1992, 35,
1067–1075.
(26) Barrett, A. J.; Kembhavi, A. A.; Brown, M. A.; Kirschke, H.; Knight,
C. G.; Tama, M.; Hanada, K. L-trans-Epoxysuccinyl-leucylamido(4-
guanidino)butane (E-64) and its analogues as inhibitors of cysteine
proteinases including cathepsin B, H, and L. Biochem. J. 1982, 201,
189–198.
(39) Schaschke, N.; Assfalg-Machleidt, I.; Lassleben, T.; Sommerhoff,
C. P.; Moroder, L.; Machleidt, W. Epoxysuccinyl peptide-derived
affinity labels for cathepsin B. FEBS Lett. 2000, 482, 91–96.
(40) Schaschke, N.; Dominik, A.; Matschiner, G.; Sommerhoff, C. P.
Bivalent inhibition of beta-tryptase: distance scan of neighboring
subunits by dibasic inhibitors. Bioorg. Med. Chem. Lett. 2002, 12,
985–988.
(41) Magrath, J.; Abeles, R. H. Cysteine protease inhibition by azapeptide
esters. J. Med. Chem. 1992, 35, 4279–4283.
(42) Powers, J. C.; Boone, R.; Carroll, D. L.; Gupton, B. F.; Kam, C. M.;
Nishino, N.; Sakamoto, M.; Tuhy, P. M. Reaction of azapeptides with
human leukocyte elastase and porcine pancreatic elastase. New
inhibitors and active site titrants. J. Biol. Chem. 1984, 259, 4288–
4294.
(43) Powers, J. C.; Gupton, B. F. Reaction of serine proteases with aza-
amino acid and aza-peptide derivatives. Methods Enzymol. 1977, 46,
208–216.
(44) Gupton, B. F.; Carroll, D. L.; Tuhy, P. M.; Kam, C.-M.; Powers, J. C.
Reaction of azapeptides with chymotrypsin-like enzymes. New inhibi-
tors and active site titrants for chymnotrypsin AR, subtilisin BPN′,
subtilisin carlsberg, and human leukocyte cathepsin G. J. Biol. Chem.
1984, 259, 4279–4287.
(45) Thornberry, N. A.; Rano, T. A.; Peterson, E. P.; Rasper, D. M.;
Timkey, T.; Garcia-Calvo, M.; Houtzager, V. M.; Nordstrom, P. A.;
Roy, S.; Vaillancourt, J. P.; Chapman, K. T.; Nicholson, D. W. A
combinatorial approach defines specificities of members of the caspase
family and granzyme B. Functional relationships established for key
mediators of apoptosis. J. Biol. Chem. 1997, 272, 17907–17911.
(46) Potempa, J.; Pike, R.; Travis, J. Titration and mapping of the active
site of cysteine proteinases from Porphyromonas gingiValis (gingi-
pains) using peptidyl chloromethanes. Biol. Chem. 1997, 378, 223–
230.
(27) Palmer, J. T.; Rasnik, D.; Klaus, J. L.; Brömme, D. Vinyl sulfone as
mechanism-based cysteine protease inhibitors. J. Med. Chem. 1995,
38, 3193–3196.
(28) Johnson, T. O.; Hua, Y.; Luu, H. T.; Brown, E. L.; Chan, F.; Chu,
S. S.; Dragovich, P. S.; Eastman, B. W.; Ferre, R. A.; Fuhrman, S. A.;
Hendrickson, T. F.; Maldonado, F. C.; Matthews, D. A.; Meador, J. W.;
Patick, A. K.; Reich, S. H.; Skalitzky, D. J.; Worland, S. T.; Yang,
M.; Zalman, L. S. Structure-based design of a parallel synthetic array
directed toward the discovery of irreversible inhibitors of human
rhinovirus 3C protease. J. Med. Chem. 2002, 45, 2016–2023.
(29) Dragovich, P. S.; Zhou, R.; Skalitzky, D. J.; Fuhrman, S. A.; Patick,
A. K.; Ford, C. E.; Meador, J. W., 3rd; Worland, S. T. Solid-phase
synthesis of irreversible human rhinovirus 3C protease inhibitors. Part
1: Optimization of tripeptides incorporating N-terminal amides. Bioorg.
Med. Chem. 1999, 7, 589–598.
(30) Jacobsen, W.; Christians, U.; Benet, L. Z. In vitro evaluation of the
disposition of A novel cysteine protease inhibitor. Drug Metab. Dispos.
2000, 28, 1343–1351.
(31) Graul, A.; Castaner, J. AG-7088: anti-rhinovirus drug, HRV 3C
protease inhibitor. Drugs Future 2000, 25, 9–15.
(32) Matthews, D. A.; Dragovich, P. S.; Webber, S. E.; Fuhrman, S. A.;
Patick, A. K.; Zalman, L. S.; Hendrickson, T. F.; Love, R. A.; Prins,
T. J.; Marakovits, J. T.; Zhou, R.; Tikhe, J.; Ford, C. E.; Meador,
J. W.; Ferre, R. A.; Brown, E. L.; Binford, S. L.; Brothers, M. A.;
DeLisle, D. M.; Worland, S. T. Structure-assisted design of mecha-
nism-based irreversible inhibitors of human rhinovirus 3C protease
with potent antiviral activity against multiple rhinovirus serotypes.
Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 11000–11007.
(33) Renslo, A. R.; McKerrow, J. H. Drug discovery and development for
neglected parasitic diseases. Nat. Chem. Biol. 2006, 2, 701–710.
(34) Leon-Felix, J.; Ortega-Lopez, J.; Orozco-Solis, R.; Arroyo, R. Two
novel asparaginyl endopeptidase-like cysteine proteinases from the
protist Trichomonas Vaginalis: their evolutionary relationship within
the clan CD cysteine proteinases. Gene 2004, 335, 25–35.
(35) Ekici, O. D.; Gotz, M. G.; James, K. E.; Li, Z. Z.; Rukamp, B. J.;
Asgian, J. L.; Caffrey, C. R.; Hansell, E.; Dvorak, J.; McKerrow, J. H.;
Potempa, J.; Travis, J.; Mikolajczyk, J.; Salvesen, G. S.; Powers, J. C.
Aza-peptide Michael acceptors: a new class of inhibitors specific for
caspases and other clan CD cysteine proteases. J. Med. Chem. 2004,
47, 1889–1892.
(47) Powers, J. C.; Asgian, J. L.; Ekici, O. D.; James, K. E. Irreversible
inhibitors of serine, cysteine, and threonine proteases. Chem. ReV.
2002, 102, 4639–4750.
(48) James, K. E.; Asgian, J. L.; Li, Z. Z.; Ekici, O. D.; Rubin, J. R.;
Mikolajczyk, J.; Salvesen, G. S.; Powers, J. C. Design, synthesis, and
evaluation of aza-peptide epoxides as selective and potent inhibitors
of caspases-1, -3, -6, and -8. J. Med. Chem. 2004, 47, 1553–1574.
(49) Ganesan, R.; Jelakovic, S.; Campbell, A. J.; Li, Z. Z.; Asgian, J. L.;
Powers, J. C.; Grutter, M. G. Exploring the S4 and S1 prime subsite
specificities in caspase-3 with aza-peptide epoxide inhibitors. Bio-
chemistry 2006, 45, 9059–9067.
(50) Freidig, A. P.; Verhaar, H. J. M.; Hermens, J. L. M. Comparing the
potency of chemicals with multiple modes of action in aquatic
toxicology: acute toxicity due to narcosis versus reactive toxicity of
acrylic compounds. EnViron. Sci. Technol. 1999, 33, 3038–3043.
(51) Buergin-Schaller, R.; Arnold, C.; Pretsch, E. New parameters for
predicting 1H NMR chemical shifts of protons attached to carbon
atoms. Anal. Chim. Acta 1995, 312, 95–105.
(52) Ekici, O. D.; Li, Z. Z.; Campbell, A. J.; James, K. E.; Asgian, J. L.;
Mikolajczyk, J.; Salvesen, G. S.; Ganesan, R.; Jelakovic, S.; Grutter,
M. G.; Powers, J. C. Design, synthesis, and evaluation of aza-peptide
Michael acceptors as selective and potent inhibitors of caspases-2,
-3, -6, -7, -8, -9, and -10. J. Med. Chem. 2006, 49, 5728–5749.
(53) Caffrey, C. R.; Mathieu, M. A.; Gaffney, A. M.; Salter, J. P.; Sajid,
M.; Lucas, K. D.; Franklin, C.; Bogyo, M.; McKerrow, J. H.
Identification of a cDNA encoding an active asparaginyl endopeptidase
of Schistosoma mansoni and its expression in Pichia pastoris. FEBS
Lett. 2000, 466, 244–248.
(54) Caffrey, C. R.; Hansell, E.; Lucas, K. D.; Brinen, L. S.; Alvarez
Hernandez, A.; Cheng, J.; Gwaltney, S. L.; Roush, W. R.; Stierhof,
Y. D.; Bogyo, M.; Steverding, D.; McKerrow, J. H. Active site
mapping, biochemical properties and subcellular localization of
rhodesain, the major cysteine protease of Trypanosoma brucei
rhodesiense. Mol. Biochem. Parasitol. 2001, 118, 61–73.
(36) Knobloch, W.; Niedrich, H. N-Aminoacyl-hydrazinoessigsaeure-
derivate. J. Prakt. Chem. 1962, 4, 263–281.
(37) Niedrich, H. Hydrazine compounds as hetero constituents in peptides.
XI. Synthesis of sustituted 2,4-bis-carboxymethyl-1-acyl-semicarba-
zide, the alpha-aza-asparagine peptides. Chem. Ber. 1969, 102, 1557–
1569.
(38) Hogberg, T.; Strom, P.; Ebner, M.; Ramsby, S. Cyanide as an efficient
and mild catalyst in the aminolysis of esters. J. Org. Chem. 1987,
2033–2036.
JM701311R