Magnetically responsive carboxylated magnetite-polydipyrrole/ polydicarbazole nanocomposites of core-shell morphology. Preparation, characterization, and use in DNA hybridization

Article abstract of DOI:10.1021/ja050285l

Novel bis-heterocyclic mono- and dicarboxylated dipyrrole and dicarbazole monomers have been synthesized in a modular manner. Their oxidative polymerization around magnetite nanosized particles has been investigated and optimized toward new magnetic magne

Full text of DOI:10.1021/ja050285l

Published on Web 08/10/2005
Magnetically Responsive Carboxylated
Magnetite-Polydipyrrole/Polydicarbazole Nanocomposites of
Core-Shell Morphology. Preparation, Characterization, and
Use in DNA Hybridization
Jean-Paul Lellouche,*,† Govindaraji Senthil,† Augustine Joseph,†
Ludmila Buzhansky,† Ian Bruce,‡ Erika R. Bauminger,§ and Jacob Schlesinger|
Contribution from the Department of Chemistry, Bar-Ilan UniVersity, Ramat-Gan 52900, Israel,
Department of Biosciences, UniVersity of Kent, Canterbury, Kent, ME4 4TB, United Kingdom,
Racah Institute of Physics, the Hebrew UniVersity, Jerusalem, Israel, and SaVyon Diagnostics
Ltd., 3 Habosem Street, Ashdod 77610, Israel
Received January 16, 2005; E-mail: lellouj@mail.biu.ac.il
Abstract: Novel bis-heterocyclic mono- and dicarboxylated dipyrrole and dicarbazole monomers have been
synthesized in a modular manner. Their oxidative polymerization around magnetite nanosized particles
has been investigated and optimized toward new magnetic magnetite-polydipyrrole/polydicarbazole
nanocomposites (NCs) of a core-shell morphology. These NCs were thoroughly characterized by FT-IR,
TGA (Thermal Gravimetric Analysis), low- and high-resolution TEM/HR-TEM microscopies, and Mo¨ssbauer
spectroscopy along with magnetization studies. Exploiting the versatile COOH chemistry (activation by
water-soluble diimides) introduced by the polymeric shell, DNA hybridization experiments have been
conducted onto NC surfaces using an efficient blue-colored HRP-based enzymatic screening biological
system. Highly parallel NC-supported DNA hybridization experimentations revealed that these NCs presented
an interesting potential for DNA-based diagnostic applications.
Introduction
magnetic field-guided delivery of drugs (drug targeting) and
genes (gene therapy), relaxation and contrast enhancement in
Nanoparticulate materials found extensive applications in
various domains such as electronics (data storage), catalysis,
and biotechnology/biomedicine.1-5 Generally, they present a vast
range of unique size-related optical, physical, chemical, and
magnetic properties that clearly differ from those of similar bulk
materials. More specifically for biotechnology/biomedicine
applications, hybrid functionalized nanosized materials are
constantly developed as essential components of genomics/
proteomics-related diagnostic and sensing methodologies.6 The
preparation of novel magnetic nanocomposites (NCs)/nanopar-
ticles of improved properties are another important aspect in
biotechnology- and biomedicine-related applications. Magneti-
cally driven separations of small biological components and
cells, detoxification of undesirable molecules and antigens,
noninvasive magnetic resonance imaging (MRI) of tissues,
piezoelectric immunosensors, and magnetic fluid hyperthermia
for cancer therapy have been recently disclosed in those
areas.7-14
Concerning the above stated fields of research, magnetically
responsive conducting polymer15-22 (CP)-based NCs where
inorganic magnetic nanosized cores are covered by thin insoluble
outer layers of CPs are quite new core-shell materials of
underestimated potential.23,24 Armes and co-workers first oxi-
(7) Scientific and Clinical Applications of Magnetic Carriers; Ha¨feli, U., Schu¨tt,
W., Teller, J., Zborowski, M., Eds.; Plenum Press: New York, 1997.
(8) Safarik, I.; Safarikova, M. Monatsh. Chem. 2002, 133, 737-759.
(9) Hergt, R.; Hiergeist, R.; Hilger, I.; Kaiser, W. Recent Research DeVelop-
ments in Materials Science 2002, 3, 723-742.
(10) Berry, C. C.; Curtis, A. S. G. J. Phys. D: Appl. Phys. 2003, 36, R198-
R206.
(11) Jain, K. K. Expert ReView of Molecular Diagnostics 2003, 3, 153-161.
(12) Pankhurst, Q. A.; Connolly, J.; Jones, S. K.; Dobson, J. J. Phys. D: Appl.
Phys. 2003, 36, R167-R181.
† Bar-Ilan University.
‡ University of Kent.
§ The Hebrew University.
(13) Mornet, S.; Vasseur, S.; Grasset, F.; Duguet, E. J. Mater. Chem. 2004, 14,
2161-2175.
| Savyon Diagnostics Ltd.
(1) Arshady, R.; Pouliquen, D.; Halbreich, A.; Roger, J.; Pons, J. N.; Bacri, J.
C.; Da Silva, M. d. F.; Hafeli, U. Microspheres, Microcapsules & Liposomes
2002, 5, 283-329.
(14) Payne, A. G. Medical Hypotheses 2004, 62, 718-720.
(15) Bidan, G. Sens. Actuators B 1992, 6, 45-56.
(16) Deronzier, A.; Moutet, J. C. Curr. Top. Electrochem.1994, 3, 159-200.
(17) Cosnier, S. Appl. Biochem. Biotechnol. 2000, 89, 127-138.
(18) Malinauskas, A. Polymer 2001, 42, 3957-3972.
(19) Gangopadhyay, R.; De, A. Handbook of Organic-Inorganic Hybrid
Materials and Nanocomposites 2003, 2, 217-263.
(20) Rubinson, J. F. ACS Symp. Ser. 2003, 832, 2-15.
(21) Gangopadhyay, R. Encyclopedia of Nanoscience and Nanotechnology 2004,
2, 105-131.
(22) Wallace, G. G.; Innis, P. C.; Kane-Maguire, L. A. P. Encyclopedia of
Nanoscience and Nanotechnology 2004, 4, 113-130.
(2) Hyeon, T. Chem. Commun. 2003, 927-934.
(3) Hilgendorff, M.; Giersig, M. NATO Science Series, II: Mathematics,
Physics and Chemistry 2003, 91, 151-161.
(4) Willard, M. A.; Kurihara, L. K.; Carpenter, E. E.; Calvin, S.; Harris, V. G.
Encyclopedia of Nanoscience and Nanotechnology 2004, 1, 815-848.
(5) Pellegrino, T.; Kudera, S.; Liedl, T.; Javier, A. M.; Manna, L.; Parak, W.
J. Small 2005, 1, 48-63.
(6) Cao, Y. C.; Jin, R.; Nam, J.; Thaxton, C. S.; Mirkin, C. A. J. Am. Chem.
Soc. 2003, 125, 14676-14677.
9
11998
J. AM. CHEM. SOC. 2005, 127, 11998-12006
10.1021/ja050285l CCC: $30.25 © 2005 American Chemical Society

Magnetite-Polypyrrole/Polycarbazole Nanocomposites
A R T I C L E S
Scheme 1. Synthesis of DPyr-/DCbz-Based Mono-/Diacid Monomers from L-Lysine Including a Key Aminated Monocarbazole Intermediate
datively deposited nonfunctional doped polypyrrole around
nanosized silica-magnetite (Fe3O4) particles using both aqueous
oxidants H2O2/Fe3+/HCl and (NH4)2S2O8.25,26 Resulting colloi-
dally stable core-shell NCs with diameters in the range 100-
520 nm displayed superparamagnetism. Much more recently at
near completion of our own studies, Peng’s group described
the fabrication of nanosized ferromagnetic Fe3O4-cross-linked
polyaniline NCs by oxidatively polymerizing aniline (oxidizable
monomer) using ammonium peroxodisulfate oxidant
(NH4)2S2O8.27 Related NCs were polydispersed (20-30 nm
averaged diameter) and of a core-shell morphology. Even
nonmagnetic organic (polystyrene-latex),28-31 inorganic (SiO2,32-38
SnO239) and metallic (Au)40,41 cores have been successfully
engaged as micro-/nanosized supports to oxidatively polymerize
nonfunctional/functional CP precursors in their presence.
Obviously, the full potential of magnetic magnetite-CPs NCs
has not yet been fully exploited especially considering hetero-
cyclic functional CP precursors built on oxidizable heterocycles
different from usual nonfunctional pyrrole or aniline. Accord-
ingly, we wanted to develop such magnetically responsive NCs
enabling the postpolymerization covalent attachment of biologi-
cal species and more specifically of DNA sequences. For that
purpose, we designed and synthesized several new bis-
heterocyclic mono- and dicarboxylated dipyrrole (DPyr, indexed
a) and dicarbazole (DCbz, indexed b) monomers to be oxida-
tively polymerized around magnetite nanoparticles (Schemes 1
and 2). Both DPyr- and DCbz-monomers 4a-b were directly
accessible in one step from L-lysine 1 (hydrochloride form) using
a modified Clauson-Kaas42-44 reaction. Other DPyr-/DCbz
monomers 15-18a, 8-10b, and 15-18b have been built
modularly in order to introduce molecular diversity45-47 at the
monomer level while minimizing the number of synthetic steps
to a maximum of 3 or 4 steps. Key structural features included
oxidizable monocarboxylated or monoaminated Pyr- and Cbz-
containing building blocks arising from L- or D-amino acids and
appropriate linkers of variable lengths. C2-symmetrization
operations made use of generally high-yielding stable amide
connections between these Pyr- and Cbz-based building blocks
and both hydrophilic or hydrophobic diaminated/dicarboxylated
linkers Cl-L1-3/H2N-L4-5. Nonproblematic chemical poly-
merizations of DPyr-monomers around magnetite nanoparticles
were expected based on literature results15-22 and on our own
(23) Armes, S. P. Curr. Opin. Colloid Interface Sci. 1996, 1, 214-220.
(24) Gangopadhyay, R.; De, A. Chem. Mater. 2000, 12, 608-622.
(25) Butterworth: M. D.; Armes, S. P. Polym. Mater.: Sci. Eng. 1995, 72, 300-
301.
(26) Butterworth, M. D.; Bell, S. A.; Armes, S. P.; Simpson, A. W. J. Colloid
Interface Sci. 1996, 183, 91-99.
(27) Deng, J.; Ding, X.; Zhang, W.; Peng, Y.; Wang, J.; Long, X.; Li, P.; Chan,
A. S. C. Polymer 2002, 43, 2179-2184.
(28) Lascelles, S. F.; Armes, S. P. J. Mater. Chem. 1997, 7, 1339-1347.
(29) Barthet, C.; Armes, S. P.; Lascelles, S. F.; Luk, S. Y.; Stanley, H. M. E.
Langmuir 1998, 14, 2032-2041.
(30) Cairns, D. B.; Armes, S. P.; Bremer, L. G. B. Langmuir 1999, 15, 8052-
8058.
(31) Khan, M. A.; Armes, S. P. Langmuir 1999, 15, 3469-3475.
(32) Maeda, S.; Armes, S. P. J. Colloid Interface Sci. 1993, 159, 257-259.
(33) Maeda, S.; Armes, S. P. J. Mater. Chem. 1994, 4, 935-942.
(34) Maeda, S.; Corradi, R.; Armes, S. P. Macromolecules 1995, 28, 8, 2905-
2911.
(35) Pope, M. R.; Armes, S. P.; Tarcha, P. J. Bioconjugate Chem. 1996, 7, 436-
444.
(42) Pe´rie´, K.; Marks, R. S.; Szumerits, S.; Cosnier, S.; Lellouche, J.-P
Tetrahedron Lett. 2000, 41, 3725-3729.
(36) McCarthy, G. P.; Armes, S. P.; Greaves, S. J.; Watts, J. F. Langmuir 1997,
13, 3686-3692.
(43) Elming, N.; Clauson-Kaas, N. Acta Chim. Scand. 1952, 867-874.
(44) Pe´rie´, K.; Strokhin, V.; Marks, R. S.; Lellouche, J.-P. NoVel Approaches
in Biosensors and Rapid, Diagnostic Assays. 43rd OHOLO Conference,
Eilat, Oct. 10-14, 1999; Liron, Z., Bomberg, A., Fisher, M., Eds; Kluwer
Academic/Plenum Publishers: New York, 2001; pp 225-233.
(45) Meyers, H. V. Biology-Chemistry Interface 1999, 271-287.
(46) Weber, L. Methods and Principles in Medicinal Chemistry; Clark, D. E.,
Ed.; Wiley-VCH: 2000; Vol. 8, pp 137-157.
(37) Han, M. G.; Armes, S. P. Langmuir 2003, 19, 4523-4526.
(38) Azioune, A.; Ben Slimane, A.; Hamou, L. A.; Pleuvy, A.; Chehimi, M.
M.; Perruchot, C.; Armes, S. P. Langmuir 2004, 20, 3350-3356.
(39) Maeda, S.; Armes, S. P. Synth. Met. 1995, 69, 499-500.
(40) Marinakos, S. M.; Novak, J. P.; Brousseau, L. C., III; House, A. B.; Edeki,
E. M.; Feldhaus, J. C.; Feldheim, D. L. J. Am. Chem. Soc. 1999, 121, 8518-
8522.
(41) Marinakos, S. M.; Shultz, D. A.; Feldheim, D. L. AdV. Mater. (Weinheim,
(47) Wright, D. L.; Orugunty, R. S.; Robotham, C. V. Organic Synthesis: Theory
and Applications 2001, 5, 197-254.
Germany) 1999, 11, 34-37.
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 11999

A R T I C L E S
Lellouche et al.
Scheme 2. DPyr-/DCbz-Containing Diacid Monomers from L-Aspartic and Glutamic Amino Acids
experience. On the contrary and most importantly, the bis-
heterocylic chemical design of DCbz-monomers that are more
difficult to oxidize is worth mentioning. Indeed, the electro-
chemical polymerization of N-susbtituted monocarbazole mono-
mers is known to produce only short useless tetrameric oligo-
mers soluble in electrochemical media.48,49 However, overcom-
ing this limitation, we recently successfully electrosynthesized
stable amine-sensitive polydicarbazole (polyDCbz) films onto
Au microelectrodes.42 Such polyDCbz-films were produced from
bis-heterocyclic N-pentafluorophenyl and N-hydroxysuccinim-
idyl/phthalimidyl esters of DCbz-monomer 4b (Scheme 1)
enabling the post-electropolymerization covalent attachment of
polyphenol and glucose oxidases.50-52 Most likely, the specific
bis-heterocyclic chemical design of monomer 4b (ester forms)
allowed reticulation of the corresponding polyDCbz-polymer
that resulted in an improved stability of films. Moreover and in
addition to monomer 4b (acid form), two other similarly
designed DCbz-monomers (acid form) 8-9b have been suc-
cessfully oxidized chemically around magnetite nanoparticles.
It afforded carboxylated magnetite-polyDCbz NCs of a core-
shell sheetlike morphology (20-40 nm averaged size).53
Altogether, these two convergent results prompted us to
investigate more deeply the preparation, characterization, and
use in sensitive DNA hybridizations of novel magnetic magnetite-
polyDPyr/polyDCbz NCs arising from a much wider range of
carboxylated bis-heterocyclic DPyr-/DCbz-monomers. Their
modular chemical design authorized a high structural diversity
for monomers that emphasized the respective roles of both
different heterocycles (Pyr and Cbz) and hydrophilic/hydro-
phobic linkers on the performances of corresponding NCs. Upon
DNA hybridization, sensitivity features of a model DNA analyte
as well as the nonspecific binding issues were also examined.
The obtained results pointed out the great importance of the
concept of molecular diversity for engineering functional
polyDPyr-/polyDCbz- shell outer layers of magnetic NCs.
Experimental Section
Amino acid precursors were purchased from Bachem. DMT (2,5-
dimethoxytetrahydrofuran) 3, HOBt (1-hydroxybenzotriazole), DCC
(dicyclohexylcarbodiimide), and N-methylmorpholine (NMM) were
used as supplied from Acros. High-field 1H and 13C Fourier Transform
NMR spectra were obtained from a Bruker DMX 300 machine (300
and 75 MHz respectively). IR spectral data were collected using a
Bomen-Hartman & Braun Instrument using KBr pellets (transmission
better than 85%, see the Supporting Information (SI) for details on
sample preparation). Formvar carbon 400 mesh Cu (SPI Supplies West
Chester, USA) and carbon-free 400 mesh Au grids (Agar Scientific
Ltd., U. K.), respectively, have been used for low- and high-resolution
TEM microphotographs. Microphotographs were obtained from both
JEOL-1200EX and JEOL-JEM2010 instruments (Oxford Instruments,
accelerating voltage 200 kV, Gatan CCD camera). TGA graphs were
run on a TGA-Mettler apparatus (TG-50 DSS50 model) with temper-
ature profile settings being 25-130 °C at 20 °C/min, at 130 °C for 15
min and then onward to 800 °C at 15 °C/min under N2. C,H,N-
Elemental analyses were performed on an EA 1110/CHNS-O CE
instrument, and data were corrected for oxygen. Saturation magnetiza-
tions Ms and coercivity factors Hc were measured from an Oxford VSM
system Magnetometer equipped with an Aerosonic VSM 3001 control-
ler. Mo¨ssbauer spectra were obtained at both 90 and 300 K temperatures
using a conventional Mo¨ssbauer spectrometer and a 30 mCi 57Co (Rh)
radioactive source. Spectra were computer-fitted with Lorentzian lines,
(48) Helary, G.; Chevrot, C.; Sauvet, G.; Slove, A. Polym. Bull. 1991, 26, 131-
138.
(49) Desbene-Monvernay, A.; Lacaze, P. C.; Delamar, M. J. Electroanal. Chem.
1992, 354, 241-246.
(50) Cosnier, S.; Marks, R. S.; Lellouche, J.-P.; Pe´rie´, K.; Fologea, D.; Szunerits,
S. Electroanalysis 2000, 12, 1107-1112.
(51) Cosnier, S.; Szunerits, S.; Marks, R. S.; Lellouche, J.-P.; Pe´rie´, K. J.
Biochem. Biophys. Methods 2001, 50, 65-77.
(52) Cosnier, S.; Le Pellec, A.; Marks, R. S.; Pe´rie´, K.; Lellouche, J.-P.
Electrochem. Commun. 2003, 5, 973-977.
(53) Lellouche, J.-P.; Perlman, N.; Joseph A.; Govindaraji S.; Buzhansky, L.;
Yakir, A.; Bruce, I. Chem. Commun. 2004, 560-561.
9
12000 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Magnetite-Polypyrrole/Polycarbazole Nanocomposites
A R T I C L E S
with line widths, quadrupole splittings, isomer shifts, and magnetic
hyperfine fields being free parameters. Magnetite particles were
dispersed during NC fabrication using a Bransonic ultrasonic cleaner
(2510E MTH model, 42 kHz at full power).
both diamine linkers H2N-L4-5, e.g., lipophilic 1,4-diaminobu-
tane and hydrophilic 4,7,10-trioxa-1,13-tridecanediamine using
a DCC-HOBt amide coupling system (H2N-L4-5, DCC,
HOBt, N-methyl morpholine (NMM), CH2Cl2, room tempera-
ture, 3 h). Final deprotection of resulting symmetrized benzyl
esters by transfer hydrogenolysis (10% Pd/C, cyclohexene,
i-PrOH, reflux, 1 or 2 h) completed the corresponding synthetic
sequences. It afforded the targeted dicarboxylate DPyr-/DCbz-
monomers 15-18a/b (acid forms) in three steps from starting
benzylated amino acids 11-12. Consistent with previous
observations, medium to good overall yields in DPyr-/DCbz-
monomers depended on heterocyclic DPyr- or DCbz-series
(DPyr-15-18a: 66-70% overall yields, DCbz-15-18b: 24-
34% overall yields).
Specific Reagents, Buffers, and Washing/Assay Solutions for
DNA Hybridizations. PBS buffer (pH 7.0): prepared from Dulbecco’s
Phosphate Buffered Saline (Sigma). 0.4 M MES (pH 5.0): prepared
using 2-morpholinoethanesulfonic acid hydrate 99%, adjusted to pH
5.0 by addition of 10 M NaOH and stored at 4 °C. TNET buffer (pH
7.5): prepared from a mixture of 10 mM Tris-HCl, 0.5 M NaCl, 1
mM EDTA, and 0.02% Tween-20. Washing solution: prepared from
a mixture of 3 M NaCl and 2 M Tris-HCl (pH 7.5). Assay solution:
prepared from a mixture of 154 mM NaCl, 50 mM Tris-HCl (pH 7.8),
0.5% BSA, and 0.1% Tween 20. EDC: N′-(3-(dimethylamino)propyl)-
N-ethylcarbodiimide hydrochloride, >98% purity (Aldrich).
All these DPyr-/DCbz-monomers have been fully character-
ized, their chemical structures confirmed, and purities checked
before the fabrication of corresponding NCs by appropriate
analytical means (thin-layer and high-performance liquid chro-
matographies, optical rotations54) and spectroscopic analyses
Results and Discussion
Synthesis of Carboxylated DPyr-/DCbz-Monomers. Mono-
carboxylate DPyr- and DCbz-based monomers 4a-b were
synthesized in one step starting from L-lysine (hydrochloride
salt) 1 and 2,5-dimethoxytetrahydrofuran 3 (DMT) according
to a modified Clauson-Kaas reaction42-44 (Scheme 1). Basi-
cally, two different sets of sligthly acidic conditions were
separately optimized (4a: AcOH, NaOAc/H2O, 1,2-CH2ClCH2-
Cl (DCE), 76 °C, 3 h, 70% yield; 4b: AcOH, concentrated HCl,
dioxane, reflux, 3 h then overnight at room temperature, 25%
yield). Accordingly and in four steps from starting ꢀ-ΝΗ(Z)-
protected L-lysine 2 (Z: benzyloxycarbonyl group), two aromat-
ics and one alkyl (butyl) C2-symmetrical dicarboxylate DCbz-
monomers 8-10b were readily synthesized through the pivotal
monocarbazole monoamine intermediate 6b (Scheme 1, 8-9b:
12% global yield for each monomer, 10b: 15% global yield)
using key C2-symmetrization amidations (CHCl3, Et3N, Cl-L1-3
linkers, 0-20 °C, 2 h, 68-72% yields). Aromatic and alkyl
linkers arose from tere- (para substitution), isophthaloyl (meta
substitution), and adipoyl (hexyl linker) dichlorides. Similar
attempts to prepare the pyrrole ꢀ-NH2 analogue 6a of the
carbazole intermediate 6b from the ꢀ-ΝΗ(Z)-protected pyrrole
compound 5a were unsuccessful due to its intrinsic instability
after Z-group deprotection by transfer hydrogenolysis (Scheme
1, 10% Pd/C, cyclohexene, MeOH, reflux, 30 min). Indeed, the
resulting deprotected ꢀ-aminated intermediate 6a could not be
obtained pure since it readily and consistently cyclized intramo-
lecularly toward the corresponding seven-membered pyrrole
lactam 7a during manipulation (6a:7a ) 4:1 assayed by high-
field 1H NMR for a quasi-quantitative 91% recovery yield after
separation from reaction mixture). This intramolecular amidation
did not occur for the sterically more hindered Cbz-based
intermediate 6b, therefore, allowing corresponding C2-sym-
metrization amidations as described above (Scheme 1).
1
(FT-IR, 1D/2D-high-field H/13C NMR, low- and high-resolu-
tion FAB-MS, S-2 in the SI section). Interestingly and for all
DPyr-/DCbz-monomers, connecting chains separating hetero-
cyclic units presented different lengths and lipophilicity/
hydrophilicity characteristics that could have a major importance
regarding fabrication and properties of polymeric outer layers
deposited onto magnetite nanoparticles.
Preparation of Magnetite-Carboxylated PolyDPyr-/Poly-
DCbz-Nanocomposites. Concerning preparation of magnetite-
polyDPyr/-polyDCbz NCs, nanosized magnetite particles onto
which monomeric CP-precursors were polymerized have been
prepared by a modified Sugimoto method.55,56 The oxidative
hydrolysis of iron(II) sulfate heptahydrate FeSO4‚7H2O by
KNO3 in an alkaline KOH medium under nitrogen gave free-
flowing brilliant black magnetite sheetlike nanoparticles of mean
size 20-40 nm (low-resolution TEM analysis). Magnetite
nanoparticles were characterized by FT-IR spectroscopy (KBr
pellet) that showed strong characteristic peaks at 411 and 584
cm-1. Additionally, a broad and strong peak at 3422 cm-1
indicated the presence of surface Fe-OH hydroxyl groups.55,56
Variations of the intensity of this specific IR absorption peak
allowed a simple followup of surface modifications occurring
onto magnetite nanoparticles during NC fabrication. 57Fe
Mo¨ssbauer spectroscopy also confirmed the absence of maghemite
(γ-Fe2O3) as an oxidation end-product of magnetite. Magnetite
nanoparticles could be dispersed and stored for some days in
neutral water at 4 °C at a concentration of 46.7 g/L as a stock
solution. Aliquots from this stock solution were further diluted
before use in each set of polymerization experiments (see typical
procedures, S-1 in the SI).
Salient Features of the Methodology of NC Preparation.
Results obtained during this work clearly emphasized three
salient features of NC preparation, confirming previous data
obtained for a much shorter range of monomers.53 First,
oxidative polymerizations of DPyr- and DCbz-monomers in the
presence of magnetite nanoparticles needed minimal monomer
and oxidant solubilities in aqueous or nonaqueous media. For
To exclude these limiting intramolecular amidations, two
novel amino acid starting blocks, e.g., benzyl esters of
L-aspartic and glutamic acids, have been similarly reacted with
DMT 3 according to the same modified Clauson-Kaas reaction
(Scheme 2).
Uneventfully, both former sets of acidic conditions afforded
Pyr- and Cbz-containing monomers 13-14a and 13-14b (mono
benzyl esters) building on aspartic and glutamic acid skeletons
(Scheme 2; 13-14a (n ) 1, 2): AcOH, NaOAc/H2O, 76 °C, 2
h, 78 and 81%; 13-14b (n ) 1, 2): AcOH, dioxane at reflux,
3 h then overnight at 20 °C, 30 and 40%). C2-symmetrization
couplings of these benzylated acids could proceed readily with
(54) All chemical intermediates and monomers are optically pure (HPLC
separation of diastereomers according to ref 42). It should also be noticed
that, after C2-symmetrization amidations, meso diasteromers were never
detected (13C/1H NMR) implying excellent enantiomeric purities (ee ∼97%).
(55) Sugimoto, T.; Matijevic, E. J. Colloid Interface Sci. 1980, 74, 227-243.
(56) Taylor, J. I.; Hurst, C. D.; Davies, M. J.; Sachsinger, N.; Bruce, I. J. J.
Chromatogr., A 2000, 890, 159-166.
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12001

A R T I C L E S
Lellouche et al.
example, DCbz-monomers 15b and 17b could not be polym-
erized, since they were totally insoluble in any organic or water-
miscible organic solvent. Preliminary screening studies were
conducted with the monocarboxylated monomers 4a-b. Poly-
mer deposits in resulting NCs were followed by TGA (Thermal
Gravimetric Analysis, 200-750 °C temperature range) and FT-
IR analyses. Several polymerization parameters were examined
and included different (i) polymerization times (1-6 h range),
(ii) mono- or bis-electronic oxidants, (iii) molar/weight ratios
of DPyr- and DCbz-monomers/magnetite nanoparticles, (iv)
polymerization solvents (alcohols, acetone, acetonitrile, dim-
ethylformamide, and respective aqueous mixtures), (v) medium
temperatures (in the range of 25-55 °C) whether using
ultrasounds or not (ultrasonic cleaner Bransonic at full 42 Khz
power, 2510E MTH model), and finally (vi) magnetite concen-
trations (0.5-5% w/v range at constant experiment volume).
Therefore, two different polymerization media have been
specifically disclosed for optimal polymerization of DPyr- and
DCbz-monomers (45/55 v/v H2O/CH3OH mixture and pure
acetone, respectively; see corresponding procedures in the SI)
after process extension to the full set of monomers.
based enzymatic system (HRP: horseradish peroxidase) allow-
ing detection and quantification of optically read signal outputs.
FT-IR Studies: FT-IR spectra of all the eleVen prepared NCs
were analyzed and compared with those of magnetite and
corresponding monomers (see S-3 in the SI). FT-IR spectra of
all magnetite-polyDPyr/polyDCbz NCs were found to be very
similar. They included mixed absorption peaks characteristic
of both freshly prepared magnetite (ν: 1083-1099, 1017-1024,
568-585 cm-1) and of polyDPyr- and polyDCbz-polymeric
systems {ν: 2850-2922 and 2958-2964 (δCsp3sH), 1650-1750
(νCdO, carboxyl), 1454-1558 (νCsp2sCsp2, polypyrrole and
polycarbazole aromatics), 1258-1264 (ν(CdO)sO, acid), 800-
808 (δCsp2sH, out of plane stretching) cm-1}. As cited before,
the intensity of the large absorption peak corresponding to
surface Fe-OH hydroxyl groups of magnetite (ν ) 3422 cm-1
)
in prepared NCs was greatly reduced. It clearly suggested that
carboxylated polyDPyr-/polyDCbz-outer layers should strongly
interact with magnetite Fe-OH hydroxyl groups through
respective interactions of type Fe-OH/COOH polymer groups
(metallic ester bond). Current available literature60 in the field
supported this result disclosing similar examples of strong
interactions between carboxylated organic ligands and metal
oxides. On the other hand, more importantly, strong carbonyl
stretching vibrations appearing at νCdO ) 1630-1750 cm-1
were rather indicative of free carboxylates useful for the covalent
immobilization of any amine modified capture bioprobes.
TEM Analysis. Low-resolution TEM microphotographs have
been obtained for all the prepared NCs. Notably, they indicated
that our fabrication process involving ultrasonication altered
neither the sheetlike polygonal morphology nor the average size
(20-40 nm) that characterized starting magnetite nanoparticles.
Furthermore, smoother nonsharp-edged morphological features
of NCs versus starting magnetite nanoparticles pointed out the
likely presence of polymeric polyDPyr-/polyDCbz-adlayers
around magnetite nanoparticles. Mixed structures of the type
discrete polyDPyr and polyDCbz particulate-magnetite nano-
particles could not be also detected. These observations
combined with FT-IR analyses of NCs emphasized the likely
core-shell morphology of magnetite-polyDPyr/-polyDCbz NCs.
An absolute proof for that core-shell morphology for all
prepared NCs arose from HR-TEM analyses performed together
with elemental energy-dispersive X-ray measurements (EDAX
analyses). Illustrative HR-TEM images (Figure 1and S-4 in the
SI) of four selected NCs magnetite-polyDPyr(4a), -polyDCbz-
(4b), -polyDPyr(16a), and -polyDCbz(16b) clearly showed
magnetite crystals covered by more or less uniform amorphous
polyDPyr-/DCbz-adlayers.
The absolute requirement for ultrasonic irradiation of po-
lymerization media was a second salient feature. It allowed
improved DPyr-/DCbz-monomer and oxidant dispersion/solu-
bilization at an optimal constant medium temperature of 55 °C.
Moreover, produced nanosized NCs1-4 showed minimal ag-
gregation for all tested DPyr-/DCbz-monomers (low-resolution
TEM analysis).
A third feature was related to selected mono- and bis-
electronic oxidants optimal for both series of DPyr-/DCbz-
monomers. On one hand, all tested DPyr-monomers 4a and 15-
18a were best polymerized by FeCl3 and ammonium peroxo-
disulfate (NH4)2S2O8 with the last oxidant being preferred
(cleaner magnetite-polyDPyr NCs). On the other hand, DCbz-
monomers 4b, 8-10b, 16b, and 18b could be efficiently
polymerized only when using the Ce(IV) salt CAN ((NH4)2-
53
Ce(NO3)6 (see typical procedures for NC preparation, S-1 in
the SI). Beyond the use of oxidants specific to each monomer
series, main protocol differences related to (i) optimal polym-
erization media, e.g., a 45/55 v/v H2O/CH3OH mixture for DPyr-
based monomers 4a and 15-18a and pure CH3COCH3 for the
more hydrophobic DCbz-based ones 4b, 8-10b, 16b, and 18b,
and (ii) optimal ultrasound-assisted polymerization times, e.g.,
1 h for DPyr-based monomers versus 5 h for DCbz-based ones.
Nanocomposite Characterization. Magnetically responsive
magnetite-polyDPyr and -polyDCbz NCs have been thoroughly
characterized using a range of analytical and spectroscopic
methods that included FT-IR and 57Fe Mo¨ssbauer spec-
troscopies, C,H,N-elemental and TGA thermogravimetric analy-
ses, magnetism measurements, and finally low- and high-
resolution TEM microscopies with energy-dispersive X-ray
elemental microanalysis (EDAX). Additionally as discussed later
on, a highly efficient DNA-based biological parallel screening
system helped to characterize and evaluate prepared magnetic
NCs via specific binding/nonspecific properties of structurally
versatile polymeric coverages. Covalent attachment of a model
aminated 20-mer DNA capture probe onto magnetic NCs made
use of the versatile COOH chemistry through carboxylate
activation by the water-soluble carbodiimide EDC.57-59 There-
after, DNA hybridizations occurring onto NC surfaces were
specifically examined using an amplifying blue-colored HRP-
For these NCs, adlayer thicknesses varied in a 5-7.5 nm
range. EDAX elemental analyses performed onto NC samples
deposited onto 400 mesh carbon-free gold grids consistently
showed iron-poor carbon-enriched crystal edges versus iron-
rich carbon-poor crystal centers after element calibration (INCA
software). In fact, these observations were consistent with the
relatively low quantity of polyDPyr and polyDCbz polymers
deposited onto magnetite nanoparticles independently of DPyr-/
DCbz-type of monomers (∼18-32% w) as discussed later on
(TGA and C,H,N-elemental analyses of nanocomposites).
(57) Staros, J. V. Biochemistry 1982, 21, 3950-3955.
(58) Gibson, F. S.; Park, M. S.; Rapoport, H. J. Org. Chem. 1994, 59, 7503-
7507.
(59) Grayson, I. Speciality Chemicals 2000, 20, 86-88.
(60) Kataby, G.; Cojocaru, M.; Prozorov. R.; Gedanken A. Langmuir 1999, 15,
1703-1708 and references therein.
9
12002 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Magnetite-Polypyrrole/Polycarbazole Nanocomposites
A R T I C L E S
Figure 1. HR-TEM microphotographs of selected magnetite-polyDPyr/-polyDCbz nanocomposites.
TGA and C,H,N-Elemental Analyses. TGA analyses of all
NCs were carried out in the temperature range 200-750 °C
with the specific temperature profile indicated in the Experi-
mental Section (Experimental Section, TGA curves and Table
S-6 in the SI). Both types of magnetite-polyDPyr and -polyDCbz
NCs showed different patterns of two-step profiles of weight
losses (TGA curves, S-6 in the SI). Weight losses between 250
and 400 °C (first step) could be due to evaporation/decomposi-
tion of shorter oligomeric polymer chains, while end polymer
decomposition/burning occurred in a second step between 400
and 700 °C depending on NCs. Both polyDPyr- and polyDCbz-
based NCs lead to polymer deposits in a w/w range of 18-
30% and 21-31%, respectively.
C,H,N-Elemental analysis data corrected for oxygen (Table
S-6 in the SI) were found quite consistent with these NC
compositional data and, therefore, allowed to check for data
homogeneity. More specifically and except the atypical TGA
curve of the magnetite-polyDCbz(16b) NC, other magnetite-
polyDCbz NCs displayed one tightly grouped set of very similar
TGA curves that appeared independent of monomer structures.
Regarding polyDPyr-based NCs, the magnetite-polyDPyr-
(16a) NC also displayed an atypical TGA curve when compared
to other polyDPyr-based NCs. Contrary to the former polyDCbz-
series of NCs, TGA graphs of polyDPyr-based NCs were found
quite distinct most likely pointing out a greater influence of
DPyr-monomer structures on the stability of corresponding
polyDPyr-adlayers to heat.
Magnetization Studies. Bulk magnetization against applied
magnetic field experiments have been measured at 300 K for
all fabricated lyophilized magnetic NCs. Magnetization profiles
(Figure 2and Table S-7 in the SI) were very similar and showed
hystereses with coercivity factors Hc in a low to medium range
of 35-132 Oe. For that reason, these NCs cannot be strictly
considered as superparamagnetic nanocomposites. Saturation
magnetizations Ms have been observed in a range of 32-55
emu/g that were lower than the known reported value of 92-
98 emu/g of pure magnetite. Most likely, it resulted from the
compositional modification of core magnetite due to oxidative
polymerization processes. In fact, inorganic magnetic cores were
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12003

A R T I C L E S
Lellouche et al.
Figure 2. Selected magnetization profiles of magnetite-polyDCbz(4b) (Ms: 35 emu/g, coercivity Hc: 132 Oe) and magnetite-polyDCbz (9b) (Ms: 52
emu/g, coercivity Hc: 35 Oe) nanocomposites.
Figure 3. Biological DNA-based screening system involving carboxylated magnetite-polyDPyr/polyDCbz nanocomposites.
Figure 4. Comparative charts of the efficiency (SB/NSB ratio) of FITC-5′labeled DNA2 capture at a concentration of 10-7 M by magnetite-polyDPyr/
polyDCbz nanocomposites.
formed of less magnetic nonstoichiometric magnetite Fe3-xO4
(0 e x e 0.33) as determined by 57Fe Mo¨ssbauer analysis at
300 K (obtention of two superposed magnetic subspectra
compatible with Fe3+ and Fe2.5+ atoms located in tetrahedral
and octahedral sites, respectively, in different relative intensities,
Figure S-5 in the SI). Interestingly, less magnetic NCs of higher
coercivity factors were consistently found in the polyDCbz-
series due to longer polymerization times, e.g., 5 h versus 1 h
for the polyDPyr-series of nanocomposites meaning a more
pronounced oxidation of the starting magnetite core.
Covalent Attachment of an NH2-5′Modified DNA1 Se-
quence and Hybridization Studies. Once characterized satis-
factorily by the range of methods cited previously, polyDPyr-/
polyDCbz-NCs have been screened in a parallel mode using a
simple powerful DNA-based biological system (Figure 3 and
S-1 in the SI). This DNA-based screening system comprised
the covalent attachment of an amine modified single-strand
DNA sequence onto NC surfaces and its hybridization to a
second complementary DNA sequence. NC-supported DNA
hybridizations were characterized and quantified by reading
optical outputs generated by an enzymatic amplifying system.
For that purpose, an amine modified 20-mer DNA probe DNA1
(H2N-(CH2)12-5′GCACTGGGAGCATTGAGGCT) that char-
acterized the 20210 mutation in the Human Factor II gene (G
f A single oligonucleotide mutation at position 20210)61,62 has
been chosen as a capture DNA probe.
Accordingly, carboxylated magnetite-polyDPyr/polyDCbz
NCs were treated with the water-soluble carbodiimide EDC (N′-
(3-(dimethylamino)propyl)-N-ethylcarbodiimide hydrochlo-
ride)59 in a 0.4 M MES buffer medium (pH 5.0, 2 h incubation
at 20 °C) to activate surface COOH groups. Then, activated
NCs were reacted with the NH2-5′modified DNA1 probe toward
(61) Poort, S. R.; Rosendaal, F. R.; Reitsma, P. H.; Bertina, R. M. Blood 1996,
88, 3698-3703.
(62) Vicente, V.; Gonzalez-Conejero, R.; Rivera, J.; Corral, J. Haematologica
1999, 84, 356-362.
9
12004 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Magnetite-Polypyrrole/Polycarbazole Nanocomposites
A R T I C L E S
Figure 5. Comparative charts for magnetite-polyDPyr/polyDCbz nanocomposites at decreasing concentrations of the FITC-5′labeled DNA2 model analyte.
DNA1-decorated magnetic polyDPyr-/polyDCbz-NCs via co-
valent amide bonding.63
to minimize data dispersion. Indeed, OD variations were always
observed to be less than 5-8%. Specific binding (SB ) TB -
NSB)/NSB ratios that were indicative of NC efficiency were
calculated and compared with parallel similarly processed
commercial micrometric COOH-Dynabeads M-270 (i 2.8 µm,
Dynal AS, Oslo, Norway),64 which have been commonly used
for magnetism-driven suspension assays.
In a first series of DNA hybridization experiments, concentra-
tions of both complementary FITC-5′labeled -DNA2 probe and
tested NCs were fixed at 10-7M and at 1.0% w/v (50 µg per
ELISA microtiter plate well), respectively (S-1 in the SI). From
careful examination of resulting SB/NSB ratios (Figure 4), it
was found that two magnetite-polyDCbz NCs namely, magnetite-
polyDCbz(9b), and -polyDCbz(16b) NCs were as efficient as
COOH-Dynabeads in specifically capturing the model analyte
FITC-5′labeled DNA2. Calculated averaged SB/NSB ratios were
in a high 21.8-22.8 range. In contrast, all tested magnetite-
polyDPyr NCs were found less efficient than standard COOH-
Dynabeads with SB/NSB ratios being in a low to medium 4.2-
16.3 range.
In this later series, only the magnetite-polyDPy(16a) NC had
managed to have a decent 16.3 SB/NSB ratio against 22.2
obtained for standard COOH-Dynabeads. Another interesting
feature seemingly resulting from monomer design has also been
discerned. Both pairs of magnetite-polyDPyr(16a)/polyDCbz-
(16b) and magnetite-polyDPyr(18a)/polyDCbz(18b) NCs pre-
pared from DPyr-/DCbz-monomers 16/18a-b showed remark-
ably different performances. The first pair building on an
hydrophobic 1,4-diaminobutane linker at monomer level was
The successful covalent modification of NCs by the probe
DNA1 was confirmed by further hybridizations with a fluores-
ceine-labeled anti-sense 20-mer complementary DNA2 strand
(fluoresceine (FITC)-triethyleneglycol linker-5′AGCCTCAAT-
GCTCCCAGTGC, 1 h, 60 °C). After hybridization (TNET
buffer, pH 7.5), the NCs were incubated with an anti-FITC
HRP-labeled mouse monoclonal antibody (HRP: horseradish
peroxidase, 20 min, 20 °C) to enable an enzyme-based colored
detection of NC-supported DNA hybridizations. Accordingly,
this NC-immobilized amplifying enzymatic construct was added
and reacted with the HRP colorless substrate TMB (3,3′,5,5′-
tetramethylbenzidine). TMB enzymatic oxidation (1.5 min,
20 °C) afforded blue-colored visible optical outputs that were
read in parallel (96-well plastic microtiter plate) at 620 nm using
an ELISA reader. Resulting measured optical densities (ODs)
related to the total amount of FITC-DNA2 analyte being
recognized by DNA1-decorated NCs (Total Binding: TB)
through hybridization-based specific (specific binding: SB) and
nonspecific interactions (nonspecific binding: NSB). Parallel
experiments were also conducted by omitting the FITC-DNA2
incubation step with the same DNA1-decorated NCs. It allowed
us to estimate the affinity of DNA1-decorated magnetite-
polyDPy/-polyDCbz NCs to physically adsorb (nonspecific
binding: NSB) the reporter anti-FITC HRP-labeled mouse
antibody. For each tested NC, specific and nonspecific OD
values were averaged outputs of six parallel experiments in order
(63) DNA1 loading for both types of polyDPyr-/polyDCbz-modified NCs and
Dynabeads was similar, e.g., 1.2 nmol of DNA1/mg of NCs/Dynabeads.
This is supported by the fact that both CP-modified nanocomposites and
Dynabeads possessed concentrations of accessible COOH groups of 36-
54 and 150 mmol, respectively, that much exceeded the quantity of DNA1
engaged in the loading step. Reversed-phase HPLC checking of corre-
sponding postcoupling washings did not allow detection of any unbound
DNA1 probe (results to be reported in a separate forthcoming publication
involving biology-related data).
(64) Dynabeads M-270 (carboxylic acid form, 2.8 µm diameter, 2-5 m2/g
specific area) are superparamagnetic beads composed of highly cross-linked
polystyrene with a magnetic iron oxide material precipitated and trapped
in evenly distributed pores. A hydrophilic outer layer of glycidyl ether
provides functional carboxylate groups (150 µmol/g beads). The iron content
of beads is 15% w/w for a magnetic mass susceptibility in a 88-126 ×
10-6 m3/g range.
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12005

A R T I C L E S
Lellouche et al.
found more efficient (SB/NSB ) 16.3 and 22.8) than the second
one prepared from the more hydrophilic 4,7,10-trioxa-1,13-
tridecane linker (SB/NSB ) 8.0 and 11.6). Noticeably, the least
efficient among all the tested NCs, the magnetite-polyDPyr-
(17a) NC (SB/NSB ) 4.2) built also on the same hydrophilic
4,7,10-trioxa-1,13-tridecaneamine linker. These results excluded
this kind of PEG-like monomer internal linker for performant
magnetic NCs. Additionally, both magnetite-polyDPyr(4a)/
polyDCbz(4b) NCs prepared from the same monocarboxylated
L-lysine-based precursor showed almost similar efficiencies (SB/
NSB ) 13.2 and 15.4, respectively) indicating that efficiencies
are independent of the type of monomer/polymer heterocycles
polyDPyr-/polyDCbz.
(10 fM level) of FITC-5′labeled DNA2.65 The two other more
sensitive NCs magnetite-polyDCbz(4b) and -polyDCbz(8b)
were found an order less sensitive with similar SB/NSB ratios
(2.0 and 1.6, respectively, at 10-13 M). Importantly, these low-
range DNA detection levels at low NSB have been achieved
without using any additional passivating step (incubations with
egg albumin, BSA, PEG1000 or Triton X surfactants, dextran)
commonly used in the diagnostic field.
Conclusions
Novel oxidatively polymerizable mono- and dicarboxylated
DPyr- and DCbz-monomers have been chemically designed and
readily synthesized using a general and versatile route (C2-
symmetrization of NH2-/COOH-amino acid-related building
blocks). Their oxidative polymerization onto magnetite nano-
particles has been achieved using oxidants specific of monomer
heterocyclic chemical type. Resulting magnetically responsive
sheetlike magnetite-DPyr/-DCbz nanocomposites (20-40 nm
size) have been fully characterized using a range of analytical
and spectroscopic techniques. They have been shown unam-
biguously to possess a core-shell morphology. COOH func-
tionalities that have been introduced by the polymeric shell
allowed these NCs to be covalently modified by an aminated
20-mer DNA sequence (capture probe). Resulting DNA-
functionalized NCs have been screened for improved properties
regarding DNA hybridizations occurring onto NC surfaces using
a blue-color emitting HRP-based enzymatic signal amplifying
system. Observed SB/NSB ratios for the whole set of prepared
NCs compared well or were even better than those of standard
commercially available COOH-Dynabeads parallely treated
under similar conditions. The type of monomer heterocycles
Pyr or Cbz did not alter drastically the global efficiency of
magnetic nanocomposites. On the contrary, the chemical type
of linkers had significant effects in DNA hybridizations. Another
unique capability of our approach to prepare these novel
magnetically responsive magnetite-polyDPyr/-polyDCbz NCs
lies in the potential combinatorial engineering of polymeric
shells of NCs for optimization to a given application. The
corresponding results dealing with combinatorially fabricated
magnetic NCs will be reported soon in separate publications.
Sensitivity Patterns of NCs at Decreasing Concentrations
of FITC-5′Labeled DNA2 (Model Analyte). Subsequently, the
above set of DNA1-decorated NCs has also been screened in
parallel to investigate the lowest sensitivity limit of detection
of FITC-5′labeled DNA2 acting as a model analyte. During these
experiments, all the parameters and protocols arising from the
previous study were implemented while the concentration of
FITC-5′labeled DNA2 was varied downward in the 10-7-10-14
M range. Corresponding ODs and averaged NSB data (triplicate
experiments) for each tested NC were reported in Figure 5. NSB
data were consistently in a low 0.05-0.09 range for all tested
NCs except for the magnetite-polyDPyr(17a) NC prepared from
the hydrophilic linker 4,7,10-trioxa-1,13-tridecanediamine that
averaged a high 0.11 value. Previously observed least detection
efficiencies (lowest SB/NSB ratios) for this specific NC were
retrieved for all tested concentrations of FITC-5′labeled DNA2.
On the contrary, three magnetite-polyDPyr(4a), -polyDPyr-
(15a), and -polyDPyr(16a) NCs from the polyDPyr-series and
four magnetite-polyDCbz(4b), -polyDCbz(8b), -polyDCbz(9b),
and -polyDCbz(16b) NCs from the polyDCbz-series were found
to attain reproducible SB/NSB ratios in the 1.6-2.7 range at
very low 10-12-10-14 M concentrations of FITC-5′labeled
DNA2.65 These results took a particular significance when
COOH-Dynabeads similarly tested in parallel were found totally
inefficient. Therefore, these novel highly sensitive magnetic NCs
have an interesting potential for DNA detection at very low
concentrations. Best among all the studied magnetite-polyDPyr/
polyDCbz NCs was the magnetite-polyDPy(16a) NC that
Acknowledgment. This work has been funded under both
Vth/VIth Framework European CHEMAG (n° GRD2-2000-
30122) and NACBO (n° NMP3-2004-500802-2) projects. The
authors thank Profs. Shlomo Margel for his scientific assistance
in TGA analyses, Drs. Yudith and Tova Tamari for acquiring
TEM and HRTEM microphotographs, and Mr. Ishai Bruckental
(Department of Physics, Bar-Ilan University) for his help for
magnetization measurements.
displayed the most sensitive SB/NSB ratio of 2.7 at 10-14
M
(65) This high-level sensitivity (10 fM level) for detection of DNA hybridization
already sustains comparison with other ultrasensitive detection methodolo-
gies based on fluorescence (6 × 10-12- 1 × 10-15 M level),65a-e surface
plasmon resonance (SPR, 10-11 M),65f electrochemistry (1 × 10-10-0.1 ×
10-15 M)65g-m and alternative/combined means involving nanoparticles (20
× 10-15 and 0.5 × 10-18 M).65n,o (a) Wang, G.; Yuan, J.; Matsumoto, K.;
Hu, Z. Anal. Biochem. 2001, 299, 169-172. (b) Epstein, J. R.; Lee, M.;
Walt, D. R. Anal. Chem. 2002, 74, 1836-1840. (c) Ali Mehnaaz, F.; Kirby,
R.; Goodey, A. P.; Rodriguez, M. D.; Ellington, A. D.; Neikirk, D. P.;
McDevitt, J. T. Anal. Chem. 2003, 75, 4732-4739. (d) Nie, L.; Tang, J.;
Guo, H.; Chen, H.; Xiao, P.; He, N. Anal. Sci. 2004, 20, 461-463. (e) Li,
H.; Rothberg, L. J. Anal. Chem. 2004, 76, 5414-5417. (f) He, L.; Musick,
M. D.; Nicewarner, S. R.; Salinas, F. G.; Benkovic, S. J.; Natan, M. J.;
Keating, C. D. J. Am. Chem. Soc. 2000, 122, 9071-9077. (g) Korri-
Youssoufi, H.; Garnier, F.; Srivastava, P.; Godillot, P.; Yassar, A. J. Am.
Chem. Soc. 1997, 119, 7388-7389. (h) Zhang, Y.; Kim, H.-H.; Heller, A.
Anal. Chem. 2003, 75, 3267-3269. (i) Wang, J.; Liu, G.; Zhu, Q. Anal.
Chem. 2003, 75, 6218-6222. (j) Park, N.; Hahn, J. H. Anal. Chem. 2004,
76, 900-906. (k) Hernandez-Santos, D.; Diaz-Gonzalez, M.; Gonzalez-
Garcia, M. B.; Costa-Garcia, A. Anal. Chem. 2004, 76, 6887-6893. (l)
Hwang, S.; Kim, E.; Kwak, J. Anal. Chem. 2005, 77, 579-584. (m) Liu,
J.; Tian, S.; Tiefenauer, L.; Nielsen, P. E.; Knoll, W. Anal. Chem. ACS
ASAP (AN 2005:267048). (n) Cao, Y. C.; Jin, R.; Mirkin C. A. Science
2002, 297, 1536-1540. (o) Nam, J.-M.; Stoeva Savka, I.; Mirkin C. A. J.
Am. Chem. Soc. 2004, 126, 5932-5933.
Supporting Information Available: Typical synthetic pro-
cedures, analytical and spectral characterization data of selected
oxidizable DPyr-/DCbz-monomers, FT-IR spectra of selected
magnetite-NCs, low- and high-resolution TEM and HR-TEM
microphotographs with elemental EDAX analyses and the
Mo¨ssbauer spectrum of magnetite-polyDCbz(18b) nanocom-
posite, TGA and C,H,N-elemental analyses (TGA curves and
comparative table), a table of absolute magnetizations and
coercivity values of NCs. This material is available free of
charge via the Internet at http://pubs.acs.org.
JA050285L
9
12006 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005