Gene deletion of 7,8-linoleate diol synthase of the rice blast fungus: Studies on pathogenicity, stereochemistry, and oxygenation mechanisms

Article abstract of DOI:10.1074/jbc.M109.062810

Linoleate diol synthases (LDS) are heme enzymes, which oxygenate 18:2n-6 sequentially to (8R)-hydroperoxylinoleic acid ((8R)-HPODE) and to (5S,8R)-dihydroxy-, (7S,8S)-dihydroxy-, or (8R,11S)-dihydroxylinoleic acids (DiHODE). The genome of the rice blast fungus, Magnaporthe oryzae, contains two genes with homology to LDS. M. oryzae oxidized 18:2n-6 to (8R)-HPODE and to (7S,8S)-DiHODE, (6S,8R)-DiHODE, and (8R,11S)-HODE. Small amounts of 10-hydroxy-(8E,12Z)-octadecadienoic acid and traces of 5,8-DiHODE were also detected by liquid chromatography-mass spectrometry. The contribution of the 7,8-LDS gene to M. oryzae pathogenicity was evaluated by replacement of the catalytic domain with hygromycin and green fluorescent protein variant (SGFP) cassettes. This genetically modified strain ?7,8-LDS infected rice leaves and roots and formed appressoria and conidia as the native fungus. The ?7,8-LDS mutant had lost the capacity to biosynthesize all the metabolites except small amounts of 8-hydroxylinoleic acid. Studies with stereospecifically deuterated linoleic acids showed that (8R)-HPODEwas formed by abstraction of the pro-S hydrogen at C-8 and antarafacial oxygenation, whereas (7S,8S)-Di-HODE and (8R,11S)-DiHODE were formed from (8R)-HPODE by suprafacial hydrogen abstraction and oxygenation at C-7 and C-11, respectively. A mac1 suppressor mutant (?mac1 sum1-99) of M. oryzae, which shows cAMP-independent protein kinase A activity, oxygenated 18:2n-6 to increased amounts of (10R)-HPODE and (5S,8R)-DiHODE. Expression of the 7,8-LDS gene but not of the second homologue was detected in the suppressor mutant. This suggests that PKA-mediated signaling pathway regulates the dioxygenase and hydroperoxide isomerase activities of M. oryzae.

Full text of DOI:10.1074/jbc.M109.062810

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 8, pp. 5308–5316, February 19, 2010
© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
Gene Deletion of 7,8-Linoleate Diol Synthase of the Rice
Blast Fungus
□
S
STUDIES ON PATHOGENICITY, STEREOCHEMISTRY, AND OXYGENATION MECHANISMS*
Received for publication, September 4, 2009, and in revised form, December 17, 2009 Published, JBC Papers in Press, December 20, 2009, DOI 10.1074/jbc.M109.062810
Fredrik Jernere´n‡, Ane Sesma§, Marina Francheschetti§, Mats Hamberg¶, and Ernst H. Oliw‡1
From the ‡Section of Biochemical Pharmacology, Department of Pharmaceutical Biosciences, Uppsala University, Biomedical
Centre, SE-751 24 Uppsala, Sweden, the §Department of Disease and Stress Biology, John Innes Center, Colney Lane,
Norwich NR4 7UH, United Kingdom, and the ¶Department of Medical Biochemistry and Biophysics, Karolinska Institutet,
S-171 77 Stockholm, Sweden
Linoleate diol synthases (LDS) are heme enzymes, which
Magnaporthe oryzae is an ascomycete fungus, which causes
rice blast disease (1, 2).2 Rice blast was first described in China
oxygenate 18:2n-6 sequentially to (8R)-hydroperoxylinoleic
acid ((8R)-HPODE) and to (5S,8R)-dihydroxy-, (7S,8S)-dihy- andJapanover300yearsago. Thediseaseisdifficulttocontrol, and
it remains a serious problem. In Japan, rice blast annually reduces
the rice crop by ϳ25% (2, 3). M. oryzae has also been found on
other continents where wheat, barley, and pearl millet also can be
infected. As a consequence of its biological importance, M. oryzae
was the first fungal plant pathogen that was sequenced (4).3 The
haploid genome (ϳ40 Mb) is estimated to contain about 11,000
genes in seven chromosomes (5). This study focuses on a linoleate
diol synthase (LDS)4 of M. oryzae, which is homologous to LDS of
important plant and human fungal pathogens.
droxy-, or (8R,11S)-dihydroxylinoleic acids (DiHODE). The
genome of the rice blast fungus, Magnaporthe oryzae, contains
two genes with homology to LDS. M. oryzae oxidized 18:2n-6 to
(8R)-HPODE and to (7S,8S)-DiHODE, (6S,8R)-DiHODE, and
(8R,11S)-HODE. Small amounts of 10-hydroxy-(8E,12Z)-octa-
decadienoic acid and traces of 5,8-DiHODE were also detected
by liquid chromatography-mass spectrometry. The contribu-
tion of the 7,8-LDS gene to M. oryzae pathogenicity was evalu-
ated by replacement of the catalytic domain with hygromycin
and green fluorescent protein variant (SGFP) cassettes. This
genetically modified strain ⌬7,8-LDS infected rice leaves and
roots and formed appressoria and conidia as the native fungus.
The ⌬7,8-LDS mutant had lost the capacity to biosynthesize all
the metabolites except small amounts of 8-hydroxylinoleic acid.
Studies with stereospecifically deuterated linoleic acids showed
that (8R)-HPODE was formed by abstraction of the pro-S hydro-
gen at C-8 and antarafacial oxygenation, whereas (7S,8S)-Di-
HODE and (8R,11S)-DiHODE were formed from (8R)-HPODE
by suprafacial hydrogen abstraction and oxygenation at C-7 and
C-11, respectively. A mac1 suppressor mutant (⌬mac1 sum1–
99) of M. oryzae, which shows cAMP-independent protein
kinase A activity, oxygenated 18:2n-6 to increased amounts of
(10R)-HPODE and (5S,8R)-DiHODE. Expression of the 7,8-LDS
gene but not of the second homologue was detected in the sup-
pressor mutant. This suggests that PKA-mediated signaling
pathway regulates the dioxygenase and hydroperoxide isomer-
ase activities of M. oryzae.
LDS was first described in the take-all fungus of wheat, Gaeu-
mannomyces graminis (6). This enzyme (EC 1.13.11.44), oxi-
dizes 18:2n-6 sequentially to (8R)-HPODE and to (7S,8S)-Di-
HODE (6–8) and was designated 7,8-LDS. (8R)-HPODE is
formed by hydrogen abstraction and antarafacial oxygenation
at C-8, whereas the diol is formed sequentially by intramolecu-
lar suprafacial oxygenation at C-7 by the N-terminal cyto-
chrome P450 domain of LDS, as summarized in Fig. 1 (8, 9).
Sequence homology, the reaction mechanism, and results of
site-directed mutagenesis suggest that 7,8-LDS and mamma-
lian cyclooxygenases have mechanistic and structural similari-
ties (8, 10–13).
Genes with homology to 7,8-LDS are present in M. oryzae,
Magnaporthe aspergilli, and other filamentous fungi (14, 15).
Two of them have been studied by gene expression and gene
deletion, (10R)-DOX of Aspergillus nidulans and Aspergillus
fumigatus (16, 17) and 5,8-LDS of A. nidulans and A. fumigatus
(16, 18).5 These enzymes oxygenated 18:2n-6 to (8R)-HPODE
2 M. oryzae designates the rice-infecting species of Magnaporthe isolates sep-
arate from M. grisea (51).
3 Data are from the Magnaporthe grisea Sequencing Project at Broad Institute
of Harvard and Massachusetts Institute of Technology.
* This work was supported by Vetenskapsrådet Medicin/Grant 03X-06523 (to 4 The abbreviations used are: LDS, linoleate diol synthase; DiHODE, dihy-
E. O.), The Knut and Alice Wallenberg Foundation/Grant KAW 2004.0123
and Formas/Grant 222-2005-1733, The Swedish Research Council for Envi-
ronmental, Agricultural Sciences, and Spatial Planning Project 229-2004-
833 (to M. H.), and The Biotechnology and Biological Sciences Research
Council Grant BB/C520720/1, United Kingdom (to A. S.).
S
droxy-(9Z,12Z)-octadecadienoic acid; DOX, dioxygenase; (8R)-HODE,
(8R)-hydroxy-(9Z,12Z)-octadecadienoic acid; (8R)-HPODE, (8R)-hydroper-
oxy-(9Z,12Z)-octadecadienoic acid; (10R)-HPODE, (10R)-hydroperoxy-
(8E,12Z)-octadecadienoicacid;HPODE, hydroperoxyoctadecadienoicacid;
MAPK, mitogen-activated protein kinase; PKA, protein kinase A; RP,
reversed phase; TMS, trimethylsilyl ether; HPLC, high pressure liquid chro-
matography; MS/MS, tandem mass spectrometry; GC-MS, gas chromatog-
raphy-mass spectrometry; LC-MS, liquid chromatography-mass spectrom-
etry; UTR, untranslated region.
□
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Figs. 1S–12S and Tables 1S and 2S.
1 To whom correspondence should be addressed: Section of Biochemical
Pharmacology, Dept. of Pharmaceutical Biosciences, Uppsala University,
P. O. Box 591, SE-751 24 Uppsala, Sweden. Tel.: 46-18-4714455; Fax: 46-18- 5 Hoffmann, I., Jernere´n, F., andOliw, E. H. (2009) RegulatoryOxylipins, AnInter-
4714847; E-mail: Ernst.Oliw@farmbio.uu.se.
national Symposium, Lausanne, Switzerland, June 4–6, 2009.
5308 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 8•FEBRUARY 19, 2010

Gene Targeting of 7,8-LDS
TABLE 1
Oxygenases of M. oryzae with homology to 7,8-LDS of G. graminis
and (10R)-DOX, 5,8-, and 8,11-LDS of A. fumigatus
Percent identitya
Locus, GenBankTM
(hypothetical proteins) 7,8-LDSgg 5,8-LDSaf 8,11-LDSaf (10R)-DOXaf
%
MGG_13239
MGG_10859
63
41
48
49
39
48
40
48
a Alignments were performed with the ClustalW algorithm. 7,8-LDSgg is 7,8-LDS of
G. graminis var. triticie; 5,8-LDSaf and 8,11-LDSaf designate 5,8-LDS and the ten-
tatively identified 8,11-LDS of A. fumigatus (16), respectively; (10R)-DOXaf des-
ignates the (10R)-DOX enzyme (GenBankTM accession number XP_75170,
XP_754409, and XP_746438).
M. oryzae is a model organism for studies of fungal diseases
of blasts (25), and it also infects rice roots (26). The spores of M.
oryzae attach to the hydrophobic surface of leaves and contain
all that is needed to develop an injection apparatus for cuticle
penetration, designated an appressorium with penetrating
hyphae. In this process, the conidium undergoes apoptosis with
transfer of lipid bodies, trehalose, and glycerol to the appresso-
rium. The subsequent mobilization and oxidation of fatty acids
of lipid bodies are controlled by PKA, MAPK, triacylglycerol
lipases, and ␤-oxidation (27–32). Glycerol accumulates and
generates the unprecedented internal turgor pressure of the
appressorium (27). These processes are deranged in mutants of
the cAMP-protein kinase cascade (29). Whether LDS enzymes
are involved in lipid mobilization and pathogenicity and can be
regulated by kinases are unknown.
FIGURE 1. Mechanism of oxidation of linoleic acid to (7S,8S)-DiHODE by
7,8-LDS of G. graminis.
or (10R)-HPODE by abstraction of the pro-S hydrogen at C-8
followed by antarafacial oxygen insertion at C-8 by LDS or at
C-10 with double bond migration in the case of (10R)-DOX
(16). (8R)-HPODE is isomerized to (5S,8R)-DiHODE by 5,8-
LDS and to (8R,11S)-DiHODE by A. fumigatus. 8,11-LDS of A.
fumigatus has not been identified by gene deletion nor
by gene expression. (5S,8R)-DiHODE and (8R,11S)-DiHODE
appear to be formed from (8R)-HPODE by the same mecha-
nism as (7S,8S)-DiHODE (7, 16, 19), viz. suprafacial hydrogen
abstraction and hydroxylation.
The first goal of this study was to characterize the oxygen-
ation of 18:2n-6 by M. oryzae with respect to all products, oxy-
genation mechanisms, and stereochemistry. Our second goal
was to use gene targeting to identify and study the biological
importance of 7,8-LDS during rice infection and sporulation.
The third goal was to determine whether LDS activity is influ-
enced by the cAMP-mediated signaling pathway. Finally, we
also assayed oxygenation of unsaturated fatty acids by mycelia
to identify the major products formed by cytochrome P450.
Studies on the biological function of fungal oxylipins started
20 years ago in A. nidulans. (8R)-HODE and (5S,8R)-DiHODE
were found to induce premature sexual sporulation (20). Gene
deletion of 5,8-LDS and (10R)-DOX in A. nidulans and A.
fumigatus was later found to influence sporulation, develop-
ment, mycotoxin production, and pathogenicity (16, 21, 22). In
contrast, little is known about the biological function of 7,8-
LDS of G. graminis. The hyphae of G. graminis penetrate and
destroy wheat roots, and the take-all disease causes significant
economical losses (23). The genome of G. graminis is not yet
available. Transformation and genetic manipulation of G. gra-
minis are difficult and preclude gene deletion studies of 7,8-
LDS. We therefore turned our attention to the genetically
tractable M. oryzae, another fungal grass pathogen of the Mag-
naporthaceae family (24), to better understand the biological
roles of the 7,8-LDS. Amino acid identities between deduced
oxygenases of the two genes of M. oryzae with homology to
7,8-LDS of G. graminis and fatty acid oxygenases of aspergilli
are summarized in Table 1. M. oryzae has previously been
found to oxygenate 18:2n-6 to 7,8-DiHODE and 8-HODE, and
the transcript of the tentative 7,8-LDS gene was sequenced
(14).6
EXPERIMENTAL PROCEDURES
Materials—Fatty acids were dissolved in ethanol and stored
in stock solutions (50–100 mM) at Ϫ20 °C. 18:2n-6 (99%),
18:3n-6 (99%), and 18:3n-3 (99%) were from VWR, all other
fatty acids (98–99%) were from Larodan (Malmo¨, Sweden).
(7R)-[2H]18:2n-6, (8R)-[2H]18:2n-6, and (11S)-[2H]18:2n-6
were prepared as described previously (7, 16). (13R)-
[2H4]HODE, (8R)-HPODE, and stereoisomers of 8,11-DiHODE
were prepared and purified as described previously (19). Chem-
ically competent Escherichia coli (Top10), DNA ladders,
reverse transcriptase (Superscript III), and pCR2.1 were from
ϩ
Invitrogen. pGEM5Zf and DNase I were obtained from Pro-
mega, and pCAMBIA0380 was from CAMBIA (Canberra,
Australia). Phusion DNA polymerase was from Finnzymes,
and GeneJET cloning kit was from Fermentas. Taq DNA poly-
merase, hexadecyltrimethylammonium bromide, cefotaxime,
hygromycin B, kanamycin, 3,5-dimethoxy-4-hydroxyaceto-
phenone, and tetranitromethane were from Sigma. Restriction
enzymes were from New England Biolabs and Fermentas. Plas-
mid Midi kits, and QIAquick gel extraction kits were from Qia-
gen. SYBR Green Supermix and RNA StdSens analysis kit were
6 M. Cristea, A. E. Osbourn, and E. H. Oliw, GenBankTM accession number
AY372822.
FEBRUARY 19, 2010•VOLUME 285•NUMBER 8
JOURNAL OF BIOLOGICAL CHEMISTRY 5309

Gene Targeting of 7,8-LDS
from Bio-Rad. Agrobacterium tumefaciens (strain AGL-1) were
obtained as described previously (26).
Fungal Strains and Growth—M. oryzae Guy11 was used in
the LDS gene deletion study. M. oryzae was grown in liquid
culture for 7–14 days in complete medium, minimal medium
(33), minimal medium without glucose, or without nitrate salts
(34). Conidia were prepared from mycelia grown for 8–12 days
on complete medium agar at 22 °C under 16-h light and 8-h
dark cycles of fluorescent light (True-light). The agar plates
were flooded with distilled water and harvested with a glass
spreader, and the conidial suspensions were filtered through
one layer of Miracloth.
FIGURE 2. Mutant ⌬7,8-LDS was produced by homologous recombina-
tion using A. tumefaciens-mediated transformation. 2.5 kb of the LDS
gene, including putative heme ligands of 7,8-LDS, was replaced with SGFP
andTrpC/hphcassettes. ThemodifiedstrainswerecharacterizedbyPCRanal-
ysis, Southern hybridization, and by analysis of enzymatic activity.
The following genetically modified strains of M. oryzae were
studied: deletion of adenylyl cyclase MAC1 gene (⌬mac1) (35);
deletion of the adenylyl cyclase MAC1 gene with a suppressor fragment was cloned, excised (ApaI), and ligated in-frame and
mutation in the cAMP binding domain of the regulatory sub- upstream of SGFP in pGEMgfp/hph (under control of the 7,8-
unit of PKA (⌬mac1 sum1–99 (29)); deletion of the catalytic LDS promotor). Primers MG_F-3Ј-UTR (5Ј-cagagctcTCAA-
subunit of protein kinase A (⌬cpka) (36); deletion of PMK1 GACGGAGAATGGAG) and MG_R-3Ј-UTR (5Ј-gagctc-
(PMK1, pathogenicity MAPK 1) (31); and deletion of the CCGGGAACATCAAAAAGTTCAG) with restriction sites for
MAPK substrate and transcription factor MST12 (32). The SacI (underlined) amplified the last 1206 bp of 7,8-LDS coding
mycelium was ground up in liquid nitrogen and homogenized, sequence and 55 bp of its 3Ј-UTR. This fragment was cloned,
and the supernatant was assayed for enzyme activity with excised (SacI), and ligated into pGEM-5Ј-UTR-gfp/hph, result-
18:2n-6 as substrate (see below). The experiment was per- ing in the gene deletion construct (5Ј-UTR-gfp-hph-3Ј-UTR;
formed in triplicate.
Fig. 2). The construct (4917 bp) was restricted (EcoRI and
Enzyme Assays—Mycelia (0.5–20 g wet weight) of M. oryzae SmaI) and ligated into pCAMB0380, and the plasmid was des-
were incubated in 0.1 M sodium borate buffer (pH 8.0) with ignated pCAMB⌬7,8-LDS. This plasmid was introduced into
0.5–1 mg of fatty acids mlϪ1 (4–5 h, 21 °C), as described previ- chemically competent A. tumefaciens AGL-1 by heat shock.
ously (14). Mycelia were also ground up in liquid nitrogen,
A. tumefaciens-mediated Transformation—Competent A.
and the fine powder was stored at Ϫ80 °C. The nitrogen powder tumefaciens containing pCAMB⌬7,8-LDS was used to trans-
was homogenized (glass-Teflon, 10 passes; 4 °C) in 10 volumes form M. oryzae Guy11 conidia (39). Selection medium agar
(w/v) of 0.1 mM KHPO4 buffer (pH 7.3), 2 mM EDTA, 0.04% consisted of complete medium supplemented with 250 ␮g/ml
Tween 20, centrifuged at 13,000 ϫ g (10 min, 4 °C), and used hygromycin B and with 200 ␮M cefotaxime to eliminate A.
immediately for enzyme assay. Microsomal fractions and high tumefaciens. Transformants were grown individually on selec-
speed supernatants were prepared by centrifugation tion medium in 24-well plates before analysis.
(100,000 ϫ g, 60 min; 4 °C) of low speed supernatant and
Analysis of ⌬7,8-LDS Transformants—Transformants were
assayed for enzyme activity. An aliquot (0.5–1 ml) was incu- analyzed by PCR, Southern blot, and for expression of LDS
bated with 100 ␮M of fatty acids for 30–40 min on ice. In some activity. PCR was used as a first screening to distinguish
experiments, 50 pmol of (13R)-[2H4]HODE was added as an between homologous and nonhomologous recombination.
internal standard. The products were extracted with ethyl ace- Primers F-MG-43646 (5Ј-GGTTGTTTGTAGTACTGCAG-
tate or on SepPak/C18 (19). Triphenylphosphine or NaBH4 was CAGC) and R-SGFP-149 (5Ј-GCAGATGAACTTCAGGTG-
used to reduce hydroperoxides to alcohols to simplify analysis. CAGCTT) amplified a fragment of 1736 bp in transformants
The products from incubations with mycelia were purified by resulting from homologous recombination. This primer pair
TLC (Kieselgel 60, Merck) or by preparative RP-HPLC.
would generate amplicons of different size, or no amplicon at
Gene Replacement Construct—The gene replacement con- all, in ectopic transformants. Primers F-⌬lds (5Ј-AACG-
struct of 7,8-LDS is outlined in Fig. 2. Standard procedures of GCAACGGTATACATCAGAAC-3) and R-⌬lds (5Ј-TATT-
molecular biology methods were used (37). SGFP was excised GCCAAATGTTTGAACGATCGG-3Ј) generated amplicons
from pCAMBgfp (26) with NcoI and NotI and cloned into of 1105 bp in ectopic transformants, because the R-⌬lds primer
ϩ
pGEM5Zf , yielding pGEMgfp. A 1424-bp SalI-fragment from binds to a sequence in the T-DNA of pCAMB⌬7,8-LDS outside
pCAMBgfp containing a hygromycin B resistance cassette of the gene replacement construct. Confirmation of the inte-
(hph, which encodes hygromycin phosphotransferase, con- gration pattern was determined by Southern hybridization (see
trolled by the TrpC promoter) was ligated downstream of SGFP supplemental material). Finally, the deletion mutants of 7,8-
in pGEMgfp (yielding pGEMgfp/hph). The flanking regions of LDS were assayed for enzyme activity, as above.
7,8-LDS (MGG_13239) were obtained by PCR. Genomic DNA
PCR Analysis of Gene Transcripts in M. oryza, the ⌬mac1
was prepared from M. oryzae Guy11 (38). The primers MG_F- Mutant, and the Suppressor Mutant (⌬mac1 sum1–99)—Total
5Ј-UTR (5Ј-gggcccGAATTCTTCTAGCCTGAAGAA-3Ј) and RNA was prepared from nitrogen powder of mycelia (grown for
MG_R-5Ј-UTR (5Ј-atgggcccCGAGCTTTTGGAAGAATG-3) 7–14 days) using LiCl extraction (17) and treated with DNase I.
with restriction sites for ApaI (underlined) amplified 1375 bp of Quality was assessed on the Experion Automated Electro-
5Ј-UTR and the first 87 bp of the coding region of 7,8-LDS. This phoresis System (Bio-Rad). First-strand cDNA was synthesized
5310 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 8•FEBRUARY 19, 2010

Gene Targeting of 7,8-LDS
using Superscript III. Real time PCR was performed in an iCycler deuterated 18:2n-6 were analyzed as described previously (16),
(Bio-Rad) with SYBR Green Supermix. 500 nM forward and and the deuterium content of the recovered 18:2n-6 was deter-
reverse primers and ϳ200 ng of cDNA were used in 50 ␮l. mined (LC-MS/MS analysis; m/z 276–2823 full scan). For
Primers used for the detection of MGG_13239 were 5Ј-AGC- preparative use, we employed a large column (20 ϫ 150-mm
CTTCAACACGTTGATGAAG (forward) and 5Ј-GGAG- Reprosil 100 ODS-A, 5 ␮; Dr. Maisch, Ammerbuch, Germany),
GAACGTCGAGTCCTTG (reverse) and for MGG_10859 eluted with 85–90% methanol in water with 0.1% acetic acid.
were 5Ј-ACCGCGTCTTTGTATCCTTTG (forward) and
Normal phase HPLC with MS/MS analysis was performed in
5Ј-CATCTCGGTGATGGCAATCTG (reverse). Both primers a silicic acid column (5 ␮m; Kromasil 100SI, 250 ϫ 2 mm, Dalco
were designed to bridge an intron to distinguish amplification Chromtech) using 1% isopropyl alcohol in hexane for separa-
of cDNA from any contaminating genomic DNA. Primers for tion of hydroxy fatty acids and 7% isopropyl alcohol in hexane
detection of actin as housekeeping gene (40) were 5Ј-CCTG- for separation of DiHODE (0.3–0.5 ml/min; Constametric
GCACCGTCGTCGATGAAGG and 5Ј-GCGAGGCGAG- 3200 pump, LDC/MiltonRoy). The effluent was combined with
AATGGAACCACCG. Cycling conditions were as follows: isopropyl alcohol/water (3:2; 0.2–0.3 ml/min) from a second
95 °C, 3 min followed by 50 cycles (95 °C, 30 s; 58 °C, 30 s; 72 °C, pump (Surveyor MS pump (16)). The combined effluents were
30 s). Melting point curve analysis and agarose gel electro- introduced by electrospray ionization into the ion trap mass
phoresis verified amplification of one single product of the spectrometer (LTQ, ThermoFisher). Steric analysis of 8-HODE
expected size. Cycle threshold (CT) values were obtained from and 10-HODE was performed by chiral phase HPLC-MS/MS
the iCycler software (Bio-Rad).
(19).
GC-MS analysis, hydrogenation, and synthesis of methyl
Infection Assays—Rice (Oryzae sativa spp. indica var. CO39)
seedlings were grown at 85% relative humidity, 25 °C, and 16-h ester and TMS ether derivatives were performed as described
light/8-h dark photoperiod. Two-week-old plants with second previously (41, 42). Carbon values were estimated from the
and third expanded leaves were used for leaf infection assays. retention times of saturated fatty acid methyl esters (41).
Plants were spray-inoculated with 2 ml of a suspension of 105
RESULTS
conidia/ml with 0.25% gelatin per pot. Symptoms were scored
after 5 days.
7,8-LDS Activity—Mycelia of M. oryzae Guy11 and nitrogen
Root infection assays were carried out using thick and moist powder preparations of mycelia transformed 18:2n-6 to
vermiculite. Wet vermiculite was prepared by immersing in 8-HPODE, 8-HODE, and 7,8-DiHODE as major metabolites
distilled water (2 h), and excess water was then removed by a (Fig. 3A) in agreement with previous reports (14, 43) and to
sieve. We filled a 50-ml Falcon tube with 30 cm of wet vermic- 6,8-DiHODE. 6,8-DiHODE eluted on the left shoulder of 7,8-
ulite, followed by a mycelial plug with the same diameter as the DiHODE but could be separated from the latter by preparative
Falcon tube, a further layer of 5 cm of wet vermiculite, and five LC-MS (Fig. 3B). The relative amounts of these metabolites
rice seeds of the same strain covered with the other 5-cm layer were ϳ5 and ϳ95%, respectively. The MS/MS spectrum of 6,8-
of wet vermiculite. The tube was sealed with parafilm to prevent DiHODE (Fig. 3C) showed structurally important signals at m/z
Ϫ
loss of humidity. Lesions were scored and compared with wild 173 ( OOC-(CH2)4-CHOH-CH2-COH), m/z 155 (173–18),
Ϫ
type strain Guy11 after 15 days.
and m/z 129 ( OOC-(CH2)4-COH). The MS/MS spectrum of
Appressorium Formation—Aliquots (150 ␮l) of conidia sus- 6,8-[U-13C]DiHODE was consistent with this fragmentation
pensions (104 spores/ml) were placed on plastic microscope mechanism.
coverslips (BDH, Germany) and incubated under humid con-
Steric analysis was performed after chemical reduction of
ditions at 25 °C in 16-h light/8-h dark photoperiod. At least 200 HPODE to alcohols. 8-HODE consisted of over 95% of the
conidia per strain were examined microscopically for germina- 8R stereoisomer (supplemental material). We confirmed that
tion and formation of appressoria in each experiment.
(8R)-HPODE was a precursor of 7,8- and 6,8-DiHODE. The
Radial Growth and Asexual Sporulation—Mycelial plugs of absolute configuration of (7,8S)-DiHODE was determined by
M. oryzae Guy11 and ⌬7,8-LDS were placed in triplicates on GC-MS analysis after hydrogenation (Fig. 4A); the designation
agar plates with complete and minimal medium. The fungal 8S in (7S,8S)-DiHODE is due to the hydroxyl at C-7 and the
growth area, and the number of conidia were determined after Cahn-Ingold-Prelog nomenclature rules. The retention time of
10 days (22 °C, fluorescent light as above). The conidia were the biological product was the same as the threo stereoisomer of
harvested as above, and the conidia were counted in a hemocy- 7,8-octadecanoic acid (methyl ester TMS ether derivative, as
tometer and corrected for the fungal growth area.
described in the supplemental material), and only a few percent
LC- and GC-MS Analysis—RP-HPLC with MS/MS analysis of the erythro isomer was detected. The configuration at C-6 of
was performed with a Surveyor MS pump (ThermoFisher) and 6, (8R)-DiHODE was also determined by GC-MS analysis after
an analytical octadecyl silica column (5 ␮m; 2.0 ϫ 150 mm; hydrogenation. The hydrogenated product had the same reten-
Phenomenex), which was usually eluted with methanol/water/ tion time as the anti stereoisomer of 6,8-DiHODE (TMS ether
acetic acid, 800:200:0.05, at 0.3 ml/min. The effluent was sub- methyl ester derivative, supplemental material), as shown in
ject to electrospray ionization in an ion trap mass spectrometer Fig. 4B. This suggested that (6S,8R)-DiHODE was formed. We
(LTQ, ThermoFisher). The heated transfer capillary was set at conclude that both dihydroxymetabolites were formed with
315 °C, the ion isolation width at 1.5, and the collision energy at high stereo selectivity.
25–35 (arbitrary scale). Prostaglandin F1␣ (100 ng/min) was
7,8-LDS activity was present without noticeable differences
infused for tuning. Products formed from stereospecifically in mycelia grown in all studied media as follows: complete and
FEBRUARY 19, 2010•VOLUME 285•NUMBER 8
JOURNAL OF BIOLOGICAL CHEMISTRY 5311

Gene Targeting of 7,8-LDS
minimal media and minimal medium minus glucose or minus
nitrate salts. This suggest that the 7,8-LDS activity is not altered
under nutrient-rich or starvation conditions.
10-DOX, 8,11-LDS, and 5,8-LDS Activities—In addition to
the metabolites discussed above, we also noticed that M. oryzae
formed detectable amounts of 10-HODE, 8,11-DiHODE, and
5,8-DiHODE. 10-HODE was identified by its MS/MS spec-
trum, selective ion monitoring of characteristic MS/MS ions
(m/z 295 3 m/z 155; m/z 295 3 m/z 183), the retention time,
and by comparison with authentic 10-HODE (19). Selective ion
monitoring of 8-HODE (m/z 295 3 m/z 157) and 10-HODE
suggested 10-HODE only constituted a few percent of
(8R)-HODE.
Significant amounts of 8,11-DiHODE were mainly formed by
nitrogen powder of M. oryzae Guy11, and it was a minor prod-
uct (2–3%) compared with (7S,8S)-DiHODE. 8,11-DiHODE
was identified by LC-MS/MS analysis (supplemental material).
Nitrogen powder preparations of mycelia also formed 8,11-
DiHODE from exogenous (8R)-HPODE and from [U-13C]18:
2n-6. The configuration of the hydroxyl at C-11 was S (supple-
mental material). We conclude that (8R,11S)-DiHODE was
formed. Finally, traces of 5,8-DiHODE were detected (Ͻ0.5% of
(7S,8S)-DiHODE) in most experiments (MS/MS spectrum with
the characteristic signals at m/z 115 and m/z 173 at the reten-
tion time of authentic 5,8-DiHODE during RP-HPLC).
Oxygenation Mechanism—The mechanism of biosynthesis
of (8R)-HPODE, (7S,8S)-DiHODE, and (8R,11S)-DiHODE was
studied with (8R)-[2H]18:2n-6, (7R)-[2H]18:2n-6, and (11S)-
[2H]18:2n-6 as substrates with nitrogen powder preparations of
mycelia. The results are summarized in Table 2. The deuterium
labels were retained in both (8R)-HODE and in (7S,8S)-
DiHODE, respectively. This suggested antarafacial hydrogen
abstraction and oxygen insertion at C-8 and suprafacial hydro-
gen abstraction and oxygenation at C-7. (11S)-[2H]18:2n-6
(Ͼ95%) was transformed to (8R,11S)-DiHODE with loss of the
deuterium label, suggesting suprafacial oxygenation at C-11
(Table 2).
Tetranitromethane (30 and 100 ␮M) inhibited the biosynthe-
sis of (8R)-HODE and (7S,8S)-DiHODE dose-dependently
(supplemental material). This finding is in agreement with a key
role of tyrosine radicals for hydrogen abstraction at C-8 (8), as
this reagent will nitrate tyrosine residues.
Nitrogen powder preparations of M. oryzae Guy11 oxi-
dized 18:1n-9 (cis) and 18:3n-3 in analogy with 18:2n-6 to
8-hydroxy- and 7,8-dihydroxymetabolites (supplemental mate-
rial). 20:2n-6 was only oxidized at C-10, suggesting that 20:2n-6
FIGURE 3. RP-HPLC separation with MS/MS analysis of products formed
from 18:2n-6 by M. oryzae Guy11. A, nitrogen powder of M. oryzae was
incubated with (8S)-[2H]18:2n-6, and the major metabolites and unchanged
substrate were analyzed by LC-MS (total ion current). The deuterium content
of the metabolites and recovered 18:2n-6 was determined by MS/MS analysis
(see Table 2). Small amounts of 6,8-DiHODE eluted on the left shoulder of
7,8-DiHODE. B, mycelia were incubated with 18:2n-6, and 6,8- and 7,8-
DiHODE were separated by preparative RP-HPLC and analyzed by MS/MS.
Top, total ion current (m/z 3113full scan); middle, reconstructed ion chro-
matogram for a characteristic ion of 7,8-DiHODE (m/z 173; ϪOOC-(CH2)5-
CHOH-CHO), and bottom, a characteristic ion of 6,8-DiHODE (m/z 127;
ϪOOC-(CH2)4-CHO). C, MS/MS spectrum of 6,8-DiHODE. Inset shows for-
mation of characteristic fragments.
5312 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 8•FEBRUARY 19, 2010

Gene Targeting of 7,8-LDS
FIGURE 5. LC-MS/MS analysis of oxylipins produced by M. oryzae
Guy11 (wild type) and the genetically modified strain, ⌬7,8-LDS. The
top two chromatograms show MS/MS analysis of m/z 3113 m/z 173, a
characteristic fragment of 7,8-DiHODE (ϪOOC-(CH2)5-CHOH-CHO). This
metabolite could not be detected in the mutant ⌬7,8-LDS (ion chromato-
gram magnified 100 times). The bottom two chromatograms show MS/MS
analysis of m/z 295 3 m/z 157, the characteristic fragment of 8-HODE
(ϪOOC-(CH2)6-CHO). This metabolite could be detected only in trace
amounts in mutant ⌬7,8-LDS (ion chromatogram magnified 100 times),
and it could possibly be formed by autoxidation.
entered the catalytic site for dioxygenation “tail first.” 18:1n-9
(trans), 18:3n-6, and 20:4n-6 were not oxidized.
Gene Targeting of 7,8-LDS and Biosynthesis of Oxylipins—
Gene replacement of the 7,8-LDS gene at the MGG_13239
locus (supplemental material) resulted in complete loss of bio-
synthesis of (7S,8S)-DiHODE, which clearly links the M. oryzae
7,8-LDS activity to this gene. The ⌬7,8-LDS mutant incubated
with 18:2n-6 appeared to form trace amounts of 8-HODE (Fig.
5). 8-HPODE can be formed during autoxidation as a minor
product (ϳ1%) in comparison with 9- and 13-HPODE (44).
8-HODE was present only in somewhat larger amounts (ϳ3%),
and we cannot exclude minor enzymatic contribution. Nitro-
gen powder preparations of M. oryzae Guy11 transformed
exogenous (8R)-HPODE to 7,8-, 6,8-, 8,11-, and 5,8-DiHODE,
whereas nitrogen powder preparations of ⌬7,8-LDS did not
form detectable amounts of these products.
FIGURE 4. Steric analysis of (7,8S)-DiHODE and (6,8R)-DiHODE by capil-
laryGC-MS. A, top, chromatogramof(7,8S)-DiHODEmethylesterafterhydro-
genation and silylation with selective ion monitoring of m/z 231. Bottom,
chromatogram of the methyl esters and TMS ether derivatives of erythro and
threo 7,8-hydroxyoctadecanoic acid. As the precursor 8-HPODE has an R con-
figuration, the results show that (7S,8S)-DiHODE was formed. B, top, chromato-
gram shows selective ion chromatogram of 6,8-DiHODE methyl ester after
hydrogenation and silylation with selective ion monitoring of m/z 217. Bot-
tom, selective ion chromatogram of the syn and anti stereoisomers of methyl
6,8-hydroxyoctadecanoate (TMS ether derivative). As the metabolite was
formed from (8R)-HPODE, the results show that (6S,8R)-DiHODE was pro-
duced. The ion intensities were normalized to 100%, as indicated.
Infection Assays—The spray inoculation assays with the
⌬7,8-LDS mutant did not show any differences in frequency or
severity of lesions as compared wild type M. oryzae Guy11. The
⌬7,8-LDS mutant also infected rice roots as the wild type
(Fig. 6). Appressoria formation also appeared to occur without
abnormality in the ⌬7,8-LDS mutant (supplemental material).
The expression of SGFP inserted within the 7,8-LDS coding
sequence was readily detected in mycelia of the ⌬7,8-LDS mutant
by epifluorescence microscopy (supplemental material).
TABLE 2
Transformation of stereospecifically deuterated linoleic acids by
nitrogen powder preparation of mycelia of M. oryzae Guy11
Conidia production and spore morphology of the ⌬7,8-LDS
mutant was not affected. Radial growth and colony morphology
were also unchanged both on complete or minimal media.
Oxylipins Formed by Mutants Implicated in the cAMP-de-
pendent and Mitogen-activated Protein Kinase Cascades—
There are two important signaling pathways required for M.
oryzae appressorium development and leaf penetration as fol-
lows: the PMK1 pathway (31), and the cAMP-activated PKA
pathway (36). Nitrogen powder preparations of M. oryzae
mutants lacking the adenylyl cyclase (⌬mac1), a catalytic sub-
Percent Incorporation of 2H
͓2H͔18:2n-6
Percent 2H
Oxygenated
18:2n-6a
metabolites
%
64
%
57
(8R)-͓2H͔18:2n-6
(7R)-͓2H͔18:2n-6
(11S)-͓2H͔18:2n-6
59% (8R)-8-͓2H͔HODE
59% (8R)-7,8-͓2H͔DiHODE
40% (7R)-8-͓2H͔HODE
41
39
41% (7R)-7,8-͓2H͔DiHODE
Ͻ1% (11S)-8,11-͓2H͔DiHODE
Ͼ95
Ͼ95
a The deuterium content was determined in recovered 18:2n-6 from the experi-
ments to correct for dilution of ͓2H͔18:2n-6 by endogenous 18:2n-6 in the prepa-
rations (cf. Fig. 3A).
FEBRUARY 19, 2010•VOLUME 285•NUMBER 8
JOURNAL OF BIOLOGICAL CHEMISTRY 5313

Gene Targeting of 7,8-LDS
FIGURE 6. Infection of rice leaves and roots. A, leaves and roots infected by
M. oryzae. B, leaves and roots infected by ⌬7,8-LDS.
unit of the PKA (⌬cpka), the PMK1, or the transcription factor
MST12 oxidized 18:2n-6 as did the native M. oryzae Guy11.
The biosynthesis of 6,8-DiHODE and 8,11-DiHODE also
appeared to be unchanged. These results suggest that both
PMK1 and PKA-dependent signaling pathways have no influ-
ence in the 7,8-LDS activity or that their effect was not detect-
able under our experimental conditions.
However, the suppressor mutant (⌬mac1 sum1–99), which
shows cAMP-independent PKA activity due to a mutation in
the regulatory subunit of PKA leading to a partially constitutive
PKA activity (27), formed increased amounts of 10-HPODE,
10-HODE, and 5,8-DiHODE (Fig. 7). Compared with the
⌬mac1 mutant (and to wild type M. oryzae Guy11), the biosyn-
thesis of 10-HODE and 5,8-DiHODE appeared to be aug-
mented ϳ8- and 100-fold, respectively, in the experiment illus-
trated in Fig. 7. LC-MS/MS analysis suggested that 10-HPODE
amounted to ϳ30% of (8R)-HPODE and 5,8-DiHODE to ϳ20%
of (7S,8S)-DiHODE. In other experiments, 5,8-DiHODE and
10-HODE were formed in even larger amounts than (7S,8S)-
DiHODE and (8R)-HODE, respectively. This seems to be
FIGURE 7. LC-MS analysis of products formed from 18:2n-6 by two
mutants of M. oryzae, ⌬mac1 with disruption of adenylate cyclase and
⌬mac1 sum1–99 with augmented PKA activity. A, RP-HPLC-MS/MS analy-
sisofDiHODEformedby⌬mac1sum1–99. Thetopchromatogramshowstotal
ion current (TIC) during MS/MS analysis (m/z 3113 full scan), the middle m/z
3113 m/z 173 (a characteristic ion in the MS/MS spectra of both 7,8-DiHODE
and 5,8-DiHODE), and the bottom chromatogram m/z 3113 m/z 115 (ϪOOC-
(CH2)3-COH; a characteristic ion in the MS/MS spectrum of 5,8-DiHODE). Only
traces of 5,8-DiHODE were formed by ⌬mac1 mutant (data not shown). B, RP-
HPLC-MS/MS analysis of 8- and 10-HODE. The reconstructed ion chromato-
grams for detection of for 8-HODE (m/z 2953157) and 10-HODE (m/z
2953155 (183–18)) in the ⌬mac1 strain. The bottom chromatograms showed
related to an increased growth time of the mycelia but was not an 8-fold relative increase in formation of 10-HODE by the ⌬mac1sum1–99
strain. The ion chromatograms of 10-HODE were magnified 10 times, as
further investigated.
indicated.
Chiral phase HPLC-MS/MS analysis showed that 10-HODE
mainly consisted of the R stereoisomer (ϳ85% R; supplemental
material). Normal phase HPLC-MS/MS analysis showed that expression of the transcripts of MGG_10859, MGG_13239, and
5,8-DiHODE eluted with the same retention time as authentic actin in three strains (Guy11 and two mutants, ⌬mac1 and
(5S,8R)-DiHODE (supplemental material). Finally, we deter- ⌬mac1 sum1–99).
mined that 5,8- and 7,8-LDS activities were present in high
In Guy11 and ⌬mac1 mycelia, transcripts of MGG_13239
speed supernatant of nitrogen powder prepared from mycelia (7,8-LDS) were more (⌬CT ϳ 1.9) and less abundant (⌬CT ϳ
of the ⌬mac1 sum1–99 mutant. 1.9) compared with transcripts of actin. This suggested that
Real Time PCR Analysis—Real time PCR was performed to 7,8-LDS could be down-regulated in ⌬mac1 (⌬CT ϳ 3.8). The
investigate whether the increased formation of (5S,8R)- transcripts of MGG_10859 were less abundant than actin in
DiHODE and (10R)-HPODE in ⌬mac1 sum1–99 strain could Guy11 (⌬CT ϳ 10.6) and ⌬mac1 (⌬CT ϳ 5.7) and thus up-reg-
be due to relative up-regulation of the second gene with homol- ulated in the latter (⌬CT ϳ 4.9). We confirmed that the nitrogen
ogy to 7,8-LDS, MGG_10859. We therefore compared the powder preparations used for RNA extraction oxidized linoleic
5314 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 8•FEBRUARY 19, 2010

Gene Targeting of 7,8-LDS
The genome of M. oryzae con-
tains two genes with homology to
the dioxygenase and P450 domains
of 7,8-LDS of G. graminis. Disrup-
tion of the gene (MGG_13239) with
a deduced protein of 63% amino
acid identity to 7,8-LDS of G. grami-
nis abolished formation of all major
DiHODE both from 18:2n-6 and
from exogenous (8R)-HPODE. It
seems likely that the P450 domain of
7,8-LDS catalyzes isomerization of
(8R)-HPODE to (7S,8S)-DiHODE
in analogy with 7,8-LDS of G. gra-
minis. This hydroperoxide isomer-
ase may not be specific for hydroxy-
lation of C-7, and (6S,8R)-DiHODE
is likely formed in this way.
FIGURE 8. Overview of products formed by 7,8-LDS of M. oryzae Guy11 and the mechanism of biosyn-
thesis. (8R,11S)-DiHODE might be formed by the hydroperoxide isomerase (P450) of 7,8-LDS, as indicated.
(8R,11S)-DiHODE biosynthesis was detected from 18:2n-6 and
from (8R)-HPODE in nitrogen powder preparations of M.
oryzae Guy11 but not in preparations of ⌬7,8-LDS. (8R,11S)-
DiHODE could conceivably be formed by the hydroperoxide
isomerase of 7,8-LDS as a minor by-product. (8R,11S)-DiHODE
was formed by antarafacial dioxygenation at C-8 and suprafacial
hydroxylation at C-7 and C-11. This mechanism of biosynthesis
appears to be a characteristic feature of the family of LDS enzymes
(7, 16, 42). We conclude that the metabolites discussed above can
be formed by 7,8-LDS, as summarized in Fig. 8.
acid to 7,8-DiHODE with insignificant formation of 5,8-Di-
HODE (Ͻ1%), although MGG_10859 mRNA was detected.
In the ⌬mac1 sum1–99 mutant, transcripts of MGG_13239
(7,8-LDS) were detected by real time PCR analysis, but we could
not detect transcripts of MGG_10859 (n ϭ 7; 50 cycles). We
confirmed that the PCR efficiencies for both primer pairs of
MGG_10859 and MGG_13239 were comparable with genomic
DNA as template. We also confirmed that the nitrogen powder
preparation of the ⌬mac1 sum1–99 mutant used for RNA
extraction formed 5,8-DiHODE and 10-HODE as major
metabolites.
⌬7,8-LDS infected rice leaves and roots to the same extent as
native M. oryzae. We found no apparent defects in conidia and
appressoria formation or in radial growth. This might due to alter-
native compensatory pathways, which seem to be common in rice
blast (45). Recent genome analysis suggests that LDS homologues
occur in many filamentous fungi (46), and it may be linked to
housekeeping functions. A protein with homology to LDS is abun-
dant in teliospores of Ustilago maydis and is thought to participate
in the mobilization of stored lipids, although gene deletion of this
protein did not produce a distinct phenotype (47). In contrast,
gene deletion of 5,8-LDS and (10R)-DOX affected biological pro-
cesses of A. fumigatus and A. nidulans (15, 16).
Hydroxylation and Epoxidation of Unsaturated Fatty Acids—
Mycelia of M. oryzae catalyzed ␻2- and/or ␻3-hydroxylation of
all investigated unsaturated fatty acids and oxidation to vicinal
diols also occurred. ␻-Hydroxymetabolites could not be de-
tected. The diols were likely formed by epoxidation of the ter-
minal double bonds of the fatty acids followed by enzymatic
hydrolysis. Over 50% of the fatty acids were typically consumed
in 4–5 h, and these hydroxy- and dihydroxymetabolites were
obtained in significant yields, as judged from TLC analysis.
Experimental details of GC-MS analysis and a summary of the
major metabolites of unsaturated C18-C22 fatty acids are given
in the supplemental material.
Degradation of lipid bodies, activation of lipases, and gener-
ation of glycerol are important steps in formation of the turgor
pressure of appressoria of M. oryzae (27). Protein kinases are
DISCUSSION
We have studied oxygenation of 18:2n-6 by M. oryzae Guy11 important regulators of this process (29–32). Glycogen forma-
and report four major findings. First, gene deletion allowed us tion and lipid degradation occur rapidly in the ⌬mac1 sum1–99
to identify the 7,8-LDS gene (MGG_13239). Second, we could mutant (27). Interestingly, mycelia of ⌬mac1 sum1–99 formed
also determine the metabolites of 18:2n-6 associated with the much larger amounts of (10R)-HPODE and (5S,8R)-DiHODE
7,8-LDS activity, their structures, and mechanism of formation in comparison with the ⌬mac1 mutant and M. oryzae Guy11.
with the aid of stereospecifically deuterated 18:2n-6 and by Could this be due to up-regulation of the second gene product
chiral analysis. Third, gene deletion showed that 7,8-LDS activ- (MGG_10859) with homology to 7,8-LDS?
ity was not critical for sporulation or rice infection. Fourth, a
Transcripts of the two LDS homologues were detected by
suppressor mutant of M. oryzae with cAMP-independent PKA PCR analysis in Guy11 and the ⌬mac1 mutant, and
activity (⌬mac1 sum1–99) transformed 18:2n-6 to two other MGG_10859 mRNA appeared to be up-regulated in the ⌬mac1
major metabolites, (10R)-hydroxy-(8E,12Z)-octadecadienoic mutant. In contrast, MGG_10859 mRNA was not detectable in
acid and (5S,8R)-DiHODE, which were barely detectable in M. the mutant with cAMP-independent PKA activity (⌬mac1
oryzae Guy11 and a mutant of the adenylate cyclase MAC1 gene sum1–99). MGG_10859 could therefore not be linked to bio-
(⌬mac1). These results suggest that (10R)-DOX and 5,8-hy- synthesis of (10R)-HPODE nor (5S,8R)-DiHODE. As shown in
droperoxide isomerase activities could be up-regulated by PKA. Table 1, MGG_10859 did not show specific sequence homology
FEBRUARY 19, 2010•VOLUME 285•NUMBER 8
JOURNAL OF BIOLOGICAL CHEMISTRY 5315

Gene Targeting of 7,8-LDS
8. Su, C., Sahlin, M., and Oliw, E. H. (1998) J. Biol. Chem. 273, 20744–20751
9. Lee, D. S., Nioche, P., Hamberg, M., and Raman, C. S. (2008) Nature 455,
363–368
to any of the listed enzymes, and the homology did not suggest
a specific catalytic activity. Further studies will be needed to
determine its function.
10. Jernere´n, F., Garscha, U., Hoffmann, I. M., and Oliw, E. H. (2010) Biochim.
Biophys. Acta, in press
The genome of M. oryzae contains over 120 CYP genes,
grouped with only a few members per family (5). It is conceiv-
able that 5,8-DiHODE could be formed by any of these P450s of
the suppressor mutant. We found, however, that 5,8-LDS (and
7,8-LDS) activities were present in the high speed supernatant
and negligible in the microsomal fraction, which seems to
exclude microsomal enzymes.
11. Su, C., and Oliw, E. H. (1996) J. Biol. Chem. 271, 14112–14118
12. Ho¨rnsten, L., Su, C., Osbourn, A. E., Garosi, P., Hellman, U., Wernstedt,
C., and Oliw, E. H. (1999) J. Biol. Chem. 274, 28219–28224
13. Garscha, U., and Oliw, E. H. (2008) FEBS Lett. 582, 3547–3551
14. Cristea, M., Osbourn, A. E., and Oliw, E. H. (2003) Lipids 38, 1275–1280
15. Tsitsigiannis, D. I., Kowieski, T. M., Zarnowski, R., and Keller, N. P. (2005)
Microbiology 151, 1809–1821
The P450 domain of 7,8-LDS contains several sequences
with homology to the PKA motif, Arg-Arg-Xaa-(Ser/Thr).
Phosphorylation of P450 at this motif by PKA has so far only
been found to reduce P450 activity without influence on prod-
uct specificity (48). Whether the oxylipin biosynthesis of the
⌬mac1 sum1–99 mutant can be attributed to post-translational
modification of 7,8-LDS merits further investigation.
16. Garscha, U., Jernere´n, F., Chung, D., Keller, N. P., Hamberg, M., and Oliw,
E. H. (2007) J. Biol. Chem. 282, 34707–34718
17. Garscha, U., and Oliw, E. H. (2009) J. Biol. Chem. 284, 13755–13765
18. Brodhun, F., Go¨bel, C., Hornung, E., and Feussner, I. (2009) J. Biol. Chem.
284, 11792–11805
19. Garscha, U., and Oliw, E. H. (2007) Anal. Biochem. 367, 238–246
20. Champe, S. P., and el-Zayat, A. A. E. (1989) J. Bacteriol. 171, 3982–3988
21. Dagenais, T. R., Chung, D., Giles, S. S., Hull, C. M., Andes, D., and Keller,
N. P. (2008) Infect. Immun. 76, 3214–3220
Mycelia of M. oryzae also oxidized medium and long chain
polyunsaturated fatty acids by hydroxylation and epoxidation,
as summarized in the supplemental material. CYP102 of Bacil-
lus megaterium is the prototype microbiological fatty acid ␻2-
and ␻3-hydroxylase and fatty acid epoxygenase (49). Blast
search with CYP102 revealed three homologous hypothetical
enzymes (numbers 3–5) of the CYP505A family in M. oryzae.
Further studies will be needed to link CYP505 of M. oryzae to
fatty acid oxygenation in the same way as the terminal oxygen-
ases of Fusarium oxysporum were linked to CYP404 (50).
Recent studies of Talbot and co-workers (28) showed that per-
oxisomal ␤-oxidation is essential for M. oryzae during appres-
sorium-mediated rice infection, and the lipid bodies of spores
may provide the fuel for the ␤-oxidation.
22. Tsitsigiannis, D. I., and Keller, N. P. (2006) Mol. Microbiol. 59, 882–892
23. Cook, R. J. (2003) Physiol. Mol. Plant Pathol. 62, 73–86
24. Cannon, P. F. (1994) Systema Ascomycetum 13, 25–42
25. Talbot, N. J., and Foster, A. J. (2001) Adv. Bot. Res. 34, 263–287
26. Sesma, A., and Osbourn, A. E. (2004) Nature 431, 582–586
27. Thines, E., Weber, R. W., and Talbot, N. J. (2000) Plant Cell 12, 1703–1718
28. Wang, Z. Y., Soanes, D. M., Kershaw, M. J., and Talbot, N. J. (2007) Mol.
Plant Microbe Interact. 20, 475–491
29. Adachi, K., and Hamer, J. E. (1998) Plant Cell 10, 1361–1374
30. Mitchell, T. K., and Dean, R. A. (1995) Plant Cell 7, 1869–1878
31. Xu, J. R., and Hamer, J. E. (1996) Genes Dev. 10, 2696–2706
32. Park, G., Xue, C., Zheng, L., Lam, S., and Xu, J. R. (2002) Mol. Plant
Microbe Interact. 15, 183–192
33. Foster, A. J., Jenkinson, J. M., and Talbot, N. J. (2003) EMBO J. 22, 225–235
34. Ou, S. (1985) Rice Diseases, CAB International, Kew, UK
35. Choi, W., and Dean, R. A. (1997) Plant Cell 9, 1973–1983
36. Xu, J. R., Urban, M., Sweigard, J. A., and Hamer, J. E. (1997) Mol. Plant
Microbe Interact. 10, 187–194
In summary, we report the first studies on the biological
function of 7,8-LDS in M. oryzae, an important fungal grass
pathogen and model organism. We identified the 7,8-LDS gene
(MGG_13239) and determined the structure and mechanism of
formation of metabolites. Gene deletion showed that 7,8-LDS
was not critical for sporulation nor for rice infection. PKA,
which has profound effects on these processes, augmented for-
mation of two previously unrecognized oxylipins of M. oryzae,
37. Davis, L., Kuehl, M., and Battey, J. (1994) Basic Methods in Molecular
Biology, pp. 1–304, Appleton and Lange, Norwalk
38. Talbot, N. J. (2001) in Molecular and Cellular Biology of Filamentous
Fungi (N. Talbot, ed) pp. 25–26, Oxford University Press, Bath
39. Rho, H. S., Kang, S., and Lee, Y. H. (2001) Mol. Cells 12, 407–411
40. Carbone, I., and Kohn, L. M. (1999) Mycologia 91, 553–556
(5S,8R)-DIHODE and (10R)-HPODE. We conclude that M. 41. Oliw, E. H., Stark, K., and Bylund, J. (2001) Biochem. Pharmacol. 62, 407–415
42. Wadman, M. W., van Zadelhoff, G., Hamberg, M., Visser, T., Veldink,
oryzae can oxidize to 18:2n-6 to a more complex set of oxylipins
G. A., and Vliegenthart, J. F. (2005) Lipids 40, 1163–1170
than previously anticipated.
43. Oliw, E. H., Su, C., Skogstro¨m, T., and Benthin, G. (1998) Lipids 33, 843–852
44. Haslbeck, F., Grosch, W., and Firl, J. (1983) Biochim. Biophys. Acta 750,
185–193
REFERENCES
1. Wilson, R. A., and Talbot, N. J. (2009) Nat. Rev. Microbiol. 7, 185–195
2. Skamnioti, P., and Gurr, S. J. (2009) Trends Biotechnol. 27, 141–150
3. Ribot, C., Hirsch, J., Balzergue, S., Tharreau, D., Notte´ghem, J. L., Lebrun,
M. H., and Morel, J. B. (2008) J. Plant Physiol. 165, 114–124
4. Dean, R. A., Talbot, N. J., Ebbole, D. J., Farman, M. L., Mitchell, T. K.,
Orbach, M. J., Thon, M., Kulkarni, R., Xu, J. R., Pan, H., Read, N. D., Lee,
Y. H., Carbone, I., Brown, D., Oh, Y. Y., Donofrio, N., Jeong, J. S., Soanes,
D. M., Djonovic, S., Kolomiets, E., Rehmeyer, C., Li, W., Harding, M., Kim,
S., Lebrun, M. H., Bohnert, H., Coughlan, S., Butler, J., Calvo, S., Ma, L. J.,
Nicol, R., Purcell, S., Nusbaum, C., Galagan, J. E., and Birren, B. W. (2005)
Nature 434, 980–986
45. Oh, Y., Donofrio, N., Pan, H., Coughlan, S., Brown, D. E., Meng, S., Mitch-
ell, T., and Dean, R. A. (2008) Genome Biol. 9, R85
46. Soanes, D. M., Alam, I., Cornell, M., Wong, H. M., Hedeler, C., Paton,
N. W., Rattray, M., Hubbard, S. J., Oliver, S. G., and Talbot, N. J. (2008)
PLoS ONE 3, e2300
47. Huber, S. M., Lottspeich, F., and Ka¨mper, J. (2002) Mol. Genet. Genomics
267, 757–771
48. Oesch-Bartlomowicz, B., and Oesch, F. (2003) Arch. Biochem. Biophys.
409, 228–234
49. Capdevila, J. H., Wei, S., Helvig, C., Falck, J. R., Belosludtsev, Y., Truan, G.,
Graham-Lorence, S. E., and Peterson, J. A. (1996) J. Biol. Chem. 271,
22663–22671
5. Deng, J., Carbone, I., and Dean, R. A. (2007) BMC Evol. Biol. 7, 30
6. Brodowsky, I. D., Hamberg, M., and Oliw, E. H. (1992) J. Biol. Chem. 267,
14738–14745
7. Hamberg, M., Zhang, L. Y., Brodowsky, I. D., and Oliw, E. H. (1994) Arch.
Biochem. Biophys. 309, 77–80
50. Kitazume, T., Takaya, N., Nakayama, N., and Shoun, H. (2000) J. Biol.
Chem. 275, 39734–39740
51. Couch, B. C., and Kohn, L. M. (2002) Mycologia 94, 683–693
5316 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 8•FEBRUARY 19, 2010

This paper is available online at www.jbc.org
ADDITIONS AND CORRECTIONS
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 26, p. 20422, June 25, 2010
© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
VOLUME 285 (2010) PAGES 5308–5316
DOI 10.1074/jbc.A109.062810
VOLUME 285 (2010) PAGES 13507–13516
DOI 10.1074/jbc.A109.049411
Gene deletion of 7,8-linoleate diol synthase of the rice
blast fungus. STUDIES ON PATHOGENICITY,
Direct ubiquitination of ␤-catenin by Siah-1 and
regulation by the exchange factor TBL1
STEREOCHEMISTRY, AND OXYGENATION MECHANISMS.
Fredrik Jernere´n, Ane Sesma, Marina Franceschetti, Mats Hamberg,
and Ernst H. Oliw
Yoana N. Dimitrova, Jiong Li, Young-Tae Lee, Jessica Rios-Esteves,
David B. Friedman, Hee-Jung Choi, William I. Weis, Cun-Yu Wang,
and Walter J. Chazin
The Acknowledgment section was inadvertently deleted from the
article. It should read as follows.
Dr. Franceschetti’s name was misspelled. The correct spelling is
shown above.
VOLUME 285 (2010) PAGES 14514–14520
DOI 10.1074/jbc.A109.076695
Acknowledgments—We thank S. Meyn, D. Morin, C. Thorn, S. Bhat-
tacharya, A. Morin, and G. Schneider for assistance, helpful discus-
sions, and valuable advice, S. Matsuzawa for Myc-Siah-1 plasmid, K.
Gould for His-UbcH5a expression vector, S. Soss for assistance in
NMR data collection, the Protein User’s Club (Vanderbilt University)
for the expression of TBL1, and S. Hiebert, M. Ohi, and B. Schulman
for critical reading of the manuscript.
Agonist-selective dynamic compartmentalization of
human mu opioid receptor as revealed by resolutive
FRAP analysis.
Aude Saulie`re-Nzeh Ndong, Claire Millot, Maithe´ Corbani, Serge Maze`res,
Andre´ Lopez, and Laurence Salome´
Dr. Saulie`re-Nzeh Ndong’s name was misprinted. The author’s name
is shown correctly above.
We suggest that subscribers photocopy these corrections and insert the photocopies in the original publication at the location of the original
article. Authors are urged to introduce these corrections into any reprints they distribute. Secondary (abstract) services are urged to carry
notice of these corrections as prominently as they carried the original abstracts.
20422 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 26•JUNE 25, 2010

Lipids:
Gene Deletion of 7,8-Linoleate Diol
Synthase of the Rice Blast Fungus:
STUDIES ON PATHOGENICITY,
STEREOCHEMISTRY, AND
OXYGENATION MECHANISMS
Fredrik Jernerén, Ane Sesma, Marina
Francheschetti, Mats Hamberg and Ernst H.
Oliw
J. Biol. Chem. 2010, 285:5308-5316.
doi: 10.1074/jbc.M109.062810 originally published online December 20, 2009
Access the most updated version of this article at doi: 10.1074/jbc.M109.062810
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2010/01/07/M109.062810.DC1.html
Supplemental material:
http://www.jbc.org/content/suppl/2010/01/15/M109.062810.DC2.html
This article cites 47 references, 19 of which can be accessed free at
http://www.jbc.org/content/285/8/5308.full.html#ref-list-1