Synthesis and Biological Evaluation of Novel 1-(4-(Hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-phenylurea Derivatives

Article abstract of DOI:10.1002/cbdv.201700223

A series of novel phenylurea containing 2-benzoylindan-1-one derivatives 3a?–?3j were synthesized from the reaction of phenylurea-substituted acetophenones 1a?–?1j with phthalaldehyde 2 under mild reaction conditions in good yields. All synthesized compou

Full text of DOI:10.1002/cbdv.201700223

Article Type: Full Paper
Synthesis and Biological Evaluation of Novel 1-(4-(Hydroxy(1-oxo-1,3-dihydro-2H-
inden-2-ylidene)methyl)phenyl)-3-phenylurea Derivatives
Hayreddin Gezegen,*a Ceylan Hepokur,b Uğur Tutar,a and Mustafa Ceylanc
aDepartment of Nutrition and Dietetics, Faculty of Health Sciences, Cumhuriyet University, 58140 Sivas,
Turkey
bDepartment of Biochemistry, Faculty of Pharmacy, Cumhuriyet University, 58140 Sivas, Turkey
cDepartment of Chemistry, Faculty of Arts and Sciences, Gaziosmanpasa University, 60250 Tokat, Turkey
(Phone: +90 346 219 1010; Fax: +90 346 219 1261; e-mail: gezegenh@cumhuriyet.edu.tr)
A series of novel phenylurea containing 2-benzoylindan-1-one derivatives 3a-j were synthesized from the
reaction of phenylurea-substituted acetophenones 1a-j with phthalaldehyde 2 under mild reaction conditions in
good yields. All synthesized compounds were characterized by spectroscopic methods. The obtained
compounds (3a-j) were evaluated for anticancer activity against HeLa and C6 cell lines. Antiproliferative
activity was determined by the BrdU proliferation ELISA assay, 3f and 3g were found to be most active
compounds. The compounds were also screened for antimicrobial activity and all compounds showed
remarkable activity against used microorganisms.
Keywords: 2-Benzoylindan-1-one, Phenylurea, Anticancer, Apoptosis, Antimicrobial
Introduction
Cancer is a pathological condition that occurs in a genetic and developmental process,
which is caused by losing the cells excessive proliferation and apoptosis functions. According
to World Health Organization data, 63% of non-communicable disease-related deaths are
associated with cancer. Some types of cancer cause death and for this reason cancer is one of
the most investigated health problems for treatment. Cancer types that cause the most deaths
are reported to be lung, stomach, colon, liver and breast cancers [1-4]. Chemotherapy is a
frequent method of fighting cancer. Thus, studies involving the synthesis of new compounds
and the investigation of their bioactive potentials have made significant contributions to the
development of new cancer drugs [5].
This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: 10.1002/cbdv.201700223
This article is protected by copyright. All rights reserved.

1,3-Diketones have an important place in the organic and medicinal chemistry as a
synthetic building block [6-8]. These compounds play a leading role in the synthesis of many
heterocyclic and bioactive compounds [9-11]. High reactivity of 1,3-diketones allow
molecular diversity in the synthesis of organic and natural compounds. For example,
pyrazoles [8,12], pyrroles [13,14], pyrimidines [15,16], furans [17,18], chromenes [19],
xanthenes [20,21], isocoumarins [22,23], pyranones [24] and sulfur-containing heterocycles
[25] can be synthesized from the 1,3-diketones. In the literature, 1,3-diketones have been
reported as having potential uses as catalyst [26], anticancer I [27], antibacterial II [28],
antifungal, antioxidant III [29] (Figure 1), OLED [30], liquid crystal [31], UV filter [32],
fluorescent [33] and photoluminescent [34] materials in several studies.
On the other hand, among the compounds exhibiting biological activity, it known that
compounds containing the diarylurea unit have a broad spectrum of activity [35,36]. There
are many studies in the literature that reveal antimicrobial [37], anticonvulsant [38], anti-
inflammatory [39], antiplasmodial [40], antidepressant [41], antiviral [42], antituberculosis
[43] and cytotoxic [44] activities of the diarylurea containing compounds. Also sorafenib IV
and linifanib V [45, 46], which are used in the treatment of cancer, are good examples of
bioactive compounds containing the diarylurea unit (Figure 2). For this reason, diarylurea
motif is an important pharmacophore and it is widely used in the development of novel
polyfunctional compounds or drugs [47].
In the light of this information, we synthesized novel 1-(4-(hydroxy(1-oxo-1,3-
dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-phenylurea derivatives 3a-j, which are 1,3-
diketone and diphenylurea motif, by the reaction of phenylurea substituted acetophenones 1a-
j with phthalaldehyde 2 in basic medium. The structures of the synthesized compounds were
1
characterized by H-NMR, 13C-NMR, 2D-NMR, IR, and HPLC-TOF/MS analysis studies.
Anticancer activity of the compounds was examined against C6 and HeLa cell lines, and
antimicrobial activity of the compounds was investigated against nine microorganisms.
Results and Discussion
Herein, we report synthesis of 1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)-3-phenylurea derivatives 3a-j in high yields from reaction of 1-(4-
acetylphenyl)-3-phenylurea derivatives 1a-j with phthalaldehyde 2 in basic medium (Scheme
1) (Table 1). The starting compounds of 1-(4-acetylphenyl)-3-phenylurea derivatives 1a-j
This article is protected by copyright. All rights reserved.

were prepared by treatment of related isocyanates with 4'-aminoacetophenone in toluene at
reflux conditions (Scheme 1).
The structures of synthesized 1,3-diketones 3a-j were determined by spectroscopic
studies (1H-, 13C-, 2D-NMR, IR, and HPLC-TOF/MS). The analysis of NMR spectra showed
that the compounds 3a-j were present in enol form in high proportion. Therefore, NMR data
of 3a-j were given according to the enol form. The full analysis of HSQC and HMBC spectra
of 3a confirmed the presence of 1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)-3-phenylurea structure (Figure 3) (Table 2).
In the 1H NMR spectrum of 3a the hydroxyl proton of enol form gave a broad singlet
at δ 15.35 ppm. The amide protons of urea unit -NHa and -NHb gave a singlet at δ 9.11 and
8.78 ppm respectively. The methylene protons H2-C(4) on indanone unit gave a singlet at δ
3.99 ppm. All the aliphatic and aromatic signals in the spectrum were consistent with the
structure of 3a.
The anticancer activities of 3a-j were investigated on human epithelial carcinoma
(HeLa) and rattus norvegicus brain glioma (C6) cell lines at 24 hours. HeLa and C6 cell lines
were purchased from ATCC. The results were compared with 5-FU that was used as positive
control and given Table 3. According to Table 3, the compound 3g, which contains two
trifluoromethyl groups, against the HeLa cell line is the most active compound (IC50
=
5.70±0.98 µg/mL) and has considerably higher activity than 5-FU (IC50 = 8.30±0.76 µg/mL).
Moreover, 3g has a significant level of activity against the C6 cell line (IC50 = 9.39±0.68
µg/mL), although not as much as 5-FU (IC50 = 7.73±0.76 µg/mL). The compound 3f exhibits
higher activity (IC50 = 7.42±1.87 µg/mL) according to 5-FU against the HeLa cell line, and a
lower activity against C6 cell line (IC50 = 8.87±0.05 µg/mL) than 5-FU. Compound 3b has an
activity close to that of 5-FU against HeLa cell line (IC50 = 8.62 ±1.2 µg/mL) whereas it has
approximately two times less activity (IC50 = 16.99±1.24 µg/mL) against the C6 cell line than
5-FU. Other compounds do not have a significant activity against the cell lines used in the
study. It is seen that when the synthesized compounds are taken into consideration, the
presence of the trifluoromethyl group at the para position or the both meta position on phenyl
ring contribute to enhancing activity (Table 3).
This article is protected by copyright. All rights reserved.

The antiproliferative activity for the 3a-j was determined by the BrdU proliferation
ELISA assay. Compound 3f has an antiproliferative effect (35-43%) higher than 5-FU against
the C6 cell line, whereas it does not exhibit sufficient antiproliferative activity against the
HeLa cell line (Figure 4). As shown in Figure 5, compound 3g exhibits an inhibition of about
80% against both cell lines. Other compounds did not have any antiproliferative activity (p
<0.05).
Expression levels of Bcl-2 genes, known to be associated with apoptosis in both cells,
were investigated by quantitative Real Time PCR to elucidate the molecular mechanisms of
apoptosis observed in HeLa and C6 cells. When cells respond to an apoptotic stimulus, an
internal and external apoptotic pathway activates. The Bcl-2 protein family, which is
involved in the internal pathway, has an important role in regulating apoptosis. Anti-apoptotic
proteins such as Bcl-2 inhibit apoptosis. According to the results of our experiments to
determine anti-apoptotic protein Bcl-2 levels in the light of this information, the synthesized
compounds has no effect on the anti-apoptotic mechanism at HeLa and C6 cell levels.
Interaction of the receptor and adapter proteins results in a protein complex called the
death-triggering signaling complex (DISC). This death complex divides procaspase-8 into
two different sized fractions, providing the formation of active caspase-8 and caspase-9
called initiator caspases [48]. Activated caspase-8 and caspase-9 leads to the activation of
caspase-3, caspase-6 and caspase-7, which are proenzymes in the inactive state, in the form
of a chain [49]. All activated caspases cleave cell macromolecules, leading to the formation
of typical apoptosis morphology. The antiproliferations of 3f and 3g were observed to be
highly toxic. These compounds are not apoptotic because they kill the cells (Figure 6).
In addition, 3a-j were screened for their in vitro antimicrobial activities by serial
microdilution method against four gram-negative bacteria (Klebsiella pneumoniae ATCC
10031, Shigella boydii ATCC 9905, Escherichia coli ATCC 11229, Proteus vulgaris ATCC
7829), three gram-positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus
faecalis ATCC 29212, Bacillus cereus ATCC 10987) and two yeasts (Candida albicans
ATCC 10231, Candida tropicalis ATCC 750). Piperacillin/Tazobactam (8:1) and
Flucanozole were used as positive control. The determined MIC (minimum inhibitory
concentrations) values of the 3a-j are given in the Table 4.
This article is protected by copyright. All rights reserved.

According to the test results, all compounds showed remarkable activity against used
microorganisms. All compounds demonstrated same activity with antibiotic against
Klebsiella pneumoniae ATCC 10031 (P/T = 31.3 μg/mL). Against Shigella boydii ATCC
9905, compound 3a, 3b, 3c, 3e, 3f and 3j showed activity at lower concentration (31.3
μg/mL) than positive control, while other compounds 3d, 3g, 3h, and 3i exhibited activity at
the same level with positive control (P/T = 62.5 μg/mL). Compounds 3a, 3b, 3e and 3j
showed significant activity against Escherichia coli ATCC 11229 at 31.3 µg/mL
concentration (P/T = 15.6 µg/mL). The most active compound against Proteus vulgaris
ATCC 7829 is 3j, which showed activity at the same concentration as the antibiotic (P/T =
31.3 µg/mL). Compound 3j has a better activity level than the positive control with 31.25
μg/mL against Staphylococcus aureus ATCC 25923. Other compounds showed activity at
the same concentration with positive control (P/T = 62.5 μg/mL). Compounds 3c, 3d, 3e, 3g,
3h and 3j showed significant activity at 31.25 μg/ml against Enterococcus faecalis ATCC
29212 (P/T = 62.5 μg/mL). All compounds showed better activitiy than positive control
against Bacillus cereus ATCC 10987 and the most active compounds were found 3a, 3b, 3c,
3d, 3e, 3f, 3g and 3j at 31.3 µg/mL concentration. Compound 3h and 3i showed activitiy at
62.5 µg/mL concentration (P/T = 62.5 μg/mL). Also, all the compounds 3a-j showed the
same activity (31.3 µg/mL) against Candida albicans ATCC 10231 and Candida tropicalis
ATCC 750 yeasts (Flu. = 15.6 μg/mL) (Table 4).
Conclusions
In conclusion,
a
series of novel 1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)-3-phenylurea derivatives (3a-j) have been synthesized from the
phenylurea substituted asetophenone derivatives (1a-j) in high yields (73-85%). The
structures of new compounds were established on the basis of spectroscopic methods. In
addition, anticancer (on C6 and HeLa cell lines) and antimicrobial properties of the 3a-j were
investigated. The compounds 3f and 3g showed remarkable anticancer activity compared to
5-FU. All of the compounds exhibited antimicrobial activity. The obtained compounds 3a-j
have potential use in the synthesis of new heterocyclic and bioactive compounds.
This article is protected by copyright. All rights reserved.

Experimental Section
General
Melting points were measured on an Electrothermal 9100 apparatus. IR spectra (KBr disc)
1
13
were recorded on a Jasco FT/IR-430 spectrometer. H and C NMR spectra were recorded
on a Agilent 600 MHz Premium COMPACT NMR instrument in DMSO-d6 at rt; δ in ppm
relative to TMS, with J in hertz (Hz). The multiplicities of the signals in the 1H NMR spectra
are abbreviated by s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad), and
combinations thereof. Agilent Technology of 1260 Infinity HPLC System was coupled with
6210 Time of Flight (TOF) LC/MS detector and ZORBAX SB-C18 (4.6 x 100 mm, 3.5 μm)
column. Anhydrous sodium sulfate was used as a drying agent for the organic phase.
General procedure for the synthesis of 1a-j
To a solution of 4’-aminoacetophenone (20 mmol) in toluene (150 mL) was added related
isocyanate (20 mmol) and the mixture was refluxed for 3h. Brown precipitate formed in the
reaction result was filtered and dried. The obtained crude product was recrystallized from
DMSO. Three of the synthesized starting materials 1e, 1h, 1i are new and others are known
(1a [50,51], 1b [51], 1c [52], 1d [51], 1f [53], 1g [54], 1j [55]) in the literature.
1-(4-acetylphenyl)-3-(3-(trifluoromethyl)phenyl)urea (1e). Brown solid; yield 80%; mp
207-210 °C; IR (KBr, cm-1) 3367, 3300, 3193, 3112, 3065, 2889, 1719, 1648, 1595, 1563,
1529, 1493,1413, 1367, 1341, 1325, 1267, 1234, 1200, 1175, 1157, 1120, 1068, 961, 832,
696, 655. 1H NMR (600 MHz, DMSO-d6) δ 9.18 (s, 1H), 9.14 (s, 1H), 8.01 (s, 1H), 7.89 (d, J
13
= 6.9 Hz, 2H), 7.59 (m, 3H), 7.50 (bs, 1H), 7.30 (m, 1H), 2.49 (s, 3H). C NMR (151 MHz,
DMSO-d6) δ 196.6, 152.6, 144.4, 140.6, 131.1, 130.3, 130.0 (2C), 130.0 (q, J = 31.4 Hz),
124.6 (q, J = 272.2), 122.48, 118.8 (d, J = 3.6 Hz), 117.84 (2C), 114.8 (q, J = 3.8 Hz) 26.71.
+
HPLC-TOF/MS: 323.1056 ([M+H]+, C16H14F3N2O2 ; calc. for 323,1002).
1-(4-acetylphenyl)-3-(4-chloro-3-(trifluoromethyl)phenyl)urea (1h). Brown solid; yield
80%; mp 257-260 °C; IR (KBr, cm-1) 3330, 3258, 3157, 2950, 2886, 1649, 1590, 1552, 1479,
1
1421, 1326, 1317, 1257, 1233, 1178, 1128, 1035, 977, 831, 729, 629. H NMR (600 MHz,
DMSO-d6) δ 9.23 (s, 1H), 9.22 (s, 1H), 8.08 (s, 1H), 7.89 (d, J = 7.6 Hz, 2H), 7.63 (d, J = 7.6
13
Hz, 1H), 7.58 (m, 3H), 2.49 (s, 3H). C NMR (151 MHz, DMSO-d6) δ 196.7, 152.5, 144.2,
This article is protected by copyright. All rights reserved.

139.4, 132.4, 131.2, 130.0 (2C), 127.2 (q, J = 30.6 Hz), 123.7, 123.2 (q, J = 272.9 Hz),123.1,
117.9 (2C), 117.4 (q, J = 5.6 Hz), 26.74. HPLC-TOF/MS: 357.0667 ([M+H]+,
+
C16H13ClF3N2O2 ; calc. for 357,0612).
1-(4-acetylphenyl)-3-(3-chloro-4-methylphenyl)urea (1i). Brown solid; yield 87%; mp
222-225 °C; IR (KBr, cm-1) 3369, 3288, 3193, 3107, 3061, 2976, 1717, 1647, 1588, 1525,
1
1495, 1360, 1304, 1281, 1266, 1237, 1189, 1167, 1045, 963, 912, 839, 828, 681, 596. H
NMR (600 MHz, DMSO-d6) δ 9.09 (s, 1H), 8.85 (s, 1H), 7.88 (d, J = 7.2 Hz, 2H), 7.67 (s,
1H), 7.56 (d, J = 7.2 Hz, 2H), 7.30 – 7.10 (m, 2H), 2.49 (s, 3H), 2.24 (s, 3H). 13C NMR (151
MHz, DMSO-d6) δ 196.68, 152.51, 144.59, 138.91, 133.57, 131.61, 131.00, 130.04 (2C),
129.11, 118.83, 117.70 (2C), 117.64, 26.75, 19.25. HPLC-TOF/MS: 303.0820 ([M+H]+,
+
C16H16ClN2O2 ; calc. for 303,0895).
General procedure for the synthesis of 3a-j
To a solution of 1a-j (10 mmol) in EtOH (70 mL) was added NaOH (2.5 M, 5 mL) and the
mixture was stirred until dissolved completely of 1a-j. Then to this mixture was added a
solution of phthalaldehyde 2 (10 mmol) in EtOH (30 mL) and it was stirred at room
temperature for 4h. Yellow precipitate that formed in the reaction result was transferred to a
beaker contain 200 mL of water and then diluted HCl (10%, 30 mL) added to this mixture.
The obtained product was filtered in vacuum, dried and crystallized from DMSO.
1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-phenylurea (3a).
Yellow solid; yield 78%; mp 262-265 °C; IR (KBr, cm-1) 3511, 3292, 3048, 2899, 1638,
1593, 1576, 1546, 1499, 1443, 1406, 1372, 1304, 1222, 1170, 1092, 881, 850, 745, 738, 692,
1
656. H NMR (600 MHz, DMSO-d6) keto-enol (24:76), enol tautomer: δ 15.35 (bs, -OH),
9.11 (s, -NHa), 8.78 (s, -NHb), 7.95 (d, J = 8.8 Hz, H-C(2a), H-C(6a)), 7.76 (d, J = 7.6 Hz, H-
C(2b)), 7.68-7.59 (m, H-C(3a), H-C(5a), H-C(3b), H-C(5b)), 7.48 (d, J = 7.9 Hz, H-C(2c), H-
C(6c)), 7.47-7.40 (m, H-C(4b)) 7.29 (t, J = 7.9 Hz, C(3c), H-C(5c)), 6.98 (t, J = 7.3 Hz, H-
C(4c)), 3.99 (s, H1,2-C(4)). 13C NMR (151 MHz, DMSO-d6) δ 194.6 (C(1)), 171.1 (C(3)),
152.6 (C(5)), 149.0 (C(6b)), 143.7 (C(4a)), 139.7 (C(1c)), 137.5 (C(1b)), 133.7 (C(3b)), 129.8
(C(2a), C(6a)), 129.2 (C(3c), C(5c)), 127.8 (C(4b)), 127.2 (C(1a)), 126.3 (C(5b)), 123.0 (C(2b)),
122.6 (C(4c)), 118.8 (C(2c), C(6c)), 118.0 (C(3a), C(5a)), 109.0 (C(2)), 32.3 (C(4)). HPLC-
+
TOF/MS: 371.1244 ([M+H]+, C23H19N2O3 ; calc. for 371,1390).
This article is protected by copyright. All rights reserved.

1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-(4-
methoxyphenyl)urea (3b). Yellow solid; yield 80%; mp 277-280 °C; IR (KBr, cm-1) 3493,
3408, 3289, 3045, 2938, 2900, 2833, 1595, 1549, 1510, 1467, 1406, 1371, 1299, 1230, 1173,
1029, 880, 829, 740, 656. 1H NMR (600 MHz, DMSO-d6) keto-enol (42:58), enol tautomer: δ
15.41 (s, 1H), 9.22 (s, 1H), 8.76 (s, 1H), 8.02 (d, J = 7.4 Hz, 1H), 7.95 (d, J = 7.4 Hz, 2H),
7.68 -7.60 (m, 4H), 7.50-7.47 (m, 1H), 7.37 (d, J = 8.2 Hz, 2H), 6.87 (d, J = 7.8 Hz, 2H),
4.03 (s, 2H), 3.71 (s, 3H). 13C NMR (151 MHz, DMSO-d6) δ 194.6, 171.2, 155.1, 152.8,
149.0, 144.0, 137.5, 133.8, 132.7, 129.8 (2C), 128.1, 127.3, 126.4, 123.0, 120.6 (2C), 117.9
+
(2C), 114.4 (2C), 109.0, 55.6, 32.3. HPLC-TOF/MS: 401.1370 ([M+H]+, C24H21N2O4 ; calc.
for 401,1496).
1-(4-fluorophenyl)-3-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)urea (3c). Yellow solid; yield 85%; mp 277-280 °C; IR (KBr, cm-1)
3289, 3048, 2993, 2890, 2820, 1633, 1594, 1547, 1508, 1466, 1407, 1371, 1304, 1212, 1169,
1
1092, 995, 883, 834, 742, 655. H NMR (600 MHz, DMSO-d6) keto-enol (42:58), enol
tautomer: δ 15.43 (s, 1H), 9.24 (s, 1H), 8.95 (s, 1H), 8.03 (d, J = 8.6 Hz, 1H), 7.96 (d, J = 8.5
13
Hz, 2H), 7.64 (m, 4H), 7.48 (m, 3H), 7.13 (t, J = 8.3 Hz, 2H), 4.03 (s, 2H). C NMR (151
MHz, DMSO-d6) δ 194.2, 171.2, 157.9 (d, J = 238.6 Hz), 152.7, 149.0, 143.7, 137.5, 136.1
(d, J = 2.3 Hz), 133.8, 129.8 (2C), 127.2, 126.4, 124.1, 123.1, 120.6 (d, J = 8.0 Hz, 2C),
118.0 (2C), 115.8 (d, J = 22.2 Hz, 2C), 109.0, 32.3. HPLC-TOF/MS: 389.1197 ([M+H]+,
+
C23H18FN2O3 ; calc. for 389,1296).
1-(4-chlorophenyl)-3-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)urea (3d). Yellow solid; yield 84%; mp 292-295 °C; IR (KBr, cm-1)
3461, 3289, 3046, 2998, 2899, 1641, 1611, 1590, 1545, 1488, 1467, 1406, 1396, 1301, 1223,
1169, 1090, 1011, 882, 832, 816, 739, 654.1H NMR (600 MHz, DMSO-d6) keto-enol (41:59),
enol tautomer: δ 15.41 (s, 1H), 9.20 (s, 1H), 8.98 (s, 1H), 8.03 (d, J = 8.2 Hz, 1H), 7.97 (d, J
= 8.2 Hz, 2H), 7.69-7.60 (m, 4H), 7.50 (d, J = 8.2 Hz, 3H), 7.33 (d, J = 8.2 Hz, 2H), 4.04 (s,
2H). 13C NMR (151 MHz, DMSO-d6) δ 194.6, 171.1, 152.5, 149.0, 143.5, 138.7, 137.5,
133.8, 129.8 (2C), 129.1 (2C), 127.2, 126.4 (2C), 124.1, 123.0, 120.3 (2C), 118.1 (2C),
+
109.1, 32.3. HPLC-TOF/MS: 405.0890 ([M+H]+, C23H18ClN2O3 ; calc. for 405,1000).
This article is protected by copyright. All rights reserved.

1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-(3-
(trifluoromethyl)phenyl)urea (3e). Yellow solid; yield 75%; mp 242-245 °C; IR (KBr, cm-
1) 3439, 3335, 3267, 3073, 2937, 2905, 1692, 1639, 1617, 1556, 1529, 1494, 1370, 1335,
1314, 1291, 1223, 1182, 1168, 1107, 1095, 1068, 903, 845, 813, 746, 695, 634.1H NMR (600
MHz, DMSO-d6) keto-enol (43:57), enol tautomer: δ 15.43 (s, 1H), 9.22 (s, 1H), 9.15 (s, 1H),
8.03 (m, 2H), 7.95 (d, J = 8.3 Hz, 2H), 7.76 (d, J = 7.5 Hz, 1H), 7.67 (d, J = 8.1 Hz, 2H),
13
7.64- 7.60 (m, 2H), 7.50 (bs, 1H), 7.43 (m, 1H), 7.33-7.30 (m, 1H), 3.99 (s, 2H). C NMR
(151 MHz, DMSO-d6) δ 194.7, 170.9, 152.6, 148.9, 143.3, 140.6, 137.5, 135.5, 133.7, 130.0
(q, J = 31.4 Hz), 129.7 (2C), 127.2, 126.3, 124.6 (q, J = 272.3 Hz), 124.1, 123.0, 122.4, 118.8
(q, J = 3.7 Hz), 118.2 (2C), 114.79 (q, J = 4.6 Hz), 109.07, 32.32. HPLC-TOF/MS: 439.1146
+
([M+H]+, C24H18F3N2O3 ; calc. for 439,1264).
1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-(4-
(trifluoromethyl)phenyl)urea (3f). Yellow solid; yield 78%; mp 277-280 °C; IR (KBr, cm-1)
3535, 3307, 3069, 2945, 2900, 1646, 1628, 1601, 1578, 1546, 1470, 1410, 1372, 1328, 1268,
1
1225, 1165, 1122, 1108, 1068, 1015, 883, 838, 742, 656. H NMR (600 MHz, DMSO-d6)
keto-enol (41:59), enol tautomer: δ 15.41 (s, 1H), 9.26 (s, 1H), 9.23 (s, 1H), 7.97 (d, J = 8.1
13
Hz, 2H), 7.78 (d, J = 7.4 Hz, 1H), 7.65 (m, 8H), 7.48 (bs, 1H), 4.03 (s, 2H). C NMR (151
MHz, DMSO-d6) δ 194.7, 171.0, 152.4, 149.0, 143.3, 137.5, 133.8, 129.8 (2C), 127.9, 127.6,
126.5 (q, J = 3.6 Hz, 2C), 126.4, 124.9 (q, J = 262.8 Hz), 123.0, 122.6, 122.4, 118.5 (2C),
+
118.2 (2C), 109.1, 32.3. HPLC-TOF/MS: 439.1226 ([M+H]+, C24H18F3N2O3 ; calc. for
439,1264).
1-(3,5-bis(trifluoromethyl)phenyl)-3-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)urea (3g). Yellow solid; yield 82%; mp 185-188 °C; IR (KBr, cm-1)
3566, 3355, 3302, 3120, 3064, 3016, 2902, 1724, 1605, 1584, 1535, 1518, 1473, 1394, 1320,
1
1303, 1275, 1184, 1124, 1045, 1033, 949, 863, 840, 748, 732, 680. H NMR (600 MHz,
DMSO-d6) keto-enol (40:60), enol tautomer: δ 15.38 (s, 1H), 9.52 (s, 1H), 9.46 (s, 1H), 8.14
(s, 2H), 8.05 (d, J = 7.3 Hz, 1H), 7.97 (d, J = 7.8 Hz, 2H), 7.70- 7.64 (m, 5H), 7.48 (bs, 1H),
4.03 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ 194.3, 170.9, 152.6, 149.1, 135.5, 133.9,
131.2 (q, J = 32.1 Hz, 2C), 129.7 (2C), 127.9,127.2, 126.4, 124.1, 123.7 (q, J = 274.1 Hz,
2C), 118.7 (bs, 2C), 118.6 (2C), 118.2 (2C), 115.2 (bs), 109.22, 32.30. HPLC-TOF/MS:
+
507.1014 ([M+H]+, C25H17F6N2O3 ; calc. for 507,1138).
This article is protected by copyright. All rights reserved.

1-(4-chloro-3-(trifluoromethyl)phenyl)-3-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)urea (3h). Yellow solid; yield 84%; mp 180-183 °C; IR (KBr, cm-1)
3535, 3360, 3266, 3239, 3184, 3102, 3065, 3003, 2897, 1707, 1620, 1604, 1552, 1515, 1483,
1
1469, 1376, 1326, 1306, 1260, 1204, 1180, 1122, 1113, 1028, 960, 840, 748, 731, 550. H
NMR (600 MHz, DMSO-d6) keto-enol (40:60), enol tautomer: δ 15.38 (s, 1H), 9.29 (s, 1H),
9.27 (s, 1H), 8.10 (bs, 1H), 8.04 (d, J = 7.3 Hz, 1H), 7.97 (d, J = 7.4 Hz, 2H), 7.64 (m, 6H),
7.51-7.47 (m, 1H), 4.04 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ 194.7, 171.0, 152.5,
149.1, 143.2, 139.4, 139.3, 137.5, 132.4, 131.5, 129.8 (2C), 127.2, 126.4, 124.1, 123.7, 123.1
(2C), 118.4 (2C), 117.4 (q, J = 6.5 Hz), 109.1, 32.31. HPLC-TOF/MS: 473.0750 ([M+H]+,
+
C24H17ClF3N2O3 ; calc. for 473,0874).
1-(3-chloro-4-methylphenyl)-3-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)urea (3i). Yellow solid; yield 73%; mp 222-225 °C; IR (KBr, cm-1)
3448, 3289, 3094, 3044, 2983, 1637, 1583, 1541, 1498, 1406, 1371, 1303, 1221, 1169, 1114,
1
1091, 1049, 994, 882, 837, 789, 740, 655, 549, 482. H NMR (600 MHz, DMSO-d6) keto-
enol (41:59), enol tautomer: δ 15.52 (s, 1H), 9.16 (s, 1H), 8.89 (s, 1H), 8.03 (d, J = 7.2 Hz,
1H), 7.96 (d, J = 7.4 Hz, 2H), 7.69 (bs, 1H), 7.66-7.62 (m, 4H), 7.50-7.46 (m, 1H), 7.24 (d, J
13
= 8.2 Hz, 1H), 7.22-7.18 (m, 1H), 4.03 (s, 2H). C NMR (151 MHz, DMSO-d6) δ 194.6,
171.1, 152.5, 149.0, 143.5, 138.9, 137.5, 133.8, 131.6, 130.2, 129.8 (2C), 129.1, 128.1, 127.2,
126.4, 123.0, 118.1 (2C), 117.6 (2C), 109.1, 32.34, 19.28. HPLC-TOF/MS: 419.1117
+
([M+H]+, C24H20ClN2O3 ; calc. for 419,1157).
1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-ylidene)methyl)phenyl)-3-(naphthalen-1-
yl)urea (3j). Yellow solid; yield 79%; mp 242-245 °C; IR (KBr, cm-1) 3461, 3264, 3046,
3011, 2900, 1634, 1599, 1574, 1549, 1509, 1468, 1406, 1372, 1323, 1231, 1176, 1093, 1012,
881, 836, 783, 742, 659. 1H NMR (600 MHz, DMSO-d6) keto-enol (40:60), enol tautomer: δ
15.24 (s, 1H), 9.51 (s, 1H), 8.90 (s, 1H), 8.12 (d, J = 8.5 Hz, 1H), 8.06 (d, J = 7.2 Hz, 1H),
7.99 (d, J = 6.8 Hz, 2H), 7.93 (d, J = 8.1 Hz, 1H), 7.71 (d, J = 8.2 Hz, 2H), 7.67-7.63 (m,
4H), 7.59 (t, J = 7.5 Hz, 1H), 7.54 (t, J = 7.2 Hz, 1H), 7.48 (d, J = 6.8 Hz, 2H), 4.03 (s, 2H).
13C NMR (151 MHz, DMSO-d6) δ 194.2, 171.1, 153.1, 149.0, 143.8, 137.5, 135.5, 134.1,
133.8, 131.6, 129.9, 128.8, 126.6, 126.3, 126.2 (2C), 124.1, 123.9, 123.0, 121.8, 118.0 (2C),
+
117.5, 109.0, 32.37. HPLC-TOF/MS: 421.1593 ([M+H]+, C27H21N2O3 ; calc. for 421,1547).
This article is protected by copyright. All rights reserved.

Biological evaluation.
Cell culture
All cell lines were purchased from (ATCC). Two cell lines were used in this study: C6
(Rattus brain glioma), HeLa (human epithelial carcinoma) cell lines. The medium
environment that we used in our study was DMEM, containing 10% fetal bovine serum
(FBS), 1% L-glutamine, 100 IU/mL penicillin, and 10 mg/mL streptomycin. Cell lines
produced using DMEM would be reproduced at 37°C, in an oven with 95% humidity and 5%
CO2.
BrdU Cell Proliferation assay (BCPA)
In order to examine the cell proliferation in the study, the BrdU Cell proliferation ELISA kit
was used [56]. The method is based on the measurement of BrdU (5-Bromo-2'-deoxy-
uridine) bound to cellular DNA during DNA synthesis using anti-BrdU antibody. Plates of 96
were seeded as 3 x 103 cells and incubated on 24 h. The BrdU labeling reagent prepared by
adding BrdU: DMEM (1: 100) was pipetted in 20 μL wells and incubated for 4 hours.
Solution was discharged and FixDenate solution was added to make 100 μL / well and
incubated at room temperature for 45 min. Again plate was discharged anti-BrdU-POD
solution was added to make 50 μL / well and incubated at room temperature for 2 h. Again
plate was discharged and washed 3 times with 1:10 washing buffer:ddH2O. 25 μL of 1 M
H2SO4 was added to each well in order to stop the reaction. Reading at a wavelength of 450-
650 nm was performed. Percentage of inhibition was calculated according to the following
formula.
% inhibition =[100 x (Cell control - Experiment)]/ (Cell control)
Determination of the effects of compounds (3f and 3g) that showed highly antiproliferative
activity on Cell Cycle and Apoptosis
The effect of the compounds on the cell cycle and on the expression of the major genes
involved in apoptosis were determined using the RealTime Ready Gene Expression Custom
Panel kit. Two compounds 3f and 3g which showed antiproliferative properties from the
synthesized compounds were applied to the cells. 6 Well-plated cells was applied to 2 μL of
compounds (3f or 3g). Incubated for 24 hours in an at 37 °C and 5% CO2. The cells were
trypsinized according to the protocol. RNA isolation from the obtained cell pellet was
This article is protected by copyright. All rights reserved.

performed with Hybrid R (GeneAll, Cat no. 106-101, Lon no. 10615G23063). RNA isolation
was performed from the isolated samples according to the following protocol: HyperScript
(GeneAll Cat # 601-005). cDNA isolation RNA from isolated samples was performed
according to protocol [HyperScript (GeneAll Cat no: 601-005)]. Quantities of cDNA samples
were measured (Molecular probes, qubit ssDNA Assay Kit, Life Technologies). Samples of
measured cDNA amount was worked for expression by Real Time PCR. Caspase 3, Caspase
8, Caspase 9, Bcl-2, TNF, SYBR Green based qRT PCR was worked. REALAMP SYBR
GREEN MASTERMİX (LOW ROX DYE) (Cat no:801-050,Lot no:QP116G25001) was
used. Primers were designed with the help of the National Center for Biotechnology
Information (NCBI). [Caspase-3; 3’→5’ AAGCGAATCAATGGACTCTG; 5’→3’
AAACATCACGCATCAATTCC. Caspase-8; 3’→5’ GAAAGCAATCTGTCCTTCCT;
5’→3’
GGCTCTTCCTTTGTTCATCTCC; 5’→3’ ATCACCAAATCCTCCAGAACCA. Bcl-2;
3’→5’ GTACGACAACCGGGAGATAGTG; 5’→3’
GACAGCCAGGAGAAATCAAACAG. TNF-α; 3’→5’ CCTCTTCTCCTTCCTGATCGT;
5’→3’ TTGCTACAACATGGGCTACAG. GAPDH; 3’→5’
ATGACCCTCTTCTCCATCTC.
Caspase-9;
3’→5’
TGCACCACCAACTGCTTAGC; 5’→3’ GGCATGGACTGTGGTCATGAG].
Antimicrobial activity, determination of MICs
The broth microdilution method was employed for the determination of antimicrobial
activities of the synthesized compounds [57]. The minimal inhibitory concentration (MIC)
values of the compounds were studied using the micro-well dilution method for the bacterial
and fungal strains. Overnight broth cultures were used to prepare the inocula of the
microorganisms and suspensions were adjusted to 0.5 McFarland standard turbidity. After the
dissolution of the 3a-j for the purpose of testing in Mueller Hinton Broth (MHB) which has
10% (v/v) DMSO, serial twofold dilutions were prepared in 96-well plates with MHB at a
concentration varying between 15.6-500 µg/mL. Piperacillin/Tazobactam (8:1) and
Flucanozole were used as standard antibacterial and antifungal agents respectively. A Bio
Tek microplate reader (Bio Tek Instruments, Inc., Winooski, VT, USA) was used to measure
the optical density (OD) at 620 nm and it was measured again following the incubation for 24
hours at 37 °C. MIC was determined as the lowest concentration of 3a-j that inhibits the
growth of test bacteria.
This article is protected by copyright. All rights reserved.

Supplementary Material
Supporting information for this article is available on the WWW under http:// dx.doi. org/
Acknowledgements
The authors are indebted to the Technical Research Council of Turkey (Grant TUBİTAK-
114Z634) for financial support of this work.
Author Contribution Statement
Project design by H.G. and M.C. Experiments, data analysis, and writing of the manuscript
by H.G. Anticancer activity tests and interpretation of test results by C.H. Antimicrobial
activity tests by U.T.
References
[1] C. H. Liang, G. H. Wang, T. H. Chou, S. H. Wang, R. J. Lin, L. P. Chan, E. C. So, J. H.
Sheu, ‘5-epi-Sinuleptolide Induces Cell Cycle Arrest and Apoptosis Through Tumor
Necrosis Factor/Mitochondria-Mediated Caspase Signaling Pathway in Human Skin
Cancer Cells’, Biochim. Biophys. Acta. 2012, 1820, 1149-1157.
[2] L. S. Monteiro, K. X. Bastos, J. M. Barbosa-Filho, P. F. Athayde-Filho, M. F. F. M.
Diniz, M. V. Sobral, ‘Medicinal Plants and Other Living Organisms with Antitumor
Potential Against Lung Cancer’, Evidence-Based Complementary and Alternative Med.
2014, 2014: 604152, 1-15.
[3] S. L. Sankari, K. M. K. Masthan, N. A. Babu, T. Bhattacharjee, M. Elumalai, ‘Apoptosis
in Cancer-An Update’, Asian. Pac. J. Cancer. Prev. 2012, 13, 4873-4878.
[4] M. Shi, N. Guo, ‘MicroRNA Expression and Its Implications for The Diagnosis and
Therapeutic Strategies of Breast Cancer’, Cancer. Treat. Rev. 2009, 35, 328-334.
[5] W. Tan, J. Lu, M. Huang, Y. Li, M. Chen, G. Wu, J. Gong, Z. Zhong, Z. Xu, Y. Dang, J.
Guo, X. Chen, Y. Wang, ‘Anti-Cancer Natural Products Isolated from Chinese Medicinal
Herbs’, Chinese Med. 2011, 6:27, 1-15.
[6] A. V. Kel’in, A. Maioli, ‘Recent Advances in The Chemistry of 1,3-Diketones: Structural
Modifications and Synthetic Applications’, Curr. Org. Chem. 2003, 7, 1855-1886.
[7] P. A. Vigato, V. Peruzzo, S. Tamburini, ‘The Evolution of β-Diketone or β-Diketophenol
Ligands and Related Complexes’, Coord. Chem. Rev. 2009, 253, 1099-1201.
This article is protected by copyright. All rights reserved.

[8] J. Kim, E. Shokova, V. Tafeenko, V. Kovalev, ‘(CF3CO)2O/CF3SO3H-Mediated Synthesis
of 1,3-Diketones from Carboxylic Acids and Aromatic Ketones’, Beil. J. Org. Chem. 2014,
10, 2270-2278.
[9] M. Abdel-Aziz, A. El-Din, G. Abuo-Rahma, A. A. Hassan, ‘Synthesis of Novel Pyrazole
Derivatives and Evaluation of Their Antidepressant and Anticonvulsant Activities’, Eur. J.
Med. Chem. 2009, 44, 3480-3487.
[10] M. Baumann, I. R. Baxendale, S. V. Ley, N. Nikbin, ‘An Overview of The Key Routes to
The Best Selling 5-Membered Ring Heterocyclic Pharmaceuticals’, Beil. J. Org. Chem.
2011, 7, 442-495.
[11] M. S. Christodoulou, L. Sandra, K. M. Kasiotis, S. A. Harotounian, ‘Novel Pyrazole
Derivatives: Synthesis and Evaluation of Anti-Angiogenic Activity’, Bioorg. Med. Chem.
2010, 18, 4338-4350.
[12] B. Lee, P. Kang, K. H. Lee, J. Cho, W. Nam, K. W. Lee, N. H. Hur, ‘Solid-State and
Solvent-Free Synthesis of Azines, Pyrazoles, and Pyridazinones Using Solid Hydrazine’,
Tetrahedron Lett. 2013, 54, 1384-1388.
[13] S. Maiti, S. Biswas, U. Jana, ‘Iron(III)-Catalyzed Four-Component Coupling Reaction of
1,3-Dicarbonyl Compounds, Amines, Aldehydes, and Nitroalkanes: A Simple and Direct
Synthesis of Functionalized Pyrroles’, J. Org. Chem. 2010, 75, 1674-1683.
[14] S. I. Bhat, D. R. Trivedi, ‘A Catalyst- and Solvent-Free Three-Component Reaction for
The Regioselective One-Pot Access to Polyfunctionalized Pyrroles’, Tetrahedron Lett.
2013, 54, 5577-5582.
[15] E. S. Putilova, G. V. Kryshtal, G. M. Zhdankina, N. A. Troitskii, S. G. Zlotin,
‘Alkylammonium and Alkylimidazolium Perhaloborates, Phosphates and Aluminates as
Catalysts in The Biginelli Reaction’, Russ. J. Org. Chem. 2005, 41, 512-516.
[16] K. Konkala, N. M. Sabbavarapu, R. Katla, N. Y. V. Durga, T. V. K. Reddy, B. L. A. P.
Devi, R. B. N. Prasad, ‘Revisit to The Biginelli Reaction: A Novel and Recyclable
Bioglycerol-Based Sulfonic Acid Functionalized Carbon Catalyst for One-Pot Synthesis
of Substituted 3,4-Dihydropyrimidin-2-(1H)-ones’, Tetrahedron Lett. 2012, 53, 1968-
1973.
[17] B. Schickmous, J. Christoffers, ‘Synthesis of Tetrasubstituted Furan Derivatives by
Condensation of 1,3-Diketones with Cyclic α-Hydroxy-β-oxo Esters’, Eur. J. Org. Chem.
2014, 20, 4410-4416.
This article is protected by copyright. All rights reserved.

[18] L. Albrecht, L. K. Ransborg, B. Gschwend, K. A. Jorgensen, ‘An Organocatalytic
Approach to 2-Hydroxyalkyl- and 2-Aminoalkyl Furanes’, J. Am. Chem. Soc. 2010, 132,
17886-17893.
[19] A. Kumar, M. S. Rao, ‘An Expeditious and Greener One-Pot Synthesis of 4H-
Chromenes Catalyzed by Ba(OTf)2 in PEG-Water’, Green. Chem. Lett. Rev. 2012, 5,
283-290.
[20] A. Shaabani, M. Mahyari, F. Hajishaabanha, ‘The Synthesis of Xanthenes and
Benzoxanthenes on Graphene Oxide and Sulfated Graphene Nanosheets in Water’, Res.
Chem. Intermed. 2014, 40, 2799-2810.
[21] S. Bhattacharjee, D. K. Das, A. T. Khan, ‘Ammonium Chloride-Catalyzed Three-
Component Reaction for The Synthesis of Fused 4H-Chromene Derivatives in Aqueous
Medium’, Synthesis 2014, 46, 73-80.
[22] V. Kavala, C. C. Wang, D. K. Barange, C. W. Kuo, P. M. Lei, C. F. Yao, ‘Synthesis of
Isocoumarin Derivatives via The Copper-Catalyzed Tandem Sequential Cyclization of 2-
Halo-N-Phenyl Benzamides and Acyclic 1,3-Diketones’, J. Org. Chem. 2012, 77, 5022-
5029.
[23] S. Pathak, K. Debnath, A. Pramanik, ‘Silica Sulfuric Acid: A Reusable Solid Catalyst for
One Pot Synthesis of Densely Substituted Pyrrole-Fused Isocoumarins Under Solvent-
Free Conditions’, Beil. J. Org. Chem. 2013, 9, 2344-2353.
[24] G. Wang, X. Chen, G. Miao, W. Yao, C. Ma, ‘Divergent NHC-Catalyzed Oxidative
Transformations of 3-Bromoenal: Selective Synthesis of 2H-Pyran-2-ones and Chiral
Dihydropyranones’, J. Org. Chem. 2013, 78, 6223-6232.
[25] Y. Wang, D. Dong, Y. Yang, J. Huang, Y. Ouyang, Q. Liu, ‘A Facile and Convenient
One-Pot Synthesis of Polysubstituted Thiophenes from 1,3-Dicarbonyl Compounds in
Water’, Tetrahedron 2007, 63, 2724-2728.
[26] S. S. Weng, C. S. Ke, F. K. Chen, Y. F. Lyu, G. Y. Lin, ‘Transesterification Catalyzed by
Iron(III) β-Diketonate Species’, Tetrahedron 2011, 67, 1640-1648.
[27] R. Wilken, M. S. Veena, M. B. Wang, E. S. Srivatsan, ‘Curcumin: A Review of Anti-
Cancer Properties and Therapeutic Activity in Head and Neck Squamous Cell
Carcinoma’, Mol. Cancer. 2011, 10:12, 1-19.
[28] P. N. Verma, J. I. Sheikh, HD. Juneja, ‘Synthesis of β-Diketone and Its Metal
Complexes’, World. Appl. Sci. J. 2011, 14, 1154-1157.
[29] J. Sheikh, T. B. Hadda, ‘Antibacterial, Antifungal and Antioxidant Activity of Some New
Water-Soluble β-Diketones’, Med. Chem. Res. 2013, 22, 964-975.
This article is protected by copyright. All rights reserved.

[30] I. V. Taydakov, A. A. Akkuzina, R. I. Avetisov, A. V. Khomyakov, R. R. Saifutyarov, I.
Ch. Avetissov, ‘Effective Electroluminescent Materials for OLED Applications Based on
Lanthanide 1,3-Diketonates Bearing Pyrazole Moiety’, J. Lumin. 2016, 177, 31-39.
[31] S. Clark, J. M. Elliott, J. R. Chipperfield, P. Styring, E. Sinn, ‘The First Uranium Based
Liquid Crystals. Uranyl Metallomesogens from β-Diketone and Tropolone Ligands’,
Inorg. Chem. Commun. 2002, 5, 249-251.
[32] M. Yamaji, M. Kida, ‘Photothermal Tautomerization of A UV Sunscreen (4-Tert-butyl-
4′-methoxydibenzoylmethane) in Acetonitrile Studied by Steady-State and Laser Flash
Photolysis’, J. Phys. Chem. A 2013, 117, 1946-1951.
[33] D. Wang, C. Zheng, L. Fan, J. Zheng, X. Wei, ‘Preparation and Fluorescent Properties of
Europium (III) Complexes with β-Diketone Ligand and 2,2-Dipyridine or 1,10-
Phenanthroline’, Synth. Met. 2012, 162, 2063-2068.
[34] H. Tang, H. Tang, Z. Zhang, C. Cong, K. Zhang, ‘Synthesis, Thermal, Photoluminescent,
and Electroluminescent Properties of A Novel Quaternary Eu(III) Complex Containing A
Carbazole Hole-Transporting Functional Group’, J. Mater. Sci. Mater. Electron. 2009,
20, 597-603.
[35] N. Jiang, Y. Bu, Y. Wang, M. Nie, D. Zhang, X. Zhai, ‘Design, Synthesis and Structure-
Activity Relationships of Novel Diaryl Urea Derivatives as Potential EGFR Inhibitors’,
Molecules 2016, 21, 1572, 1-12.
[36] P. Sikka, J. K. Sahu, A. K. Mishra, S. R. Hashim, ‘Role of Aryl Urea Containing
Compounds in Medicinal Chemistry’, Med. Chem. 2015, 5 (11), 479-483.
[37] I. H. Eissa, H. Mohammad, O. A. Qassem, W. Younis, T. M. Abdelghany, A. Elshafeey,
M. M. A. R. Moustafa, M. N. Seleem, A. S. Mayhoub, ‘Diphenylurea Derivatives for
Combating Methicillin- and Vancomycinresistant Staphylococcus aureus’, Europ. J.
Med. Chem. 2017, 130, 73-85.
[38] C. B. Mishra, S. Kumari, M. Tiwari, ‘Design and Synthesis of Some new 1-Phenyl-3/4-
[4-(aryl/heteroaryl/alkyl-piperazine1-yl)-phenyl-ureas as Potent Anticonvulsant and
Antidepressant Agents, Arch. Pharm. Res. 2016, 39, 603-617.
[39] S. H. Hwang, K. M. Wagner, C. Morisseau, J.-Y. Liu, H. Dong, A. T. Wecksler, B. D.
Hammock, ‘Synthesis and Structure-Activity Relationship Studies of Urea-Containing
Pyrazoles as Dual Inhibitors of Cyclooxygenase-2 and Soluble Epoxide Hydrolase’, J.
Med. Chem. 2011, 54, 3037-3050.
[40] M.-L. Go, ‘Novel Antiplasmodial Agents’, Med. Res. Rev. 2003, 23, 456-487.
This article is protected by copyright. All rights reserved.

[41] S. Perveen, S. Mustafa, M. A. Khan, A. Dar, K. M. Khan, W. Voelter, ‘Substituted Urea
Derivatives: A Potent Class of Antidepressant Agents’, Med. Chem. 2012, 8, 330-336.
[42] S. Aravapalli, H. Lai, T. Teramoto, K. R. Alliston, G. H. Lushington, E. L. Ferguson, R.
Padmanabhan, W. C. Groutas, ‘Inhibitors of Dengue Virus and West Nile Virus
Proteases Based on The Aminobenzamide Scaffold’, Bioorg. Med. Chem. 2012, 20,
4140-4148.
[43] R. S. Upadhayaya, G. M. Kulkarni, N. R. Vasireddy, J. K. Vandavasi, S. S. Dixit, V.
Sharma, J. Chattopadhyaya, ‘Design, Synthesis and Biological Evaluation of Novel
Triazole, Urea and Thiourea Derivatives of Quinoline Against Mycobacterium
tuberculosis’, Bioorg. Med. Chem. 2009, 17, 4681-4692.
[44] W. Xuan, W. Ding, H.-X. Hui, S.-Q. Zhang, ‘Synthesis and Cytotoxic Activity of
Diaryl Urea Derivatives with a 4-Methylpiperazinylcarbonyl Moiety, Med. Chem. Res.
2013, 22, 3857-3862.
[45] J. King, D. H. Palmer, P. Johnson, P. Ross, R. A. Hubner, K. Sumpter, S. Darby, C.
Braconi, C. Iwuji, D. Swinson, P. Collins, K. Patel, J. Nobes, I. Muazzam, C. Blesing, A.
Kirkwood, S. Nash, T. Meyer, ‘Sorafenib for The Treatment of Advanced Hepatocellular
Cancer - a UK Audit’, Clin. Oncol. 2017, 29, 256-262.
[46] C. Cainap, S. Qin, W.-T. Huang, I. J. Chung, H. Pan, Y. Cheng, M. Kudo, Y.-K. Kang,
P.-J. Chen, H.-C. Toh, V. Gorbunova, F. A. L. M. Eskens, J. Qian, M. D. McKee, J. L.
Ricker, D. M. Carlson, S. El-Nowiem, ‘Linifanib Versus Sorafenib in Patients With
Advanced Hepatocellular Carcinoma: Results of a Randomized Phase III Trial’, J. Clin.
Oncol. 2015, 33, 172-179.
[47] L. Garuti, M. Roberti, G. Bottegoni, M. Ferraro, ‘Diaryl Urea: A Privileged Structure in
Anticancer Agents’, Curr. Med. Chem. 2016, 23, 1528-1548.
[48] M. Hassan, H. Watari, A. AbuAlmaaty, Y. Ohba, N. Sakuragi, ‘Apoptosis and
Molecular Targeting Therapy in Cancer’, BioMed. Res. Inter. 2014, 2014:150845, 1-23.
[49] M. Lamkanfi, N. Festjens, W. Declercq, B. T. Vanden, P. Vandenabeele, ‘Caspases in
Cell Survival, Proliferation and Differentiation’, Cell. Death Differ. 2007, 14, 44-55.
[50] F. Sonmez, S. Sevmezler, A. Atahan, M. Ceylan, D. Demir, N. Gencer, O. Arslan, M.
Kucukislamoglu, ‘Evaluation of New Chalcone Derivatives as Polyphenol oxidase
inhibitors’, Bioorg. Med. Chem. Lett. 2011, 21, 7479-7482.
[51] J. N. Dominguez, C. Leon, J. Rodrigues, N. G. Dominguez, J. Gut, P. J. Rosenthal,
‘Synthesis and Evaluation of New Antimalarial Phenylurenyl Chalcone Derivatives’, J.
Med. Chem. 2005, 48, 3654-3658.
This article is protected by copyright. All rights reserved.

[52] N. P. Buu-Hoi, N. D. Xuong, V. T. Suu, ‘New NN′-Disubstituted Thioureas and Ureas of
Biological Interest’, J. Chem. Soc. 1958, 2815-2821.
[53] H. Martin, A. Lukaszczyk, D. Duerr, G. Pissiotas, O. Rohr, A. Hubele, S. Janiak,
German Pat. 1802739, 1969, 24pp (Chem. Abstr. 1969, 71, 91056).
[54] H. Martin, A. Ruperti, Great Britain Pat. 976528A, 1962, 5pp (Chem. Abstr. 1963, 59,
1532).
[55] Chr. W. Raadsveld, Nitro- and Bromonitro-Derivatives of para-Aminoacetophenone,
Rec. Trav. Chim. Pays-Bas 1935, 54, 813-827.
[56] A. Aydın, N. Korkmaz, Ş. Tekin, A. Karadağ, ‘Anticancer Activities and Mechanism of
Action of 2 Novel Metal Complexes, C16H34N8O5Ag2Cd and C11H16N7O2Ag3Ni’, Turk.
J. Biol. 2014, 38, 948-955.
[57] M. Balouiri, M. Sadiki, S. K. Ibnsouda, Methods for in vitro Evaluating Antimicrobial
Activity: A Review, J. Pharm. Anal. 2016, 6, 71-79.
Table 1. Synthesized 3a-j derivatives.
Entry
Ar
Product
3a
Yield (%)a
m. p. °C
262-265
277-280
277-280
292-295
242-245
277-280
185-188
180-183
222-225
242-245
1
Ph
78
80
85
84
75
78
82
84
73
79
2
4-MeOPh
4-FPh
3b
3c
3
4
4-ClPh
3d
3e
5
3-CF3Ph
4-CF3Ph
3,5-CF3Ph
3-CF3-4-ClPh
3-Cl-4-CH3Ph
1-Naphthyl
6
3f
7
3g
8
3h
3i
9
10
3j
aYield of isolated product.
This article is protected by copyright. All rights reserved.

Table 2. 1H and 13C NMR (DMSO-d6) data of 3a, δ (ppm), J (Hz).
Position HSQC (H → C)
δ(H)
HMBC (H → C)
2J 3J
δ(C)
1
2
3
4
-
-
-
194.6
109.0
171.1
32.3
3.99 (s)
C(2), C(6b) C(1),C(3), C(1b), C(5b)
5
-
-
152.6
127.2
1a
2a
7.95 (d, J = 8.8) 129.8
7.68-7.59 (m)
-
C(3), C(4a), C(6a),
3a
118.0
143.7
118.0
C(2a), C(4a) C(1a), C(5a)
4a
5a
7.68-7.59 (m)
C(4a), C(6a) C(1a), C(3a)
C(3), C(2a), C(4a)
6a
7.95 (d, J = 8.8) 129.8
137.5
7.76 (d, J = 7.6) 123.0
1b
2b
3b
4b
5b
6b
1c
-
C(3b)
C(1), C(6b)
7.68-7.59 (m)
7.47-7.40 (m)
7.68-7.59 (m)
-
-
7.48 (d, J = 7.9) 118.8
7.29 (t, J = 7.9) 129.2
6.98 (t, J = 7.3
7.29 (t, J = 7.9) 129.2
7.48 (d, J = 7.9) 118.8
133.7
127.8
126.3
149.0
139.7
C(2b), C(4b) C(1b)
C(5b), C(3b) C(2b), C(6b)
C(4b), C(6b) C(4), C(1b)
2c
C(1c), C(3c) C(4c), C(6c)
3c
C(2c)
C(1c), C(5c)
4c
122.6
C(3c), C(5c) C(2c)
5c
C(2c)
C(1c), C(5c)
6c
C(1c), C(5c) C(2c), C(4c)
C(5), C(4a) C(3a)
C(5), C(1c) C(6c)
-NHa
-NHb
-OH
9.11 (s)
8.78 (s)
15.35 (bs)
-
-
-
Table 3. IC50 values of 3a-j on HeLa and C6 cell lines after 24 h.
Entry Compound Ar
HeLa IC50 (µg/mL) C6 IC50 (µg/mL)
1
2
3
4
5
6
7
8
9
3a
3b
3c
3d
3e
3f
3g
3h
3i
Ph
4-MeOPh
4-FPh
4-ClPh
3-CF3Ph
4-CF3Ph
3,5-CF3Ph
3-CF3-4-ClPh 12.12±0.65
3-Cl-4-CH3Ph 23.29±0.98
18.28±0.02
8.62 ±1.2
17.50 ±0.98
16.99±1.24
57.25±1.45
11.11±0.66
16.48±0.78
8.87±0.05
9.39±0.68
30.21±1.85
25.89±2.15
37.82±1.15
7.73±0.76
10.28 ±0.67
12.94 ±2.54
12.25±2.87
7.42±1.87
5.70±0.98
10
3j
1-Naftil
5-FU
11.04±1.12
8.30±0.76
This article is protected by copyright. All rights reserved.

Table 4. Minimum-inhibitory concentrations (MIC, in μg/mL) of 3a-j.
3a
3b
3c
3d
3e
3f
3g
3h
3i
3j
P/T a)
Gram-negative
K. pneumoniae 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3
S. boydii
E. coli
P. vulgaris
Gram-positive
S. aureus
E. faecalis
31.3 31.3 31.3 62.5 31.3 31.3 62.5 62.5 62.5 31.3 62.5
31.3 31.3 62.5 62.5 31.3 62.5 62.5 62.5 62.5 31.3 15.6
62.5 62.5 125 62.5 62.5 125 62.5 125 125 31.3 31.3
62.5 62.5 62.5 62.5 62.5 62.5 62.5 62.5 62.5 31.3 62.5
62.5 62.5 31.3 31.3 31.3 125 31.3 31.3 125 31.3 62.5
Bacillus cereus 31.3 31.3 31.3 31.3 31.3 31.3 31.3 62.5 62.5 31.3 125
Yeasts
Flu.
31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 15.6
31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 31.3 15.6
C. albicans
C. tropicalis
a) P/T, piperacillin/tazobactam (8:1); Flu., flucanazole
Scheme 1. Synthesis of 3a-j starting from 1a-j.
This article is protected by copyright. All rights reserved.

Figure 1. Some bioactive 1,3-diketones.
Figure 2. Anticancer diarylurea compounds.
Figure 3. Selected HMBCs of 3a.
This article is protected by copyright. All rights reserved.

60
50
40
30
20
10
0
C6 5-FU
HeLa 5-FU
C6 3f
HeLa 3f
0
20
40
60
80
Concentration ( g/mL)
Figure 4. The antiproliferative activity graph of the compound 3f.
100
C6 5-FU
HeLa 5-FU
C6 3g
80
HeLa 3g
60
40
20
0
0
20
40
60
80
Concentration ( g/mL)
Figure 5. The antiproliferative activity graph of the compound 3g.
This article is protected by copyright. All rights reserved.

3,0
2,5
2,0
1,5
1,0
0,5
0,0
3f
3g
caspase3
caspase8
caspase9
TNF
BCl-2
Change
Figure 6. Effect of 3f and 3g on pathways.
This article is protected by copyright. All rights reserved.

Graphical Abstract
Synthesis and Biological Evaluation of Novel 1-(4-(hydroxy(1-oxo-1,3-dihydro-2H-inden-2-
ylidene)methyl)phenyl)-3-phenylurea derivatives
Hayreddin Gezegen,*a Ceylan Hepokur,b Uğur Tutar,a and Mustafa Ceylanc
100
60
C6 5-FU
HeLa 5-FU
C6 3g
HeLa 3g
C6 5-FU
HeLa 5-FU
C6 3f
50
40
30
20
10
0
80
60
40
20
0
HeLa 3f
0
20
40
60
80
0
20
40
60
80
Concentration ( g/mL)
Concentration ( g/mL)
This article is protected by copyright. All rights reserved.