Cloning and characterization of the β-xylosidase from Dictyoglomus turgidum for high efficient biotransformation of 10-deacetyl-7-xylosltaxol

Article abstract of DOI:10.1016/j.bioorg.2019.103357

With the aim of finding an extracellular biocatalyst that can efficiently remove the C-7 xylose group from 10-deacetyl-7-xylosltaxol, a Dictyoglomus turgidum β-xylosidase was cloned and expressed in Escherichia coli BL21 (DE3). The molecular mass of purified Dt-Xyl3 was approximately 84 kDa. The recombinant Dt-Xyl3 was most active at pH 5.0 and 75 °C, retaining 88% activity at 65 °C for 1 h, and displaying excellent stability over pH 4.0–7.5 for 24 h. In terms of kinetic parameters, the K_m and V_max values for pNPX were 0.8316 mM and 5.0178 μmol/mL·min, respectively. Moreover, Dt-Xyl3 was activated by Mn²⁺ and Ba²⁺ and inhibited by Cu²⁺, Ni⁺ and Al³⁺. In particular, it displayed high tolerance to salts with 60.8% activity in 20% (w/v) NaCl. Ethanol and methanol at 5–15% showed little effect on the enzymatic activity. Dt-Xyl3 demonstrated multifunctional activities followed by pNPX, pNPAraf and pNPG and had a high selectivity for cleaving the outer xylose moieties of 10-deacetyl-7-xylosltaxol with K_cat/K_m 110.87 s^?1/mM, which produced 10-deacetyl-taxol to semi-synthesize paclitaxel. Under the optimized conditions (60 °C, pH 4.5, enzyme dosage of 0.5 U/mL), 1 g of 10-deacetyl-7-xylosltaxol was transformed to its corresponding aglycone 10-deacetyl-taxol within 30 min, with a molar conversion of 98%. This is the first report that Dictyoglomus turgidum can produce extracellular GH3 β-xylosidase with highly specific activity for 10-deacetyl-7-xylosltaxol biotransformation, thus leading to the application of β-xylosidase Dt-Xyl3 as a biocatalyst in biopharmaceutics.

Full text of DOI:10.1016/j.bioorg.2019.103357

Bioorganic Chemistry xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg
Cloning and characterization of the β-xylosidase from Dictyoglomus turgidum
for high efficient biotransformation of 10-deacetyl-7-xylosltaxol
a,b,c,1
b,1
b
a,b,c
d,⁎
d
Qi Li
, Yujie Jiang , Xinyi Tong , Jianjun Pei
, Wei Xiao , Zhenzhong Wang ,
a,b,c,⁎
Linguo Zhao
a
Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, 159 Long Pan Road, Nanjing 210037, China
College of Chemical Engineering, Nanjing Forestry University, 159 Long Pan Road, Nanjing 210037, China
Jiangsu Key Lab for the Chemistry & Utilization of Agricultural and Forest Biomass, 159 Long Pan Road, Nanjing 210037, China
Jiangsu Kanion Pharmaceutical Co., Ltd., Lianyungang, China
b
c
d
A R T I C L E I N F O
A B S T R A C T
Keywords:
With the aim of finding an extracellular biocatalyst that can efficiently remove the C-7 xylose group from 10-
Dictyoglomus turgidum
β-Xylosidase
deacetyl-7-xylosltaxol, a Dictyoglomus turgidum β-xylosidase was cloned and expressed in Escherichia coli BL21
(
DE3). The molecular mass of purified Dt-Xyl3 was approximately 84 kDa. The recombinant Dt-Xyl3 was most
Enzymatic characterization
Halotolerant
active at pH 5.0 and 75 °C, retaining 88% activity at 65 °C for 1 h, and displaying excellent stability over pH
4
.0–7.5 for 24 h. In terms of kinetic parameters, the K
m
and Vmax values for pNPX were 0.8316 mM and
2+ 2+ 2+
Biotransformation
5
.0178 μmol/mL·min, respectively. Moreover, Dt-Xyl3 was activated by Mn and Ba and inhibited by Cu
,
1
0-deacetyl-7-xylosltaxol
+
3+
Ni and Al . In particular, it displayed high tolerance to salts with 60.8% activity in 20% (w/v) NaCl. Ethanol
and methanol at 5–15% showed little effect on the enzymatic activity. Dt-Xyl3 demonstrated multifunctional
activities followed by pNPX, pNPAraf and pNPG and had a high selectivity for cleaving the outer xylose moieties
−1
of 10-deacetyl-7-xylosltaxol with Kcat/K 110.87 s /mM, which produced 10-deacetyl-taxol to semi-synthesize
m
paclitaxel. Under the optimized conditions (60 °C, pH 4.5, enzyme dosage of 0.5 U/mL), 1 g of 10-deacetyl-7-
xylosltaxol was transformed to its corresponding aglycone 10-deacetyl-taxol within 30 min, with a molar con-
version of 98%. This is the first report that Dictyoglomus turgidum can produce extracellular GH3 β-xylosidase
with highly specific activity for 10-deacetyl-7-xylosltaxol biotransformation, thus leading to the application of β-
xylosidase Dt-Xyl3 as a biocatalyst in biopharmaceutics.
1
. Introduction
better selectivity, higher yield and mild reaction conditions. Shin et al.
[
7] characterized a GH39 β-xylosidase from Thermoanaerobacterium
β-D-Xylosidase is one of the key enzymes for xylan hydrolysis [1]. It
thermosaccharolyticum and used it to produce ginsenosides Rg1 and Rh1
from notoginsenosides R1 and R2 with a molar conversion yield of
100% in 4 and 18 h, respectively. Zhang et al. [8] cloned, expressed and
characterized a thermostable GH3 β-xylosidase from Thermotoga pet-
rophila and used it to transform 20(S)-Rg3 from ginsenoside extract in
cooperation with a β-glucosidase with a corresponding molar conver-
sion of 95.0%. Moreover, Li et al. [6] characterized a highly xylose-
tolerant GH39 β-xylosidase from Dictyoglomus thermophilum and used it
to completely biotransform astragaloside IV to produce cycloastragenol
with stronger anti-aging activity in 3 h. Therefore, it is particularly
important to screen, clone and express β-xylosidase with high specifi-
city for the biotransformation of bioactive substances.
can hydrolyze lignocellulose and hemicellulose resources (especially
xylans, which are complex heteropolysaccharides consisting of a
backbone of β-1,4-linked xylose residues and side chains depending on
the source) combined with β-D-xylanase to produce xylooligosacchar-
ides or xylose, which are widely used in the biomass energy, food, feed
and medicine industries [2–4]. However, the roles of β-xylosidase in-
clude but are not limited to the degradation of xylooligosaccharides. In
recent years, more attention has been paid by researchers to the use of
β-xylosidase as a biocatalyst for the bioconversion of xylose-containing
natural active substances from forest sources [5,6]. Compared with
traditional chemical catalysts, biocatalysts such as β-xylosidase provide
⁎
Corresponding authors at: College of Chemical Engineering, Nanjing Forestry University, Nanjing 210037, China. (Linguo Zhao). Jiangsu Kanion Pharmaceutical
Co., Ltd., 58 Haichang South Road, Lianyungang 222001, China. (Wei Xiao).
E-mail addresses: xw@kanion.com (W. Xiao), lgzhao@njfu.edu.cn (L. Zhao).
1
Qi Li and Yujie Jiang contributed equally to this work.
https://doi.org/10.1016/j.bioorg.2019.103357
Received 5 June 2019; Received in revised form 8 October 2019; Accepted 9 October 2019
0045-2068/ © 2019 Published by Elsevier Inc.
Please cite this article as: Qi Li, et al., Bioorganic Chemistry, https://doi.org/10.1016/j.bioorg.2019.103357

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
According to different GH families and sources, β-xylosidases dis-
sequence.
play different enzymatic properties [9]. To date, many β-xylosidases
have been found in bacteria, archaea, fungi and plant, and most belong
to GH families 1, 3, 39, 43 and 120 based on the GH classification
system CAZy (www.cazy.org) [10–12]. Generally, β-xylosidases with
high temperature resistance, high sugar resistance and greater specifi-
city have better application prospects in industrial processes, since high
temperatures not only increase the solubility of transformed substrates
but also reduce the risk of contamination, and high sugar tolerance can
resist the inhibition of substrate feedback [13,14]. However, β-xylosi-
dases from fungal sources have optimum temperatures between 40 and
β-Xylosidases Xln-DT from Dictyoglomus thermophilum [6], Dth3
from Dictyoglomus thermophilum [30], Tth XyB3 from Thermotoga
Thermarum [17], Tth Xyl from Thermoanaerobacterium thermo-
saccharolyticum [31] and Tpe Xln3 from Thermotoga petrophila [8] were
preserved and prepared by the Microbial Technology Research La-
boratory, Nanjing Forestry University.
2.2. Media and materials
LB agar plates (1% peptone, 0.5% yeast extract, 1% NaCl and 1.5%
agar) containing 100 μg/mL ampicillin were used to cultivate the strain.
LB broth was used for seed culture in a shake flask.
6
0 °C and an optimum pH range of 3–5, which are not suitable for
biocatalytic transformation under high temperatures [15,16]. There-
fore, more attention has been paid to the discovery of β-xylosidases
from thermophilic bacteria in recent years [17,18]. Dictyoglomus tur-
gidum, a hypertermophilic bacterium, is regarded as a treasury of
thermostable and sugar-tolerant glycosidase genes. To date, several β-
glucosidases have been cloned, characterized and purified from Dic-
tyoglomus turgidum [19,20]. However, β-xylosidases from Dictyoglomus
turgidum have rarely been reported. Therefore, the discovery of ther-
mostable β-xylosidases with high substrate specificity from Dictyo-
glomus turgidum has become the focus of our current work, with im-
portant research significance and value.
The substrates pNP-β-D-xylopyranoside (pNPX), pNP-β-D-glucopyr-
anoside (pNPG), oNP-β-D-glucopyranoside (oNPG), pNP-β-D-galacto-
pyranoside (pNPGal), pNP-α-L-rhamnopranoside (pNPR), pNP-a-L-ara-
binofuranoside (pNPArf) and pNP-a-L-arabinopyranoside (pNPArp)
were purchased from Sigma-Aldrich (USA). 7-β-Xylosyl-10-deacetyla-
taxol (> 98% Purity, HPLC) and 10-deacetylataxol (> 98% Purity,
HPLC) were purchased from Chendu Institute of Biology, CAS (www.
cdmust.com).
2.3. Plasmid constructions and DNA manipulation
Paclitaxel (Taxol), isolated from the bark of Taxus brevifolia, is a
kind of diterpenoid that plays an essential role in the treatment of some
cancers, such as breast cancer, non-small cell lung cancer, advanced or
recurrent cervical cancer, and others [21–23]. Paclitaxel is distributed
in many Taxus species; however, paclitaxel in yew plants is present in
very small quantities, at only 0.01%-0.02% by weight from stem bark
The β-xylosidase-encoding gene Dt-xyl3 (Accession No.
ACK42995.1) with a size of 2268 bp was amplified from Dictyoglomus
turgidum DSM 6724 genomic DNA by PCR with the primers Dt-xyl3-F (
CGCCATATGGAGAAAGAAAAGATTGAGGAG) and Dt-xyl3-R (CCGCTC
GAGTTTTACTATGAAAAATCCCTT). The restriction enzyme sites are
the underlined sequences. The PCR products were digested with NdeI
and XhoI and subcloned into the pET-20b vector, finally yielding the
expression plasmid pET-20b-Dt-xyl3.
[
24]. In addition, the chemical synthesis route of paclitaxel is compli-
cated, the reaction conditions are difficult to control and the synthesis
yield is very low [25]. All of the above reasons have hindered the ex-
tensive application of paclitaxel in the clinic. Fortunately, the contents
of other toxoids such as 7-β-xylosyl-10-deacetylataxol (7-XDT) and its
analogues are much higher than paclitaxel, up to 0.5% by weight,
which is 20–50 times that of paclitaxel [26]. By removing the C-7 xy-
lose, the product 10-deacetylataxol (DT) can be used for the semi-
synthesis of paclitaxel [27]. Compared with chemical methods to re-
move the C-7 xylose from 7 to XDT, biological methods (enzymatic
catalysis processes) are more efficient and environmentally friendly.
Cheng et al. [28] isolated the glycoside hydrolase Lxyl-p1-2 from Len-
tinula edodes and used it to convert 7-β-xylosyltaxanes with a bio-
conversion rate of approximately 80%. Dou et al. [29] reported a novel
cellulosome-like multienzyme complex produced by Cellulosimicrobium
cellulans that undertook efficient glycoside hydrolysis of water-in-
soluble 7-xylosy-10-deacetylpaclitaxel.
DNA manipulation followed standard operating procedures. A Gel
Extraction Kit and a Plasmid Kit (Axygen, USA) were used for purifying
the PCR products and plasmids. DNA restriction enzymes (NdeI and
XhoI), T4 DNA ligase and Ex-taq polymerase were purchased from
TaKaRa (Dalian, China). DNA transformation was manipulated by steps
for heat shock transformation at 42 °C for 2 min.
2.4. Nucleotide sequence and structural analyses of Dt-xyl3
The nucleotide sequences of Dt-xyl3 and other known β-xylosidase
genes were analyzed by the multiple sequence alignment tool Clustal
X1.9. Databases were searched by using BLAST (www.blast.ncbi.nlm.
nih.gov/Blast.cgi) at NCBI and against CAZy.
The protein sequences were submitted to Swiss Model (www.
swissmodel.expasy.org) and I-TASSER (www.zhanglab.ccmb.med.
umich.edu/I-TASSER) for protein structure homology modeling.
Tertiary structures and predicted active catalytic centers of GH3 β-xy-
losidase Dt-xyl3 were visualized using Swiss-Pdb Viewer and analyzed
by PyMOL.
In this study, we cloned, expressed and characterized a novel
thermostable GH3 multifunctional enzyme β-xylosidase/glucosidase/
arabinosidase from Dictyoglomus turgidum. This enzyme displayed
highly selective hydrolysis performance in removing the outer C-7 xy-
lose of 7-xylosy-10-deacetylpaclitaxel. These extraordinary properties
make Dt-Xyl3 more suitable for preparation of 10-deacetylpaclitaxel
and its analogues, which are widely used in the pharmaceutical and
commercial industries.
2.5. Expression and enzyme purification
E. coli BL21 (DE3) with the recombinant plasmid pET-20b-Dt-xyl3
was grown in LB ampicillin medium at 37 °C (180 r/min in an orbital
shaker). The cells were induced with isopropyl-β-D-thiogalactopyrano-
side (IPTG) to a final concentration of 0.1 mM with an optical density at
OD600 of approximately 0.8, and the bacteria were further incubated at
25 °C for approximately 12 h.
2
. Materials and methods
2
.1. Bacterial strains and plasmids
Dictyoglomus turgidum DSM 6724 was purchased from Deutsche
Sammlung von Mikroorganismen und Zelkulturen (www.dsmz.de).
The bacteria (200 mL) were harvested by centrifugation at 5,
000 × g (4 °C) for 10 min, washed several times with distilled water and
resuspended in 20 mL of 1 × binding buffer (5 mM imidazole, 0.5 mM
NaCl, and 20 mM Tris-HCl buffer, pH 7.9). The soluble proteins con-
taining recombinant Dt-xyl3 were obtained by ultrasonication, heat-
treated at 75 °C for 30 min and then cooled in an ice bath and
Escherichia coli BL21 and Top10F’ cells were grown in Luria-Bertani
(
LB) broth at 37 °C. BL21-pET-20b-Dt-xyl3 was constructed in our lab
by transforming the host strain E. coli BL21 with the recombinant
plasmid pET-20b-Dt-xyl3 (restriction enzyme cutting sites up- and
downstream were NdeI and XhoI, respectively) encoding the Dt-Xly3
2

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
centrifuged at 8000 × g (4 °C) for 30 min. Finally, the supernatants
were purified with a Ni-nitrilotriacetic acid (NTA) affinity column
was 200 μL and contained sodium phosphate buffer (50 mM, pH 5.0),
1 g/L 7-XDT (DMSO as a solvent) and 0.5 U/mL (relative to final en-
zyme dosage) β-xylosidase. The reaction system was incubated at 75 °C
for 30 min, then suspended in an ice bath and stopped by adding 400 μL
of methanol. After centrifugation at a speed of 8 000 r/min, the me-
thanol extract of this material was assayed by HPLC. The control was
created using only substrate without enzyme.
(
Novagen, USA), and the enzyme protein was collected by eluting with
1
× binding buffer (pH 7.9). The target protein was examined by 12%
SDS-PAGE gel and stained with Coomassie brilliant R-250, and the
protein bands were analyzed by density scanning with an image ana-
lysis system (Bio-Rad, USA) [32]. The purified protein concentration
was measured by a Bradford protein Assay Kit (Sangon Biotech, China)
using albumin from bovine serum as a standard.
For comparing the conversion efficiency of different β-xylosidases to
7-XDT, the kinetic constants of Dt-xyl3, Xln-DT, Dth3, Tth XyB3, Tth
Xyl and Tpe Xln3 were determined with 7-XDT as the substrate at
concentrations of 0.1–3 g/L.
2.6. β-Xylosidase assay and biochemical characterization
To select suitable transformation conditions, the effects of the main
factors (temperature, pH, enzyme dosage, 7-β-xylosyl-10-deacetyla-
taxol concentration and enzymatic transformation time) were in-
vestigated. The variation ranges were as follows: temperature ranging
from 50 to 90 °C, pH value ranging from 4.0 to 7.0, enzyme dosage of
0.1–4 U/mL, 7-β-xylosyl-10-deacetylataxol concentration of 0.5–5 g/L
and enzymatic transformation time (5 min, 10 min, 15 min, 20 min,
30 min, 60 min and 120 min). The molar bioconversion rate of 7-XDT to
DT, expressed as molar conversion (%), was calculated by the following
pNP method. The reaction mixture contained the following: 10 μL of
0 mM substrate pNPX dissolved in sodium phosphate buffer (50 mM,
2
pH 6.0), 180 μL of sodium phosphate buffer (50 mM, pH 6.0) and 10 μL
of purified enzyme. The reaction was carried out at 75 °C for 10 min,
and the reaction was quenched by adding 600 μL of Na
2
CO (1 M) [6].
3
The enzymatic activity was immediately measured by detecting the
liberated pNP at 405 nm. For every sample, the activity was measured
three separate times. One unit of β-xylosidase activity (1 U) was defined
as the amount of enzyme required to liberate 1 μmol of pNP per minute
under the above assay conditions, which is consistent with the litera-
ture reference [17].
formula: Molar conversion (%) = [C
i
/M
i
]/[C
t
/M
t
] × 100, where C and
i
M
i
are the initial concentration and molar mass of 7-XDT, respectively,
and C
t
and M are the DT concentration and the molar mass of DT after
t
The purified Dt-xyl3 was biochemically characterized using pNPX as
the substrate. The activity of purified Dt-xyl3 was measured at 65–90 °C
per 5 °C at pH 5.0 (50 mM citric acid/sodium citrate buffer). To esti-
mate enzyme thermostability, Dt-xyl3 was preincubated without sub-
strate at 65, 75, and 85 °C for 2 h (every 30 min), and then the residual
β-xylosidase activity was determined at 75 °C and pH 5.0 (50 mM citric
acid/sodium citrate buffer). The activity of the enzyme without pre-
incubation was defined as 100%. The optimum pH was evaluated by
incubation at 75 °C for 10 min in citric acid/sodium citrate buffer and
sodium phosphate buffer (50 mM) with various pH values (pH 4.0–7.5).
To estimate enzyme stability at pH 4.0–7.5 in citric acid/sodium citrate
buffer and sodium phosphate buffer, the purified Dt-xyl3 was pre-
incubated in different buffers without substrate at 4 °C overnight. After
time t, respectively. The concentrations of 7-XDT and DT were calcu-
lated according to standard equations (y = 8189.3X + 342.63,
2
2
R = 0.9991 for 7-XDT and y = 5933.1X + 132.29, R = 0.9995 for
DT).
2.8. Assay of 7-XDT and DT by HPLC
7-XDT and DT were analyzed using an Agilent HPLC 1260 system
(USA) and
a
C18 column (4.6 × 250 mm; i.d., 5 μm; S.No.
USNH017518, USA) with distilled water (A) and acetonitrile (B) as the
mobile phase. A 25-min binary gradient elution was performed. An
isocratic elution of 44% solvent B lasted for the initial 10 min; a linear
gradient elution of 44–48% solvent B was performed from 10 to 13 min,
followed by a linear gradient elution of 48–100% solvent B from 13 to
18 min; and finally, the column was returned to its starting condition in
7 min. The injection volume was 20 μL for each sample, the flow rate
was 1 mL/min, and absorbance at 230 nm was monitored.
2
5
4 h, the residual β-xylosidase activity was determined at 75 °C and pH
.0 (50 mM citric acid/sodium citrate buffer).
Enzymatic activity was detected in the presence of various xylose,
glucose and arabinose concentrations (10, 20, 30, 50, 80, 100, 200, 300
and 500 mM) and different concentrations of NaCl (3.0–30.0%, w/v).
The effects of adding different ions or chemical reagents on the β-xy-
3. Results and discussion
3
+
2+
2+
+
+
3+
losidase activity of purified Dt-xyl3 were evaluated. Fe , Ni , Na
,
,
2
+
2+
2+
+
2+
2+
2+
2+
Sr , Ca , Cu , Li , Co , Zn , Mn , Mg , Ba , K , Al
3.1. Cloning, sequence, and structural analysis of the β-xylosidase gene Dt-
xyl3
+
NH
4
and the chemical agent EDTA were assayed at final concentra-
tions of 1 mM and 5 mM in the reaction mixture. The activity of purified
Dt-xyl3 was measured with the addition of organic solvents (methanol,
ethanol or DMSO) at final concentrations of 5%, 10%, 15%, 20%, 25%,
According to the complete genome sequence analysis of
Dictyoglomus turgidum DSM 6724, a putative protein with possible β-
xylosidase/glucosidase/arabinosidase activity (GenBank accession No.
ACK42995.1) was found. The gene fragment of Dt-xyl3 was obtained
with primers Dt-xyl3-f and Dt-xyl3-r using cDNA as the template. The
full-length gene of Dt-xyl3 was shown to be 2268 bp and encoded 756
amino acids with a predicted MW of 83.9 kDa. To date, more than 130
families have been classified as glycoside hydrolases [9]. Homologous
amino acid sequences of the deduced Dt-xyl3 and other foregone β-
xylosidase proteins were searched in GenBank. To determine the evo-
lutionary relationships among the β-xylosidases, phylogenetic trees
were constructed by using the Neighbor-Joining (NJ) method. The NJ
trees showed that there were seven clades, and each clade was com-
posed of a separated monophyletic group (Fig. 1). Among them, Clade I
was the β-xylosidases from bacteria, archaea and fungi, which belong to
GH3. GH3 β-xylosidase and β-glucosidase enzymes are pivotal for the
degradation of hemicellulosic biomass and other natural active sub-
strates, such as the GH3 β-xylosidase/α-arabinosidase from Thermotoga
thermarum [17], which exhibited high hydrolytic activity on xylooli-
gosaccharides, and the β-glucosidase from Thermotoga petrophila [8]
3
0%, 40% and 50% in the mixture. The purified Dt-xyl3 was pre-
incubated with each reagent for 10 min at 75 °C before adding into
pNPX. The activity of the enzyme without the metal ions, chemical
reagent and organic solvents was defined as 100%.
The substrate specificity of the purified enzyme was tested by using
pNPX, pNPG, oNPG, pNPGal, pNPR, pNPArf and pNPArp. The kinetic
parameters of purified Dt-xyl3 were determined at 75 °C using pNPX as
the substrate at various final concentrations ranging from 0.2 to 8 mM
prepared in pH 5.0 citric acid/sodium citrate buffer under standard
reaction conditions [17]. The data were analyzed by nonlinear regres-
sion using the Michaelis-Menten equation.
2
.7. Enzymatic transformation of 7-β-Xylosyl-10-deacetylataxol
For 7-β-Xylosyl-10-deacetylataxol as the substrate, six purified β-
xylosidases (Dt-xyl3, Xln-DT, Dth3, Tth XyB3, Tth Xyl and Tpe Xln3)
were compared to hydrolyze 7-XDT with the enzymatic transformation
reaction mixture. The volume of the transformation reaction mixture
3

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Fig. 1. Neighbor-joining (NJ) tree results from the analysis of the β-xylosidase Dt-xyl3 with 29 amino acid sequences. (Numbers on nodes correspond to percentage
bootstrap values for 1000 replicates).
with high ginsenoside Rb1 to ginsenoside 20(S)-Rg3 bioconversion
productivity. In the NJ trees, the β-xylosidase Dt-xyl3 had a distant
relationship with other β-xylosidases that belonged to the GH3 family.
Dt-xyl3 had the highest sequence similarity of 88.58% with the β-glu-
cosidase from Dictyoglomus thermophilum (GenBank accession No.
WP_012548714.1). Although these enzymes belong to the GH3 family,
the sequence similarity differs greatly. The multiple amino acid se-
quence alignment indicated that Dt-xyl3 had a sequence similarity of
4.46 and 8.64; a Z-score > 1 implies good alignment and vice versa.
The confidence of each model was quantitatively measured based on
the C-score calculated by the significance of threading template align-
ments and convergence parameters of the structure assembly simula-
tions. The C-score is generally within the [-5–2] range, where a C-score
of a higher value indicates a model with a higher confidence and vice
versa. In this paper, the C-scores based on PDB 5YOTA and 5Z87A were
0.77 and −0.60, respectively, which indicated that the final model
predicted by I-TASSER was realistic. TM-score was estimated by C-score
and protein length following the correlation observed between these
qualities. Since the 2 proteins (5YOTA and 5Z87A) from the PDB were
ranked by cluster size, the TM-scores followed by 5Z87A and 5YOTA
were 0.932 and 0.920, respectively. The ligand binding sites according
to the template of PDB 3WLKX were 138GLU, 186LEU, 200ARG,
233LYS, 234HIS, 278MET, 281TYR, 313ASP, 314TYR, 346LEU and
517GLU (Fig. 2).
4
2% with the β-xylosidases from bacteria such as Thermotoga petro-
phila RKU-1 (GenBank accession No. ABQ46867.1) and Thermotoga
thermarum (GenBank accession No. WP_01393146.1), 44% with the β-
xylosidases from archaea such as Caldanaerobius polysaccharolyticus
(
(
GenBank accession No. AFM44649.1) and Sulfolobus solfataricus P2
GenBank accession No. AAK43134.1), and 24% with the β-xylosidases
from fungi such as Aspergillus sp.BCC125 (GenBank accession No.
AGB57183.1) and Lentinula edodes (GenBank accession No.
AET31457.1). The detailed multiple amino acid sequence alignment of
Dt-xyl3 with the previously reported enzymes described above is shown
in Fig. S1. Clade II to Clade VII were β-xylosidases belonging to 30, 39,
The full sequence of the β-xylosidase gene Dt-xyl3 was ligated into
the expression vector pET-20b at NdeI and XhoI to generate the plasmid
pET-20b-Dt-xyl3. Then, a positive E. coli colony with recombinant
plasmid pET-20b-Dt-xyl3 was finally introduced to express recombinant
Dt-xyl3 with 0.1 mM isopropyl β-D-thiogalactoside (IPTG) for approxi-
mately 12 h at 25 °C. Among the expressed proteins, soluble expression
accounted for approximately 14.3%, while the remaining 86.7% was
inclusion bodies (data were not shown). During 12 h of incubation,
cultures grown on IPTG reached a maximum β-xylosidase activity of 2.4
U/mL in LB medium.
4
3, 52, 54 and 120, of which most were from thermophilic bacteria.
The members of the thermophilic genus Dictyoglomus turgidum had a
5
9–68% distant relationship with the genera of Clade II, Clade III, Clade
VI and VII, which suggested that its enzymatic properties might be
distinct. Based on the analysis of Dt-xyl3 with Blast and NJ trees, this
protein could be a member of the GH3 family.
Dt-xyl3 of I-TASSER modeling started from the structure templates
identified by LOMETS from the PDB library. The homology model of Dt-
xyl3 was built using templates of the highest significance in the
threading alignments, which were measured by the Z-score. The tem-
plates in this section were the 2 best templates (PDB 5YOTA and
3.2. Purification and characterization of recombinant β-xylosidase Dt-xyl3
To study the biochemical properties and characteristics of any en-
5
Z87A) selected from the LOMETS threading programs with Z-scores of
zyme, protein purification is an essential step. The crude β-xylosidase
4

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Fig. 2. Tertiary structures of the GH3 β-xylosidase Dt-xyl3 from Dictyoglomus
turgidum and predicted active center sites. (138GLU, 186LEU, 200ARG, 233LYS,
2
34HIS, 278MET, 281TYR, 313ASP, 314TYR, 346LEU, 517GLU).
Dt-xyl3 was purified by heat treatment and Ni2+-affinity column
chromatography with a final purification of 3.07-fold and a yield of
5
7.7% (detailed purification results from a 200-mL culture are shown in
Table 1). After all purification preparations, the expressed protein was
shown as a single band on a 12% SDS-PAGE gel with a molecular mass
of more than 75 kDa without other bands (Fig. 3), which corresponded
to the predicted molecular mass of the monomer (83,916 Da).
Fig. 3. SDS-PAGE analysis of recombinant β-xylosidase Dt-xyl3 expressed in E.
coli BL21 (DE3). Lane Marker: protein marker; Lane 1: the crude extract of E.
coli BL21 (DE3) harboring pET-20b; Lane 2: the crude extracts of β-xylosidase
Dt-xyl3; Lane 3: the cell extracts after sonication were heat-treated at 75 °C for
30 min; Lane 4: purified β-xylosidase Dt-xyl3 by Ni-NTA resin affinity chro-
matography.
The specific activity of the purified Dt-xyl3 was measured by using
substrates at 1.0 mM (pNPX, pNPG, oNPG, pNPGal, pNPR, pNPArf and
pNPArp) at 75 °C and pH 6.0 (Table 2). The K and Vmax of the enzyme
m
using pNPX as the substrate were 0.8316 mM and 5.0178 μmol/mL·min,
respectively, followed by pNPArf, pNPG and pNPArp. The purified Dt-
xyl3 was not active with oNPG, pNPGal and pNPR. The kinetic para-
meters were measured from Lineweaver-Burk double reciprocal plots,
which suggested that Dt-xyl3 has highly specific activity on residual
xylose. The enzyme can hydrolyze xylobiose and cellobiose to produce
xylose and glucose (Fig. S2).
Table 2
Kinetic parameters of recombinant Dt-xyl3 towards various chromogenic sub-
strates as measured by pNP release at 75 °C.
a
Substrate
Kinetic parameters
The relative enzymatic properties of the purified β-xylosidase Dt-
xyl3 were determined by using pNPX as the substrate. The optimal
temperature for Dt-xyl3 was revealed to be 75 °C (Fig. 4a), which was
similar to the GH39 β-xylosidase Xln-DT from Dictyoglomus thermo-
philum but significantly higher than the GH3 β-xylosidase Lxyl-p1-2
from Lentinula edodes and the β-xylosidase from Aspergillus niger USP-67
Km (mM)
Vmax (μmol/mL·min)
p-Nitrophenyl-β-D-xylopyranoside
p-Nitrophenyl-β-D-galactopyranoside
p-Nitrophenyl-α-L-arabinofuranoside
p-Nitrophenyl-α-L-arabinopyranoside
p-Nitrophenyl-α-L-rhamnopyranoside
p-Nitrophenyl-β-D-glucopyranoside
0.8316
5.0178
b
ND
2.014
2.4319
ND
7.542
13.595
[
28,33]. In industrial applications, enzyme heat resistance has been a
2.394
2.8672
bottleneck for economically viable enzyme use. Thus, enzyme ther-
mostability has become an appreciable property in practical processes.
The thermal stability of Dt-xyl3 was evaluated at 65, 75 and 85 °C
a
b
Final concentration of each was 1.0 mM.
Not determined, spectific activity is not determined by the analytical
(
Fig. 4b). The Dt-xyl3 was highly stable at 65 °C for 2 h, keeping almost
methods used in this study.
9
0% of its initial activity when incubated below 65 °C for 60 min.
However, the thermostability of Dt-xyl3 significantly decreased above
from Phanerochaete chrysosporium [34] but significantly lower than the
GH43 β-xylosidases from Thernonyces lanuginosus and Humicola insolens
Y1 [35,36]. Moreover, the pH stability of Dt-xyl3 was excellent at 2, 6,
7
5 °C over 30 min and was completely lost at 85 °C after 30 min. The
purified β-xylosidase Dt-xyl3 had the highest enzyme activity at pH 5.0
after testing a pH range of 4.0–7.5 (Fig. 4c), which was similar to the
GH3 β-xylosidase from Neurospore crassa [18] and GH43 β-xylosidase
1
2 and 24 h, respectively. Thus, the enzyme can maintain excellent pH
Table 1
Purification of recombinant protein Dt-xyl3.
Purification step
Total activity (U)
Total protein (mg)
Specific activity (U/mg)
Yield (%)
Fold purification
Culture extract
575.3
389.6
332.2
260.3
68.59
48.82
2.21
5.68
6.79
100
1
a
Heat treatment
67.7
57.7
2.57
3.07
Ni affinity chromatography
Substrate for Dt-xyl3 was p-Nitrophenyl-β-D-xylopyranoside.
a
The cell extracts after sonication were heat treated at 75 °C for 30 min, and then cooled in an ice bath, centrifuged at 8,000 g for 10 min at 4 °C and the
supernatant was kept.
5

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Fig. 4. Characterization of the recombinant β-xylosidase Dt-xyl3. (a) Effect of optimum temperature on Dt-xyl3 activity; (b) The thermostability of the enzyme Dt-
xyl3 (the residual activity was monitored while the enzyme was incubated at 65 °C (filled diamond), 75 °C (filled triangle), and 85 °C (flled roundness); the maximum
activity was defined as 100%); (c) Effect of optimum pH on Dt-xyl3 activity; (d) pH stability of the enzyme Dt-xyl3.
stability over 12 h and even over 24 h. The activity of Dt-xyl3 was
gradually reduced to 80% at pH 4.0–5.5 after 24 h and was over 100%
at pH 6.0–7.5, respectively (Fig. 4d). This remarkable pH stability is
highly favorable in many industrial applications.
25–35% is hemicelluloses. In these materials, the main hemicellulosic
polymers are arabinoxylans, with a high content of xylose and lower
content of arabinose. Therefore, β-xylosidase with high xylose, arabi-
nose and glucose tolerance can quickly alleviate the feedback inhibition
of sugar to xylooligosaccharides, thus accelerating the hydrolysis of
xylooligosaccharides [39]. Previously, many NaCl-tolerant (18–20%
NaCl concentrations) endo-β-xylanases have been reported with po-
tential applications in soy sauce production, which can cut the total cost
and optimize sterilization processes [40]. So far, however, there have
been few reports of halophilic β-xylosidases [41,42]. In this study,
when the NaCl concentration was under 10% (w/v), the purified Dt-
xyl3 was activated by 132.4%-156.3%. In the presence of 15% NaCl,
the β-xylosidase activity of Dt-xyl3 decreased by 88.9% (Fig. 5b). With
the continuous increase of NaCl concentration, the β-xylosidase activity
of Dt-xyl3 was severely inhibited, which was similar to the GH39 β-
xylosidase from Sphingomonas [41]. The excessive tolerance of β-xylo-
sidase to organic solvents (methanol, ethanol and DMSO) is one of the
key factors for the use of β-xylosidase as a natural and efficient catalyst
in the production of biomass and the bioconversion of other active
substances. Enzymes with high organic solvent tolerance are affected at
higher concentrations of organic solvents, which indicates prominent
K is the sugar inhibition coefficient, which is defined as the con-
i
centration of sugar when the residual enzyme activity is 50%. The
higher the value of K , the stronger the sugar tolerance of the enzyme
i
[
6,17]. Xylose-tolerant β-xylosidase is thought to be useful for bio-
chemical application fields because xylose is a strong inhibitor of β-
xylosidase during enzymatic hydrolysis. Unfortunately, the majority of
β-xylosidases from fungi are sensitive to xylose, such as those from
Neurospora crassa [15], Trichoderma reesei [37] and Aspergillus oryzae
[
38], which display K values for xylose of 1.72, 2.3 and 2.72 mM, re-
i
spectively. The bacterial β-xylosidase Dt-xyl3 from Dictyoglomus tur-
gidum was insensitive to inhibition with K values of 20 mM xylose,
i
5
0 mM glucose and 500 mM arabinose, which were 7.35–11.63 times
higher than those of the above β-xylosidases (Fig. 5a). Agricultural
wastes, such as bagasse and corncob, are abundant and cheap lig-
nocellulose materials that are used to solve problems in the sugar in-
dustry and biofuel ethanol industry. These agricultural wastes are
formed by cellulose, hemicelluloses and lignin, of which approximately
Fig. 5. Activity of purified β-xylosidase Dt-xyl3. (a) Effect of xylose (flled roundness), glucose (filled diamond) and arabinose (filled squared) on the activity of Dt-xyl3;
(
b) Effect of NaCl on the activity of Dt-xyl3; (c) Effect of methanol (filled roundness), ethanol (filled squared) and DMSO (filled triangle) on the activity of Dt-xyl3.
6

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Table 3
formation of intra- and inter-molecular di-sulfide bonds or sulfenic acid
[44]. In addition, β-xylosidase enzyme activities were inhibited to
varying degrees at a metal ion concentration of 5 mM and almost
Effects of metal cations and reagents on the recombinant Dt-xyl3 activity.
Cation of reagent
Relative enzyme activity (%)
3
+
2+
completely inhibited by 5 mM Al . The addition of Mn
enhanced
1
mM
5 mM
the β-xylosidase enzyme activity by 59.2% and 41.0% at 1 mM and
mM, respectively, which was similar to the results obtained for α-
mannosidase from hen oviduct and β-xylosidase from Dictyoglomus
5
Contrast
100
100
3
+
+
Fe
Ni
106.9
90.6
90.7
22.7
113.4
116
2
+
thermophilum, possibly because Mn
may activate and protect the
+
Na
112.8
112.6
107.4
66.3
active center of β-xylosidases [6]. At different concentrations of EDTA
2
+
Sr
(
1 or 5 mM), there were no significant inhibition effects on enzyme
2
2
+
+
Ca
Cu
97.3
9.9
activity, which indicated that the chelating agent EDTA did not notably
affect β-xylosidase activity.
+
2
Li
98.2
95.8
74.2
60.3
141
+
+
+
+
+
Co
117.4
110.3
159.2
109.6
114.2
107.8
89.9
2
Zn
3.3. Screening of β-xylosidases for the biotransformation of 7-XDT
2
2
Mn
Mg
41.3
103.4
109.8
71.7
9.5
2
Paclitaxel is known as a “blockbuster drug”, showing outstanding
Ba
+
K
activity against various cancers including breast, lung, cervical cancers
and AIDS-related Kaposi sarcoma [45–47]. However, its content is ex-
tremely low when isolated from the bark of the tree yew. A hundred-
year-old Taxus can provide only a 300-mg dose of paclitaxel. Further-
more, the chemical synthesis of paclitaxel is complicated, and it is
difficult to improve the purity due to its numerous byproducts. The
content of 7-β-xylosyl-10-deacetylataxol, the by-product simulta-
neously extracted with paclitaxel, can be as high as 0.5%, which is
EDTA
Al
NH
3
+
35.3
+
4
93.4
94
Values shown were the mean of duplicate experiments, and the variation about
the mean was below 5%.
application advantages in the field of non-aqueous phase biocatalysis.
For example, saccharification and fermentation need to be synchro-
nized in the preparation of bioethanol, and some organic reagents are
often used to aid the dissolution of natural active substances in enzy-
matic conversion systems. In this study, organic solvents (methanol,
ethanol and DMSO) affected the activity of the β-xylosidase Dt-xyl3.
The residual enzyme activity was over 100% with low concentrations of
methanol and ethanol (10%, w/v), which was similar to the β-xylosi-
dase Xln-DT from Dictyoglomus thermophilum and the β-glucosidase from
Thermotoga petrophila [6,8]. With increasing concentrations of organic
solvent, enzyme activity was inhibited slowly (Fig. 5c). When the
concentrations of methanol and ethanol were over 30%, the residual
enzyme activity decreased to 50%. The inhibitory effects of three or-
ganic reagents on β-xylosidase Dt-xyl3 were as follows: DMSO >
methanol > ethanol. The results suggested that β-xylosidase Dt-xyl3
could be more suitably used in some industrial applications.
2
5–50 times that of paclitaxel. 7-β-xylosyl-10-deacetylataxol can be
hydrolyzed via biological or chemical methods to obtain 10-deace-
tyltaxol for the semi-synthesis of paclitaxel. Compared with organic
reagents such as periodate or other strong acids applied in chemical
methods, the bioconversion principle uses enzymes as biocatalysts to
remove xylose groups, a process that is therefore considered to be mild
and environmentally friendly (the transformation diagram is shown in
Fig. S3). Up to now, only a few of the GH3 family β-xylosidases, such as
Lxyl-p1-1 and Lxyl-p1-2 from Lentinula edodes, have been reported to
have the ability to hydrolyze 7-XDT to form DT [28].
It is universally known that the catalytic activities of β-xylosidases
from different sources and families vary greatly due to their different
structures. For instance, Tth XyB3 from Thermotoga Thermarum can cut
xylooligosaccharide but not remove the C-6 xylose moiety on noto-
ginsenoside R1 [17], and Tpe Xln3 from Thermotoga petrophila can
hydrolyze ginsenoside Rb2 and Rc to ginsenoside Rd but not cut the
xylose moiety of astragaloside IV at the C-3 position [8]. Therefore, in a
study that screened for the best β-xylosidases that can specifically
cleave the outer xylose moiety at position C-7 of 7-XDT, six β-xylosi-
dases (Dt-xyl3 from Dictyoglomus turgidum, Xln-DT from Dictyoglomus
thermophilum, Dth3 from Dictyoglomus thermophilum, Tth XyB3 from
Thermotoga Thermarum, Tth Xyl from Thermoanaerobacterium sacchar-
olyticum and Tpe Xln3 from Thermotoga petrophila, the detailed in-
formation is shown in Table 4) were used to biotransform 7-XDT. As
shown in Table 4, only 4 GH3 family β-xylosidases could biotranform 7-
XDT (the molar conversion rates of 7-XDT hydrolyzed by Dt-xyl3, Dth3,
Tth xyB3 and Tpe Xln3 β-xylosidases were 98.0%, 86.1%, 42.3% and
Furthermore, as shown in Table 3, the effects of metal ions and
chemical reagents on the β-xylosidase enzyme activities of Dt-xyl3 were
determined using pNPX as the substrate with final concentrations of
1
mM and 5 mM, and enzyme solution without metal ions and chemical
reagents was used as the control. At 1 mM, most metal ions did not
2
+
3+
inhibit the activity of β-xylosidase Dt-xyl3 except Cu
which was similar to the β-xylosidases from Aspergillus niger ADH-11
11], Cellulosimicrobium cellulans sp.21 [43] and Dictyoglomus thermo-
and Al
,
[
philum [6]. β-Xylosidase Dt-xyl3 activities were strongly inhibited up to
2
+
6
6.3% and 9.9% in the presence of 1 mM and 5 mM Cu , respectively.
2+
The cause of this phenomenon may be because Cu
is known to cat-
alyze the auto-oxidation of cysteine molecules, which leads to the
3
6.8%, respectively, in 30 min), and GH39 β-xylosidase Xln-DT from
Table 4
Kinetic parameters of β-xylosidase activity of Dt-xyl3 and other β-xylosidases.
Name
Source
GH family
Sequence homology (%)
Kinetic parameters
(mM) max (μM/min)
Refs.
K
m
V
K
cat (s−1)
Kcat/K
m
(s−1/mM)
a
Dt-xyl3
Dth3
Dictyoglomus turgidum
Dictyoglomus thermophilum
Thermotoga Thermarum
Thermotoga petrophila
3
100
0.031
4.021
0.334
0.521
ND
16.667
20.00
3.437
0.609
0.029
0.002
110.87
0.151
0.087
0.004
This study
[30]
3
29.99
41.99
9.63
Tth XyB3
Tpe Xln3
Tth Xyl
Xln-DT
3
1.667
[17]
3
0.0125
[8]
Thermoanaerobacterium saccharolyticum
Dictyoglomus thermophilum
Lentinula edodes
120
39
3
12.30
9.13
This study
[6]
ND
Lxyl-p1-1
Lxyl-p1-2
21.25
21.84
2.9
1.51
3.34
0.87
1.92
0.30
1.07
[28]
Lentinula edodes
3
1.79
[28]
7

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Fig. 6. Optimal conditions for the hydrolysis of the C-7 xylosidic bond of 7-XDT. (a) Effect of pH; (b) Effect of temperature; (c) Effect of enzyme dosage; (d) Effect of
-XDT concentration.
7
Dictyoglomus thermophilum and GH120 β-xylosidase Tth Xyl from
Thermoanaerobacterium saccharolyticum had no enzymatic activity for 7-
approximately 100%. With a concentration of 7-XDT up to 5 g/L, the
bioconversion rate dropped below 10%, which showed that a high
concentration of substrate could inhibit the activity of β-xylosidase Dt-
xyl3. Finally, the time-course biotransformation analysis of the enzy-
matic reaction by recombinant Dt-xyl3 is shown in Fig. 7a. A total of
1 g/L 7-XDT was transformed to its corresponding aglycone 10-dea-
cetyl-taxol within 30 min, with a molar conversion of 98%, which was
faster than the Lxyl-p1-1 and Lxyl-p1-2 (24 h) from Lentinula edodes
[28]. As shown in Fig. 7b, approximately all 7-XDT was converted into
DT without any byproducts that could be identified by HPLC. Thus, the
total production cost from 7 to XDT to paclitaxel can be greatly re-
duced. Taken together, our work provides a rapid and highly efficient
biocatalytic pathway to obtain DT for the semi-synthesis of taxol. All of
these results suggest that this recombinant Dt-xyl3 has great potential
for biotransformation to produce natural medicine.
XDT. The kcat/K ratio of Dt-xyl3 for 7-XDT was much higher than those
m
−1
of Dth3, Tth XyB3, Tpe Xln3, Lxyl-p1-1 and Lxyl-p1-2 (110.87 s /mM
−
1
versus 0.151, 0.087, 0.004, 0.30 and 1.07 s /mM, respectively), re-
presenting the fastest conversion efficiency of a β-xylosidase that can
specifically remove xylose at the C-7 position from 7 to XDT. The kcat
/
K ratio, which is called catalytic efficiency, reflects the affinity and
m
catalytic ability of enzymes for substrates at the same time. Hence, the
k
cat/K ratio is often used to compare different enzymes with the same
m
substrate. The larger the kcat, the faster the rate of enzymatic conver-
sion, and the smaller K , the greater the affinity between enzyme and
m
the substrate. As shown in Table 4, the kcat/K ratio of Dt-xyl3 for 7-
m
XDT was 103 to 370-fold higher than those of Lxyl-p1-1 and Lxyl-p1-2,
which indicated that Dt-xyl3 had the strongest catalytic activity for 7-
XDT among the reported GH3 β-xylosidases.
4
. Conclusions
3.4. Optimal conditions for the biotransformation of 7-XDT by Dt-xyl3
In this paper, a novel thermostable and halophilic multifunctional β-
To determine the optimal conditions for the bioconversion of 7-XDT
xylosidase/β-glucosidase/α-arabinosidase, Dt-xyl3 from Dictyoglomus
turgidum, was cloned and expressed in E. coli BL21 (DE3) to specifically
release xylose from 7 to XDT. Phylogenetic analysis showed that Xln-DT
had distant relationships with other β-xylosidases belonging to the GH
3 family. Enzymatic characterization indicated that Xln-DT had a high
optimal temperature and optimal pH of 5.0. Most importantly, there
was 50% inhibition at 20 mM xylose, 50 mM glucose and 500 mM
arabinose. Compared with the other GH3 β-xylosidases, Dt-xyl3 pos-
sessed higher efficiency in 7-β-xylosyl-10-deacetylataxol hydrolysis,
removing the xylose moiety at the C-7 carbon. This study indicates that
recombinant Dt-xyl3 would be suitable for producing natural medicine,
such as 7-β-xylosyl-10-deacetylataxol, and greatly improve the utiliza-
tion of 7-β-xylosyl-10-deacetylataxol for the semi-synthesis of taxol.
to DT, single factors (temperature, pH, enzyme dosage and substrate
concentration) were initially investigated. Considering the effects on
the β-xylosidase Dt-xyl3, 5% DMSO as the cosolvent for the above hy-
drolysis reaction did not affect enzyme activity. Within a 30-min re-
action time and with DMSO as the cosolvent, the optimal temperature
and pH for Dt-xyl3 against 7-XDT were 4.5 and 60 °C (Fig. 6a-b). With
higher enzyme dosages, higher completion rates for the bio-
transformation process were achieved. As shown in Fig. 6c, the optimal
enzyme dosage of Dt-xyl3 was 0.5 U/mL, and with a continuous in-
crease in enzyme dosage, the bioconversion rate did not increase sig-
nificantly. In addition, the substrate concentration was a critical factor
affecting the hydrolysis efficiency. Different concentrations of 7-XDT
(
from 0.5 g/L to 5 g/L) were incubated with Dt-xyl3 at a dosage of
0
.5 U/mL at 60 °C and pH 4.5 for 30 min (Fig. 6d). For Dt-xyl3, the
molar conversion rate was inhibited slightly at the high concentration
of 3 g/L 7-XDT with a 45.4% molar conversion rate. When the con-
centration of 7-XDT was below 3 g/L, the bioconversion rate was
Declaration of Competing Interest
The authors declare that they have no competing interests.
8

Q. Li, et al.
Bioorganic Chemistry xxx (xxxx) xxxx
Fig. 7. HPLC analysis of 7-XDT hydrolysis by Dt-xyl3. (a) A time-course of bioconversion of 7-XDT by Dt-xyl3; (b) 7-XDT (1 g/L) incubated with 0.5 U/mL Dt-xyl3 for
, 10 and 30 min.
0
Acknowledgements
Appendix A. Supplementary material
Yujie J and Xinyi T helped to performed purification and char-
acterization. Jianjun P helped to analyze the biotransformation of 7-
XDT and revise the manuscript. Linguo Z and Wei X directed the over-
all study and had given final approval of the version to be published. All
authors read and approved the final manuscript.
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.bioorg.2019.103357.
References
[
[
[
1] Suryani, T. Kimura, K. Sakka, K. Ohmiya, Sequencing and expression of the gene
encoding the Clostridium stercorarium β-Xylosidase Xyl43B in Escherichia coli, Biosci.
Biotechnol. Biochem. 68 (3) (2004) 609–614.
Funding
2] M.N. Aftab, A. Zafar, A.R. Awan, Expression of thermostable β-xylosidase in
Escherichia coli for use in saccharification of plant biomass, Bioengineered 8 (5)
(2017) 665–669.
This work was supported by the National Key Research
Development Program of China (Grant number 2016YFD0600805,
China); the Forestry Achievements of Science and Technology to
Promote Projects (Grant number [2017]10, China) and the 11th Six
Talents Peak Project of Jiangsu Province (Grant No. 2014-JY-011,
China).
3] M.C. Jonathan, J. DeMartini, S. Van Stigt Thans, R. Hommes, M.A. Kabel,
Characterisation of non-degraded oligosaccharides in enzymatically hydrolysed and
fermented, dilute ammonia-pretreated corn stover for ethanol production,
Biotechnol. Biofuels 10 (1) (2017).
[4] M. Michelin, M.D.L.T.M. Polizeli, D.S. Ruzene, D.P. Silva, H.A. Ruiz, A.A. Vicente,
J.A. Jorge, H.F. Terenzi, J.A. Teixeira, Production of xylanase and β-xylosidase from
9

Q. Li, et al.
autohydrolysis liquor of corncob using two fungal strains, Bioprocess Biosyst. Eng.
Bioorganic Chemistry xxx (xxxx) xxxx
deacetylbaccatin III-10-β-O-acetyltransferase catalytic fitness for Taxol production,
3
5 (7) (2012) 1185–1192.
Nat. Commun. 8 (2017) 15544.
[
[
5] L. Wang, Y. Chen, Efficient biotransformation of astragaloside IV to cycloastragenol
by Bacillus sp. LG-502, Appl. Biochem. Biotechnol. 183 (4) (2017) 1488–1502.
6] Q. Li, T. Wu, Z. Qi, L. Zhao, J. Pei, F. Tang, Characterization of a novel thermostable
and xylose-tolerant GH 39 β-xylosidase from Dictyoglomus thermophilum, BMC
Biotech. 18 (1) (2018).
[28] H.L. Cheng, R.Y. Zhao, T.J. Chen, W.B. Yu, F. Wang, K.D. Cheng, P. Zhu, Cloning
and characterization of the glycoside hydrolases that remove xylosyl groups from 7-
β-xylosyl-10-deacetyltaxol and its analogues, Mol. Cell. Proteom. 12 (8) (2013)
2236–2248.
[29] T.Y. Dou, H.W. Luan, G.B. Ge, M.M. Dong, H.F. Zou, Y.Q. He, P. Cui, J.Y. Wang,
D.C. Hao, S.L. Yang, Functional and structural properties of a novel cellulosome-like
multienzyme complex: efficient glycoside hydrolysis of water-insoluble 7-xylosyl-
10-deacetylpaclitaxel, Sci. Rep. 5 (1) (2015) 13768.
[
[
[
7] K.C. Shin, M.J. Seo, D.K. Oh, Characterization of β-xylosidase from
Thermoanaerobacterium saccharolyticum and its application to the production of
ginsenosides Rg1 and Rh1 from notoginsenosides R1 and R2, Biotechnol. Lett. 36
(
11) (2014) 2275–2281.
[30] Q. Li, T. Wu, L. Zhao, J. Pei, Z. Wang, W. Xiao, Highly efficient biotransformation of
Astragaloside IV to Cycloastragenol by sugar-stimulated beta-glucosidase and beta-
xylosidase from Dictyoglomus thermophilum, J. Microbiol. Biotechnol. (2018).
[31] C.H. Huang, Y. Sun, T.P. Ko, C.C. Chen, Y. Zheng, H.C. Chan, X. Pang, J. Wiegel,
W. Shao, R.T. Guo, The substrate/product-binding modes of a novel GH120 β-xy-
losidase (XylC) from Thermoanaerobacterium saccharolyticum JW/SL-YS485,
Biochem. J. 448 (3) (2012) 401–407.
8] S. Zhang, J. Xie, L. Zhao, J. Pei, E. Su, W. Xiao, Z. Wang, Cloning, overexpression
and characterization of a thermostable β-xylosidase from Thermotoga petrophila and
cooperated transformation of ginsenoside extract to ginsenoside 20(S)-Rg3 with a β-
glucosidase, Bioorg. Chem. 85 (2019) 159–167.
9] B. Henrissat, A classification of glycosyl hydrolases based on amino acid sequence
similarities, Biochem. J 293 (Pt 3) (1993) 781.
[
[
[
[
[
[
[
[
[
[
[
[
[
[
10] V.M. Benassi, R.C. de Lucas, J.A. Jorge, M.D.T.D. Polizeli, Screening of thermo-
tolerant and thermophilic fungi aiming beta-xylosidase and arabinanase produc-
tion, Brazil. J. Microbiol. 45 (4) (2014) 1459–1467.
[32] U.K. Laemmli, Most commonly used discontinuous buffer system for SDS electro-
phoresis, Nature 227 (1970) 680–688.
[33] V.M. Benassi, T.M.D. Silva, B.C. Pessela, J.M. Guisan, C. Mateo, M.S. Lima,
J.A. Jorge, M.D.L.T.M. Polizeli, Immobilization and biochemical properties of a
beta-xylosidase activated by glucose/xylose from Aspergillus niger USP-67 with
transxylosylation activity, J. Mol. Catal. B Enzym. 89 (5) (2013) 93–101.
[34] N.D. Huy, P. Thayumanavan, T.H. Kwon, S.M. Park, Characterization of a re-
combinant bifunctional xylosidase/arabinofuranosidase from Phanerochaete chry-
sosporium, J. Biosci. Bioeng. 116 (2) (2013) 152–159.
11] H. Patel, A.K. Kumar, A. Shah, Purification and characterization of novel bi-func-
tional GH3 family β-xylosidase/β-glucosidase from Aspergillus niger ADH-11, Int. J.
Biol. Macromol. 109 (2018) 1260–1269.
12] L. Song, W. Xia, P. Shi, X. Xu, L. Qian, Y. Cui, M. Xia, B. Yao, High level expression
of a novel family 3 neutral β-xylosidase from Humicola insolens Y1 with high tol-
erance to D-xylose, PLoS ONE 10 (2) (2015) e0117578.
13] Y. Ye, X. Li, J. Zhao, Production and Characteristics of a novel xylose- and alkali-
tolerant GH 43 β-xylosidase from Penicillium oxalicum for promoting hemicellulose
degradation, Sci. Rep. 7 (1) (2017).
[35] J.M. Corrêa, D. Christi, C.L.D. Torre, C. Henn, J.L.D. Conceição-Silva,
M.K. Kadowaki, R.D.C.G. Simão, High levels of β-xylosidase in Thermomyces lanu-
ginosus : potential use for saccharification, Brazil. J. Microbiol. 47 (3) (2016)
680–690.
14] X. Peng, H. Su, S. Mi, Y. Han, A multifunctional thermophilic glycoside hydrolase
from Caldicellulosiruptor owensensis with potential applications in production of
biofuels and biochemicals, Biotechnol. Biofuels 9 (1) (2016).
[36] X. Yang, P. Shi, H. Huang, H. Luo, Y. Wang, W. Zhang, B. Yao, Two xylose-tolerant
GH43 bifunctional β-xylosidase/α-arabinosidases and one GH11 xylanase from
Humicola insolens and their synergy in the degradation of xylan, Food Chem. 148
(148C) (2014) 381–387.
15] N. Kirikyali, I.F. Connerton, Heterologous expression and kinetic characterisation of
Neurospora crassa β-xylosidase in Pichia pastoris, Enzyme Microb. Technol. 57
(
2014) 63–68.
[37] I.D.L. Mata, P. Estrada, R. Macarron, J.M. Dominguez, M.P. Castillon, C. Acebal,
Chemical mechanism of β-xylosidase from Trichoderma reesei QM 9414: pH-de-
pendence of kinetic parameters, Biochem. J 283 (1992) 679–682.
[38] N. Kirikyali, J. Wood, I.F. Connerton, Characterisation of a recombinant β-xylosi-
dase (xylA) from Aspergillus oryzae expressed in Pichia pastoris, Amb. Exp. 4 (1)
(2014) 68 68.
16] J.M. Morrison, M.S. Elshahed, N. Youssef, A multifunctional GH39 glycoside hy-
drolase from the anaerobic gut fungus Orpinomycessp. strain C1A, PeerJ 4 (2016)
e2289.
17] H. Shi, X. Li, H.X. Gu, Y. Zhang, Y.J. Huang, L.L. Wang, F. Wang, Biochemical
properties of a novel thermostable and highly xylose-tolerant beta-xylosidase/
alpha-arabinosidase from Thermotoga thermarum, Biotechnol. Biofuels 6 (2013).
18] C.J. Yeoman, Y. Han, D. Dodd, C.M. Schroeder, R.I. Mackie, I.K.O. Cann,
Thermostable enzymes as biocatalysts in the biofuel industry, Adv. Appl. Microbiol.
[39] W. Bankeeree, R. Akada, P. Lotrakul, H. Punnapayak, S. Prasongsuk, Enzymatic
Hydrolysis of black liquor xylan by a novel xylose-tolerant, thermostable β-xylosi-
dase from a tropical strain of Aureobasidium pullulans CBS 135684, Appl. Biochem.
Biotechnol. 184 (3) (2018) 919–934.
7
0 (2010) 1–55.
19] F.A. Fusco, G. Fiorentino, E. Pedone, P. Contursi, S. Bartolucci, D. Limauro,
Biochemical characterization of a novel thermostable β-glucosidase from
Dictyoglomus turgidum, Int. J. Biol. Macromol. 113 (2018).
[40] S. Yegin, Single-step purification and characterization of an extreme halophilic,
ethanol tolerant and acidophilic xylanase from Aureobasidium pullulans NRRL Y-
2311-1 with application potential in the food industry, Food Chem. 221 (2017)
67–75.
20] Y.S. Kim, S.J. Yeom, D.K. Oh, Characterization of a GH3 family β-glucosidase from
Dictyoglomus turgidum and its application to the hydrolysis of isoflavone glycosides
in spent coffee grounds, J. Agric. Food. Chem. 59 (21) (2011) 11812.
21] X. Du, A.R. Khan, M. Fu, A. JianboJi, G. Zhai Yu, Current development in the
formulations of non-injection administration of paclitaxel, Int. J. Pharmac. 542
[41] N. Li, X. Han, S. Xu, C. Li, X. Wei, Y. Liu, R. Zhang, X. Tang, J. Zhou, Z. Huang,
Glycoside hydrolase family 39 β-Xylosidase of Sphingomonas showing salt/ethanol/
trypsin tolerance, low-pH/low-temperature activity, and transxylosylation activity,
J. Agric. Food. Chem. 66 (36) (2018) 9465–9472.
(
1–2) (2018) 242.
[42] D.R. Carvalho, S. Carli, L.P. Meleiro, J.C. Rosa, A.H.C. Oliveira, J.A. Jorge,
R.P.M. Furriel, A halotolerant bifunctional β-xylosidase/α-L-arabinofuranosidase
from Colletotrichum graminicola: purification and biochemical characterization, Int.
J. Biol. Macromol. 114 (2018) 741–750.
22] L. Ling, Y. Du, M. Ismail, R. He, Y. Hou, Z. Fu, Y. Zhang, C. Yao, X. Li, Self-as-
sembled liposomes of dual paclitaxel-phospholipid prodrug for anticancer therapy,
Int. J. Pharm. 526 (1–2) (2017) 11–22.
23] G.P. Stathopoulos, D. Antoniou, J. Dimitroulis, P. Michalopoulou, A. Bastas,
K. Marosis, J. Stathopoulos, A. Provata, P. Yiamboudakis, D. Veldekis, Liposomal
cisplatin combined with paclitaxel versus cisplatin and paclitaxel in non-small-cell
lung cancer: a randomized phase III multicenter trial, Ann. Oncol. Offic. J. Europ.
Soc. Med. Oncol. 21 (11) (2010) 2227–2232.
[43] Y. Ye, Y. Hu, C. Hu, J. Leng, H. Chen, X. Zhao, J. Gao, Y. Zhou, Overexpression and
characterization of a glycoside hydrolase family 1 enzyme from Cellulosimicrobium
cellulans sp.21 and its application for minor ginsenosides production, J. Mol. Catal.
B Enzym. 120 (ISSN) (2015) 60–67.
[44] C. Vieille, G.J. Ziekus, Hyperthermophilic enzymes: sources, uses and molecular
mechanisms for thermostability, Microbiol. Mol. Biol. Rev. 65 (1) (2001) 1–43.
[45] T. Anil, G. Jerome, S.M. Wayne, H. William, F.K. Alvin, B.M. Espina, G. Carlos,
M. Lily, M. Karl, D.T. Scadden, Multicenter trial of low-dose paclitaxel in patients
with advanced AIDS-related Kaposi sarcoma, Cancer 95 (1) (2010) 147–154.
[46] C. Feng, D. Dan, F.U. Yan, Y.H. Zheng, L. Shi, M.X. Chang, X.B. Jing, Anti-tumor
activity of biodegradable polymer-paclitaxel conjugated micelle against mice U14
cervical cancers, Chem. Res. Chin. Univ. 28 (4) (2012) 656–661.
[47] H.J. Kang, S.H. Lee, J.E. Price, L.S. Kim, Curcumin suppresses the paclitaxel-in-
duced nuclear factor-kappaB in breast cancer cells and potentiates the growth in-
hibitory effect of paclitaxel in a breast cancer nude mice model, Breast J. 15 (3)
(2010) 223–229.
[
24] G.B. Ge, S.C. Liang, Y. Hu, X.B. Liu, Y.X. Mao, Y.Y. Zhang, H.W. Luan, M.H. Qiu,
L. Yang, Rapid qualitative and quantitative determination of seven valuable taxanes
from various Taxus species by UFLC-ESI-MS and UFLC-DAD, Planta Med. 76 (15)
(
2010) 1773–1777.
[
[
[
25] S. Shah, H. Tan, S. Sultan, M. Faridz, M. Shah, S. Nurfazilah, M. Hussain, Microbial-
catalyzed biotransformation of multifunctional triterpenoids derived from phyto-
nutrients, Int. J. Mol. Sci. 15 (7) (2014) 12027–12060.
26] H. Luo, Y.K. Nie, Y.J. Fu, Y.G. Zu, S.M. Li, W. Liu, L. Zhang, M. Luo, Y. Kong, Z.N. Li,
Determination of main taxoids in Taxus species by microwave-assisted extraction
combined with LC-MS/MS analysis, J. Sep. Sci. 32 (2) (2015) 192–201.
27] B.J. Li, H. Wang, T. Gong, J.J. Chen, T.J. Chen, J.L. Yang, P. Zhu, Improving 10-
10