Bioproduction of benzylamine from renewable feedstocks via a nine-step artificial enzyme cascade and engineered metabolic pathways

Article abstract of DOI:10.1002/cssc.201800709

Production of chemicals from renewable feedstocks has been an important task for sustainable chemical industry. Although microbial fermentation has been widely employed to produce many biochemicals, it is still very challenging to access non-natural chemicals. Two methods (biotransformation and fermentation) have been developed for the first bio-derived synthesis of benzylamine, a commodity non-natural amine with broad applications. Firstly, a nine-step artificial enzyme cascade was designed by biocatalytic retrosynthetic analysis and engineered in recombinant E. coli LZ243. Biotransformation of l-phenylalanine (60 mm) with the E. coli cells produced benzylamine (42 mm) in 70 % conversion. Importantly, the cascade biotransformation was scaled up to 100 mL and benzylamine was successfully isolated in 57 % yield. Secondly, an artificial biosynthesis pathway to benzylamine from glucose was developed by combining the nine-step cascade with an enhanced l-phenylalanine synthesis pathway in cells. Fermentation with E. coli LZ249 gave benzylamine in 4.3 mm concentration from glucose. In addition, one-pot syntheses of several useful benzylamines from the easily available styrenes were achieved, representing a new type of alkene transformation by formal oxidative cleavage and reductive amination.

Full text of DOI:10.1002/cssc.201800709

Accepted Article
Title: Bioproduction of Benzylamine from Renewable Feedstocks via
a 9-Step Artificial Enzyme Cascade and Engineered Metabolic
Pathways
Authors: Yi Zhou, Shuke Wu, Jiwei Mao, and Zhi Li
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemSusChem 10.1002/cssc.201800709
Link to VoR: http://dx.doi.org/10.1002/cssc.201800709
A Journal of
www.chemsuschem.org

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
Bioproduction of Benzylamine from Renewable Feedstocks via a
9-Step Artificial Enzyme Cascade and Engineered Metabolic
Pathways
Yi Zhou,[b] Shuke Wu,[a, b] Jiwei Mao,[a] and Zhi Li*[a, b]
Abstract: Production of chemicals from renewable feedstocks has
been an important task for sustainable chemical industry. While
microbial fermentation has been widely employed to produce many
biochemicals, it is still very challenging to access non-natural
chemicals. Herein, we developed two methods (biotransformation and
fermentation) for the first bio-derived synthesis of benzylamine, a
commodity non-natural amine with broad applications. At first, a 9-
step artificial enzyme cascade was designed by biocatalytic
retrosynthesis analysis and engineered in recombinant E. coli LZ243.
Biotransformation of ʟ-phenylalanine (60 mM) with the E. coli cells
produced benzylamine (42 mM) in 70%. Importantly, the cascade
biotransformation was scaled up to 100 mL and benzylamine was
successfully isolated in 57% yield. Secondly, an artificial biosynthesis
pathway of benzylamine from glucose was developed by combining
the 9-step cascade with an enhanced ʟ-phenylalanine synthesis
pathway in cells. Fermentation with E. coli LZ249 gave benzylamine
in 4.3 mM from glucose. In addition, one-pot syntheses of several
step reaction or cascade reactions,[5] but they often start from non-
renewable substrates. In fact, only a few enzyme cascades were
recently reported for converting bio-based substrates to natural[6]
or non-natural products.[7] Thus, designing novel artificial enzyme
cascades to convert biochemicals to man-made products is
particularly important, which could lead to the production of
chemicals
from
renewable
feedstocks
via
cascade
biotransformations as well as fermentation by combining the
artificial cascades with natural metabolic pathways.
Production of benzylamine 1a from renewable feedstock is
very attractive. This compound is a representative of a group of
alkyl amines that are useful chemicals. Benzylamine 1a itself is a
commodity chemical widely used as corrosion inhibitor as well as
in synthetic textiles and paints.[8] It is also a key synthon to
produce many other useful chemicals (e.g. dibenzylimines,
hexanitrohexaazaisowurtzitane)[9] and pharmaceuticals (e.g.
lacosamide, alniditan).[10] Existing methods for manufacturing
useful benzylamines from the easily available styrenes were achieved, benzylamine 1a include aminolysis of benzyl chloride,
representing a new type of alkene transformation by formal oxidative
cleavage-reductive amination.
hydrogenation of benzonitrile, and reductive amination of
benzaldehyde.[8] Benzylamine 1a could also be produced by
biocatalytic methods, such as the transamination of
benzaldehyde using ω-transaminase (ω-TA),[11] reduction of
benzamide by Clostridium sporogenes,[12] and cascade oxidation-
amination of benzyl alcohol using oxidase/alcohol dehydrogenase
together with ω-TA/amine dehydrognease.[13] However, all these
chemical and biological syntheses start from non-renewable
feedstock. Benzylamine 1a was also observed as an intermediate
in the degradation of N-substituted formamide with Arthrobacter
pascens,[14] but neither biosynthesis pathway nor bioproduction of
benzylamine 1a has been reported. Thus far, no method is
available for bio-derived production of benzylamine 1a, despite
that bio-based amine production is an emerging theme.[15]
Introduction
The development of green and sustainable chemical industry
calls for innovative manufacturing technologies for efficient
production of bulk and fine chemicals from renewable feedstocks
in an environmentally benign manner.[1] An attractive strategy is
the fermentative production of chemicals from sugars by
harnessing the metabolism of microbial cells.[2] This strategy has
been demonstrated in industrial manufacturing of a wide range of
biochemicals,[3] yet it still has difficulty to access many
petrochemical-derived non-natural bulk and fine chemicals due to
the lack of biosynthesis pathways. On the other hand, many
enzymes have been employed for producing non-natural
chemicals in a green manner (mild reaction conditions, high
selectivity, biodegradable and non-toxic catalysts)[4] via single-
To develop the first bio-derived synthesis of benzylamine 1a,
we conducted biocatalytic retrosynthesis analysis16 of
benzylamine 1a, designed the cascade bioconversion of
biobased ʟ-phenylalanine 10 to 1a, combined the novel cascade
[a]
[b]
Dr. S. Wu, Dr. J. Mao, Prof. Z. Li
Department of Chemical and Biomolecular Engineering
National University of Singapore
4 Engineering Drive 4, Singapore 117585 (Singapore)
E-mail: chelz@nus.edu.sg
Dr. Y. Zhou, Dr. S. Wu, Prof. Z. Li
Synthetic Biology for Clinical and Technological Innovation (SynCTI)
Life Sciences Institute
National University of Singapore
Scheme 1. Biocatalytic retrosynthesis analysis of benzylamine 1a to connect its
synthesis to a cellular metabolite ʟ-phenylalanine 10 as well as glucose 11. ω-
28 Medical Drive, Singapore 117456 (Singapore)
Supporting information for this article is given via a link at the end of
the document.
TA (ω-transaminase), BFD
(benzoylformate decarboxylase), PAL
(phenylalanine ammonia lyase), PAD (phenylacrylic acid decarboxylase).
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
AlaDH
CvTA
AlkJ EcALDH
SMDH
BFD
PAD
PAL
SMO SpEH
pACYC/pCDF/pET/pRSF
pACYC/pCDF/pET/pRSF
pACYC/pCDF/pET/pRSF
pACYC/pCDF/pET/pRSF
Figure 1. (a) Artificial biosynthesis pathway of glucose 11 to benzylamine 1a by combining shikimate pathway with novel enzyme cascades containing
phenylalanine ammonia lyase (PAL), phenylacrylic acid decarboxylase (PAD), styrene monooxygenase (SMO), epoxide hydrolase (SpEH), alcohol
dehydrogenase (AlkJ), aldehyde dehydrogenase (EcALDH), S-mandelate dehydrogenase (SMDH), benzoylformate decarboxylase (BFD), ω-transaminase
(CvTA), and alanine dehydrogenase (AlaDH). (b) Genetically construction of four enzyme modules on different compatible plasmids, pACYC, pCDF, pET, and
pRSF, respectively.
with the natural Shikimate pathway for artificial biosynthesis of 1a
from glucose 11, engineered Escherichia coli strains expressing
the pathway enzymes via modular approach, and achieved the
production of biobased benzylamine 1a either from ʟ-
phenylalanine 10 by whole-cell based cascade biotransformation
or from glucose 11 by fermentation.
CvTA from Chromobacterium violaceum,[11b] and alanine
dehydrogenase (AlaDH) from Bacillus subtilis.[18a]
ʟ-Phenylalanine 10 is a key metabolite produced from glucose
11 via shikimate pathway.[19] Combining the 9-step artificial
enzyme cascade with shikimate pathway of Escherichia coli
accomplished a de novo artificial biosynthesis pathway from
glucose 11 to benzylamine 1a.
Genetic construction of 4 individual enzyme modules for
engineering of the 9-step artificial enzyme cascade
Results and Discussion
Design of artificial 9-step enzyme cascade and metabolic
pathway for bio-derived synthesis of benzylamine 1a
We employed a modular approach to construct the 9-step enzyme
cascade for the conversion of ʟ-phenylalanine 10 to 1a by
developing four individual enzyme modules (Figure 1b). To
ensure high yield of the overall cascade, the last reaction step is
very crucial to be highly efficient to convert the intermediate to
final product. To achieve this, CvTA-AlaDH[20] was used as
module 1 for the amination of 2a to 1a with cellular ʟ-alanine (Ala),
pyruvate (Pyr) and externally supplied NH3. The remaining eight
steps were engineered by using three modules: SMDH was
combined with AlkJ-EcALDH[18] to form AlkJ-EcALDH-SMDH as
module 2 for converting 6a to 3a; BFD was constructed together
with SMO-SpEH[18] to form SMO-SpEH-BFD as module 3 for
converting 8a to 6a as well as 3a to 2a; the previous constructed
PAL-PAD module[7d] was used as module 4 for converting 10 to
8a; Each enzyme module was genetically constructed on four
compatible plasmids (pACYC, pCDF, pET, pRSF) with low to high
copy numbers. The best construct was selected based on the
corresponding catalytic performance for the module reactions.
Biocatalytic retrosynthesis analysis[16] was performed to design a
9-step artificial enzyme cascade to convert biogenic ʟ-
phenylalanine 10 to benzylamine 1a (Scheme 1): i) benzylamine
could be produced from benzaldehyde 2a via transamination by
ω-TA;[11] ii) benzaldehyde 2a could be synthesized from
phenylglyoxylic acid 3a via decarboxylation by benzoylformate
decarboxylase (BFD);[17] iii) phenylglyoxylic acid 3a is an
intermediate in our recently developed enzyme cascade from
styrene 8a;[18] iv) styrene 8a could be produced from ʟ-
Phenylalanine 10 by using phenylalanine ammonia lyase (PAL)
and phenylacrylic acid decarboxylase (PAD).[7d]
The 9-step artificial enzyme cascade to convert ʟ-
phenylalanine 10 to benzylamine 1a was established by choosing
the appropriate enzyme for each individual reaction step (Figure
1a), including PAL from Arabidopsis thaliana,[7d] PAD from
Aspergillus niger,[7d] styrene monooxygenase (SMO) from
Pseudomonas sp. VLB120,[18] epoxide hydrolase (SpEH) from
Sphingomonas sp. HXN-200,[18] alcohol dehydrogenase (AlkJ)
from Pseudomonas putida GPo1,[18] aldehyde dehydrogenase
(EcALDH) from E. coli,[18] S-mandelate dehydrogenase (SMDH)
from Pseudomonas putida,[18b] BFD from Pseudomonas putida,[17]
Engineering of the 7-step artificial enzyme cascade for the
transformation of styrene 8a to benzylamine 1a
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
a)
50
40
30
20
10
0
Scheme 2. Cascade biotransformation of styrenes 8b-8g to benzylamines 1b-
1g with resting cells of E. coli (LZ220) (10 g cdw L−1).
78% conversion from 8a by using different cells in 24 h (Figure
2a). The best result (47 mM 1a and 78% conversion) was
obtained from E. coli LZ220 harboring the plasmids pRSF-SMO-
SpEH-BFD, pACYC-AlkJ-EcALDH-SMDH, and pET-CvTA-
AlaDH. The course of biotransformation of 8a with E. coli LZ220
was shown in Figure 2b. The final product 1a was formed in 46.5
mM (5.0 g L−1). Benzoic acid (9 mM) was identified as the only
major byproduct. This enzyme cascade gave rise to a new type of
one-pot conversion of an alkene to an amine via formal oxidative
cleavage-reductive amination.
ACE ACR AEC AER ARC ARE CAE CAR CEA CER CRA CRE EAC EAR ECA ECR ERA ERC RAC RAE RCA RCE REA REC
60
50
40
30
20
10
0
b)
S-Mandelic acid
4a
St8yreane
Di6ola
Benzoic acid
Byprod.
Benzylamine
1a
The engineered artificial 7-step enzyme cascade was also
used for the conversion of substituted styrenes 8b-8g to give the
corresponding benzylamines 1b-1g in 69% to 47% conversion
(Scheme 2). Substituted benzylamines are useful chemicals. For
instance, 4-fluorobenzylamine 1c is
a key precursor for
manufacturing of Raltegravir (anti-HIV drug)[22a] and
Pimavanserin (drug to treat Parkinson's disease),[22b] and 3-
chlorobenzylamine 1d is a synthon for a potent A3 adenosine
receptor agonist.[22c] The newly developed cascade provides one-
pot synthesis of these compounds from the easily available
substituted styrenes by using only molecular oxygen, ammonia,
and glucose.
0
4
8
12
16
20
24
Time/ h
Figure 2. (a) Production of 1a from 8a (60 mM) via a 7-step cascade by using
the resting cells (10 g cdw L−1) of E. coli LZ201-224 containing 8 enzymes in
three modules with different plasmids; (b) Cascade biotransformation of 8a (60
mM) to 1a with the resting cells of E. coli LZ220 (15 g cdw L−1) at 30 °C for 24
h. The reactions were conducted in EO and KP buffer (1:5 v/v) with glucose (1%
+ 2 %) and NH3/NH4Cl (200 mM + 100 mM). All experiments were carried out in
triplicate, and the data are the mean values with standard deviation.
Engineering of the 9-step artificial enzyme cascade for the
transformation of ʟ-phenylalanine 10 to benzylamine 1a
Having demonstrated the 7-step enzyme cascade for the
conversion of 8a to 1a, the module 4 (PAL-PAD) was further
integrated with module 1-3 to achieve a 9-step cascade for the
conversion of ʟ-phenylalanine 10 to 1a. The plasmids of PAL-PAD
were transformed into E. coli LZ201-LZ224 to obtain another
twenty-four strains, E. coli LZ225-LZ248 (Table S1, Supporting
Information). Each strain contains a specific combination of the
four plasmids and co-expresses the ten enzymes. As shown in
the SDS-PAGE analysis (Figure S2, Supporting Information),
most of the enzymes were clearly observed and expressed at
various levels in different strains. The resting cells of each strain
were examined for biotransformation of 10 (40 mM) to 1a in a KP
buffer-EO two-phase system. As shown in Figure 3a, all strains
successfully produced the target product 1a in 24 h. The best
result (33 mM 1a and 83% conversion) was obtained from E. coli
LZ243, which harbors the optimal plasmid combination (pRSF-
We first combined module 1-3 to examine one-pot conversion of
8a to 1a. Although styrene 8a is industrially produced from non-
renewable fossil-fuel resources, it could be also produced from
renewable resource by microbial transformation.[21] The plasmids
of SMO-SpEH-BFD, AlkJ-EcALDH-SMDH, and CvTA-AlaDH
were combinatorically transformed into E. coli BL21 (DE3) host to
give twenty-four strains, E. coli LZ201-LZ224 (Table S1 for the list
of strains in Supporting Information). Each strain contains a
specific combination of the three plasmids and co-expresses the
eight enzymes. As shown in the SDS-PAGE analysis (Figure S1,
Supporting Information), most of the enzymes were clearly
observed and expressed at various levels in different strains. The
resting cells of the strains were used to catalyze the
biotransformation of 8a (60 mM) in a two-phase system of KP
(potassium phosphate) buffer and ethyl oleate (EO). EO was used
as a green organic phase to reduce the toxicity of 8a and 7a to
cells. Target compound 1a was produced in 9-47 mM with 15-
PAL-PAD,
pACYC-SMO-SpEH-BFD,
pCDF-AlkJ-EcALDH-
SMDH, pET-CvTA-AlaDH). This set of plasmids led to balanced
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
1a, because SMO and AlaDH consume NADH, while EcALDH
generates NADH (other enzymes are independent of NADH). The
required stoichiometric amount of NADH was regenerated via
cellular metabolism of glucose.
a)
40
30
20
10
0
Production of benzylamine 1a from ʟ-phenylalanine 10 by
using resting cells of recombinant E. coli via the 9-step
enzyme cascade
Preparative biotransformation of bio-based ʟ-Phe 10 (60 mM) to
benzylamine 1a was thus performed on a 100-mL scale with
resting cells of E. coli LZ243 (20 g L−1) via the 9-step cascade in
a two-phase system of KP buffer (80 mL) and EO (20 mL) for 24
h. 1a was produced in 71% conversion and isolated in 57% yield
after ethyl acetate extraction and flash chromatography.
ACERACRE AECRAERCARCE ARECCAERCARE CEARCERACRAE CREAEACREARCECARECRAERACERCARACE RAECRCAE RCEAREACRECA
Similarly, benzylamines 1a, 1c, and 1d were produced from
styrenes 8a (60 mM), 8c (30 mM), and 8d (30 mM) with the resting
cells of E. coli LZ220 via the 7-step enzyme cascade in 62%, 49%,
and 42% isolated yield, respectively. These results clearly
showed the scalability and synthetic utility of the developed
whole-cell based 9- and 7-step enzyme cascades.
For the economical aspect, the 7-step cascade from styrene
8a is more attractive in production of benzylamine 1a than the 9-
step cascade from ʟ-phenylalanine 10, because styrene is
manufactured at a very large scale and available at very low price,
while ʟ-phenylalanine is a bulk biochemical and more expensive.
The production from ʟ-phenylalanine may be also profitable,
because the 9-step cascade biotransformation could, in principle,
directly utilize non-isolated ʟ-phenylalanine in the fermentation
broth, which will significantly lower the cost of substrate.
60
b)
BenNH2
Diol
S-Mandelic acid
1a
6a
4a
50
40
30
20
10
0
Benzoic acid
Byprod.
Styrene
8a
L-Phe
10
0
4
8
12
16
20
24
Time/ h
Figure 3. (a) Production of 1a from 10 (40 mM) via an 8-step enzyme cascade
by using the resting cells (10 g cdw L−1) of E. coli LZ225-248 containing 10
enzymes in four modules with different plasmids; (b) Cascade biotransformation
of 10 (60 mM) to 1a with the resting cells of E. coli LZ243 (15 g cdw L−1) at 30 °C
for 24 h. The reactions were conducted in EO and KP buffer (1:5 v/v) with
glucose (1% + 2 %) and NH3/NH4Cl (100 mM + 100 mM). All experiments were
carried out in triplicate, and the data are the mean values with standard
deviation.
Engineering of an artificial biosynthesis pathways for the
fermentative production of benzylamine 1a from glucose 11
An excellent long-term solution to sustainable benzylamine 1a is
directly fermentative producing it from glucose 11. To achieve this,
we first improved the native shikimate pathway in E. coli to
enhance the production of ʟ-phenylalanine 10. E. coli NST74
strain[23] with overexpressed four key genes in ʟ-phenylalanine
synthesis (aroF, aroG, tyrR, pheA) was employed. A DE3
prophage was then integrated into its genome to endow E. coli
NST74 the compatibility of T7 expression system to enable the
expression of enzymes in the 9-step artificial cascade on the
pACYC, pCDF, pET, pRSF plasmids. With E. coli NST74 (DE3)
as the host strain, the same set of plasmids containing the
individual module (pRSF-PAL-PAD, pACYC-SMO-SpEH-BFD,
pCDF-AlkJ-EcALDH-SMDH, pET-CvTA-AlaDH) were introduced
to afford E. coli LZ249. Cultivation of this strain in M9 medium with
glucose (20 g L−1) produced benzylamine 1a in 2.3 mM (Figure 4).
To further improve the fermentation, both the adding time and the
concentration of the inducer (IPTG) was optimized (Figure S4,
Supporting Information). Finally, 4.3 mM (0.46 g L−1) of 1a was
produced from glucose 11 (Figure 3). In comparison, fermentation
using E. coli LZ243 strain without the improved shikimate pathway
gave only 0.3 mM of 1a after 24 h. Thus, a 13-fold improvement
of the productivity was achieved by using the engineered E. coli
LZ249.
co-expression of the ten enzymes in single host cell, thus enabling
one-pot cascade biotransformation of 10 to 1a with high
conversion. The combinatorial approach could be a general
method to find out the optimal expression levels of multiple
enzymes and the best whole-cell catalyst for a specific cascade
biotransformation.
The resting cells of E. coli LZ243 strain were selected for
examining the cascade biotransformation of 10 in higher
concentrations of 60-100 mM. As showed in Figure S3
(Supporting information), a high conversion was achieved with 60
mM of 10. Thus, the course of the cascade reaction of 10 (60 mM)
to 1a was studied in detail. As shown in Figure 3b, benzylamine
1a were accumulated in 42.4 mM (4.5 g L−1) at 24h with 70%
conversion. A small amount of benzoic acid (8 mM) was formed
as a byproduct. To the best of our knowledge, this is the first report
on production of benzylamine 1a from a biogenic starting material.
Overall, both the 7-step and 9-step cascades require 1 mole of
NADH (nicotinamide adenine dinucleotide) to produce 1 mole of
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
the synthesis of benzylamine 1a from biogenic ʟ-phenylalanine 10.
E. coli LZ243 cells containing the enzyme cascade successfully
converted ʟ-phenylalanine 10 (60 mM) to benzylamine 1a (42 mM,
4.5 g L−1) in 70%. This represents the first synthesis of
benzylamine 1a from a biobased chemical. The whole-cell
transformation also provides a greener synthesis utilizing only
molecular oxygen, ammonia, and glucose.
Combining the 9-step artificial enzyme cascade with improved
shikimate pathway of E. coli gave rise to a novel artificial
biosynthesis pathway to convert glucose 11 to benzylamine 1a.
The first fermentative production of benzylamine 1a was achieved
with E. coli LZ249 strain containing the artificial biosynthesis
pathway, giving benzylamine 1a in 4.3 mM (0.46 g L−1) from
glucose 11.
In addition, 7-step artificial enzyme cascade was developed
to convert styrene 8a (60 mM) to benzylamine 1a (47 mM, 5.0 g
L−1) in 78%. The same cascade catalysed the conversion of
substituted styrenes 8b-g to the corresponding substituted
benzylamine 1b-g in 69-47%. The novel alkene transformation via
formal oxidative cleavage and reductive amination provides one-
pot synthesis of the useful and valuable amines from the easily
available alkenes by using molecular oxygen, ammonia, and
glucose.
In general, the study showcases the power of retrosynthesis-
designing and module-based engineering of enzyme
cascade/pathway to access commodity chemicals in a green and
sustainable manner. Similar approaches could be extended for
the production of other useful chemicals such as alkyl amines
from renewable feedstocks.
6.0
5.0
4.0
3.0
2.0
1.0
0.0
1
2
3
E. coli LZ249
E. coli LZ249
Strain:
E. coli LZ243
0.5 mM
OD600 = 0.6
0.1 mM
OD600 = 1.0
IPTG amount:
Inducingtime: OD600 = 0.6
0.5 mM
Figure 4. Fermentative production of 1a from glucose 11 via an artificial
biosynthesis pathway by growing E. coli LZ243 or LZ249 strain in M9 medium
supplemented with glucose for 24 h, with different amount of inducer (IPTG) and
induction time. All experiments were carried out in triplicate, and the data are
the mean values with standard deviation.
Herein, the first fermentative production of benzylamine 1a
was successfully achieved via the engineering of an artificial
biosynthesis pathway. This expanded the product scope of
fermentation
to
non-natural
amines.[24]
Notably,
ω-
transaminase[25] was successfully incorporated in the artificial
cascade and combined, for the first time, with the natural
metabolic pathway to produce a non-natural amine-containing
molecule. Similar approach could be used to engineer artificial
pathways and microbial cells for the fermentative production of
non-natural amines and alkaloids.
A frequently encountered problem in fermentative production
is the toxic/inhibitory effect of the final product on cell growth. The
toxicity of 1a to E. coli growth was investigated by culturing the
recombinant E. coli strain in M9 medium supplemented with 1a at
different concentration. 5 mM 1a was found to show inhibition on
the growth of E. coli cells (Figure S5, Supporting Information).
This indicates that the product concentration of 4.3 mM in the
fermentation is close to the limit of the toxic concentration for the
E. coli cells. Further improvement of the fermentative production
of 1a may target at the reduction of the toxicity of 1a by in situ
product recovery[26a] (e.g. using ion-exchange resins)[26b] or host
engineering (e.g. expressing membrane transporters[26c] to export
the intracellular benzylamine).
Experimental Section
Genetic engineering of module 2 (AlkJ-EcALDH-SMDH)
The genes of AlkJ-EcALDH was amplified from previous construct[18a]
using primers “ACTGGGATCCGATGTACGACTATATAATCGTTGGTGC
TG” and “ACTGGAATTCTTAATACCGTACACACACCGACTTAG” with
Q5 DNA polymerase. The PCR product was double-digested with BamHI
and EcoRI to give BamHIAlkJ-EcALDHEcoRI. The gene of SMDH was
amplified from the previous construct SMDH-MR[18b] using primers
“ACTGGAATTCTAAGGAGATATATAATGAGCCAGAATCTCTTTAACGT
TG” and “ACTGCTCGAGTCATGCGTGTGTTCCTTTACCAATG” with Q5
DNA polymerase. The PCR product was double-digested with EcoRI and
XhoI to give EcoRISMDHXhoI. The two fragments, BamHIAlkJ-EcALDHEcoRI and
EcoRISMDHXhoI, were ligated to the BamHI and XhoI digested pRSFduet-1
vector concurrently with T4 DNA ligase. The ligation product was
transformed into E. coli BL21 (DE3) competent cells to give AlkJ-EcALDH-
SMDH on the pRSF plasmid. Using the same procedure, the AlkJ-
EcALDH-SMDH was also constructed on the other three vectors,
pACYCduet-1, pCDFduet-1, and pETduet-1.
Genetic engineering of module 3 (SMO-SpEH-BFD)
The genes of SMO-SpEH was amplified from previous construct[18a] using
primers “ACTGTCATGAAAAAGCGTATCGGTATTGTTGG” and “ACTG
AAGCTTCAAAGATCCATCTGTGCAAAGGCC” with Q5 DNA polymerase.
The PCR product was double-digested with BspHI and HindlII to give
BspHISMO-SpEHHindIII. The gene of BFD was amplified from the genome of
Pseudomonas pudita ATCC12633 using primers “ACTGAAGCTTTAAG
Conclusions
A novel 9-step artificial enzyme cascade with ten selected
enzymes assembled in four enzyme modules was developed for
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
GAGATATATAATGGCTTCGGTACACGGCACCACAT” and “ACTGCTC
GAGTCACTTCACCGGGCTTACGGTGCTT” with Q5 DNA polymerase.
The PCR product was double-digested with HindIII and XhoI to give
2 mM phenylethylamine, 500 μL) to prepare the analytical sample for
reversed phase HPLC analysis of 1a, 4a, 6a, 10, and benzoic acid. The
supernatant of organic phase samples (20 μL) was mixed with EtOAc
(containing 2 mM benzyl alcohol, 980 μL) to prepare the analytical sample
for GC-FID analysis of 8a. Other intermediates 9a, 7a, 5a, 3a, and 2a were
either undetectable or in a trivial amount (<0.2%) in HPLC analysis of
aqueous phase and GC analysis of organic phase.
HindIIIBFDXhoI. The two fragments, BspHISMO-SpEHHindIII and HindIIIBFDXhoI
,
were ligated to the NcoI and XhoI digested pRSFduet-1 vector
concurrently with T4 DNA ligase. The ligation product was transformed into
E. coli BL21 (DE3) competent cells to give SMO-SpEH-BFD on the pRSF
plasmid. Using the same procedure, the SMO-SpEH-BFD was also
constructed on the other three vectors, pACYCduet-1, pCDFduet-1, and
pETduet-1.
Engineering of E. coli NST74 (DE3) host strain
ʟ-Phenylalanine over-producing E. coli NST74 (over-expressing aroF,
aroG, tyrR, pheA)[23] was purchased from American Type Culture
Collection (ATCC 31884). A λDE3 lysogenization kit (Merck) was used to
introduce the λDE3 lysogens to give the E. coli NST74 (DE3). It was used
as the host to construct E. coli LZ249, the best fermentative production
strain. Common E. coli BL21 (DE3) strain was used as the host for
biotransformation strains, E. coli LZ201-248.
Source of module 1 (CvTA-AlaDH) and module 4 (PAL-PAD)
Four CvTA-AlaDH plasmids from a previous project[20] were directly used
in this study. Four PAL-PAD plasmids constructed previously[7d] were
directly used in this study.
Procedure for biotransformation of 8a to 1a
Procedure for fermentative production of 1a
E. coli LZ201-224 cells were firstly prepared by standard cultivation
procedure (see Supporting Information for details) immediately before the
biotransformation. The resting cells were resuspended in KP buffer (pH
8.0, 200 mM). 8a was dissolved in ethyl oleate (EO) to prepare the stock
solution of 8a (300 mM). In a 100-mL flask, cells suspension, glucose
solution (50%), and NH3/NH4Cl (pH 8.0, 5 M) were added to give a 2-mL
aqueous phase of resting cells (10-15 g cdw L−1), glucose (1%), and
NH3/NH4Cl (200 mM). 8a in EO (300 mM, 0.4 mL) was added to form the
second phase. The reaction mixture was put in an incubating shaker at
30 °C and 300 rpm. At 10 h, additional glucose (2%) and NH3/NH4Cl (100
mM, from a 5 M stock solution) was added into the system to increase the
reversible transamination of 2a to 1a. For strain screening (Figure 2a),
samples of the aqueous phase (100 μL) were taken at 24 h. For reaction
progress (Figure 2b), samples of the aqueous phase (100 μL) and samples
of the organic phase (40 μL) were taken at 2, 5, 8, 12, and 24 h. All the
samples were centrifuged (3 min, 10000 g). The supernatant of aqueous
phase samples (50 μL) was mixed with TFA solution (0.5%, 450 μL) and
ACN (containing 2 mM phenylethylamine, 500 μL) to prepare the analytical
sample for reversed phase HPLC analysis of 1a, 4a, 6a, and benzoic acid.
The supernatant of organic phase samples (20 μL) was mixed with EtOAc
(containing 2 mM benzyl alcohol, 980 μL) to prepare the analytical sample
for GC-FID analysis of 8a. Other intermediates 7a, 5a, 3a, and 2a were
either undetectable or in a trivial amount (<0.2%) in HPLC analysis of
aqueous phase and GC analysis of organic phase.
E. coli LZ243 or LZ249 strain was firstly inoculated in LB medium (1 mL)
containing chloramphenicol (25 mg L−1), streptomycin (25 mg L−1),
ampicillin (50 mg L−1), and kanamycin (25 mg L−1) and grew at 37 °C
overnight (11-13 h). The overnight culture (0.5 mL) was inoculated in M9
medium (50 mL) containing glucose (20 g L−1), yeast extract (6 g L−1), and
the same four antibiotics in a tri-baffled flask (250-mL) with a vented cap.
The E. coli continued to grow at 37 °C and the OD600 of the culture was
monitored by using a UV-spectrometer. At certain time (OD600 = 0.6, 1.0,
or 2.0), IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added at a final
concentration of 0.5, 0.1, or 0.05 mM to induce the protein expression. The
E. coli further grew at 25 °C for 24 h. At the end of cultivation, 1 mL sample
of the medium was subjected to centrifugation, and 250 μL supernatant
was isolated and mixed with TFA solution (0.5%, 250 μL) and ACN
(containing 2 mM phenylethylamine, 500 μL) to prepare the analytical
sample for reversed phase HPLC (see Supporting Information for the
analytical method).
Procedure for preparation of 1a from 10
Freshly prepared E. coli LZ243 cells were resuspended in KP buffer (200
mM, pH 8.0) to form a cell suspension. In a 500-mL baffled flask, cells
suspension, glucose solution (50%), and solid 10 (4.8 mmol, 793 mg) were
added to form an 80-mL aqueous phase of resting cells (20 g cdw L−1),
glucose (1%), and 10 (60 mM). EO (20 mL) was added to form the second
phase. The reaction mixture was incubated in a shaker at 30 °C and 300
rpm. At 4 h, NH3/NH4Cl (pH 8.0, 100 mM) was added into the system. At
10 h, additional glucose (2%) and NH3/NH4Cl (pH 8.0, 100 mM) was added
into the system. At the end of reaction (24 h), the reaction mixture was
centrifuged (3200 g, 15 min), and cells were washed with water and
centrifuged again (3200 g, 15 min). The aqueous solution was combined
and adjusted to pH = 13 with NaOH solution (10 M), and then extracted
with EtOAc (100 mL) for three times. The EtOAc extract was combined
and evaporated with rotary evaporator. The crude product was purified by
Procedure for biotransformation of 10 to 1a
E. coli LZ225-248 cells were firstly prepared by standard cultivation
procedure (see Supporting Information for details) immediately before the
biotransformation. The resting cells were resuspended in KP buffer (pH
8.0, 200 mM). Solid 10 was dissolved in KP buffer (pH 8.0, 200 mM) to
prepare the stock solution of 10 (150 mM). In a 100-mL flask, cells
suspension, glucose solution (50%), and stock solution of 10 were added
to give a 2-mL aqueous phase of resting cells (10-15 g cdw L−1), glucose
(1%), and 10 (40-60 mM). EO (0.4 mL) was added to form the second
phase. The reaction mixture was put in an incubating shaker at 30 °C and
300 rpm. At 4 h, NH3/NH4Cl (pH 8.0, 100 mM) was added into the system.
At 10 h, additional glucose (2%) and NH3/NH4Cl (pH 8.0, 100 mM) was
added into the system. For strain screening (Figure 3a), samples of the
aqueous phase (100 μL) were taken at 24 h. For reaction progress (Figure
3b), samples of the aqueous phase (100 μL) and samples of the organic
phase (40 μL) were taken at 2, 5, 8, 12, and 24 h. All the samples were
centrifuged (3 min, 10000 g). The supernatant of aqueous phase samples
(50 μL) was mixed with TFA solution (0.5%, 450 μL) and ACN (containing
silica
gel
column
chromatography
with
an
eluent
of
EtOAc/MeOH/triethylamine of 200:20:1 (Rf ≈ 0.3). The product was dried
under vacuum overnight. Benzylamine 1a was isolated as light-yellow
liquid (293 mg, 57% yield). 1H NMR (400 MHz, CDCl3): δ = 7.46–7.25 (m,
5H), 3.89 (s, 2H) ppm. 13C NMR (100 MHz, CDCl3): δ = 143.3, 128.6, 127.1,
126.8, 46.5 ppm.
Procedure for preparation of 1a, 1c, and 1d from 8a, 8c, and 8d,
respectively
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
Freshly prepared E. coli LZ220 cells were resuspended in KP buffer (200
mM, pH 8.0) to form a cell suspension. In a 500-mL baffled flask, cells
suspension, glucose solution (50%), and NH3/NH4Cl (PH 8.0, 5 M) were
added to form an 80-mL aqueous phase of resting cells (20 g cdw L−1),
glucose (1%), and NH3/NH4Cl (pH 8.0, 200 mM). EO (20 mL) containing
8a (4.8 mmol, 499 mg), 8c (2.4 mmol, 294 mg) or 8d (2.4 mmol, 333 mg)
was added to form the second phase. The reaction mixture was incubated
in a shaker at 30 °C and 300 rpm. At 10 h, additional glucose (2%) and
NH3/NH4Cl (pH 8.0, 100 mM) was added into the system. At the end of
reaction (24 h), the reaction mixture was centrifuged (3200 g, 15 min), and
cells were washed with water and centrifuged again (3200 g, 15 min). The
aqueous solution was combined and adjusted to pH = 13 with NaOH
solution (10 M), and then extracted with EtOAc (100 mL) for three times.
The EtOAc extract was combined and evaporated with rotary evaporator.
The crude products were purified by silica gel column chromatography with
an eluent of EtOAc/MeOH/triethylamine of 200:20:1 (Rf ≈ 0.3). The
products were dried under vacuum overnight. Benzylamine 1a was
isolated as light-yellow liquid (319 mg, 62% yield). 1H NMR (400 MHz,
CDCl3): δ = 7.46–7.25 (m, 5H), 3.89 (s, 2H) ppm. 13C NMR (100 MHz,
CDCl3): δ = 143.3, 128.6, 127.1, 126.8, 46.5 ppm. 4-Fluorobenzylamine
1c was isolated as light-yellow liquid (147 mg, 49% yield). 1H NMR (400
MHz, CDCl3): δ = 7.31–7.27 (m, 2H), 7.05–7.01 (m, 2H), 3.86 (s, 2H) ppm.
13C NMR (100 MHz, CDCl3): δ = 161.8 (d, J = 243.0Hz), 138.9 (d, J =
3.2Hz), 128.6 (d, J = 7.9Hz), 115.2 (d, J = 21.1Hz), 45.8 ppm. 3-
Chlorobenzylamine 1d was isolated as light-yellow liquid (143 mg, 42%
yield). 1H NMR (400 MHz, CDCl3): δ = 7.25–7.10 (m, 4H), 3.77 (s, 2H) ppm.
13C NMR (100 MHz, CDCl3): δ = 145.3, 134.4, 129.8, 127.2, 126.9, 125.2,
46.0 ppm.
Angew. Chem. Int. Ed. 10.1002/anie.201800343; h) M. Winkler, M. Geier,
S. P. Hanlon, B. Nidetzky, A. Glieder, Angew. Chem. Int. Ed.
10.1002/anie.201800678.
[5]
a) J. H. Schrittwieser, J. Sattler, V. Resch, F. G. Mutti, W. Kroutil, Curr.
Opin. Chem. Biol. 2011, 15, 249–256; b) N. Ladkau, A. Schmid, B. Bühler,
Curr. Opin. Biotechnol. 2014, 30, 178–189; c) V. Köhler, N. J. Turner,
Chem. Commun. 2015, 51, 450–464; d) J. Muschiol, C. Peters, N.
Oberleitner, M. Mihovilovic, U. Bornscheuer, F. Rudroff, Chem. Commun.
2015, 51, 5798–5811; e) T. Bayer, S. Milker, T. Wiesinger, F. Rudroff, M.
D. Mihovilovic, Adv. Synth. Catal. 2015, 357, 1587–1618; f) J. B. Wang,
M. T. Reetz, Nat. Chem. 2015, 7, 948–949; g) S. P. France, L. J.
Hepworth, N. J. Turner, S. L. Flitsch, ACS Catal. 2017, 7, 710–724; h) S.
Wu, Z. Li, ChemCatChem, 2018, DOI: 10.1002/cctc.201701669; i) J. H.
Schrittwieser, S. Velikogne, M. Hall, W. Kroutil, Chem. Rev. 2018, 118,
270–348; j) J. M. Sperl, V. Sieber, ACS Catal. 2018, 8, 2385–2396.
a) N. Wagner, A. Bosshart, J. Failmezger, M. Bechtold, S. Panke, Angew.
Chem. 2015, 127, 4256–4260; Angew. Chem. Int. Ed. 2015, 54, 4182–
4186; b) I. Bassanini, J. Krejzova, W. Panzeri, D. Monti, V. Křen, S. Riva,
ChemSusChem 2017, 10, 2040–2045; c) Y. Ohta, R. Hasegawa, K.
Kurosawa, A. H. Maeda, T. Koizumi, H. Nishimura, H. Okada, C. Qu, K.
Saito, T. Watanabe, Y. Hatada, ChemSusChem 2017, 10, 425–433; d)
E. Klumbys, Z. Zebec, N. J. Weise, N. J. Turner, N. S. Scrutton, Green
Chem. 2018, 20, 658–663.
[6]
[7]
a) J. W. Song, E. Y. Jeon, D. H. Song, H. Y. Jang, U. T. Bornscheuer, D.
K. Oh, J. B. Park, Angew. Chem. 2013, 125, 2594–2597; Angew. Chem.
Int. Ed. 2013, 52, 2534–2537; b) K. B. Otte, M. Kirtz, B. M. Nestl, B.
Hauer, ChemSusChem 2013, 6, 2149–2156; c) E. Busto, N. Richter, B.
Grischek, W. Kroutil, Chem. Eur. J. 2014, 20, 11225–11228; d) Y. Zhou,
S. Wu, Z. Li, Angew. Chem. 2016, 128, 11819–11822; Angew. Chem.
Int. Ed. 2016, 55, 11647–11650; e) P. Yao, Y. Cui, S. Yu, Y. Du, J. Feng,
Q. Wu, D. Zhu, Adv. Synth. Catal. 2016, 358, 2923–2928; f) X. Chen, Y.
Cui, X. Cheng, J. Feng, Q. Wu, D. Zhu, ChemistryOpen 2017, 6, 534–
540; g) N. Oberleitner, A. K. Ressmann, K. Bica, P. Gärtner, M. W.
Fraaije, U. T. Bornscheuer, F. Rudroff, M. D. Mihovilovic, Green Chem.
2017, 19, 367–371.
Acknowledgements
We thank the financial supports from GlaxoSmithKline (GSK) and
Singapore Economic Development Board (EDB) through a Green
and Sustainable Manufacturing Grant (Project No. 279-000-348-
592) and National University of Singapore through Synthetic
Biology for Clinical and Technological Innovation (SynCTI)
Program.
[8]
[9]
L. Heuer, Benzylamine in Ullmann’s Encyclopedia of Industrial Chemistry,
Wiley-VCH, 2000, pp. 385–387.
a) Z. J. Wang, K. Garth, S. Ghasimi, K. Landfester, K. A. Zhang,
ChemSusChem 2015, 8, 3459–3464; b) U. R. Nair, R. Sivabalan, G. M.
Gore, M. Geetha, S. N. Asthana, H. Singh, Combust. Explos. Shock
Waves. 2005, 41, 121–132.
[10] a) D. Choi, J. P. Stables, H. Kohn, J. Med. Chem. 1996, 39, 1907–1916;
b) G. Lommen, M. De Bruyn, M. Schroven, W. Verschueren, W.
Janssens, J. Verrelst, J. Leysen, Bioorg. Med. Chem. Lett. 1995, 5,
2649–2654.
Keywords: amines • biotransformations • cascade reactions •
enzyme catalysis • sustainable chemistry
[1]
[2]
[3]
a) C. O. Tuck, E. Pérez, I. T. Horváth, R. A. Sheldon, M. Poliakoff,
Science 2012, 337, 695–699; b) M. Beller, G. Centi, L. Sun,
ChemSusChem 2017, 10, 6–13.
[11] a) J. S. Shin, B. G. Kim, J. Org. Chem. 2002, 67, 2848–2853; b) U.
Kaulmann, K. Smithies, M. E. Smith, H. C. Hailes, J. M. Ward, Enzym.
Microb. Technol. 2007, 41, 628–637.
a) Y. G. Yadav, G. Stephanopoulos, ChemSusChem 2014, 7, 1847–
1853; b) S. Y. Lee, H. U. Kim, Nat. Biotechnol. 2015, 33, 1061–1072; c)
J. Nielsen, J. D. Keasling, Cell 2016, 164, 1185–1197.
[12] O. Dipeolu, J. Gardiner, G. Stephens, Biotechnol. Lett. 2005, 27, 1803–
1807.
[13] a) M. Fuchs, K. Tauber, J. Sattler, H. Lechner, J. Pfeffer, W. Kroutil, K.
Faber, RSC Adv. 2012, 2, 6262–6265; b) S. Klatte, V. F. Wendisch,
Bioorg. Med. Chem. 2014, 22, 5578–5585; c) F. G. Mutti, T. Knaus, N.
S. Scrutton, M. Breuer, N. J. Turner, Science 2015, 349, 1525–1529.
[14] H. Fukatsu, Y. Hashimoto, M. Goda, H. Higashibata, M. Kobayashi, Proc.
Natl. Acad. Sci. USA 2004, 101, 13726–13731.
a) J. Becker, C. Wittmann, Angew. Chem. 2015, 127, 3383–3407; Angew.
Chem. Int. Ed. 2015, 54, 3328–3350; b) D. Jullesson, F. David, B. Pfleger,
J. Nielsen, Biotechnol. Adv. 2015, 33, 1395–1402; c) J. M. Clomburg, A.
M. Crumbley, R. Gonzalez, Science 2017, 355, aag0804.
[4]
a) Biocatalysis in Organic Synthesis, (Eds.: K. Faber, W. D. Fessner, N.
Turner), Thieme, Stuttgart, 2014; b) U. T. Bornscheuer, G. W. Huisman,
R. J. Kazlauskas, S. Lutz, J. C. Moore, K. Robins, Nature 2012, 485,
185–194; c) M. T. Reetz, J. Am. Chem. Soc. 2013, 135, 12480–12496;
d) D. Holtmann, M. W. Fraaije, I. W. Arends, D. J. Opperman, F.
Hollmann, Chem. Commun. 2014, 50, 13180–13200; e) B. M. Nestl, S.
C. Hammer, B. A. Nebel, B. Hauer, Angew. Chem. 2014, 126, 3132–
3158; Angew. Chem. Int. Ed. 2014, 53, 3070–3095; f) M. T. Reetz, Chem.
Rec. 2016, 16, 2449–2459; g) J. Dong, E. Fernández-Fueyo, F.
Hollmann, C. Paul, M. Pasic, S. Schmidt, Y. Wang, S. Younes, W. Zhang,
[15] a) V. Froidevaux, C. Negrell, S. Caillol, J. P. Pascault, B. Boutevin, Chem.
Rev. 2016, 116, 14181–14224; b) M. Pelckmans, T. Renders, S. Van de
Vyver, B. F. Sels, Green Chem. 2017, 19, 5303–5331.
[16] a) M. Hönig, P. Sondermann, N. J. Turner, E. M. Carreira, Angew. Chem.
2017, 129, 9068–9100; Angew. Chem. Int. Ed. 2017, 56, 8942–8973; b)
R. O. M. A. de Souza, L. S. M. Miranda, U. T. Bornscheuer, Chem. Eur.
J. 2017, 23, 12040–12063.
[17] a) A. Y. Tsou, S. C. Ransom, J. A. Gerlt, D. D. Buechter, P. C. Babbitt,
G. L. Kenyon, Biochemistry 1990, 29, 9856–9862; b) H. Iding, T.
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
Dünnwald, L. Greiner, A. Liese, M. Müller, P. Siegert, J. Grötzinger, A. S.
2006, 317, 910–918; c) S. Tchilibon, B. V. Joshi, S. K. Kim, H. T. Duong,
Z. G. Gao, K. A. Jacobson, J. Med. Chem. 2008, 48, 1745–1758.
[23] Y. J. Choi, D. E. Tribe, Biotechnol. Lett. 1982, 4, 223–228.
[24] a) S. Galanie, K. Thodey, I. J. Trenchard, M. F. Interrante, C. D. Smolke,
Science 2015, 349, 1095–1100; b) S. Masuo, S. Zhou, T. Kaneko, N.
Takaya, Sci. Rep. 2016, 6, 25764; c) V. F. Wendisch, M. Mindt, F. Pérez-
García, Appl. Microbiol. Biotechnol. 2018, 102, 3583–3594.
Demir, M. Pohl, Chem. Eur. J. 2000, 6, 1483–1495.
[18] a) S. Wu, Y. Zhou, T. Wang, H. P. Too, D. I. C. Wang, Z. Li, Nat. Commun.
2016, 7, 11917; b) Y. Zhou, S. Wu, Z. Li, Adv. Synth. Catal. 2017, 359,
4305–4316.
[19] a) J. Bongaerts, M. Krämer, U. Müller, L. Raeven, M. Wubbolts, Metab.
Eng. 2001, 3, 289–300; b) A. Rodriguez, J. A. Martnez, N. Flores, A.
Escalante, G. Gosset, F. Bolivar, Microb. Cell Fact. 2014, 13, 126.
[20] S. Wu, J. Liu, Z. Li, ACS Catal. 2017, 7, 5225–5233.
[25] a) R. C. Simon, N. Richter, E. Busto, W. Kroutil, ACS Catal. 2014, 4,
129–143; b) F. Steffen-Munsberg, C. Vickers, H. Kohls, H. Land, H.
Mallin, A. Nobili, L. Skalden, T. van den Bergh, H. J. Joosten, P. Berglund,
M. Höhne, U. T. Bornscheuer, Biotechnol. Adv. 2015, 33, 566–604; c) F.
Guo, P. Berglund, Green Chem. 2017, 19, 333–360; d) I. Slabu, J. L.
Galman, R. C. Lloyd, N. J. Turner, ACS Catal. 2017, 7, 8263–8284; e) A.
Gomm, E. O’Reilly, Curr. Opin. Chem. Biol. 2018, 43, 106–112; f) S. A.
Kelly, S. Pohle, S. Wharry, S. Mix, C. C. Allen, T. S. Moody, B. F. Gilmore,
Chem. Rev. 2018, 118, 349–367.
[21] a) R. McKenna, D. R. Nielsen, Metab. Eng. 2011, 13, 544–554; b) S.
Wallace, E. P. Balskus, Angew. Chem. 2016, 128, 6127–6131; Angew.
Chem. Int. Ed. 2016, 55, 6023–6026.
[22] a) V. Summa, A. Petrocchi, F. Bonelli, B. Crescenzi, M. Donghi, M.
Ferrara, F. Fiore, C. Gardelli, O. Gonzalez Paz, D. J. Hazuda, P. Jones,
O. Kinzel, R. Laufer, E. Monteagudo, E. Muraglia, E. Nizi, F. Orvieto, P.
Pace, G. Pescatore, R. Scarpelli, K. Stillmock, M. V. Witmer, M. Rowley,
J. Med. Chem. 2008, 51, 5843–5855; b) K. E. Vanover, D. M. Weiner, M.
Makhay, I. Veinbergs L. R. Gardell, J. Lameh, A. L. Del Tredici, F. Piu,
H. H. Schiffer, T. R. Ott, E. S. Burstein, A. K. Uldam, M. B. Thygesen, N.
Schlienger, C. M. Andersson, T. Y. Son, S. C. Harvey, S. B. Powell, M.
A. Geyer, B. R. Tolf, M. R. Brann, R. E. Davis, J. Pharmacol. Exp. Ther.
[26] a) J. M. Woodley, M. Bisschops, A. J. Straathof, M. Ottens, J. Chem.
Technol. Biotechnol. 2008, 83, 121–123; b) M. D. Truppo, J. D. Rozzell,
N. J. Turner, Org. Process Res. Dev. 2010, 14, 234–237; c) D. B. Kell,
N. Swainston, P. Pir, S. G. Oliver, Trends Biotechnol. 2015, 33, 237–246.
This article is protected by copyright. All rights reserved.

10.1002/cssc.201800709
ChemSusChem
FULL PAPER
Entry for the Table of Contents (Please choose one layout)
Layout 1:
FULL PAPER
Sustainable benzylamine: A novel
Y. Zhou, S. Wu, J. Mao, Z. Li*
9-step enzyme cascade was
Alternative
Input 3
Alternative
Input 2
Input 1
Page No. – Page No.
retrosynthetically designed and
constructed for the first bio-derived
production of non-natural
Bioproduction of Benzylamine from
Renewable Feedstocks via a 9-Step
Artificial Enzyme Cascade and
Engineered Metabolic Pathways
benzylamine from biobased ʟ-
phenylalanine. The enzyme cascade
was further integrated with the
cellular metabolic pathway to
achieve fermentative production of
benzylamine from glucose.
Artificialenzymecircuit (pathway) in cell
Output
This article is protected by copyright. All rights reserved.