Biological Synthesis of Chiral p-Coumaroyl Glycerol

Full text of DOI:10.1002/bkcs.11748

Note
DOI: 10.1002/bkcs.11748
BULLETIN OF THE
M. K. Song et al.
KOREAN CHEMICAL SOCIETY
Biological Synthesis of Chiral p-Coumaroyl Glycerol
Min Kyung Song,† GeunYoung Sim,† Su Jin Lee,† Bong-Gyu Kim,‡ Mihyang Kim,† Taegum Lee,†
Youhoon Chong,† and Joong-Hoon Ahn†,
*
†Department of Bioscience & Biotechnology, Bio/Molecular Informatics Center, Konkuk University, Seoul
05029, South Korea. *E-mail: jhahn@konkuk.ac.kr
‡Gyeongnam National University of Science and Technology, Department of Forest Resources, Jinju-si
52725, South Korea
Received March 26, 2019, Accepted November 4, 2019, Published online May 15, 2019
Keywords: chiral compound, glycerol derivative hydroxycinnamic acid
Biological synthesis has advantages over chemical synthe-
sis owing to regioselectivity and enantioselectivity.
Enantioselective synthesis is a key pharmaceutical process
because different enantiomers display different biological
activity.1 Three approaches can be used to synthesize a spe-
cific form of an enantiomer.2 Among these approaches,
using an enantiomerically pure starting material
(enantiomerically pure synthon) is currently the most popu-
lar approach.2 However, development of enantiomerically
pure materials is still challenging. Glycerol itself does not
contain a chiral center; however, chiral glycerol derivatives
have been used to synthesize enantiomerically pure biologi-
cal molecules such as platelet aggregation factor, phospho-
lipids, and β-blockers.3,4 To synthesize enantiomer-specific
glycerol derivatives, suberin biosynthesis in some plants4
was harnessed to generate hydroxycinnamoyl glycerol. We
have maximally harnessed natural mimics to synthesize an
enantiomerically pure glycerol derivative p-coumaroyl
glycerol.
Enzymatic esterification is a well-known reaction in biolog-
ical synthesis, catalyzed majorly by lipases.5–7 Some members
of the plant BAHD (benzylalcohol O-acetyltransferase
[BEAT], deacetylvindoline 4-O-acetyltransferase [DAT],
anthranilate N-hydroxycinnamoyl/benzoyltransferase [HCBT],
anthocyanin O-hydroxycinnamoyltransferase [AHCT])
family also catalyze esterification reactions, while
others catalyze amidification.8 One of the BAHD
enzymes, hydroxycinnamoyl transferases (HCTs), uses
hydroxycinnamoyl-CoA as an acyl donor and diverse
acyl acceptors including shikimate or quinate, malate,
tartrate, and D-(hydroxy)phenyllactate.9–12
alcoholic and amine functional groups. In biological sys-
tems, these conjugation reactions are carried out by HCTs.
In the present study, we used OsHCT4 (hydroxycinnamate
transferase from Oryza sativa) to synthesize chiral p-
coumaroyl glycerol by conjugating glycerol with an
asymmetrical HC, and its absolute configuration and enan-
tiomeric purity were determined.
Os4CL and OsHCT4 were harnessed for p-coumaroyl
glycerol synthesis. HCs including p-coumaric acid were
activated through CoA attachment by Os4CL to generate
HC-CoA. OsHCT4 uses HC-CoA as an HC group donor
and glycerol as an acceptor to generate an HC-glycerol con-
jugate.16 Two constructs were generated: the first construct
(pC-p4CL-pHCT4) contained Os4CL and OsHCT4 under
the control of T7 promoters; the second construct (pC-
p4CL-HCT4) contained both genes under the control of
one T7 promoter. To select the optimal construct to gener-
ate the p-coumaroyl glycerol conjugate, we assessed each
construct by feeding p-coumaric acid in M9 broth sup-
plemented with 2% glucose. E. coli transformed with the
operon-type construct generated approximately 21.9 mg/L
of p-coumaroyl glycerol, while E. coli transformed with the
pseudo operon-type construct generated approximately
8.3 mg/L. Therefore, the operon-type construct was used
for further analysis. On using glycerol instead of glucose as
a carbon source, the p-coumaroyl glycerol yield was
66 mg/L, which was 3-fold that with glucose as the carbon
source.
Thereafter, we synthesized p-coumaroyl glycerol from
glucose and glycerol. p-Coumaric acid could be directly
synthesized from tyrosine by tyrosine ammonia lyase
(TAL). In addition, aroGf and tyrAf, which are feedback
inhibition resistant versions of aroG and tyrA, respectively,
and involved in tyrosine biosynthesis,17 along with TAL
were overexpressed. TAL, aroGf, and tyrAf were subcloned
into one E. coli expression vector, pA-aroGf-TAL-tyrAf.
Constructs pA-aroGf-TAL-tyrAf and pC-p4CL-HCT4 were
transformed into E. coli, and p-coumaroyl glycerol synthe-
sis was examined via high-performance liquid chromatogra-
phy (HPLC), using this strain (B-PG3). Several peaks were
Hydroxycinnamic acid (HC) is a secondary metabolite of
phenylalanine or tyrosine through a deamination reaction.
Phenylalanine ammonia lyase (PAL) and tyrosine ammonia
lyase (TAL) have been characterized from plants and
microorganisms.13,14 Introduction of these genes into heter-
ologous systems such as Escherichia coli and Saccharomy-
ces cerevisiae helped synthesize hydroxycinnamic acids
from simple sugars such as glucose and glycerol in these
systems.15 The carboxyl group of HCs conjugates with
Bull. Korean Chem. Soc. 2019, Vol. 40, 743–746
© 2019 Korean Chemical Society, Seoul & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Wiley Online Library
743

Note
BULLETIN OF THE
ISSN (Print) 0253-2964 | (Online) 1229-5949
KOREAN CHEMICAL SOCIETY
mAU
3500
Strain B-PG4 still contained p-coumaric acid (Figure 1
(b)), which was not converted to p-coumaroyl glycerol.
There are two possible explanations for the aforementioned
observation: first, conjugation of glycerol and p-coumaroyl-
CoA is slower than the conversion of tyrosine to
p-coumaric acid; second, conversion of p-coumaric acid to
p-coumaroyl-CoA is slower than the conversion of tyrosine
to p-coumaric acid. The second explanation is more proba-
ble owing to a limited glycerol supply. To assess the first
possibility, we subcloned OsHCT and Os4CL into a higher-
copy-number plasmid and examined whether the resulting
strain produced p-coumaroyl glycerol at greater levels.
However, the strain transformed with the higher-copy-
number construct did not produce more p-coumaroyl glyc-
erol and still contained unreacted p-coumaric acid,
suggesting that the first possibility was not likely. On using
glycerol instead of glucose as a carbon source and substrate
for p-coumaroyl glycerol, no p-coumaric acid was detected
in the strain, and this strain produced p-coumaric acid at
greater levels (Figure 1(c)), thus suggesting that glycerol
was the limiting factor. Using this strain, we synthesized
approximately 799.9 mg/L of p-coumaroyl glycerol after
63 h of incubation in M9 broth supplemented with 2%
glycerol.
For unequivocal determination of the absolute configura-
tion and enantiomeric purity of biologically synthesized p-
coumaroyl glycerol, chemical syntheses of enantiomerically
pure (R)- and (S)-isomers were attempted. Briefly, commer-
cially available p-coumaric acid (1, Scheme 1) was treated
with p-TsCl in the presence of NaOH to generate coumaric
acid tosylate 2. Coupling of 2 with (S)- and (R)-2,-
2-dimethyl-1,3-dioxolane-4-methanol in the presence of
EDC yielded the corresponding coumaric acid esters 3 and
4, which were easily converted to enantiomerically pure
(S)- and (R)-p-coumaroyl glycerols 5 and 6 after sequential
deprotection of the tosyl and isopropylidene moieties.
Optical rotation of the enzymatically synthesized p-
coumaroyl glycerol was measured and compared with that
of chemically synthesized (S)- and (R)-isomers (Table 1).
Specific rotation of the enzymatic product was concurrent
with that of (S)-p-coumaroyl glycerol, and its enantiomeric
purity was as high as 98.6%.
(a)
3000
2000
1000
0
P3
P3
P4
P2
P1
P5
(b)
(c)
3500
3000
2000
1000
P2
P1
0
4000
P2
P1
2000
P3
0.0
2.5
5.0
7.5
10.0
12.5
15.0
17.5
20.0
min
Figure 1. High-performance liquid chromatographic analysis of
reaction products from strain B-PG1 cultured with glucose (a),
from strain B-PG2 cultured with glucose (b), or from strain B-
PG3 cultured with glycerol (c). P1, 2-O-p-coumaroyl glycerol; P2,
1-O-p-coumaroyl glycerol; P3, p-coumaric acid; P4, 3-acetyl-1-O-
p-coumaroyl glycerol; P5, 2,3-diacetyl-1-O-p-coumaroyl glycerol.
observed (Figure 1(a)); a peak at 4 min (P3) had the same
retention time as that of p-coumaric acid, suggesting that it
is a p-coumaric acid synthesized from tyrosine by TAL.
Molecular masses of P1, P2, P4, and P5 were 238.0, 238.0,
280.1, and 322.1 Da, respectively. The molecular mass of
P1 and P2 corresponded with the predicted molecular mass
of p-coumaroyl glycerol. Nuclear magnetic resonance
(NMR) analysis of each product revealed that P1 is 2-O-p-
coumaroyl glycerol and P2 is 1-O-p-coumaroyl glycerol.
1-O-p-Coumaroyl glycerol was a major product, and 2-O-
p-coumaroyl glycerol was a minor product. We examined
the reaction products corresponding to P4 and P5. Based
on the molecular mass, P4 seemed to donate one acetyl
group to p-coumaroyl glycerol, and P5 seemed to contain
two acetyl groups conjugated with p-coumaroyl glycerol.
P4 and P5 were 3-acetyl-1-O-p-coumaroyl glycerol and
2,3-diacetyl-1-O-p-coumaroyl glycerol, respectively, both
being unexpected products.
The protein encoded by chloramphenicol resistance gene
CmR in pACYC-duet1 used herein transfers an acetyl
group from acetyl-CoA to chloramphenicol. This protein
transferred an acetyl group to glycerol. To test this, we rep-
laced CmR with the ampicillin resistance gene AmpR in
pA-aroGf-tyrAf-SeTAL, and the resulting construct was
named pA(AmpR)-aroGf-tyrAf-SeTAL. We investigated
whether the new strain transformed with pA(AmpR)-aroGf-
tyrAf-SeTAL produced acetylated products. As expected,
the acetylated p-coumaroyl glycerols were not synthesized
in the strain harboring pA(AmpR)-aroGf-tyrAf-SeTAL
(Figure 1(c)), indicating that CmR is involved in glycerol
acetylation (Figure 1(c)). To simplify the reaction product,
we then used constructs containing AmpR.
In summary, glycerol is an inexpensive material. In
plants, glycerol is a component of an insoluble lipophilic
polymer, suberin,18 comprising a polyaromatic and poly-
aliphatic domain,19 and glycerol potentially serves as the
Scheme 1. Synthesis of enantiomerically pure (S)- and (R)-
isomers of p-coumaroyl glycerols (5 and 6).
Bull. Korean Chem. Soc. 2019, Vol. 40, 743–746
© 2019 Korean Chemical Society, Seoul & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.bkcs.wiley-vch.de
744

BULLETIN OF THE
Note
KOREAN CHEMICAL SOCIETY
reverse primer, and Os4CL was amplified with 50-
ATGGTTACAAATTAATCTAGAAGGAGGATTACAA-
AATGGATCCGATGGGG-30 (XbaI site is underlined,
and the ribosomal binding site (RBS) is in low case)
and 50-ATGATATCTCATGCCAATCGCGCCACCTCG-30
(Os4CL-R). The resulting PCR products were digested with
XbaI, and both genes were ligated and re-amplified with
primers OsHCT4-F (operon) and Os4CL-R (operon). The
resulting PCR product was digested with EcoRI/NotI and
subcloned into the corresponding sites of the pCDF-1 Duet
vector.
Metabolite analysis. p-Coumaroyl glycerol was synthe-
sized in E. coli as previously described,16 with a minor
modification: glycerol was added as a carbon source instead
of glucose. To purify the reaction product, the culture was
extracted with ethyl acetate, followed by evaporation to
dryness on a rotary vacuum evaporator. The metabolites
were then dissolved in methanol. The semipreparative C18
Table 1. Specific rotations of the enzymatic product and two
chemically synthesized enantiomers of p-coumaroyl glycerol.
Compounds
Specific rotation
25
Enzymatic product
5 (S)-p-coumaroyl
glycerol
6 (R)-p-coumaroyl
glycerol
[α]D –13.9 ꢁ 0.2ꢀ (c = 1.02, CH3OH)
27
[α]D –14.1 ꢁ 0.2ꢀ (c = 0.33, CH3OH)
26
[α]D 14.3 ꢁ 0.1ꢀ (c = 0.46, CH3OH)
interlink aliphatic monomer. Caffeoyl acid, an HC, fatty
acids, and glycerol, constitute an ester present in cotton,20
and caffeoyl glycerol ester is reportedly present in oat.21,22
This prompted us to identify the gene encoding an esterifi-
cation enzyme between HCs and other molecules, including
glycerol, quinic acid, and shikimic acid. This study reports
an enzyme that converts prochiral glycerol into chiral p-
coumaroyl glycerol. Using this enzyme, (S)-p-coumaroyl
glycerol, with an optical purity of 98.6%, was synthesized.
reversed-phase column (Spherisorb
5
μm ODS2,
10 mm × 250 mm) was used with the Agilent 1260 infinity
HPLC system (Palo Alto, CA, USA). The mobile phase
comprised 72% water (A) and 28% acetonitrile (B).
Isocratic elution was carried out at a flow rate of 3 mL/min.
1H NMR spectra of the compounds in DMSO‑d6 were
recorded at 400 and 100 MHz, on a (Bruker, Billerica, MA,
USA) at 296 K. 3-Acetyl-1-O-p-coumaroylglycerol: 1H
NMR (400 MHz, DMSO‑d6): δ 7.58 (d, J = 15.2 Hz, 1H),
7.55 (d, J = 8.4 Hz, 2H), 6.80 (d, J = 8.4 Hz, 2H), 6.39 (d,
J = 15.2 Hz, 1H), 4.10 (d, J = 5.3 Hz, 2H), 4.02 (d,
J = 11.0 Hz, 2H), 3.94 (dd, J = 11.0, 5.3 Hz, 1H), 2.02 (s,
3H). 2,3-Diacetyl-1-O-p-coumaroylglycerol: 1H NMR
(400 MHz, DMSO‑d6): δ 7.59 (d, J = 15.8 Hz, 1H),7.57
(d, J = 8.2 Hz, 2H), 6.79 (d, J = 8.2 Hz, 2H), 6.39 (d,
J = 15.8 Hz, 1H), 4.25 (m, 1H), 4.05 (m, 2H), 4.01 (m,
2H), 1.98 (s, 6H). 2-O-p-coumaroylglycerol: 1H NMR
δ(ppm) in DMSO‑d6: 7.56 (d, J = 15.9 Hz, 1H), 7.54 (d,
J = 8.6 Hz, 2H), 6.79 (d, J = 8.6 Hz, 2H), 6.37 (d,
J = 15.9 Hz, 1H), 4.8 (m, 1H), 3.48–3.58 (m, 4H); 1-O-p-
coumaroylglycerol: 1H NMR δ(ppm) in DMSO‑d6: 7.57
(d, J = 15.9 Hz, 1H), 7.55 (d, J = 8.6 Hz, 2H), 6.79 (d,
J = 8.6 Hz, 2H), 6.39 (d, J = 16.0 Hz, 1H), 4.15 (dd,
J = 11.2, 4.1 Hz, 1H), 4.01 (dd, J = 11.2, 6.5 Hz, 1H),
3.73–3.68 (m, 1H), 3.41 (dd, J = 11.1, 5.5 Hz, 1H), 3.37
(dd, J = 11.3, 6.0 Hz, 1H).
Experimental
Construction of the E. coli expression vector: aroG, tyrA,
and SeTAL were cloned as previously reported.23 The selec-
tion marker was replaced through homologous recombina-
tion using the Quick and Easy Conditional Knockout Kit
(Gene Bridges, Heidelberg, Germany). A chloramphenicol
resistance gene of pACYCDuet-1 vector (Merck, Darm-
stadt, Germany) was replaced by the ampicillin resistance
gene through homologous recombination. Two primers, 50-
TCAGGCGTAGCACCAGGCGTTTAAGGGCACCAATA
ACTGCCTTAAAAAAATTACCAATGCTTAATCAGTG-
30 as the forward primer and 50-CGGGCGTATTTTTTGA
GTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAT
AAATACATTCAAATATGTA-30 as the reverse primer
(Underlined sequences are obtained from the pGEMT-easy
vector encompassing the ampicillin resistance gene; other
sequences are obtained from the pACYC-duet vector
flanking the chloramphenicol resistance gene) were used to
amplify the ampicillin resistance gene of pGEMT-easy vec-
tor (Promega, Madison, WI USA) as a template. The PCR
product was used to replace the chloramphenicol resistance
gene of pACYCDuet-1, located at position 697–1438.
Two constructs containing both Os4CL and OsHCT4
were generated. In the first construct, pC-p4CL-pHCT4,
both genes were regulated by independent T7 promoters.
Os4CL (GenBank BAD27987) was first subcloned into the
EcoRI/NotI site of pCDFDuet-1 vector and then OsHCT4
(GenBank 115 466 807) was subcloned into the
NdeI/EcoRV site of the resulting construct containing
Os4CL. The second construct, pC-4CL-HCT4 contained
two genes regulated by one T7 promoter. OsHCT4 was
amplified using 50-ATGAATTCGATGGCGACGGTG
GACGTGCTG-30 (OsHCT4-F; EcoRI site is underlined) as
the forward primer and CATCTAGATCATGCCAA
TCGCGCCACCTCG (XbaI site is underlined) as the
Authentic samples of (R)-1-O-p-coumaroyl glycerol (5)
and (S)-1-O-p-coumaroyl glycerol (6) were prepared as fol-
lows (Scheme 1):
Synthesis of p-coumaric acid p-toluenesulfonate (2). To
a solution of p-coumaric acid (0.30 g, 1.83 mmol) in H2O
(20 mL), NaOH (0.18 g, 4.57 mmol) was added followed
by p-ꢀtoluenesulfonyl chloride (p-TsCl, 0.45 g, 2.38 mmol)
at 0 C. After stirring at room temperature for 12 h, the
reaction mixture was acidified and filter-washed with
H2O. The obtained white solid was air-dried to produce 2:
1H NMR (acetone‑d6) δ 7.76 (d, J = 8.4 Hz, 2H), 7.70 (d,
J = 8.6 Hz, 2H), 7.63 (d, J = 16.1 Hz, 1H), 7.49 (d,
Bull. Korean Chem. Soc. 2019, Vol. 40, 743–746
© 2019 Korean Chemical Society, Seoul & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.bkcs.wiley-vch.de
745

BULLETIN OF THE
Note
KOREAN CHEMICAL SOCIETY
J = 8.0 Hz, 2H), 7.10 (d, J = 8.7 Hz, 2H), 6.51 (d,
J = 16.0 Hz, 1H), 2.47 (s, 3H).
(PJ01326001), Rural Development Administration, Repub-
lic of Korea and a grant from Konkuk University (2018).
Synthesis of (R)-1,2-isopropylidene glyceryl p-coumaric
acid p-toluenesulfonate (3) and (R)-1,2-isopropylidene glyc-
eryl p-coumaric acid p-toluenesulfonate (4). To a suspension
of 2 (0.10 g, 3.14 mmol) in dichloromethane (20 mL),
(R)-(−)-2,2-dimethyl-1,3-dioxolane-4-methanol
(0.058 mL,
References
4.71 mmol) or (S)-(+)-2,2-dimethyl-1,3-dioxolane-4-methanol
(0.058 mL, 4.71 mmol) was added, followed by addition of
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
(0.21 g, 1.10 mmol) and N,N-dimethylpyridine (134 mg,
1.10 mmol). After stirring at room temperature for 4 h, and
the reaction mixture was concentrated in vacuo. The crude
product was purified via column chromatography on a silica
gel (dichloromethane: ethyl acetate = 20:1) to obtain 3 or 4 as
a pale yellow solid; 1H NMR (acetone‑d6) δ 7.76 (d,
J = 8.4 Hz, 2H), 7.71 (d, J = 8.6 Hz, 2H), 7.67 (d,
J = 16.1 Hz, 1H), 7.48 (d, J = 8.0 Hz, 2H), 7.11 (d,
J = 8.7 Hz, 2H), 6.56 (d, J = 16.0 Hz, 1H), 4.37 (ddd,
J = 12.1, 10.8, 4.8 Hz, 1H), 4.25 (dd, J = 11.5, 4.6 Hz, 1H),
4.19 (dd, J = 11.5, 5.8 Hz, 1H), 4.11 (dd, J = 8.4, 6.5 Hz,
1H), 3.80 (dd, J = 8.4, 6.0 Hz, 1H), 2.46 (s, 3H), 1.37 (s,
3H), 1.31 (s, 3H).
1. A. S. de Miranda, L. S. M. Miranda, R. O. M. A. de Souza,
Biotechnol. Adv. 2015, 33, 372.
2. A. Rouf, S. C. Taneja, Chirality 2014, 26, 63.
3. D. Breitgoff, K. Laumen, M. P. Schneider, J. Chem. Soc.
Chem. Commun. 1986, 20, 1523.
4. T. Harada, H. Nakajima, T. Ohnishi, M. Takeuchi, A. Oku,
J. Org. Chem. 1992, 57, 720.
5. S. K. Karmee, Appl. Microbiol. Biotechnol. 2009, 81, 1013.
6. M. E. de Araújo, Y. E. Franco, M. C. Messias,
G. B. Longato, J. A. Pamphile, P. O. Carvalho, Planta Med.
2017, 83, 7.
7. P. Y. Stergiou, A. Foukis, M. Filippou, M. Koukouritaki,
M. Parapouli, L. G. Theodorou, E. Hatziloukas, A. Afendra,
A. Pandey, E. M. Papamichael, Biotechnol. Adv. 2013,
31, 1846.
8. J. C. D.’. Auria, Curr. Opin. Plant Biol. 2006, 9, 331.
9. L. Hoffmann, S. Maury, F. Martz, P. Geoffroy, M. Legrand,
J. Biol. Chem. 2003, 278, 95.
10. M. L. Sullivan, Plant Physiol. 2009, 150, 1866.
11. M. L. Sullivan, Planta 2014, 239, 1091.
12. M. Sander, M. Petersen, Planta 2011, 233, 1157.
13. J. Rösler, F. Krekel, N. Amrhein, J. Schmid, Plant Physiol.
1997, 113, 175.
14. C. B. Jendresen, S. G. Stahlhut, M. Li, P. Gaspar, S. Siedler,
J. Förster, J. Maury, I. Borodina, A. T. Nielsen, Appl. Envi-
ron. Microbiol. 2015, 81, 4458.
15. D. G. An, M. N. Cha, S. P. Nadarajan, B. G. Kim, J.-H. Ahn,
Appl. Biol. Chem. 2016, 59, 173.
16. I. A. Kim, B.-G. Kim, M. Kim, J.-H. Ahn, Phytochemistry
2012, 76, 25.
17. T. Lütke-Eversloh, G. Stephanopoulos, Appl. Microbiol. Bio-
technol. 2007, 75, 103.
18. L. Moire, A. Schmutz, A. Buchala, B. Yan, R. E. Stark,
U. Ryser, Plant Physiol. 1999, 119, 1137.
19. P. E. Kolattukudy, Science 1980, 208, 990.
20. A. Schmutz, T. Jenny, N. Amrhein, U. Ryser, Planta 1993,
189, 453.
21. D. G. H. Daniels, H. F. Marin, J. Sci. Fd. Agric. 1968,
19, 710.
22. D. Fomergue, D. K. Kosma, Plants (Basel) 2017, 6, 25.
23. M. J. Kim, B.-G. Kim, J.-H. Ahn, Appl. Microbiol. Bio-
technol. 2013, 97, 7195.
Synthesis of (R)-1-O-p-coumaroyl glycerol (5) and (S)-
1-O-p-coumaroyl glycerol (6). To a solution of 3 or
4 (0.15 g, 0.35 mmol) in tetrahydrofuran (THF, 10 mL),
tetrabutylammonium fluoride (1 M in THF) (0.80 mL,
2.77 mmol) was added. After stirring at room temperature
for 2 h, the reaction mixture was concentrated in vacuo and
used for the subsequent step without further purification.
The p-coumaric acid ester obtained above (3 or 4)
(0.10 g, 0.72 mmol) in THF (10 mL) was treated with 2 M
HCl (10 mL). After stirring at room temperature for 1 h,
the reaction mixture was concentrated to eliminate volatiles.
The aqueous layer was extracted thrice with ethyl acetate,
and the combined organic layers were washed with brine,
dried over MgSO4, filtered, and concentrated in vacuo. The
crude product was purified via column chromatography on
a silica gel (hexane: acetone = 3:2) to give 5 or 6 as a white
1
solid: H NMR (acetone‑d6) δ 7.57 (d, J = 15.9 Hz, 1H),
7.55 (d, J = 8.6 Hz, 2H), 6.79 (d, J = 8.6 Hz, 2H), 6.39 (d,
J = 16.0 Hz, 1H), 4.15 (dd, J = 11.2, 4.1 Hz, 1H), 4.01 (dd,
J = 11.2, 6.5 Hz, 1H), 3.73–3.68 (m, 1H), 3.41 (dd,
J = 11.1, 5.5 Hz, 1H), 3.37 (dd, J = 11.3, 6.0 Hz, 1H).
Acknowledgments. This study was funded by a grant
from the Next-Generation BioGreen 21 Program
Bull. Korean Chem. Soc. 2019, Vol. 40, 743–746
© 2019 Korean Chemical Society, Seoul & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.bkcs.wiley-vch.de
746