Superior HIV-1 TAR Binders with Conformationally Constrained R52 Arginine Mimics in the Tat(48–57) Peptide

Article abstract of DOI:10.1002/cmdc.201700653

We report a 100-fold increase in binding affinity of the Tat(48–57) peptide to HIV-1 transcriptional activator-responsive element (TAR) RNA by replacing Arg52, an essential and critical residue for Tat's specific binding, with (2S,4S)-4-guanidinoproline. The resulting αTat1M peptide is a far superior binder than γTat1M, a peptide containing another conformationally constrained arginine mimic, (2S,4S)-4-amino-N-(3-guanidinopropyl)proline, or even the control Tat peptide (CtrlTat) itself. Our observations are supported by circular dichroism (CD), isothermal titration calorimetry (ITC), gel electrophoresis and UV spectroscopy studies. Molecular dynamics simulations suggest increased interactions between the more compact αTat1M and TAR RNA, relative to CtrlTat. The CD signature of the RNA itself remains largely unchanged upon binding of the peptides. The Tat mimetics further have better cell uptake properties than the control Tat peptide, thus increasing their potential application as specific TAR-binding molecules.

Full text of DOI:10.1002/cmdc.201700653

Accepted Article
Title: Superior HIV-1 TAR-Binders with Conformationally Constrained
R52 Arginine Mimics in Tat (48-57) Peptide
Authors: Govind S. Bhosle, Shalmali Kharche, Santosh Kumar, Durba
Sengupta, Souvik Maiti, and Moneesha Fernandes
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201700653
Link to VoR: http://dx.doi.org/10.1002/cmdc.201700653
A Journal of
www.chemmedchem.org

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
Superior HIV-1 TAR-Binders with Conformationally Constrained
R52 Arginine Mimics in Tat (48-57) Peptide
[
a,d]
[b,d]
[c]
[b,d]
[c,e]
Govind S. Bhosle, Shalmali Kharche, Santosh Kumar, Durba Sengupta, Souvik Maiti* and
[
a,d]
Moneesha Fernandes*
[a]
G. S. Bhosle, Dr. M. Fernandes (ORCID 0000-0002-0751-3541)
Organic Chemistry Division
CSIR-National Chemical Laboratory (CSIR-NCL)
Dr. Homi Bhabha Road, Pune 411008, India.
E-mail: m.dcosta@ncl.res.in
[
b]
c]
S. Kharche, Dr. D. Sengupta
Physical and Materials Chemistry Division
CSIR-National Chemical Laboratory (CSIR-NCL)
Dr. Homi Bhabha Road, Pune 411008, India.
S. Kumar, Dr. S. Maiti
[
Structural Biology Unit
CSIR-Institute of Genomics and Integrative Biology (CSIR-IGIB)
Delhi, India.
E-mail: souvik@igib.res.in
[
[
d]
e]
Academy of Scientific and Innovative Research (AcSIR), CSIR-NCL Campus, Pune, India
Academy of Scientific and Innovative Research (AcSIR), CSIR-IGIB Campus, Delhi, India
Supporting information for this article is given via a link at the end of the document.
Abstract: We report a hundred-fold increase in binding affinity of the
Tat(48-57) peptide to HIV-1 TAR RNA by replacing R52, an
essential and critical residue for Tat's specific binding, by (2S,4S)-4-
guanidinoproline. The resulting αTat1M peptide is a far superior
binder than γTat1M, a peptide containing another conformationally
constrained arginine mimic, (2S,4S)-4-amino-N-(3-guanidinopropyl)-
proline, or even the control Tat (CtrlTat) itself. Our observations are
supported by CD, ITC, gel electrophoresis and UV spectroscopy
studies. Molecular dynamics simulations suggest increased
interactions between the more compact αTat1M and TAR RNA, in
comparison to CtrlTat. The CD signature of the RNA itself remains
largely unchanged upon binding of the peptides. The Tat mimetics
further have better cell uptake properties in comparison to the
control Tat peptide, thus increasing their application potential as
specific TAR-binding molecules.
the Tat(47-57) peptide, but vary (in spacing and/or chirality) the
relative positions of the functional groups. The success of these
analogues in disrupting the Tat-TAR interaction endorses the
importance of the cationic nature of the peptide and also the
relative presentation of cationic groups in determining the
binding affinity. In spite of these reports, there still exists a
pressing need for newer effective agents that can selectively
and strongly bind TAR RNA. Although proteolytically stable
10,13
peptide derivatives have been used previously to target TAR,
linear peptide analogues were found highly flexible and bound
various RNAs, preventing sufficient activity in cells. Therefore,
we focused our attention on conformationally pre-organized
mimics of HIV-1 Tat. Arginine 52 (R52) has been shown to be
14
essential for TAR-binding,
through possible bidentate
hydrogen-bonding with the two phosphates between residues
A22-U23-C24, and also with the ribose 2'-OH groups, of the
trinucleotide bulge region of TAR RNA. The presentation of the
forked arginine guanidine group in the context of flanking
cationic residues is particularly important for the binding of
Tat(47-57) to TAR RNA. We therefore chose to replace R52 with
conformationally constrained mimics, and envisioned the
RNAs are known to play key roles in many biological processes
and are considered key regulators of gene expression. They
serve as the main genetic material for many viruses such as HIV,
HCV, influenza, flaviviruses, etc. Therefore molecules that can
bind specifically to critical target RNA and disturb its function are
modulation of Tat-TAR binding through the use of proteolytically
1
greatly important in the strategy to control such retroviruses.
15b, ESI (Figure S3)
stable analogues.
Thus, two non-natural
Transcription of HIV-1 RNA requires the interaction of the virally
encoded Tat protein with the transcriptional activator-responsive
element (TAR), a bulged RNA stem-loop structure formed by the
g
pyrrolidine-based amino acids- (2S,4S)-4-guanidinoproline (P )
and (2S,4S)-4-amino-N-(3-guanidinopropyl)-proline (r), were
incorporated at position 52 of the Tat(48-57) peptide, in lieu of
arginine (Figure 1). We report herein the interesting effect of
these arginine mimics on the binding ability of the resulting Tat
peptides to TAR RNA, and find that they are distinctly different.
2
nascent transcript. Tat-TAR interactions are localized mainly to
a
trinucleotide pyrimidine bulge (residues U23-U25) and
3
adjacent duplex region in TAR RNA and the 11-amino acid
basic region of Tat (residues 47-57, YGRKKRRQRRR) (Figure
4
The synthesis of the non-natural arginine surrogates was
1). The disruption of this interaction, is thus, an area of much
15,16
accomplished as described earlier.
The orthogonally
research towards the control of HIV-1. In this direction, a variety
protected monomers Z and X (ESI, Figure S1) were utilized in
the solid phase synthesis of the αTat1M and γTat1M peptides
respectively, listed in Figure 1 (inset). The chemical structures of
the peptides are illustrated in the ESI, Figure S2. The peptides
5
6
7
of ligands including peptides besides Tat, peptidomimetics,
8
9
peptoids and peptide nucleic acids were reported. Backbone-
10
modified
Tat
analogues
including
and various peptoid-based
structures have been reported and preserve the side chains of
a
D-peptide,
11
12
oligocarbamate,
oligourea
g
αTat1M and γTat1M contain one P and r unit respectively,
8
towards the center of the oligomer. A control Tat peptide
1
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
(
CtrlTat) was also synthesized for comparison. For cell uptake
is mainly entropically driven. These favourable changes for the
binding of αTat1M could be a consequence of increased specific
hydrogen bonding contacts with TAR RNA, accompanied by
release of large number of ordered water molecules upon
complex formation, in comparison to CtrlTat or γTat1M.
studies, the peptides were tagged with fluorescein at their N-
termini (Peptides CtrlTat-cf, αTat1M-cf and γTat1M-cf in Figure
1
, inset).
The electrophoretic mobility shift assay (EMSA) is routinely used
to evaluate ligand-RNA interactions and it is possible to distinctly
and efficiently resolve free from bound RNA. Tat peptides at
increasing molar ratios (peptide:TAR RNA) of 5, 10, 15 and 20
were added to TAR RNA, and the resulting complexes analyzed
by PAGE (Figure 3). As seen in the figure, the band of free TAR
RNA is seen to decrease with increasing concentration of the
Tat peptides. This is apparent for the αTat1M peptide, where the
TAR RNA band is not visible even at the ratio of 10, further
supporting its strong binding to TAR RNA. Several increasingly
retarded bands are also visible on the gel, probably indicative of
higher order associations of the Tat peptides with TAR RNA,
most likely due to electrostatic association, rather than specific
interactions such as hydrogen bonding. A similar EMSA study
with an unrelated RNA (urRNA, 5'-r(GGA GAA UGG AGU CAA
UGU)) revealed no binding (ESI, Figure S5) of the Tat peptides,
thus re-affirming that the observed binding of the peptides to
TAR RNA is specific and not merely driven by electrostatic
interactions.
Code
Peptide
g
αTat1M
Ac-FGRKKP RQRRR-βAla-NH2
γTat1M
Ac-FGRKKrRQRRR-βAla-NH2
cf-GRKKRRQRRR-NH2
CtrlTat-cf
g
αTat1M-cf
γTat1M-cf
cf-GRKKP RQRRR-βAla-NH2
cf-GRKKrRQRRR-βAla-NH2
TAR RNA: 5'-r(GCAGAUCUGAGCCUGGGAGCUCUCUGC)
Figure 1. The Tat (47-57) peptide and proposed arginine mimics. Inset:
Oligomers of the study. The residue at position 52 of the Tat peptide is
indicated in boldface.
UV-melting experiments were carried out to examine the thermal
stability of the TAR RNA (Figure 1, inset) stem-loop in the
absence and presence of varying amounts of Tat peptide. The
UV melting curves for the TAR RNA at a peptide:RNA ratio of
0:1, 1:1, 2:1, and 3:1 are shown in the ESI (Figure S4), and the
data are listed in Table S1, ESI. The TAR RNA itself exhibited a
TAR RNA +CtrlTat
Time / min
TAR RNA +αTat1M
TAR RNA +γTat1M
17
Time / min
Time / min
T
m
of 67.0 °C, as reported earlier. The presence of peptide in
increasing concentration led to a successive increase in T . For
a [peptide]/[RNA] ratio of 1:1, the T enhancement (∆T ) was
between 0.9 to 1.7 °C, while higher [peptide]/[RNA] ratios
resulted in a further increase in the T of the RNA (∆T = 1.7 to
.7 °C for a ratio of 3:1). This increase in T at higher ratios
could be a result of secondary binding events.
0
50 100 150 200
0
50
100
150
0
50 100 150 200 250
0
0.10
0.00
-0.10
-0.20
-0.30
.20
0
.01
.00
0
.00
m
0
-
-
-
-
0.04
0.08
0.12
m
m
-0.01
-0.02
-0.40
m
m
-0.03
- 01 . 05 0
0 .11 . 60
0.5
0
.00
-0.20
0.40
3
m
0.00
0
.0
0.5
-1.0
-
-1.00
-2.00
-3.00
-
-0.60
-0.80
-1.00
Measuring thermodynamic parameters of peptide binding to
RNA offers valuable information of the molecular forces involved
in complex formation that cannot be obtained by structural
studies alone. Isothermal titration calorimetry (ITC) was
therefore carried out to thermodynamically evaluate the binding
of the Tat peptides to TAR RNA. Figure 2 shows representative
ITC profiles resulting from the injection of the Tat peptides into a
solution of the TAR RNA stem-loop. The injection heats were
corrected by subtraction of the corresponding dilution heats
derived from the injection of identical amounts of peptides into
-
1.5
2.0
-
0
1
2
3
4
5
6
7
8
0 1 2 3 4 5 6 7
0
1
2
3
4
5
6
Molar ratio
Molar ratio
Molar ratio
Figure 2. ITC profiles for the interaction of Tat peptides of the study with TAR
RNA. Upper panels: each of the heat burst curves corresponds to a single
peptide injection. Lower panels: corrected injection heats as a function of the
[
peptide]/[RNA] ratio.
17a
buffer alone.
The injection heat data corresponding to the
αTat1M
γTat1M
CtrlTat
titration of the RNA with peptide were fitted with a model for one
set of binding sites and the derived parameters are summarized
in Table S2, ESI. The studies showed that αTat1M binds to one
site on TAR RNA with a remarkable hundred-fold stronger
5
10 15 20 5 10 15 20 5 10 15 20
6
-1
affinity, Ka = 2.40 × 10 M compared to γTat1M and CtrlTat with
4
-1
4
-1
K
a
values 3.03 × 10 M and 2.94 × 10 M respectively. The
Tat:TAR complex
TAR RNA
binding is associated with binding stoichiometry (n) of
a
approximately 1.4 peptide molecules/RNA in case of αTat1M.
However the binding of CtrlTat and γTat1M is accompanied by a
stoichiometry (n) of 2.5 and 6.7 respectively. The lower
stoichiometry for the αTat1M binding is probably indicative of
specific and strong binding, in contrast to non-specific binding
due to electrostatics alone. The entropy change associated with
the binding of αTat1M to TAR RNA, as represented by (T∆S)
Figure 3. EMSA of the Tat peptides of the study. Tat peptides were added at
increasing molar ratios (peptide:TAR RNA) of 5, 10, 15 and 20. The bands
were visualized by UV-shadowing.TAR RNA was taken at a concentration of
200 µM.
(9.23 Kcal/mol) is also higher compared to CtrlTat and γTat1M
(5.66 and 4.91 Kcal/mol respectively), indicating that the binding
2
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
The arginine mimics described in this study being
conformationally constrained, were expected to pre-organize the
structure of the derived Tat1M peptides, offering an entropic
advantage in binding to target TAR RNA. In order to evaluate
this, the CD spectra of the Tat peptides of the study were
recorded in water and in presence of the secondary structure-
inducing solvent, trifluoroethanol (TFE) (Figure 4). The Tat(47-
to TAR RNA using NPDock server and minimized and scored
using CHARMM36 force-field. The most favourable docked
complexes are shown in Figure 5. The interaction energies of
these complexes are −1821.2571 kJ/mol for αTat1M as
compared to −1520.5622 kJ/mol for CtrlTat, indicating an
improved binding of αTat1M. The αTat1M-TAR RNA complex
exhibited larger number of hydrogen bonds, salt bridges and
overall contacts compared to CtrlTat (Table 1). In particular, the
increased intermolecular hydrogen bonding contacts (ESI, Table
S3) that were observed for this peptide (totally 15 Vs 8 in
CtrlTat) contribute significantly, with increased contacts with
sugar atoms (6 in αTat1M Vs 1 in CtrlTat) and those involving
the peptide backbone (9 in αTat1M Vs 7 in CtrlTat). Additionally,
the CtrlTat peptide was observed mainly to contribute in the form
of hydrogen bond donors, while the αTat1M peptide exhibited
significant number of donor as well as acceptor contributions in
binding to TAR RNA (Figure 5, inset and ESI, Table S3). From
an analysis of the TAR residues involved in hydrogen bonding
with the Tat peptides, it appears that αTat1M not only binds
through increased contacts in the trinucleotide bulge region, as
is known for CtrlTat, but additionally, has significant number of
hydrogen bonding interactions with residues in the loop region
(Residues C30 through G36, Figure 5, inset). These loop
interactions were not observed in the case of CtrlTat, which
bound mainly the bulge region and part of the adjoining stem
(Figure 5, inset). The number of interactions within a 2Å limit
(Table 1) were also more for αTat1M (20) in comparison to
CtrlTat (16). It is clear that the specificity of the αTat1M binding
to TAR RNA is derived mainly from specific hydrogen bonding
contacts between the two, and is not merely electrostatic. In fact,
the γTat1M peptide possesses an extra charge at physiological
pH (totally 9 positive charges, ESI Figure S2) in comparison to
αTat1M (totally 8 positive charges), but still failed to bind as
strongly to TAR RNA, emphasizing the specificity of this
interaction, and the importance of the relative presentation of
positive charges, in particular, specific guanidine moieties (as
we have shown, for R52), along the backbone.
5
8) peptide is reported to display a CD signature equivalent to
18
an unstructured random coil structure, even in the presence of
TFE.
19,20
The CtrlTat peptide in our study displayed a random
19
coil structure in water, as reported earlier, but contrary to the
earlier report, showed a significant change towards the α-helical
structure in the presence of TFE (Figure 4B). A similar trend was
observed for the γTat1M peptide, which displayed a CD
signature similar to CtrlTat in water and two distinct negative
bands at 225 and 205 nm in TFE. The αTat1M peptide that
g
contains the conformationally constrained arginine mimic P , on
the other hand, displayed markedly different CD signatures in
both, water and TFE. In water, a maximum at 230 nm and
minima at ≈ 237 and ≈ 206 nm, whereas in TFE, a strong
minimum at 230 nm, and another at ≈ 215 nm, were observed.
Molecular dynamics simulations were performed, wherein the
CtrlTat and αTat1M peptides were modeled as extended
conformations and simulated in water for 1 μs each. On an
average, peptides were unstructured, although the αTat1M
analogue appeared to be more compact, as evident from its
lower radius of gyration in comparison to CtrlTat (ESI, Figure
S6). All the structures from simulations were clustered and
representative structures from the top three clusters were
chosen for structural studies. Interestingly, CtrlTat exhibited a
large number of clusters with lower population in the top three
clusters, indicating a higher dynamics compared to αTat1M (ESI,
Figure S7).
1
1
5000
0000
CtrlTat
αTat1M
γTat1M
20000
CtrlTat
αTat1M
γTat1M
(
A)
(B)
1
1
5000
0000
5
000
0
5
000
0
-
5000
-
5000
-
-
-
10000
15000
20000
-
10000
-15000
-20000
(a)
(b)
2
00 220 240 260 280
200 220 240 260 280
Wavelength / nm
Wavelength / nm
Figure 4. CD spectra of the Tat peptides of the study in (A) water and (B) TFE.
We further investigated the effect of the Tat peptides binding to
TAR RNA by CD. This is illustrated in Figure S8 (ESI), where the
overall CD spectrum of TAR RNA was observed to remain
largely unchanged, with a maximum at ~ 261 nm and a small
mimimum at ~ 233 nm. Upon addition of the Tat peptides in
increasing concentration, a decrease in the amplitude at 261 nm,
which is sensitive to base-stacking interactions, was apparent in
the case of αTat1M, while this remained almost unchanged with
CtrlTat and was very low with γTat1M, again probably indicative
of the stronger interactions between αTat1M and TAR RNA, in
comparison to CtrlTat or γTat1M.
Figure 5. Docked complexes of (a) CtrlTat and (b) αTat1M peptides with TAR
RNA. The Tat peptides are rendered in Licorice representation and shown in
g
orange. Modified residue P and R52 are shown as CPK representation. TAR
RNA is shown in green. Insets: H-bonding contacts as observed in the
simulation studies with CtrlTat and αTat1M. The hydrogen bond
donors/acceptors are indicated by means of arrows pointing away or towards
the residue respectively. Nucleotides in red indicate TAR residues involved in
these interactions.
To unravel the basis of the enhanced binding of αTat1M peptide
to TAR RNA, the interaction energies of TAR RNA complex with
αTat1M and CtrlTat were analyzed. The peptides were docked
3
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
Table 1. Interactions between Tat peptides and TAR RNA.
translated into significantly different TAR-binding abilities.
αTat1M bound TAR RNA with a 100-fold higher affinity than
CtrlTat, possibly due to its compact nature and increased
interactions, including specific hydrogen bonding contacts with
the TAR residues in the bulge and loop regions, salt bridges,
besides electrostatic and other interactions. The enhanced cell
penetration properties of the Tat analogues presented herein
further prompts their exploitation as molecular transporters to
transport anti-HIV drugs into cells, as double-headed bullets
against the virus. It is indeed noteworthy, and to our knowledge,
unprecedented, that the modification of a single residue in Tat
can lead to such extreme differences in binding to TAR RNA,
and potentially prevent the viral process of transactivation of
transcription.
CtrlTat
αTat1M
−1821.257
15
Total interaction energy* (kJ/mol)
−1520.562
Number of intermolecular hydrogen
bonds
8
Number of intermolecular salt bridge
interactions
6
7
Number of contacts between Tat and
TAR RNA within 2 Å cutoff
16
20
*Total interaction energies calculated after energy minimization in GROMACS.
An attractive advantage of developing Tat peptide analogues as
TAR RNA ligands is their ability to penetrate cells. We therefore,
g
sought to evaluate the effect that the inclusion of P and r as
Experimental Section
arginine mimics would have on the cell-penetrating properties of
the fluorescein-tagged peptides (Figure 1) in HeLa cells, by flow
cytometry (Figure 6). The effect of a similar pre-organized β-
amino acid was recently reported to have a positive effect on the
Experimental Details.
Synthesis of arginine surrogates
20
cell-permeation properties of the Tat peptide, although in the
said report, three β-amino acid residues were simultaneously
included in the derived Tat peptide. In our study, both, αTat1M
and γTat1M, containing only a single pre-organized residue,
The orthogonally protected precursor for (2S,4S)-4-guanidinoproline, i.e.,
15
(2S,4S)-N1-Boc-4-(Fmoc-amino)proline
Z
(ESI, Figure S1),
was
synthesized starting from naturally occurring (2S,4R)-4-hydroxyproline as
shown in the ESI, Scheme S1, following sequential steps of N-Boc
protection, esterification, S 2 inversion of the 4(R)-hydroxy group to the
N
were internalized by >95% of the counted cells, with
significantly higher mean fluorescence in comparison to CtrlTat
Figure 6B), demonstrating their considerably superior cell-
a
corresponding 4(S)-azide through a mesyl intermediate, reduction of the
azide by hydrogenation, Fmoc-protection of the resulting amine and
finally ester hydrolysis to yield the N1-Boc-4(S)-(Fmoc-amino)-proline
derivative (Z) suitable for use in solid phase synthesis. The 4-amino
(
penetrating ability. Confocal microscopy revealed that the
peptides are distributed throughout the cytoplasm and are also
visible in the nuclei and nucleoli (ESI, Figure S9), indicating their
ability to traverse cell and nuclear membranes. Considering
fluorescein as a model cargo molecule, it may be foreseen that a
similar conjugation strategy be applied for covalently conjugating
other cell-impermeable drugs to the Tat peptides to deliver them
into cells for more effective therapeutic applications. Further, the
cytotoxicity of the Tat peptides was assessed by the standard
MTT cell viability and hemolysis assays (Figure S10, ESI),
where they were demonstrated to be relatively non-toxic.
g
group in Z was converted to the corresponding guanidino derivative, P
(Figure 1), subsequent to peptide synthesis, just prior to cleavage from
the solid support, after removal of the Fmoc protecting group, and
subsequent treatment with 1H-pyrazole carboxamidine in the presence of
Hünig's base in DMF.
The precursor to (2S,4S)-4-amino-N1-(3-guanidinopropyl)-proline, i.e.,
(
2S,4S)-4-(Fmoc-amino)-N1-((3-Boc-amino)propyl)-proline,
X
(ESI,
Figure S1), was also synthesized from the naturally occurring (2S,4R)-4-
15b,16
hydroxyproline as described earlier,
following sequential steps of
esterification, N-alkylation, S 2 inversion of the 4(R)-hydroxy function to
N
the corresponding 4(S)-azide through a mesyl intermediate, reduction of
the azide to the corresponding amine followed by ester hydrolysis and
finally amine protection as an Fmoc-derivative, to yield the orthogonally
protected monomer X, suitable for use in solid phase synthesis. The
pendant amino group of the N3-aminopropyl segment was converted to
its guanidino derivative, r (Figure 1), subsequent to peptide synthesis,
just prior to cleavage from the solid support. This was achieved by
removal of the Boc protecting group, and subsequent treatment with 1H-
pyrazole carboxamidine in the presence of Hünig's base in DMF.
1
1
,60,000.00
,20,000.00
A
Untreated
CtrlTat+cf
αTat1M+cf
γTat1M+cf
B
8
4
0,000.00
0,000.00
0
.00
Synthesis of Tat peptide oligomers
01 102 103 104 105 106 107
Fluorescence
1
The peptides were assembled on MBHA resin by either Fmoc- or Boc-
chemistry protocols, as required. β-Alanine was coupled as the first
spacer amino acid, followed by the coupling of other amino acids. All the
coupling steps were done in dry DMF in presence of DIPEA, with HOBt
and TBTU as coupling agents. Removal of the Boc-protecting group was
Figure 6. Flow cytometry data for the uptake of Tat peptides in HeLa cells (A)
Number of positive cells. (B) Mean fluorescence. Error bars indicate the
standard deviations (SD), and were calculated from three independent
experiments; each experiment was done in triplicate.
2 2
achieved using 50% TFA in CH Cl , while the Fmoc group was removed
using 20% piperidine in DMF. A phenylalanine residue was added at the
N-termini of the peptides in order to facilitate concentration calculation
from the absorbance. Guanidinylation of monomers Z and X to arginine
surrogates P and r respectively were performed on the solid support
after N-acetylation of the phenylalanine residue at N-terminus, and
deprotection of the appropriate amino group, using 1H-pyrazole-1-
In summary, conformationally constrained non-natural arginine
mimics were incorporated into Tat(48-57) at position 52 in lieu of
arginine. The differences in the arginine mimics in terms of
presentation of the guanidine moiety and peptide backbone
g
4
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
carboxamidine hydrochloride and DIPEA in dry DMF. For cell uptake
studies, the peptides were tagged with fluorescein at their N-termini by
treating them with 5/6-carboxyfluorescein in the presence of HOBt and
diisopropylcarbodiimide (DIPCDI) as coupling agents. The synthesized
peptides were cleaved from the resin by the TFA-TFMSA cleavage
protocol and purified by RP-HPLC on a C18 column. Their purity was re-
checked by analytical HPLC and all the peptides were characterized by
MALDI-TOF analysis.
Molecular dynamics simulations. Molecular dynamics simulations were
performed for the conformational sampling of the Tat peptides using the
24
25
GROMACS v5.0.5 software package. The CHARMM36 force field
was used to represent the peptides and water. The parameters for the
26
modified residue were obtained from CGenFF program. The wild type
and αTat1M peptides were independently solvated using TIP3P water
molecules and the structures were energy minimized using the steepest
descent algorithm. The systems were equilibrated under NVT conditions
for 100 ps, together with position restraints on peptides, followed by
simulations in an NPT ensemble for 1 ns. The system temperatures were
Temperature-dependent UV-melting studies
27
maintained at 300 K using the v-rescale algorithm. A constant pressure
28
of 1 bar was maintained isotropically using ParrinelloRahman algorithm.
Temperature-dependent UV-melting experiments were carried out using
a Cary 100 (Varian) spectrophotometer equipped with a Peltier-controlled
cell holder. A quartz cell of 1 cm path length was used. Temperature-
dependent absorbance changes were recorded at 260 nm with a heating
rate of 0.5 °C/min, from 25 to 100 °C. Before the start of the experiments,
each sample was held for at least 2 min at the initial temperature to attain
the required temperature. In all the melting experiments, concentration of
TAR RNA was 1 µM and peptide concentration was varied from 0 to 3
µM. The samples were prepared in10 mM sodium cacodylate buffer
containing 0.1 mM EDTA and 70 mM NaCl at pH 7.5. For each melting
Production runs of 1 μs were performed for each system.
Docking. The structures sampled in the simulations were clustered using
g_cluster program implemented in GROMACS, with a RMSD cutoff of
0
.25 nm. The representative conformations of three most populated
clusters were used for docking studies. These peptides were docked on
29
HIV-1 TAR RNA (PDB ID: 1ARJ) using NPDock server. The docked
complexes with the best scores were selected and scored on the basis of
interaction energies.
m
experiment, the melting temperature (T ) was determined using
2
1
previously described methods.
Analysis of docked complexes. In order to understand the binding affinity
associated with the peptide-RNA complexes, the minimized structures of
Tat-TAR complexes were analyzed. The docked poses obtained were
further relaxed by performing energy minimization. The interaction
energies were calculated as the sum of the Lennard Jones and
Coulombic electrostatics terms using the CHARMM36 force-field in
GROMACS v5.0.5. The number of intermolecular hydrogen bonds was
Isothermal titration calorimetry (ITC) studies
Isothermal titration calorimetry experiments were conducted at 25 °C on
a Microcal VP-ITC (Microcal, Inc.; Northampton MA). Titration of HIV-1
TAR with Tat and different modified peptides was done by injecting 6 µL
aliquots of 350 µM peptide from a 280 µL capacity rotating syringe (350
rpm) into an isothermal sample chamber containing 1.5 mL HIV-1 TAR
RNA solution at 10 µM concentration. Each experiment of this type was
accompanied by the corresponding control experiment in which 350 µM
peptide was injected into a solution of buffer alone. The duration of each
injection was 12 s and the delay between the injections was 180 s or 300
s, the initial delay prior to the first injection was 300 s. Each injection
generated a heat burst curve (microcalories/second vs. seconds) and the
area under each curve was determined by integration [using the Origin
version 7.0 software (Microcal, Inc.; Northampton, MA)] to obtain the
measure of the heat associated with that injection. The buffer corrected
ITC profiles for the binding of Tat and different modified peptides was fit
30
calculated by HBPLUS program, where hydrogen bond was defined by
these criteria - maximum donor-acceptor distance of 3.9 nm and donor-
H-acceptor angle greater than 90°. The intermolecular salt bridge
interactions were determined as the distance between charged moieties
of amino acid residues and nucleotides must be less than 0.4 nm. The
packing interactions between Tat peptide and TAR RNA were examined
31
using VMD-1.9.2 by considering intermolecular contacts with a distance
cut-off of 0.2 nm. All figures were rendered using VMD-1.9.2.
Circular dichroism (CD) spectroscopic studies
Circular dichroism experiments were performed on
a Jasco J-815
22
with a model for one site of binding. The net enthalpy change for HIV-1
TAR RNA stem loop interaction with Tat and different modified peptides
were determined by subtraction of the heat of dilution from each binding
isotherm.
spectropolarimeter equipped with a Peltier-controlled cell holder in a
quartz cuvette of 1 cm path length. The spectra of the peptides alone
were recorded at a concentration of 500 μM from 300 to 190 nm as
accumulations of 3 scans at a scann speed of 100 nm/min in water and
9
0% TFE (Sigma). The ellipticity in the acquired CD spectra was
converted to the molar ellipticity using the equation: [θ] = θ / (10 × c × l),
Electrophoretic gel mobility shift assay for Tat-TAR binding
2
−1
where, [θ] is the Molar ellipticity (deg.cm .dmol ), θ is the observed
ellipticity corrected for the buffer at a given wavelength (mdeg), c is the
molar concentration and l is the path length (cm). For the complexes of
peptides with TAR RNA, CD spectra were recorded from 320 nm to 200
nm as accumulations of 3 spectra at 25 °C. Each spectrum was collected
at a speed of 100 nm/min and 1 nm data pitch. The buffer solution
contained 10 mM sodium cacodylate buffer, 0.1 mM EDTA and 70 mM
NaCl at pH 7.5. For the titration experiments, TAR RNA was taken at a
concentration of 2 µM and the peptides were added in increasing
concentrations from 0 to 10 µM. The baseline was corrected for every
spectrum under identical conditions.
The TAR RNA binding ability of the Tat peptide and its analogues was
assessed by non-denaturing polyacrylamide gel electrophoresis using
2
0% gels. For the gel, TAR RNA (200 μM) was mixed with peptides at
varying concentrations, as indicated, in TAE buffer and incubated at
room temperature for 30 min prior to loading on the gel. The gel was run
in TAE buffer at a voltage of 150 V at 4 °C till the bromophenol blue dye
had migrated to 3/4th of the gel length. The bands were visualized by
UV-shadowing.
Computational analysis of Tat peptides binding to TAR RNA
Cell uptake and cytotoxicity studies
Structure. The 3D structure of wild type Tat peptide (CtrlTat),
corresponding to residues 47-57 [YGRKKRRQRRR], was taken from the
crystal structure of the HIV-1 Tat protein (PDB ID: 1JFW). This structure
was further used to build the modified αTat1M peptide by replacement of
R52 by the modified residue (TMP) and Y47 by F47 (in line with the
Cellular uptake studies using Flow cytometry. HeLa cells were seeded in
2
4-well plates at a density of 50,000 cells/well and incubated for 24 h.
The fluorescently tagged peptides were added to the cells at
concentrations of 5 μM in 300 μL of serum-free medium. After 4h
incubation at 37 °C, cells were washed with PBS containing heparin (1
mg/mL) to remove membrane bound peptides. Thus, the fluorescence-
positive cells (Figure 6A) that were obtained are indicative of internalized
23
synthetic Tat peptides of the study) using Discovery Studio Visualizer.
32
5
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
peptides alone and exclude those superficially and externally associated
with the cell membrane. Cells were then collected by trypsinization and
resuspended in PBS and placed on ice. Flow cytometry measurements
were carried out on a BD Accuri™ C6 Flow Cytometer System using BD
Accuri C6 Software. 10,000 live cells were used for each analysis at
room temperature. Flow cytometry measurements at 37 °C, subsequent
to treating the cells with peptides at the same temperature were carried
out using the same protocols as mentioned above. The uptake
experiments were repeated in triplicates.
The authors declare no conflict of interest.
Keywords: Tat-TAR binding • arginine mimics • Tat peptide
analogues •
References:
[1]
[2]
[3]
(a) Y. Tor, ChemBioChem 2003, 4, 998-1007. (b) T. Hermann, Curr.
Opin. Struct. Biol. 2005, 15, 355-366.
Confocal microscopy. Cells were seeded at a density of 10,000 cells/well
in a 12-well plate (NEST biotech, China) and incubated for 24 h. Labeled
peptides (5 μM) were added to the cells in serum-free media and
incubated at 37 °C for 4 h. After 4 h of incubation at 37 °C, cells were
washed twice with ice cold 1× phosphate buffered saline (PBS) and fixed
with 4 % paraformaldehyde. The cells then treated with 500 nM of DAPI
solution for 5 min at 37 °C. The excess of DAPI was again washed off
using 1X PBS twice and cells were again incubated with 100 nM
Lysotracker solution for 3 min at 37 °C. Finally cells were washed with 1X
PBS twice before imaging to remove residual traces of Lysotracker.
Imaging was done at room temperature on an inverted LSM510 META
laser scanning microscope (Carl Zeiss, Germany) using the 488 nm line
of an argon laser for fluorescein.
S.-Y. Kao, A. F. Calman, P. A. Luciw, B. M. Peterlin, Nature 1987,
330, 489-493.
(a) C. Dingwall, I. Ernberg, M. J. Gait, S. M. Green, S. Heaphy, J. Karn,
A. D. Lowe, M. Singh, M. A. Skinner, EMBO J. 1990, 9, 4145- 4153. (b)
M. G. Cordingley, R. L. LaFemina, P. L. Callahan, J. H. Condra, V. V.
Sardana, D. J. Graham, T. M. Nguyen, K. LeGrow, L. Gotlib, A. J.
Schlabach, R. J. Colonno, Proc. Natl. Acad. Sci. U.S.A.1990, 87, 8985-
8989.
[
[
4]
5]
K. M. Weeks, C. Ampe, S. C. Schultz, T. A. Steitz, D. M.
Crothers, Science 1990, 249, 1281-1285.
(a) H.-Y. Mei, D. P. Mack, A. A. Galan, N. S. Halim, A. Heldsinger, J. A.
Loo, D. W. Moreland, K. A. Sannes-Lowery, L. Sharmeen, H. N. Truong,
A. W. Czarnik, Bioorg. Med. Chem. 1997, 5, 1173–1184. (b) S. Kumar,
D. P. Arya, Bioorg. Med. Chem. Lett. 2011, 21, 4788–4792. (c) J. Tao,
A. D. Frankel, Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 2723–2726. (d) B.
Davis, M. Afshar, G. Varani, A. I. Murchie, J. Karn, G. Lentzen, M.
Drysdale, J. Bower, A. J. Potter, I. D. Starkey, T. Swarbrick, Aboul-ela,
F. J. Mol. Biol. 2004, 336, 343–356. (e) R. Pang, C. Zhang, D. Yuan, M.
Yang, Bioorg. Med. Chem. 2008, 16, 8178–8186. (f) M. Froeyen, P.
Herdewijn, Curr. Top. Med. Chem. 2002, 2, 1123–1145. (g) G.
Mousseau, S. Valente, Biology 2012, 1, 668-697. (h) A. C. Stelzer, A.
T. Frank , J. D. Kratz, M. D. Swanson, M. J. Gonzalez-Hernandez, J.
Lee, I. Andricioaei, D. M. Markovitz, H. M. Al-Hashimi, Nat. Chem. Biol.
Cytotoxicity studies. The cytotoxicity of peptides to HeLa cells was
determined by the MTT cell viability assay. All cells were plated overnight
in 96-well plates at a density of 10,000 cells per well in 0.2 ml of
appropriate growth medium with 10
% FBS at 37 °C. Different
concentrations of peptides up to a maximum of 50 µM were incubated
with the cells for 12 h, following which, the peptides were removed by
replacing the media by fresh media. The cell culture medium alone and
with cells, both without peptides, were included in each experiment as
controls. After 12 h incubation, 10 µL of a 5 mg/ml solution of 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) was added
and further incubated for 4 h. Conversion of MTT into purple formazan
product by metabolically active cells is used as an indication of cell
viability. The crystals of formazan were dissolved with DMSO and the
optical density was measured at 570 nm using a microplate reader
VarioskanFlash (4.00.53), for quantification of cell viability. All assays
were run in triplicates.
2011, 7, 553-559.
[
6] (a) Z. Athanassiou, R. L.A. Dias, J, Moehle, N. Dobson, G. Varani, J. A.
Robinson, J. Am. Chem. Soc. 2004, 126, 6906-6913. (b) D. I. Bryson,
W. Zhang, P. M. McLendon, T. M. Reineke, W. L. Santos, ACS Chem.
Biol. 2012, 7, 210−217. (c) D. I. Bryson, W. Zhang, W. K. Ray, W. L.
Santos, Mol. BioSyst. 2009, 5, 1070–1073. (d) S. Hwang, N.
Tamilarasu, K. Ryan, I. Huq, S. Richter, W. C. Still, T. M. Rana, Proc.
Natl. Acad. Sci. U.S.A. 1999, 96, 12997–13002. (e) M. S. Lalonde, M. A.
Lobritz, A. Ratcliff, M. Chamanian, Z. Athanassiou, M. Tyagi, J. Wong,
J. A. Robinson, J. Karn, G. Varani, E. J. Arts, PLoS Pathogens 2011, 7,
1-17. (e) W. Zhang, D. I. Bryson, J. B. Crumpton, J. Wynn, W. L.
Santos, Chem. Commun. 2013, 49, 2436-2438.
Hemolysis assay. Freshly drawn human red blood cells (hRBCs) with
additive K2 EDTA (spray-dried) were washed with PBS buffer several
times and centrifuged at 1000 g for 10 min until a clear supernatant was
observed. The hRBCs were re-suspended in PBS to get a 0.5 % v/v
suspension. Peptides dissolved in PBS were added to a sterile 96-well
plate to a volume of 75 µL in each well. Then 75 µL of 0.5% v/v hRBC
solution was added to make up a total volume of 150 μL in each well.
TritonX-100 and PBS were used as positive and negative controls
respectively. The plate was then incubated at 37 °C for 1 h, followed by
centrifugation at 3500 rpm for 10 min. The supernatant (120 µL) was
transferred to fresh wells and absorbance was measured at 414 nm on a
VarioskanFlash (4.00.53) Microplate Reader. Results were with respect
to the positive (Triton X-100) and negative (PBS) controls. % hemolysis
was determined by the equation: % hemolysis = (Abs.sample – Abs.PBS)/
[7]
(a) Z. Athanassiou, K. Patora, R. L. Dias, K. Moehle, J. A. Robinson, G.
Varani, Biochemistry 2007, 46, 741–751. (b) N. Tamilarasu, I. Huq, T.
M. Rana, Bioorg. Med. Chem. Lett. 2001, 11, 505-507.
[8]
(a) R. J. Simon, R. S. Kania, R. N. Zuckermann, V. D. Huebner, D. A.
Jewell, S. Banville, S. Ng, L. Wang, S. Rosenberg, C.K. Marlowe, Proc.
Natl. Acad. Sci. U.S.A. 1992, 89, 9367-9371. (b) V. Kesavan, N.
Tamilarasu, H. Cao, T. M. Rana, Bioconjugate Chem. 2002, 13, 1171-
1175.
[9]
I. Das, J. Désiré, D. Manvar, I. Baussanne, V. N. Pandey, J.-L. Décout,
J. Med. Chem. 2012, 55, 6021−6032.
(
Abs.Triton-X 100 – Abs.PBS) × 100.
[10]
I. Huq, Y.-H. Ping, N. Tamilarasu, T. M. Rana, Biochemistry 1999, 38,
5
172-5177.
11] X. Wang, I. Huq, T. M. Rana, J. Am. Chem. Soc. 1997, 119, 6444- 6445.
12] N. Tamilarasu, I. Huq, T. M. Rana, J. Am. Chem. Soc. 1999, 121, 1597-
598.
[
[
Acknowledgements
1
[13] F. Hamy, E. R. Felder, G. Heizmann, J. Lazdins, F. Aboul-ela, G. Varani,
We thank CSIR, New Delhi, for funding (BSC0123, GenCODE).
GSB thanks UGC, New Delhi, for a Research Fellowship.
J. Karn, T. Klimkait, Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 3548–3553.
[14] B. J. Calnan, B. Tidor, S. Biancalana, D. Hudson, A. D. Frankel, Science
991, 252, 1167-1171.
15] (a) B. P. Gangamani, V. A. Kumar, K. N. Ganesh, Tetrahedron 1996, 57,
5017−15030. (b) G. S. Bhosle, L. Nawale, D. Sarkar, M. Fernandes,
Unpublished data, Submitted.
1
[
1
Conflict of interest
6
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
[
[
16] H. Chilukuri, Y. M. Kolekar, G. S. Bhosle, R. K. Godbole, R. S. Kazi, M.
J. Kulkarni, M. Fernandes, RSC Adv. 2015, 5, 77332-77340.
17] (a) H. Suryawanshi, H. Sabharwal, S. Maiti, J. Phys. Chem. B 2010, 114,
11155-11163. (b) S. Kumar, S. Maiti, PLoS ONE 2013, 8,1-9.
[
18] G. R. Campbell, E. P. Loret, Retrovirology 2009, 6, 50-63
19] E. P. Loret, P. Georgel, W. C. Johnson Jr., P. S. Ho, Proc. Natl. Acad.
Sci. USA 1992, 89, 9734-9738.
[
[
20] Y. Demizu, M. Oba, K. Okitsu, H. Yamashita, T. Misawa, M. Tanaka, M.
Kurihara, S. H. Gellman, Org. Biomol. Chem. 2015, 13, 5617-5620.
21] L. A. Marky, K. J. Breslauer, Biopolymers, 1987, 26, 1601-1620.
22] M. M. Pierce, C. S. Raman, B. T. Nall, Methods, 1999, 19, 213-221.
23] Discovery Studio Visualizer, version 2.5, Accelrys, Inc., San Diego, CA,
[
[
[
2009.
[
[
[
24] D. Spoel, E. Lindahl, B. Hess, G. Groenhof, A. Mark, H. Berendsen, J.
Comput. Chem. 2005, 26, 1701-1718.
25] P. Bjelkmar, P. Larsson, M. Cuendet, B. Hess, E. Lindahl, J. Chem.
Theory Comput. 2010, 6, 459-466.
26] K. Vanommeslaeghe, E. Hatcher, C. Acharya, S. Kundu, S. Zhong, J.
Shim, E. Darian, O. Guvench, P. Lopes, I. Vorobyov, A. MacKerell Jr., J.
Comput. Chem. 2010, 31, 671-690.
[
[
[
27] H. Andersen, J. Comp. Phy., 1983, 52, 24-34.
28] M. Parrinello, A. Rahman, J. Appl. Phys., 1981, 52, 7182.
29] I. Tuszynska, M. Magnus, K. Jonak, W. Dawson, J. Bujnicki, Nucleic
Acids Res. 2015, 43, 425-430.
[30] I. McDonald, J. Thornton, J. Mol. Biol. 1994, 238, 777-793.
[31] W. Humphrey, A. Dalke, K. Schulten, J. Mol.Graph.1996, 14, 33-38.
[32] M. Lundberg, S. Wikstrom, M. Johansson, Mol. Ther. 2003, 8, 143-150.
7
This article is protected by copyright. All rights reserved.

ChemMedChem
10.1002/cmdc.201700653
COMMUNICATION
Entry for the Table of Contents
Tat(48-57) peptide
The conformationally constrained arginine mimic, (2S,4S)-4-guanidinoproline, replaces R52 in the Tat(48-57) peptide to enhance
HIV-1 TAR RNA-binding a hundred-fold.
8
This article is protected by copyright. All rights reserved.