The Plasmodium falciparum eIK1 kinase (PfeIK1) is central for melatonin synchronization in the human malaria parasite. Melatotosil blocks melatonin action on parasite cell cycle

PROFESSOR CELIA REGINA GARCIA (Orcid ID : 0000-0003-2825-1701)

Article type

: Original Manuscript

The Plasmodium falciparum eIK1 kinase (PfeIK1) is central for melatonin

synchronization in the human malaria parasite. Melatotosil blocks melatonin

action on parasite cell cycle.

Running Title: Melatotosil blocks melatonin action on Plasmodium cell cycle.

Bárbara K. M. Dias^1,2, Myna Nakabashi², Marina Rangel Rodrigues Alves³, Danielle

Pagliaminuto Portella⁴, Benedito Matheus dos Santos ², Fahyme Costa da Silva Almeida¹,

Ramira Yuri Ribeiro¹, Desiree Schuck¹, Alessandro Kappel Jordão^3,4and Celia R. S.

Garcia^2,*

1

Instituto de Ciências Biomédicas, Universidade de São Paulo, Av. Prof. Lineu Prestes, nº

2415, CEP 05508-900, São Paulo, SP, Brazil ISNI: 0000000406355304

2

Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Avenida Professor

Lineu Prestes, 580, bloco 17, São Paulo, SP, 05508-000, Brazil ISNI: 0000000406355304

3

Departamento de Farmácia, Faculdade de Farmácia, Universidade Federal do Rio Grande

do Norte, CEP 59012-570, Natal, RN, Brazil

4

Unidade Universitária de Farmácia, Centro Universitário Estadual da Zona Oeste, CEP

23070-200, Rio de Janeiro, RJ, Brazil

* Author to whom correspondence should be addressed; E-Mail: cgarcia@usp.br

This article has been accepted for publication and undergone full peer review but has not been

through the copyediting, typesetting, pagination and proofreading process, which may lead to

differences between this version and the Version of Record. Please cite this article as doi:

10.1111/jpi.12685

Bárbara K. M. Dias ^1,2

Afiliation: Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São

Paulo

Address: Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Avenida Professor

Lineu Prestes, 580, bloco 17, São Paulo, SP, 05508-000, Brazil, Phone number + 5511-2648-0954

e-mail: bkmdias@gmail.com

Myna Nakabashi²

Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Avenida Professor Lineu

Prestes, 580, bloco 17, São Paulo, SP, 05508-000, Brazil, Phone number + 5511-2648-0954 e-

mail: myna@usp.br

Marina Rangel Rodrigues Alves³

Departamento de Farmácia, Faculdade de Farmácia, Universidade Federal do Rio Grande do

Norte, CEP 59012-570, Natal, RN, Brazil, Phone number +558433429814, e-mail:

marinarangelra@gmail.com

Danielle Pagliaminuto Portella⁴

Unidade Universitária de Farmácia, Centro Universitário Estadual da Zona Oeste, CEP 23070-

200, Rio de Janeiro, RJ, Brazil, Phone number +552123336961, e-mail:

danipagliaminuto62@gmail.com

Benedito Matheus dos Santos ²

Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Avenida Professor Lineu

Prestes, 580, bloco 17, São Paulo, SP, 05508-000, Brazil, Phone number: + 5511-2648-0954 e-

mail: benedito.matheus@usp.br

Fahyme Costa da Silva Almeida¹

Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, Av.

Prof. Lineu Prestes, 1374, CEP 05508-900, São Paulo, SP, Brazil, Phone number + 5511-2648-

0954 e-mail: fahymecosta@gmail.com

Ramira Yuri Ribeiro¹

Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, Av.

Prof. Lineu Prestes, 1374, CEP 05508-900, São Paulo, SP, Brazil, Phone number + 5511-2648-

0954 e-mail : ramyuri@yahoo.com.br

Desiree Schuck¹

Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, Av.

Prof. Lineu Prestes, 1374, CEP 05508-900, São Paulo, SP, Brazil, Phone number + 5511-2648-

0954 e-mail: desireeschuck@gmail.com

Alessandro Kappel Jordão^3,4

Departamento de Farmácia, Faculdade de Farmácia, Universidade Federal do Rio Grande do

Norte, CEP 59012-570, Natal, RN, Brazil, Phone number +558433429814

Unidade Universitária de Farmácia, Centro Universitário Estadual da Zona Oeste, CEP 23070-

200, Rio de Janeiro, RJ, Brazil, Phone number +552123336961, e-mail:akjordao@gmail.com

Celia R. S. Garcia²

Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Avenida Professor Lineu

Prestes, 580, bloco 17, São Paulo, SP, 05508-000, Brazil, Phone number + 5511-2648-0954 e-

mail: cgarcia@usp.br

Abstract

Melatonin and its indoles derivatives are central in the synchronization of malaria parasites.

In this research, we discovered that melatonin is unable to increase the parasitemia in the

human malaria Plasmodium falciparum that lacks the kinase PfeIK1. The PfeIK1

knockout strain is a valuable tool in the screening of indol-related compound that blocks the

melatonin effect in wild type parasite (WT) development. The assays were performed by

using flow cytometry with simultaneous labeling for mitochondria viability with

MitoTracker Deep Red and nucleus staining with SYBR Green. We found that

Melatotosil leads to an increase in parasitemia in P. falciparum and blocks melatonin effect

in the WT parasite. Using microscopy imaging system, we found that Melatotosil at 500

nM is able to induce cytosolic calcium rise in transgenic PfGCaMP3 parasites. On the

contrary, the compound Triptiofen blocks P. falciparum cell cycle with IC₅₀9.76 µM ± 0.6,

inhibits melatonin action and do not lead to a cytosolic calcium rise in PfGCaMP3 parasites.

We also found that the synthetic indol-related compounds arrested parasite cycle for PfeIK1

knock-out and (WT) P. falciparum (3D7) in 72 hours culture assays with the IC₅₀values

slighting lower for the WT strains. We concluded that the kinase PfeIK1 is central for

melatonin downstream signaling pathways involved in parasite cell cycle progression. More

importantly, the indol-related compounds block its cycle as an upstream essential

mechanism for parasite survival. Our data clearly show that these classes of compounds

emerge as an alternative for the problem of resistance with the classical antimalarials.

Keywords: Melatonin, antimalarial, synthetic indol, Plasmodium falciparum, genetic

calcium sensor.

1. Introduction

Malaria is the disease caused by parasites from the Plasmodium genus and affects millions

of people annually. The parasite's life cycle occurs within a mosquito vector, Anopheles, and a

vertebrate host¹.

Artemisinin combinatory therapy is used as a first-line treatment of malaria^2–4.Resistance

to artemisinin is associated with mutations in the propeller domain of the kelch protein in

chromosome 13 of P. falciparum ^3–7

.

The increasing parasite resistance to the antimalarial from diverse classes such as

4,7–10

chloroquine, piperaquine, mefloquine, artemisinin, and its derivatives

creates an urgent need

for searching for new ways to combat this lethal infection. Searching for a novel mechanism to

break host-pathogen interaction is a consensus for finding new drugs to combat malaria. Previous

work from our group identified compounds from hydroxynaphthoquinones and indole class as a

potential antimalarial in vitro ^11,12

Melatonin (N-acetyl- 5-methoxytryptamine) is the primary hormone secreted by the pineal

gland, and its central physiological role is related to hormonal properties^13,14.This hormone is

present in a wide variety of organisms, including fungi, macroalgae, protists, plants, and

animals^14,15.The secretion of melatonin is related to the light/dark cycle, pointing out that it can

stabilize and reinforce circadian rhythm¹³. Melatonin plays an essential role in the regulation of

different physiological processes. It is known to reduce the oxidative stress, regulate gut and

retinal physiology^16–18, inhibit the release of cytochrome b and caspase activation in

mitochondria^19,20, is associated with immune regulation and offers neuroprotection to neurons^18.

Nevertheless, melatonin is equally related to different pathophysiological processes^18,21,22.

Melatonin and its derivatives synchronize the intraerythrocytic cycle of the human malaria

parasite P. falciparum as well as the rodent malaria P. chabaudi^23,24. The downstream signaling in

this process involves the activation of a PLC-IP3 mechanism that leads to cytosolic Ca²⁺and

cAMP increase^23,25. The role of indol-derivatives compounds to interfere with P. falciparum

development has been reported and well-reviewed²⁶.

In this research we have compared a wild type strain (3D7) and a knockout strain of P.

falciparum eukaryotic initiation factor 2- alpha kinase 1 (PfeIK1^-) and we have searched for the

ability of new indol-structure related compounds to interfere with both parasites cycle. The PfeIK1

kinase (PF3D7_ 1444500) belongs to the eIF2α kinases family²⁷and was previously described to

closely cluster with mammalian GCN2, presenting extensions in both sides of the catalytic

domain, anti-codon domain in the C-terminal extension and phosphorylates eIF2α in response to

amino acid starvation²⁸.

eIF2 is the eukaryotic initiation factor 2, composed of three subunits (α, β and γ). When

activated, eIF2 binds to tRNA-methionine complex forming the ternary complex and initiating

protein translation. Activation of eIF2 is GTP dependent and the activity of a guanine exchange

factor (GEF) is necessary. Phosphorylation of eIF2α results in repression of general protein

translation and is a well-known mechanism of stress response, since mRNA encoding for proteins

from stress response still translated^29–31. Our studies lead us to conclude that synchronization upon

melatonin requires not only the PfPK7³²but also involves PfeIK1. Moreover, indol-related

compounds are equally involved in the cell cycle progression, which explains synthetic indol-

related compounds' ability to block parasite proliferation in PfeIK1 knockout parasite strain.

2. Experimental Section

2.1. Chemistry

The chemical reagents and all solvents used in this study were purchased from Merck Millipore

Brazil (São Paulo, Brazil). Melatonin was purchased from Sigma Aldrich Brazil LTDA (São

Paulo, Brazil). Melting points were determined with a Fisher Johns instrument and are

uncorrected. Infrared (IR) spectra were recorded on an ABB FTLA2000-100 spectrophotometer in

KBr pellets (Quebec, Canada). NMR spectra, unless otherwise stated, were obtained in deuterated

Me₂SO-d₆using a Varian Unity Plus 300 MHz spectrometer. Chemical shifts () are expressed in

ppm and the coupling constant (J) in Hertz. Reactions were routinely monitored by thin-layer

chromatography (TLC) on silica gel pre-coated F254 Merck plates. Column chromatography was

performed on silica gel flash from across. The developed chromatograms were viewed under

ultraviolet light at 254 nm. The compound 2 has been synthesized using Venkatachalam and co-

workers protocol³³.

N-(2-(1H-indol-3-yl) ethyl)benzenesulfonamide (Tripbenz (4)).

o

Obtained in 89% yield as a pale yellow solid; m.p. 103-106 C; IR (KBr) _max(cm^-1) 3434, 3320

(N-H); 1153 (S=O); ¹H NMR (300 MHz, DMSO-d₆)  2.77-2.80 (m, 2H, CH₂); 2.98-3.03 (m, 2H,

CH₂); 6.92-6.96 (m, 1H); 7.02-7.06 (m, 1H); 7.10-7.11 (m, 1H); 7.30-7.38 (m, 2H); 7.54-7.64 (m,

3H); 7.74-7.77 (m, 1H); 7.79-7.82 (m, 2H); 10.8 (bs, 1H, N-H) ppm. ¹³C NMR (75 MHz, DMSO-

d₆) _c140.6; 136.2; 132.3; 129.2; 127.0; 126.5; 123.0; 121.0; 118.3; 118.0; 111.4; 111.0; 43.5;

25.4 ppm.

N-(2-(1H-indol-3-yl)ethyl)-4-methylbenzenesulfonamide (Triptosil (5)).

o

Obtained in 67% yield as a pale yellow solid; m.p. 105-109 C; IR (KBr) _max(cm^-1) 3406, 3280

(N-H); 1153 (S=O); ¹H NMR (300 MHz, DMSO-d₆ 2.36 (s, 3H, CH₃); 2.75-2.79 (m, 2H, CH₂);

2.94-2.99 (m, 2H, CH₂); 6.92-6.96 (m, 1H); 7.01-7.05 (m, 1H); 7.09-7.10 (m, 1H); 7.29-7.37 (m,

4H); 7.63-7.68 (m, 3H); 10.8 (bs, 1H, N-H) ppm.¹³C NMR (75 MHz, DMSO-d₆) _c142.5; 137.7;

136.2; 129.6; 126.7; 126.5; 122.9; 120.9; 118.3; 117.9; 111.4; 111.0; 43.5; 25.4; 21.0 ppm.

N-(2-(1H-indol-3-yl) ethyl)-5-bromothiophene-2-carboxamide (Triptiofen (6)).

o

Obtained in 64% yield as a pale yellow solid; m.p. 113-117 C; IR (KBr) _max(cm^-1) 3402, 3273

(N-H); 1620 (C=O); ¹H NMR (300 MHz, DMSO-d₆)  2.91-2.95 (m, 2H, CH₂); 3.47-3.53 (m, 2H,

CH₂); 6.95-6.99 (m, 1H); 7.04-7.08 (m, 1H); 7.09-7.10 (m, 1H); 7.12-7.14 (m, 1H); 7.16-7.17 (m,

1H); 7.32-7.34 (m, 1H); 7.56-7.57 (m, 1H); 7.72-7.73 (m, 1H); 8.64 (t, 1H, N-H, J = 5.6 Hz); 10.8

13

(bs, 1H, N-H) ppm. C NMR (75 MHz, DMSO-d₆) _c161.0; 140.3; 136.2; 130.5; 127.8; 127.7;

127.2; 122.6; 121.0; 118.3; 118.2; 111.7; 111.4; 40.1; 25.3 ppm.

N-(2-(1H-indol-3-yl)ethyl)furan-2-carboxamide (Tripfuroila (7)).

Obtained in 31% yield as a pale yellow solid; m.p. 145-148 ^oC; IR (KBr) _max(cm^-1) 3263 (N-H);

1614 (C=O); ¹H NMR (300 MHz, DMSO-d₆)  2.89-2.92 (m, 2H, CH₂); 3.46-3.51 (m, 2H, CH₂);

6.60-6.61 (m, 1H); 6.95-6.98 (m, 1H); 7.03-7.05 (m, 1H); 7.06-7.07 (m, 1H); 7.15-7.16 (m, 1H);

7.31-7.33 (m, 1H); 7.55-7.57 (m, 1H); 7.80-7.81 (m, 1H); 8.47 (t, 1H, N-H, J = 5.6 Hz); 10.8 (bs,

1H, N-H) ppm.¹³C NMR (75 MHz, DMSO-d₆) _c157.7; 148.1; 144.8; 136.2; 127.2; 122.6; 120.9;

118.3; 118.2; 113.1; 111.8; 111.7; 111.4; 39.3; 25.3 ppm.

N-(2-(1H-indol-3-yl)ethyl)cyclohexanecarboxamide (Tripcicloexila (8)).

Obtained in 64% yield as a pale yellow solid; m.p. 77-83 ^oC; IR (KBr) _max(cm^-1) 3342; 3273 (N-

1

H); 1626 (C=O); H NMR (300 MHz, DMSO-d₆)  1.13-1.37 (m, 5H); 1.62-1.66 (m, 5H); 2.01-

2.09 (m, 1H); 2.76-2.80 (m, 2H); 3.25-3.33 (m, 4H); 6.93-6.98 (m, 1H); 7.02-7.07 (m, 1H); 7.10-

7.11 (m, 1H); 7.30-7.33 (m, 1H); 7.50-7.53 (m, 1H); 7.74-7.78 (m, 1H); 10.8 ppm. (bs, 1H, N-H)

¹³C NMR (75 MHz, DMSO-d₆) _c175.0; 136.2; 127.2; 122.5; 120.8; 118.1; 111.9; 111.3; 44.0;

29.2; 25.5; 25.3; 25.2 ppm.

N-(2-(5-methoxy-1H-indol-3-yl)ethyl)benzenesulfonamide (Melatobenz (9)).

Obtained in 61% yield as a pale yellow solid; m.p. 136-140 ^oC; IR (KBr) _max(cm^-1) 3296 (N-H);

1

1172 (S=O); H NMR (300 MHz, DMSO-d₆)  2.89-2.93 (m, 2H, CH₂); 3.49-3.56 (m, 2H, CH₂);

3.71 (s, 3H, CH₃); 6.68-6.72 (m, 1H); 7.04-7.05 (m, 1H); 7.12-7.13 (m, 1H); 7.20-7.23 (m, 1H);

7.41-7.53 (m, 4H); 7.82-7.85 (m, 2H); 8.58 (t, 1H, N-H, J = 5.6 Hz); 10.6 (bs, 1H, N-H) ppm. ¹³C

NMR (75 MHz, DMSO-d₆) _c166.1; 153.0; 134.7; 131.3; 131.0; 128.2; 127.6; 127.1; 123.3;

112.0; 111.8; 111.0; 100.1; 55.2; 40.2; 25.2 ppm.

N-(2-(5-methoxy-1H-indol-3-yl)ethyl)-4-methylbenzenesulfonamide (Melatotosil (10)).

Obtained in 57% yield as a pale yellow solid; m.p. 140-143 ^oC; IR (KBr) _max(cm^-1) 3392 (N-H);

1

1151 (S=O); H NMR (300 MHz, DMSO-d₆ 2.36 (s, 3H, CH₃); 2.71-2.76 (m, 2H, CH₂); 2.91-

2.98 (m, 2H, CH₂); 3.72 (s, 3H, CH₃); 6.66-6.70 (m, 1H); 6.83-6.84 (m, 1H); 7.04-7.05 (m, 1H);

7.18-7.20 (m, 1H); 7.34-7.37 (m, 2H); 7.61-7.68 (m, 3H); 10.6 (bs, 1H, N-H) ppm. ¹³C NMR (75

MHz, DMSO-d₆) _c152.9; 142.5; 137.7; 131.3; 129.6; 127.3; 126.5; 123.5; 112.0; 111.0; 110.7;

99.7; 55.3; 43.3; 25.4; 20.9 ppm.

N-(2-(5-methoxy-1H-indol-3-yl)ethyl)furan-2-carboxamide (Melatofuroila (11)).

Obtained in 40% yield as a pale yellow solid; m.p. 66-70 ^oC; IR (KBr) _max(cm^-1) 3361; 3255 (N-

H); 1624 (C=O); ¹H NMR (300 MHz, DMSO-d₆)  2.85-2.90 (m, 2H, CH₂)

; 3.44-3.51 (m,

2H, CH₂); 3.72 (s, 3H, CH₃); 6.59-6.61 (m, 1H); 6.68-6.71 (m, 1H); 7.04-7.07 (m, 2H); 7.11-7.12

(m, 1H); 7.19-7.22 (m, 1H); 7.79-7.80 (m, 1H); 8.44 (t, 1H, N-H, J = 5.8 Hz); 10.8 (bs, 1H, N-H)

13

ppm. C NMR (75 MHz, DMSO-d₆) _c157.7; 153.0; 148.1; 144.8; 131.4; 127.6; 123.3; 113.1;

112.0; 111.8; 111.6; 111.1; 100.1; 55.3; 39,4; 25.3 ppm.

N-(2-(5-methoxy-1H-indol-3-yl)ethyl)cyclohexanecarboxamide (Melatocicloexil (12)).

Obtained in 60% yield as a pale yellow oil; IR (KBr) _max(cm^-1) 3408; 3280 (N-H); 1638 (C=O);

 1.13-1.37 (m, 5H); 1.59-1.69 (m, 5H); 2.02-2.09 (m, 1H); 2.72-2.77 (m, 2H); 3.25-3.29 (m, 2H);

3.75 (s, 3H, CH₃); 6.68-6.72 (m, 1H); 6.99-7.00 (m, 1H); 7.06-7.07 (m, 1H); 7.19-7.22 (m, 1H);

7.70-7.74 (m, 1H); 10.6 ppm. ¹³C NMR (75 MHz, DMSO-d₆) _c175.0; 152.9; 131.3; 127.5; 123.2;

111.9; 111.7; 111.0; 100.2; 55.3; 44.0; 39.2; 29.2; 25.5; 25.3 ppm.

2.1. Synthesis of Indole Compounds

In a recent study published by Schuck et al. (2014) compound (1) was identified as a

prototype with potential antimalarial activity against P. falciparum with IC₅₀2.93 µM. This

compound, unlike the others prepared in that paper, has an aromatic ring as a substituent on the

amide moiety. This result motivated our research group to continue the investigation of indole

derivatives through the structural modification of compound (1), with the substitution of the

benzene aromatic ring with heterocyclic and cyclohexane rings. In addition, the exchange of

carbonyl by the sulfonyl group was studied to verify the optimization of antimalarial activity and

the influence of the substitution pattern in these new compounds Tripbenz (4), Triptosil (5),

Triptiofen (6), Tripfuroila (7), Tripcicloexil (8), Melatobenz (9), Melatotosil (10), Melatofuroila

(11) e Melatocicloexil (12).

Methoxytryptamine³³or tryptamine an aqueous solution of NaOH at 0°C and chloroform

were reacted with the appropriate acyl chloride, benzene sulfonyl chloride or toluene sulfonyl

chloride to give the desired indoles. The general procedure for the preparation of the indole

derivatives (4)-(12) was described by Schuck et al., (2014)¹².

2.2. P. falciparum: in vitro culture

P. falciparum 3D7 and PfeIK1^-parasites were maintained in RPMI media supplemented

with A⁺human erythrocytes (parasitemia: up to 5%, hematocrit: 2%) cultivated in RPMI-1640

media (GIBCO, Billings, USA) supplemented with 0.04 % gentamicin sulfate, 0.05 %

hypoxanthine and 0.5% Albumax II (Gibco). PfeIK1^-were cultivated with 2.5µg/mL of blasticidin

for selection. PfeIK1^-parasites²⁸were kindly donated by Christian Doerig from Monash

University.

2.3. Quantitative real-time PCR

For these experiments, P. falciparum 3D7 culture were synchronized with 5% sorbitol and

parasites collected in the three stages: ring (14h); trophozoite (30h) and schizont (44h), at 4%

parasitemia. Parasites were treated with 100 nM Melatonin or 0.00005% ethanol (control) and left

for four hours before RNA extraction with Trizol (Invitrogen). RNA purified with ionic exchange

columns with DNAse using RNAse-free DNAse set (Qiagen) and RNeasy Mini Kit (Qiagen) and

quantified in a UV-Vis NanoDrop 2000c (Thermo Scientific). Three independent experiments

were performed in triplicates.

cDNA syntheses were performed using random primers and Superscript II reverse

transcriptase (Invitrogen) according to the manufacturer’s protocol. SYBR Green (Applied

Biosystems) was used in quantitative real-time PCR on a 7300 Real Time PCR System (Applied

Biosystems, Foster City, CA, USA). Amplification was carried out as follow: on step 50°C for 2

min and 95°C for 10 min for enzyme activation followed by 40 cycles of 95°C for 0.15 min for

denaturation and 60°C for 1 min for annealing/extension. The primers used were: PF14_0423-Fwd

ACGCACTCAAACCAATCAACTTT

GTTTATTAACTCCGCTTGGTCCAT.

and

PF14_0423-Rvs

Changes in relative expression were determined by 2 ^{- ΔΔCt}or transforming the threshold

cycle in absolute number of mRNA. We performed statistical analysis with ΔΔCt values in log2

with relative expression of the genes normalized to housekeeping gene seryl-tRNA synthetase.

2.4. Effect of indole compounds in parasitemia

Red blood cells infected (iRBC) with 3D7 or PfeIK1^-(iRBC) with 1% initial parasitemia

and 2% hematocrit were incubated with 500nM of the synthetic indole compounds or 100 nM

Melatonin for 48h at 37°C under mixture of gases¹². The control group received 0, 0013% of

solvent Dimethyl Sulfoxide (DMSO).

To evaluate the effect of the compounds on melatonin action on parasitemia, iRBC were

incubated with 500nM of compounds for ten minutes and then along with 100nM of melatonin for

48h at 37°C under mixture of gases.

After 48h iRBC were double-stained³⁴with nucleic acid marker SYBR Green I (1X) and

mitochondria marker, based on membrane potential, MitoTracker Deep Red (50nM), and

incubated for 20 minutes at 37°C.

Final parasitemia was obtained by flow cytometer using an Accuri C6 flow cytometer

(Becton Dickinson), collecting 10⁴cells. Parasitemia was determined by dot plots using FlowJo 5

software.

2.5. In vitro growth assay and flow cytometry analysis

Red blood cells infected with P. falciparum 3D7 or PfeIK1^-(iRBC) with 0.3 % initial

parasitemia and 1% hematocrit were incubated with different concentrations of compounds

Tripbenz (4), Triptosil (5), Triptiofen (6), Tripfuroila (7) and Tripcicloexil (8) ranging from 0.107

µM to 110 µM, and compounds Melatobenz (9), Melatotosil (10), Melatofuroila (11) and

Melatocicloexil (12) ranging from 0.1 µM to 100 µM for 72h at 37°C under mixture of gases. The

control group was treated with solvent Dimethyl Sulfoxide (DMSO) (v/v), with the highest

concentration of solvent 0.14%. Chloroquine was used as positive control with concentrations

ranging from 0.244 nM to 250 nM. Parasitemia was determined from dot plots (side scatter versus

³

fluorescence) of at least 10 cells acquired on a FACSCalibur flow cytometer using CELLQUEST

software (Becton Dickinson) or an Accuri C6 flow cytometer (Becton Dickinson). Initial gating

was carried out with unstained, uninfected erythrocytes to account for erythrocyte auto

fluorescence. The concentration responsible for 50% inhibition (IC₅₀) was determined from the

compound concentration-response curve determined with the software GraphPad Prism 6.

For assays with antimalarials, iRBCs were incubated with different concentrations of

Atovaquone ranging from 0.02 nM to 24 nM, or Artemisinin 0.15 nM to 160 nM.

After 72h iRBCs were stained with nucleic acid marker SYBR Green I (1X) (Invitrogen)

and mitochondria marker based on membrane potential MitoTracker Deep Red (50nM)

(Invitrogen), and incubated for 20 minutes at 37°C. Final parasitemia was obtained by flow

cytometer using a BD Accuri C6 Flow Cytometer, collecting 10⁴cells. Parasitemia was

determined by dot plots using FlowJo 5 software.

At least three independent experiments were performed in triplicate to calculate the IC₅₀

values for each drug.

2.6

Microscopy evaluation of blood-stage development of P. falciparum (3D7)

P. falciparum (3D7) cultures were synchronized by three rounds of 5% sorbitol treatment

for one hour³⁵. Parasites at ring stage with initial 1% parasitemia and 2% hematocrit were

incubated with Triptiofen (6) at concentrations of 1 µM and 10 µM in 24-well plates for 48 hours

at 37°C under mixture of gases. The DMSO solvent (0.1%) was used as a control. Smears of

infected erythrocytes stained with Giemsa were performed at regular intervals (0 h, 12 h, 24 h, 36

h, and 48 h after treatment)³⁶. Parasite images were acquired under a light microscope (Zeiss) with

100X magnification to assess the parasite's blood development stages. The parasitemia at the end

of the experiment was quantified for comparison between groups. Three independent experiments

were performed in triplicate. Data were analyzed using software GraphPad Prism 6.

2.7. Cytotoxicity Assay in HEK293 cells

To evaluate toxicity of the new indole compounds in mammalian cells, Human Embryonic

Kidney cells (HEK293) were maintained in 75 cm² culture flasks (Greiner Bio-One) at 37°C,

5%CO₂in Dulbecco’s Minimum Essential Media (DMEM), supplemented with 10% fetal bovine

serum, NaHCO33.7 g/l (Sigma), 100 U/ml penicillin/ and 100 μg/ml streptomycin in monolayers.

Cells were plated in flat-bottom 96-well plates in a density of 10⁴cells per well and

incubated for 24h in 150 µL media at 37°C, 5%CO_2.Cells were then treated with different

concentrations of each compound, ranging from 0.107 µM to 110 µM in 200 µL DMEM for 72h

at 37°C and 5%CO_2.Cells treated with DMSO (v/v) with the highest concentration of solvent

0.14%, were used as control.

After incubation, 40 µL of MTT reagent (solution 5 mg/mL in PBS) was added to each well, and

cells were incubated for further 3h at 37°C and 5% CO_2.The media was removed and 100 µL of

DMSO was added in each well. Plates were agitated in a shaker for 10 min to dissolve precipitates.

Absorbance was read at 570 nM in a FlexStation 3 (Molecular Devices). Six experiments were

performed independently in triplicates.

2.8. Calcium assay

Calcium assays were performed using the transgenic Plasmodium falciparum GCaMP3

parasites³⁷. PfGCaMP3 cultures were synchronized at least three times with 5% sorbitol before

starting the experiments and parasitemia was maintained between 5% and 8%. PfGCaMP3

parasites were cultivated with 10 nM/mL of WR for selection. Parasites were isolated with

saponin (0.016%) and collected by centrifugation 8.000 rpm, subsequently washed twice with

buffer M and allowed to settle in a four-well plate for microscope coated with poly-L-lysine for 30

minutes at 37°C with 5% CO₂in buffer M (16 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 5.5

mMD-glucose, 50 mM MOPS and 2 mM CaCl2, pH 7.2). The compounds used for measuring

calcium assays were: Melatotosil and Triptiofen solubilized in DMSO.

Images were captured using a Nikon Eclipse Ti2 inverted microscope with FITC filter.

Images were collected every 10s for 5 min, with NIS-Elements Ar 5.11.01 from Nikon using 60x

lens. All experiments were performed at least three independent time in duplicates.

3. Results

3.1. Effect of melatonin in the expression of pfeik1 in 3D7 parasites

To better understand the role of regulation of protein translation in the melatonin effect in

the parasite erythrocytic cycle, we investigated whether melatonin treatment could modulate gene

expression of pfeik1. For this purpose, synchronous 3D7 parasites in ring, trophozoite, and

schizont stages were treated with 100 nM melatonin for 4 hours.

Figure 1 shows that ring-stage parasites showed a 40% decrease in pfeik1 expression

with melatonin treatment compared to control. However, at the trophozoite and schizont stages, no

significant difference was observed in parasites treated with melatonin or solvent.

Phosphorylation of eIF2 occurs mainly in response to cell stress and results in an arrest

in protein translation³⁰, which could result in an arrest of cell cycle progression.

The melatonin effect in pfeik1 expression in ring stage parasites corroborate with the

evidence that melatonin would accelerate the erythrocytic parasite cycle, leading to an increase of

parasites in the mature form schizont and consequently, to a rise in parasitemia previously

described in the literature^24,38

3.2. Effect of indole compounds in P. falciparum 3D7 and PfeIK1 knockout parasites

To investigate the potential role of the Plasmodium falciparum kinase PfeIK1 in the

melatonin signal transduction pathways of parasite synchronization, we have tested the ability of

melatonin to increase parasitemia in parasite strain lacking PfeIK1 expression (PfeIK1^-). To

evaluate the parasitemia of PfeIK1^-parasites submitted to melatonin incubation, a culture of

infected erythrocytes were incubated with 100nM of the hormone for 48h. To evaluate the final

parasitemia of PfeIK1 parasites after the incubation with melatonin, we have used flow

cytometry and a double-label procedure for staining DNA with SYBR green staining³⁴and

mitochondria membrane potential with MitoTracker Deep Red to ensure to analyze only viable

parasites. Figure 2 J shows typical dot plots for the analysis of parasitemia while Figure 2 shows

that treatment with 100nM melatonin for 48 hours increased parasitemia in approximately 10% in

wildtype parasites strain of P. falciparum (3D7) but showed no effect in parasitemia in the

knockout strain, PfeIK1^-. We further investigated the ability of a series of new indol-synthetic

compounds to interfere with parasitemia of both wild type and PfeIK1^-P. falciparum parasites as

the new finding represents an interesting tool to dissect indol-signaling pathways and to interfere

with parasite cell cycle progression.

We investigated the ability of synthetic compounds to interfere with parasitemia by

incubating the synthetic compounds at 500 nM concentration for 48 hours with the wild type

parasites culture of P. falciparum (3D7). Figure 2 shows that the final parasitemia after the

incubation of parasites (3D7) with the following compounds: Tripbenz ( 4) 99.96% (± 2.03),

Triptiofen (6), 99.81% (±1.30), Tripfuroila (7), 101.4 % (±0.76), Tripcicloexil (8), 101.8

%(±1.74), Melatobenz (9), 102.0 % (±0.84), Melatofuroila (11) 101.7 % (±3.55) and

Melatocicloexil (12) 103.7 % (±1.81) have no significant effect on parasitemia when compared to

control group.

Melatotosil (10), unlikely the previous compounds tested, was able to increase parasitemia in P.

falciparum 3D7 parasites by 10% (± 2.19) when compared to the control group, treated with the

solvent, (Figure 2G). Strikingly, this effect was not observed in experiments with P. falciparum

parasites lacking PfeIK1, as the final parasitemia was found to be 97.5% (±1.67) after treating

these parasites with Melatotosil (10) (Figure 2G). We further investigated the relevance of

methoxy group in C5 in the structure of Melatotosil in the ability of the compound to modulate the

malaria parasite cycle. We therefore removed methoxy group in C5 in the synthetic compound

Triptosil (5). Our data show clearly the relevance of removing this group in C5 of the indole ring,

rendering Triptosil unable to affect the parasitemia in P. falciparum 3D7 parasites (100% ± 1.91)

(Figure 2B). As expected the knock-out strain parasites PfeIK1^-does not show any change in

parasitemia after incubating these parasites with Triptosil (99.29 ± 2.18).

Moreover, following the data obtained for parasites lacking PfeIK1, treatment with

melatonin showed no significant effect on parasitemia (102.3% ± 0.88), similar results were

obtained by incubating these parasites with the new indole compounds. Parasitemia (normalized to

control) obtained for each compound was: Tripbenz (4) 95.64 % (±0.89), Triptiofen (6) 98.65%

(±1.40), Tripfuroila (7) 98.48% (±1.29), Tripcicloexil (8)101.2% (±1.08), Melatobenz (9) 99.95%

(±1.26), Melatofuroila (11) 97.08% (±0.98), Melatocicloexil (12) 98.29% (±1.00) (Figure 2).

These results clearly show that the kinase PfeIK1 is a molecular component of the

downstream melatonin-signaling pathways and the lack of this kinase abolishes the increase in

parasitemia triggered by melatonin.

3.3. Antimalarial activity of indole compounds and IC₅₀values determination.

In the next step, we search for the ability of synthetic indole compounds to interfere with

the parasite growth in (P. falciparum 3D7 and PfeIK1^-) in vitro assays by incubating them for 72h

in a range of different concentrations and evaluating the final parasitemia using the same approach

as above, the flow cytometry after double-labeling. We were able to construct survival curves

(Figure 3) and to determine the IC₅₀for each compound.

We first tested five compounds (Tripbenz (4), Triptosil (5), Triptiofen (6), Tripfuroila (7)

and Tripcicloexil (8)) containing a bulky chain in C3 of the indole ring. The compounds tested

showed an antimalarial activity with the IC₅₀values in the micromolar range (Table 1).

Tripbenz (4) showed an IC₅₀of 18.65 µM for 3D7 parasites and 36.84 µM PfeIK1^-

parasites (Table 1). Triptosil (5) showed an IC₅₀19.79 µM for 3D7 and 30.60 µM for PfeIK1^-.

The results with Tripbenz (4) and Triptosil (5) suggest that the substituent benzene aromatic ring

on the carbonic side chain is important for antimalarial activity. When the aromatic ring is

replaced by the cyclohexyl ring in Tripcicloexil (8), the IC₅₀values increase (28.03 µM in 3D7

and 37. 61 µM in PfeIK1^-) (Table 1) corroborating with this conclusion.

With the benzene aromatic ring, the classic bioisosteric aromatic benzene ring exchange

was performed in Tripbenz (4) and Triptosil (5) by thiophene and furan rings, preparing Triptiofen

(6) and Tripfuroila (7), respectively, which presented even better results. Triptiofen (6) exhibited

IC₅₀value of 9.76 µM in wild type parasites 3D7 and 11.80 µM in parasites lacking PfeIK1^-

(Table 1), followed by Tripfuroila (7) that presented IC₅₀17.12 µM for 3D7 and 23.64 µM for

PfeIK1^-(Table 1).

Furthermore, we tested new compounds adding a methoxy group in C5 of the indole ring

and presenting the same substitutions in C3. When comparing the results of Melatobenz (9) (IC₅₀

38.52 µM in 3D7 and 57.76 µM in PfeIK1^-), Melatofuroila (11) (30.95 µM in 3D7 and 31.95 µM

in PfeIK1^-) and Melatocicloexil (12) (35.22 µM in 3D7 and 47.55 µM in PfeIK1-) with the

methoxy substituent on the C5 of the indole ring, the activity of these compounds is lower (Table

1).

As expected for this series of new compounds the methoxy group at position C5 of the

indolic ring resulted in the Melatotosil (10) without antimalarial activity (Table 1). Compounds

with higher antimalarial activity (Tripbenz, Triptosil, Triptiofen, Tripfuroila and Tripcicloexil)

showed no toxicity in HEK293 cells (Supplemental 1).

3.4.

Effect of Triptiofen in the cell cycle progression of P. falciparum 3D7

The impact of Triptiofen (6) on the erythrocytic development of P. falciparum (3D7) was

evaluated after incubation of the compound in the parasite culture at concentrations of 1 µM and

10 µM for one cycle (48 hours). Parasites development was followed by smears stained with

Giemsa every 12 h. The smears were analyzed under a microscope to assess the distribution of

stages (ring, trophozoite and schizont).

The results on Figure 4 A revealed that after 48h parasites in the control group were able

to re-invade new red blood cells, since the ring stage corresponds to completion of the entire

cycle..However, analysis of Giemsa-smears from parasites treated with Triptiofen (6) (1 µM

and10 µM) showed that although most of the parasites are in the ring stage, we could observe

parasites in segmented schizont stage (1.33 ±0.33 and 2.22 ± 0.32, respectively). Figure 4C shows

the distribution of the parasite forms in the solvent control and the groups treated with Triptiofen

(1 µM and 10 µM). Analysis reveal that Triptiofen (6) significantly reduce the number of parasites

compared to control starting at 36h after compound incubation both concentrations 1 µM and 10

µM (Figure 4B). The data indicate that Triptiofen acts in mature forms of the parasite.

3.5. Effect of indole compounds to block melatonin action in P. falciparum

parasitemia

We further evaluate if the compounds were able to abolish the increase in parasitemia

triggered by melatonin in P. falciparum 3D7 parasites. For this purpose, we performed in vitro

assays with P. falciparum -infected erythrocytes incubated for 48h with 100nM of melatonin in

presence of 500nM of each synthetic compound. Strikingly, Triptosil (5), Triptiofen (6),

Tripfuroila (7) and Melatotosil (10) were able to abolish the increase in parasitemia triggered by

melatonin in P. falciparum 3D7 (Figure 5). Melatonin treatment in presence of Triptiofen (6)

decreased parasitemia by 10% (100.1%, ± 2.15) when compared to treatment with the hormone

only (110% ± 1.97) and Tripfuroila (7) along with the hormone decreased parasitemia in 11.25%

(98.52% ± 1.50).

Although, treatment with Melatotosil (10) alone resulted in a significant increase in

parasitemia (Figure 2G), treatment with this compound along with melatonin abolished the host

hormone effect on parasitemia in 3D7 parasites, decreasing parasitemia in 11.69% (98.07% ±1.21)

when compared with treatment with the hormone alone. These data point Melatotosil (10) as a

potential melatonin receptor agonist, which can act as a partial agonist.

Interestingly, Triptosil (5), which differs from Melatotosil (10) by the absence of a

methoxy group in C5 of the indole ring, was also able to abolish melatonin effect on parasitemia,

presenting mean parasitemia of 100% (±0.76) in 3D7, a decrease of 9.7%.

Treatment of PfeIK1^-P. falciparum parasites with the indole synthetic compounds along

with melatonin has no impact in parasitemia (Figure 5) when compared to control (treated with

solvent). Our data confirm that PfeIK1^-knockout P. falciparum parasites provide an excellent tool

to study the specificity of drugs- indol derivatives to block the parasite cycle. The final parasitemia

after incubating PfeIK1^-with the compounds were as follow: (Tripbenz (4) 105.0 ± (1.82),

Triptosil (5) 105. 4 ± 2.05, Triptiofen (6) 104. 1± 1.87, Tripfuroila (7) 102. 3 ± 1.53, Tripcicloexil

(8) 105.5 ± 0.91, Melatobenz (9) 105.0 ± 1.97, Melatotosil (10) 106.2 ± 1.55, Melatofuroila (11)

99.78 ± 2.03 , Melatocicloexil (12) 107.0 ± 1.37). These data indicate that PfeIK1 plays an

important role in the synchronization pathway triggered by melatonin and its analogs.

3.6. Effect of Atovaquone and Artemisinin in PfeIK1^-

To further confirm that PfeIK1^-strain is a good model but specific for the indol-related

compounds, we further evaluate the susceptibility of PfeIK1^-to classical antimalarials drugs. We

performed similar assays with antimalarials by incubating P. falciparum 3D7 and PfeIK1^-strains

with artemisinin and atovaquone.

Atovaquone is a quinone compound used in therapy against malaria. This compound acts

as a competitive inhibitor of ubiquinol, impairing the mitochondrial function by blocking the

electron transport chain at the bc1 complex. Inhibition of this complex results in altered

concentrations of metabolites in the pyrimidine biosynthesis pathway³⁹. Treatment with

atovaquone in PfeIK1^-resulted in IC₅₀0.47 nM ± 0.07, and this value is very close to the value

observed for the wild type P. falciparum 3D7 (0.40 nM ± 0.08) (Figure 6A). Our data thus confirm

our hypothesis of the specificity for the indol, susceptibility of P. falciparum lacking the kinase

that is still responsive to the drug atovaquone.

Artemisinin and its derivatives are currently employed in first-line treatment of malaria in

combination with other compounds with a different mechanism of action². This compound

contains in its structure an endoperoxide bridge which is cleaved inside the parasite by Fe²⁺heme,

leading to activation of the molecule⁴. In this activated state, carbon-centered radicals react with

proteins and other biomolecules⁷. Similarly to the above experiments, parasites PfeIK1^-presented

IC₅₀18.84 nM ± 3.6 for artemisinin, which is compatible with the value found for the wild type

parasites 3D7, IC₅₀13.69 nM ± 2.16 (Figure 6B).

3.7. Evaluation of calcium response to compounds using P. falciparum GCaMP3.

We reported that melatonin triggers the synchronization of the P. falciparum erythrocytic

cycle in a calcium-dependent manner²⁴. We investigated if Melatotosil (10), which was able to

increase parasitemia in P. falciparum 3D7, would also trigger a calcium response similar to

melatonin.

For this purpose, we performed the calcium assays using a transgenic cell line of P. falciparum

GCaMP3 parasites that genetically encodes a GFP-based calcium sensor (GECI)³⁷, which

increases fluorescence when cytosolic calcium concentration increase. These transgenic parasites

are new genetic tools to follow calcium changes within cells as they do not require any dye

treatment, which further preserves the cell physiology. Moreover, GECI -cells warrant the

measurement of cytosolic calcium, thus avoiding the dye compartmentalization.

By using a microscopy imaging system, we investigated if the addition of Melatotosil at 500

nM to P. falciparum GCaMP3 parasites would be able to trigger a cytosolic calcium response

(Figure 7). Our data clearly show that Melatotosil elicits a calcium rise in P. falciparum parasites,

as control ionomycin at 1 µM concentration was added to ensure the integrity of the cells. We also

investigated if Triptiofen (6) was able to induce a calcium response in these parasites. Triptiofen

blocked the melatonin effect in 3D7 parasitemia and showed an antimalarial activity. The results

obtained showed that Triptiofen 500 nM does not trigger a significant cytosolic calcium rise in

these parasites, but ionomycin was still able to induce a calcium rise (Figure 7B). Figure 7D shows

the quantification and analysis of 120 cells and the statistical significance of calcium rise for

Melatotosil (Fmax/F0 1.21 ± 0.01) but not for Triptiofen (Fmax/F0 1.11 ± 0.008) compared to

DMSO (Fmax/F0 1.08 ± 0.006; Fmax/F0 1.11 ± 0.012 respectively).

4.

Discussion

Efforts from several labs focusing on better understand the rhythms underlying the cell

cycle development and coordination to host rhythms of several species of the malaria parasite have

been made.

Rijo-Ferreira et al., (2020) evaluated the impact of different factors in parasite rhythms by

analyzing the transcriptome of rodent Plasmodium chabaudi parasites. They showed that parasites

present a group of genes with rhythmic expression sustained in the absence of light, implying that

parasites possess an intrinsic clock, and the host is not the only one to drive their cell cycle length

is not only driven by the host. Also, parasites infecting arrhythmic mice experience decay and loss

of synchrony, suggesting that a host cue is essential to entrain this clock and synchronize

parasites⁴⁰.

Aiming to investigate the rhythmic gene expression in parasites in absence of host cues,

Smith et al., (2020) analyzed the gene expression from four different strains of Plasmodium

falciparum. The authors showed that P. falciparum presents rhythmic gene expression, pointing

out an intrinsic oscillator in the parasite⁴¹.

Another study by Subudhi et al. (2020) demonstrated that coordination of the parasite cell

cycle to host rhythms plays a central role in the cycling gene expression associated with essential

processes for parasite erythrocytic development⁴².

Melatonin and indol derivatives can modulate the P. falciparum erythrocytic cycle. The

synchronization triggered by melatonin involves different protein kinases such as PfPK7⁴³and

PKA²⁵as downstream molecular effectors, although the kinases PfNek-2 and PfNek-3 are not

involved in synchronization by melatonin⁴³. In this study, we show that an additional protein

kinase, PfeIK1, plays a vital role in the synchronization of the erythrocytic cycle in P. falciparum.

The affirmation is based on the fact that parasites lacking this kinase presented no significant

difference in parasitemia after melatonin treatment.

Little is known of the PfeIK1 role in the Plasmodium life cycle. Fennel et al., (2009) has

previously reported that PfeIK1 phosphorylates the eukaryotic initiation factor 2 in its α subunit

(eIF 2α) in response to aminoacid starvation²⁸. Lima et al., (2016) investigated by RNA-seq the

gene expression of 3D7 and PfPK7^-treated with melatonin. The authors observed 38 genes

modulated by melatonin in 3D7 parasites, including the gene transcribing the eIF2⁴⁴, which is

phosphorylated by Protein Kinases of the initiation factor 2 of Plasmodium falciparum, such as

PfeIK1. The data point out the importance of regulation of protein translation for the melatonin

effect. Moreover, our data contribute to decades the potential role of PfeIK1 in melatonin

signaling pathways on parasite synchronization.

In this work, we aimed to 1) investigate whether PfeIK1 plays a role in the melatonin

pathway on parasite synchronization promoting cell cycle modulation and 2) searching for new

forms to block the parasite cell cycle by using new indol-related compounds. To achieve the goal,

we used PfeIK1 knockout strain parasites and a novel series of synthetic compounds.

The relevance of these studies relies on the fundamental question on how the parasite

transduces the external signaling and puts in action its molecular machinery involved in the

melatonin pathway leading to rhythmic development and synchronization of parasites erythrocytic

cycle. Moreover, there is an urgency to find new ways to treat malaria since parasite resistance to

the classical antimalarials, such as chloroquine and artemisinin, is well known in several

continents^3–10.Thus, studies searching for new ways of treating malaria are required. Svogie et al.,

(2016) showed the indolyl-3-ethanone-α-thioesters as a potential class of antimalarial, with IC₅₀

values in the micromolar range. Luthra et al., (2019) identified an indole compound (2j) able to

disrupt the melatonin-induced synchronization in vitro in P. falciparum. In the same line, Lunga et

al. (2018) tested a library of indole compounds as potential antimalarials^36,45,46. Other indole

compounds, indolmycin, inhibit the protein translation in P. falciparum apicoplast by inhibiting

the tryptophanyl-tRNA synthetase leading to a delayed death of the parasite^47,48

.

Since PfeIK1^-parasites were susceptible to indole derivatives, we also investigated if

PfeIK1 knockout would interfere with susceptibility of parasite against classical antimalarials.

Zhang et al, (2017) has reported that parasite treatment with artemisinin resulted in an increase in

eIF2 phosphorylation by PK4 and inhibition of this kinase can avoid that parasites enter in

latency⁴⁹. The results obtained here show that PfeIK1^-reacts similarly to wild type parasites 3D7

under mitochondrial and oxidative stress caused by atovaquone and artemisinin. These data

indicate that the lack of PfeIK1 does not interfere with parasites’ susceptibility to atovaquone and

artemisinin.

Next, we evaluated the new indole compounds' ability to interfere in the melatonin

pathway and impair synchronization in P. falciparum. We identified Melatotosil (10) as a potential

melatonin receptor partial agonist, since the compound increased parasitemia in 3D7 and was also

able to inhibit melatonin action in 3D7. Interestingly, Triptosil (5), which differs from Melatotosil

(10) by the absence of a methoxy group in C5 of the indole ring, showed no effect in 3D7

parasitemia but could abolish melatonin effect.

Until now, a canonical melatonin receptor has not been identified in Plasmodium database,

although by bioinformatics analysis, four candidates for serpentine-like receptors were

identified⁵⁰. The finding of the molecular identity of such receptor in Plasmodium is of great

relevance, given the role of melatonin on parasite kinases. Vertebrate Melatonin receptors are G-

protein coupled receptors present in all tissues and were initially divided into three subfamilies

MT1, MT2, and the orphan GPR50. MT1 and MT2 activation result in inhibition of cAMP

production; also, activation of MT1 can result in inositol-phosphate production⁵¹. Structure-

activity studies about melatonin receptors showed that the 3-acylaminoethyl and 5-methoxy

groups play an essential role in receptor binding and activation. However, the 5-methoxy group's

presence is not critical to receptor binding, since the competitive agonist Luzindole lacks the

methoxy group^18,52

.

As expected, the treatment of PfeIK1^-parasites with the indole synthetic compounds and

melatonin have no impact on parasitemia compared to control (treated with solvent). Our data

confirm that PfeIK1^-knockout P. falciparum parasites provide an excellent tool to study the

specificity of indol derivatives to block the parasite cycle.

Our data indicate that PfeIK1 plays a role in parasite synchronization, showing that

melatonin pathways involved at synchronization and cell cycle progression are two distinct

pathways. The kinase PfeIK1 is central in the parasite synchronicity by melatonin.

Acknowledgments

We thank the analytical center of the Chemistry Institute of the Federal University of Rio Grande

do Norte for NMR analysis and Colsan for the blood supply.

Funding

This work was supported by a grant from Fundação de Amparo a Pesquisa do Estado de São Paulo

(FAPESP) to CRSG (Process 17/08684-7 and 18/07177-7 Imaging 20). BKMD and BMS are

recipients of fellowship from Conselho Nacional de Desenvolvimento Científico e Tecnologico

(CNPq) . The funders had no role in the study design, data collection and analysis, decision to

publish, or preparation of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

Author contributions

BKMD; MN; MRRA; DPP ;BMS; FCSA; RY and DS performed and designed the experiments

AKJ and CRSG are the principal investigators who contributed for the design of the experiments

and data discussion as well as managed the project. All the authors contributed to the writing of

the paper and interpretation of the data.

References

1.

2.

3.

Cowman AF, Healer J, Marapana D, Marsh K. Malaria: Biology and Disease. Cell. 2016.

doi:10.1016/j.cell.2016.07.055

Tse EG, Korsik M, Todd MH. The past, present and future of anti-malarial medicines.

Malar J. 2019;18(1):1-21. doi:10.1186/s12936-019-2724-z

Ashley EA, Dhorda M, Fairhurst RM, et al. Spread of Artemisinin Resistance in

Plasmodium

falciparum

Malaria.

N

Engl

J

Med.

2014;371:411-423.

doi:10.1056/NEJMoa1314981

4.

5.

Blasco B, Leroy Di, Fidock DA. Antimalarial drug resistance: Linking Plasmodium

falciparum parasite biology to the clinic. Nat Med. 2017;23(8):917-928.

doi:10.1038/nm.4381

Amaratunga C, Sreng S, Suon S, et al. Artemisinin-resistant Plasmodium falciparum in

Pursat province , western Cambodiaꢀ: a parasite clearance rate study. Lancet Infect Dis.

12(11):851-858. doi:10.1016/S1473-3099(12)70181-0

6.

7.

8.

9.

Ariey F, Witkowski B, Amaratunga C, et al. A molecular marker of artemisinin-resistant

Plasmodium falciparum malaria. Nature. 2014;505(7481):50-55. doi:10.1038/nature12876

Tilley L, Straimer J, Gnädig NF, Ralph SA, Fidock DA. Artemisinin Action and Resistance

in Plasmodium falciparum. Trends Parasitol. 2016;xx:1-15. doi:10.1016/j.pt.2016.05.010

Cowell AN, Winzeler EA. The genomic architecture of antimalarial drug resistance. Brief

Funct Genomics. 2019;18(5):314-328. doi:10.1093/bfgp/elz008

Hanboonkunupakarn B, White NJ. The threat of antimalarial drug resistance. Trop Dis

Travel Med Vaccines. 2016:1-5. doi:10.1186/s40794-016-0027-8

10. Duru V, Witkowski B, Ménard D. Plasmodium falciparum resistance to artemisinin

derivatives and piperaquine: A major challenge for malaria elimination in Cambodia. Am J

Trop Med Hyg. 2016;95(6):1228-1238. doi:10.4269/ajtmh.16-0234

11. Schuck DC, Ferreira SB, Cruz LN, et al. Biological evaluation of hydroxynaphthoquinones

as anti-malarials. Malar J. 2013;12:234. doi:10.1186/1475-2875-12-234

12. Schuck DC, Jordão AK, Nakabashi M, Cunha AC, Ferreira VF, Garcia CRS. Synthetic

indole and melatonin derivatives exhibit antimalarial activity on the cell cycle of the human

malaria parasite Plasmodium falciparum. Eur J Med Chem. 2014;78:375-382.

doi:10.1016/j.ejmech.2014.03.055

13. Claustrat B, Leston J. Melatonin: Physiological effects in humans. Neurochirurgie.

2015;61(2-3):77-84. doi:10.1016/j.neuchi.2015.03.002

14. Cecon E, Liu L, Jockers R. Melatonin receptor structures shed new light on melatonin

research. J Pineal Res. 2019;67(4):1-6. doi:10.1111/jpi.12606

15. Zhao D, Yu Y, Shen Y, Liu Q, Zhao Z, Sharma R. Melatonin Synthesis and Functionꢀ:

Evolutionary History in Animals and Plants. Front Endocrinol (Lausanne).

2019;10(April):1-16. doi:10.3389/fendo.2019.00249

16. Paulose JK, Cassone C V, Cassone VM. Aging , melatonin biosynthesis , and circadian

clockworks in the gastrointestinal system of the laboratory mouse. Physiol Genomics.

2019;51(18):1-9. doi:10.1152/physiolgenomics.00095.2018

17. Ko GY-P. Circadian regulation in the retinaꢀ: From molecules to network. Eur J Neurosci.

2018;(August 2018):194-216. doi:10.1111/ejn.14185

18. Chan KH, Wong YH. A molecular and chemical perspective in defining melatonin receptor

subtype selectivity. Int J Mol Sci. 2013;14(9):18385-18406. doi:10.3390/ijms140918385

19. Suofu Y, Li W, Jean-Alphonse FG, et al. Dual role of mitochondria in producing melatonin

and driving GPCR signaling to block cytochrome c release. Proc Natl Acad Sci U S A.

2017;114(38):E7997-E8006. doi:10.1073/pnas.1705768114

20. Tan D, Lucien C, Liu X. Mitochondria and chloroplasts as the original sites of melatonin

synthesisꢀ: a hypothesis related to melatonin ’ s primary function and evolution in

eukaryotes. J Pineal Res. 2013:127-138. doi:10.1111/jpi.12026

21. Karamitri A, Jockers R. Melatonin in type 2 diabetes mellitus and obesity. Nat Rev

Endocrinol. doi:10.1038/s41574-018-0130-1

22. Tosini G, Owino S, Guillaume J, Jockers R. Understanding melatonin receptor

pharmacology: Latest insights from mouse models, and their relevance to human disease.

Bioessays. 2014:1-10. doi:10.1002/bies.201400017

23. Beraldo FH, Almeida FM, Da Silva AM, Garcia CRS. Cyclic AMP and calcium interplay

as second messengers in melatonin-dependent regulation of Plasmodium falciparum cell

cycle. J Cell Biol. 2005;170(4):551-557. doi:10.1083/jcb.200505117

24. Hotta CT, Gazarini ML, Beraldo FH, et al. Calcium-dependent modulation by melatonin of

the circadian rhythm in malarial parasites. Nat Cell Biol. 2000;2(7):466-468.

doi:10.1038/35017112

25. Gazarini ML, Beraldo FH, Almeida FM, Bootman M, Silva AM da, Garcia CRS. Melatonin

triggers PKA activation in the rodent malaria parasite Plasmodium chabaudi. J Pineal Res.

2011;50:64-70. doi:10.1111/j.1600-079X.2010.00810.x

26. Thanikachalam PV, Maurya RK, Garg V, Monga V. An insight into the medicinal

perspective of synthetic analogs of indole: A review. Eur J Med Chem. 2019;180:562-612.

doi:10.1016/j.ejmech.2019.07.019

27. Ward P, Equinet L, Packer J, Doerig C. Protein kinases of the human malaria parasite

Plasmodium falciparumꢀ: the kinome of a divergent eukaryote. BioMed Cent Genomics.

2004;19:1-19. doi:10.1186/1471-2164-5-79

28. Fennell C, Babbitt S, Russo I, et al. PfeIK1, a eukaryotic initiation factor 2 kinase of the

human malaria parasite Plasmodium falciparum, regulates stress-response to amino-acid

starvation. Malar J. 2009;8(1):1-15. doi:10.1186/1475-2875-8-99

29. Merrick WC, Pavitt GD. Protein Synthesis Initiation in Eukaryotic Cells. Cold Spring Harb

Lab Press Protein. 2018;(May). doi:10.1101/cshperspect.a033092

30. Bennink S, Pradel G. Micro Review The molecular machinery of translational control in

malaria

parasites.

Mol

Microbiol.

2019;112(September):1658-1673.

doi:10.1111/mmi.14388

31. Doerig C, Rayner JC, Scherf A, Tobin AB. Post-translational protein modifications in

malaria parasites. Nat Rev Microbiol. 2015;13(3):160-172. doi:10.1038/nrmicro3402

32. Koyama FC, Azevedo MF, Budu A, Chakrabarti D, Garcia CRS. Melatonin-induced

temporal up-regulation of gene expression related to ubiquitin/proteasome system (ups) in

the human malaria parasite plasmodium falciparum. Int J Mol Sci. 2014;15(12):22365-

22373. doi:10.3390/ijms151222320

33. Venkatachalam SR, Salaskar A, Chattopadhyay A, et al. Synthesis , pulse radiolysis , and in

vitro radioprotection studies of melatoninolipoamide , a novel conjugate of melatonin and a

-lipoic acid. Bioorg Med Chem. 2006;14:6414-6419. doi:10.1016/j.bmc.2006.05.042

34. Ekland EH, Schneider J, Fidock DA. Identifying apicoplast-targeting antimalarials using

high-throughput

compatible

approaches.

FASEB

J.

2011;25(10):3583-3593.

doi:10.1096/fj.11-187401

35. Lambros C, Vanderberg JP. FALCIPARUM OF PLASMODIUM SYNCH STAGES IN

CULTURE. J Parasitol. 1979;65(3):418-420.

36. Luthra T, Nayak AK, Bose S, Chakrabarti S, Gupta A, Sen S. Indole based antimalarial

compounds targeting the melatonin pathway: Their design, synthesis and biological

evaluation. Eur J Med Chem. 2019;168:11-27. doi:10.1016/j.ejmech.2019.02.019

37. Borges-Pereira L, Campos BRKL, Garcia CRS. The GCaMP3 - A GFP-based calcium

sensor for imaging calcium dynamics in the human malaria parasite Plasmodium

falciparum. MethodsX. 2014;1:e151-e154. doi:10.1016/j.mex.2014.08.005

38. Beraldo FH, Garcia CRS. Products of tryptophan catabolism induce Ca2+ release and

modulate the cell cycle of Plasmodium falciparum malaria parasites. J Pineal Res.

2005;39(3):224-230. doi:10.1111/j.1600-079X.2005.00249.x

39. Nixon GL, Moss DM, Shone AE, et al. Antimalarial pharmacology and therapeutics of

atovaquone. J Antimicrob Chemother. 2013;68(January):977-985. doi:10.1093/jac/dks504

40. Rijo-Ferreira F, Acosta-Rodriguez VA, Abel JH, et al. The malaria parasite has an intrinsic

clock. Science (80- ). 2020;368(6492):746-753. doi:10.1126/science.aba2658

41. Smith LM, Motta FC, Chopra G, et al. An intrinsic oscillator drives the blood stage cycle of

the malaria parasite Plasmodium falciparum. Science (80- ). 2020;368(6492):754-759.

42. Subudhi AK, O’Donnell AJ, Ramaprasad A, et al. Malaria parasites regulate intra-

erythrocytic development duration via serpentine receptor 10 to coordinate with host

rhythms. Nat Commun. 2020;11(1):1-15. doi:10.1038/s41467-020-16593-y

43. Koyama FC, Ribeiro RY, Garcia JL, Azevedo MF, Chakrabarti D, Garcia CRS. Ubiquitin

proteasome system and the atypical kinase PfPK7 are involved in melatonin signaling in

Plasmodium falciparum. J Pineal Res. 2012;53(2):147-153. doi:10.1111/j.1600-

079X.2012.00981.x

44. Lima WR, Tessarin-Almeida G, Rozanski A, et al. Signaling transcript profile of the

asexual intraerythrocytic development cycle of Plasmodium falciparum induced by

melatonin

and

cAMP.

Genes

and

Cancer.

2016;7(9-10):323-339.

doi:10.18632/genesandcancer.118

45. Lunga MJ, Chisango RL, Weyers C, et al. Expanding the SAR of Nontoxic Antiplasmodial

Indolyl-3-ethanone Ethers and Thioethers. ChemMedChem. 2018;13(13):1353-1362.

doi:10.1002/cmdc.201800235

46. Svogie AL, Isaacs M, Hoppe HC, Khanye SD, Veale CGL. Indolyl-3-ethanone- a -

thioethersꢀ: A promising new class of non-toxic antimalarial agents. Eur J Med Chem.

2016;114:79-88. doi:10.1016/j.ejmech.2016.02.056

47. Pasaje CFA, Cheung V, Kennedy K, et al. Selective inhibition of apicoplast tryptophanyl-

tRNA synthetase causes delayed death in Plasmodium falciparum. Nat Publ Gr.

2016;(January):1-13. doi:10.1038/srep27531

48. Kennedy K, Cobbold SA, Id EH, et al. Delayed death in the malaria parasite Plasmodium

falciparum is caused by disruption of prenylation-dependent intracellular trafficking. PLoS

Biol. 2019:1-28. doi:https://doi.org/10.1371/journal.pbio.3000376 July

49. Zhang M, Gallego-Delgado J, Fernandez-Arias C, et al. Inhibiting the Plasmodium eIF2α

Kinase PK4 Prevents Artemisinin-Induced Latency. Cell Host Microbe. 2017;22(6):766-

776.e4. doi:10.1016/j.chom.2017.11.005

50. Madeira L, Galante PAF, Budu A, Azevedo MF, Malnic B, Garcia RS. Genome-Wide

Detection of Serpentine Receptor-Like Proteins in Malaria Parasites. PLoS One. 2008;3(3).

doi:10.1371/journal.pone.0001889

51. Oishi A, Karamitri A, Gerbier R, Lahu O. Orphan GPR61 , GPR62 and GPR135 receptors

and the melatonin MT 2 receptor reciprocally modulate their signaling functions. Sci Rep.

2017;(July):1-15. doi:10.1038/s41598-017-08996-7

52. Stauch B, Johansson LC, McCorvy JD, et al. Structural basis of ligand recognition at the

human MT1 melatonin receptor. Nature. 2019;569(7755):284-288. doi:10.1038/s41586-

019-1141-3

Figure Legends

Figure. 1 – Effect of melatonin in pfeik1 gene expression during P. falciparum 3D7 erythrocytic

cycle. Erythrocytes infected with P. falciparum parasites in the stages of ring (14h), trophozoite

(30h), and schizont (40h) were treated with 100nM melatonin for four hours, and pfeik1

expression was analyzed and compared to parasites that received only the solvent. The gene

expression was normalized to the housekeeping gene seryl-tRNA synthetase. Experiments were

performed in three independent biological replicates. Statistical analysis was performed with ΔΔCt

values in log2. (*) Indicates a significant difference. Student t-test followed by Dunnett’s test

(*p≤0.05; ** p≤ 0.01; ***p≤ 0.001; ****≤ 0.0001).

Figure. 2- Effect of indole compounds on P. falciparum parasitemia. Erythrocytes infected with

P. falciparum 3D7 (Blue) or PfeIK1^-(Red) were incubated for 48h with 500 nM of each indole

compounds Tripbenz (4) (A), Triptosil (5) (B), Triptiofen (6) (C), Tripfuroila (7) (D), Tripcicloexil

(8) (E), Melatobenz (9) (F), Melatotosil (10) (G), Melatofuroila (11) (H) and Melatocicloexil (12)

(I) or with 100nM melatonin (MEL). Parasites were stained with MitoTracker Deep Red and

SYBR Green I and final parasitemia was determined by flow cytometer using a BD Accuri C6

(BD Bioscience), representative dot plots are shown in J. Data represent the percentage of

parasitemia normalized to the control group treated with solvent (DMSO). Experiments were

performed 3 independent times in triplicates. Error bars represent the SEM. (*) Indicates

significant difference. One-way ANOVA followed by Dunnett’s test (*p≤0.05; ** p≤ 0.01; ***p≤

0.001; ****≤ 0.0001).

Figure. 3 – Determination of antiplasmodial activity of synthetic indole compounds in 3D7

and PfeIK1^-. Growth survival curves of blood stage P. falciparum with concentrations ranging

from 0.107µM to 110 µM for compounds Tripbenz (4), Triptosil (5), Triptiofen (6), Tripfuroila

(7) and Tripcicloexil (8), and for 3D7 (Blue) or PfeIK1^-(Red), or 0.100 to 100 µM for

compounds Melatobenz (9), Melatofuroila (11) and Melatocicloexil (12). Chloroquine was

used as positive control with concentrations ranging from 0.244 nM to 250 nM. Experiments

were performed three independent times in triplicates. Error bars represent the SEM.

Figure. 4- Effect of Triptiofen (6) in P. falciparum (3D7) cell cycle progression. Treatment

with Triptiofen leads to a dose-dependent arrest in parasite's intra-erythrocytic cycle. (A)

Smears of Giemsa-stained of P. falciparum (3D7) parasite cultures synchronized and treated

with Triptiofen (6) (1 µM and 10 µM). Aliquots taken at the indicated times after compound

incubation and images were displayed (B) Parasitemia quantified after 12h, 24h, 36, and 48

hours in the different groups evaluated. (C) Distribution of parasite stages assessed after 48

hours displayed as R ring, T trophozoite, and S schizont. (***) indicates a significant

difference. One-way ANOVA followed by Tukey's test (*p ≤0.05; ** p≤ 0.01; ***p≤ 0.001;

****≤ 0.0001).

Figure. 5 – Effect of indole compounds in melatonin action on P. falciparum parasitemia.

Erythrocytes infected with P. falciparum 3D7 (on the left) or PfeIK1^-(on the right) were incubated

for 48h with 500nM of each indole compounds Tripbenz (4) (A), Triptosil (5) (B), Triptiofen (6)

(C), Tripfuroila (7) (D), Tripcicloexil (8) (E), Melatobenz (9) (F), Melatotosil (10) (G),

Melatofuroila (11) (H) and Melatocicloexil (12) (I) along with 100nM melatonin (MEL). Effect of

melatonin in 3D7 and PfeIK1 strains are showed in (J). Parasites were stained with MitoTracker

Deep Red and SYBR Green I and final parasitemia was determined by flow cytometer using a BD

Accuri C6 (BD Bioscience). Data represent the percentage of parasitemia normalized to the

control group treated with solvent (DMSO). Experiments were performed 3 independent times in

triplicates. Error bars represent the SEM. (*) Indicates significant difference to MEL. One-way

ANOVA followed by Dunnett’s test (*p≤0.05; ** p≤ 0.01; ***p≤ 0.001; ****≤ 0.0001) or

Tukey’s test in (J).

Figure. 6 – Dose-response curves of Atovaquone and Artemisinin in P. falciparum 3D7 and

PfeIK1^-. Erythrocytes infected with P. falciparum 3D7 (A and C) or PfeIK1^-(B and D) were

incubated with Atovaquone (0.02 nM to 24 nM) or Artemisinin (0.15 nM to 160 nM) for 72h.

Parasitemia was obtained by Flow Cytometry. Experiments were performed three independent

times in triplicates. Error bars represent the SEM.

Figure. 7- Cytosolic calcium response to Melatotosil (10) and Triptiofen (6) in PfGCaMP3.

Intracellular calcium changes were monitored in a Nikon Eclipse Ti2 microscope. Representative

graph of changes in fluorescence with 500 nM of Melatotosil (10) (A) and Triptiofen (6) (B),

normalized to baseline fluorescence is showed. Basal fluorescence (on the left), fluorescence

increase after adding Melatotosil (10) (in the middle) and fluorescence after adding ionomycin (on

the right) is shown in (C). The mean of maximum fluorescence obtained with compound addition

normalized to baseline fluorescence is shown (D) for each compound tested. Experiments were

performed 3 independent times in duplicates. Error bars represent the SEM. (*) Unpaired t test (*p

≤0.05; ** p≤ 0.01; ***p≤ 0.001; ****≤ 0.0001).

Tables

Table 1. Indole derivatives: structure and in vitro antiplasmodial activity.

Compound

Structure

IC₅₀(M)

3D7 strain

PfelK1^-strain

O

H

Tripbenz

(4)

S

N

O

18.65 ± 2.50

36.84 ± 3.44

N

H

O

CH₃

H

Triptosil

(5)

S

N

O

19.79 ± 5.33

30.60 ± 1.55

N

H

Br

Triptiofen

S

H

N

(6)

9.76 ± 0.60

17.12 ± 2.60

28.03 ± 4.07

11.80 ± 0.60

23.64 ± 2.20

37.61 ± 2.72

O

N

H

Tripfuroila

(7)

O

H

N

O

N

H

Tripcicloexil

(8)

H

N

O

N

H

O

Melatobenz

(9)

H

S

N

O

38.52 ± 1.57

No activity

30.95 ± 4.92

57. 76 ± 1.31

No activity

H₃CO

N

H

O

CH₃

Melatotosil (10)

H

S

N

O

H₃CO

N

H

Melatofuroila

(11)

O

H

N

O

31.95 ± 0.46

H₃CO

N

H

Melatocicloexil

(12)

H

N

O

35.22 ± 4.14

47.55 ± 6.43

H₃CO

N

H

Atovaquone

0.40 nM

0.08

±

0.47nM ± 0.07

Artemisinin

Chloroquine

13.69nM ± 2.1 18.84nM ± 3.6

9.90 nM

1.00

±

11.33 ± 0. 65

Article Doi

The Plasmodium falciparum eIK1 kinase (PfeIK1) is central for melatonin synchronization in the human malaria parasite. Melatotosil blocks melatonin action on parasite cell cycle

DOI: 10.1111/jpi.12685

Source and publish data:

Authors:

Article abstract of DOI:10.1111/jpi.12685

Full text of DOI:10.1111/jpi.12685

Products guided by the article

R&D Labs maybe for 102016-76-2

Relevant to this article

Hot Product