Characterization of Two New Endo-β-1,4-xylanases from Eupenicillium parvum 4–14 and Their Applications for Production of Feruloylated Oligosaccharides

Article abstract of DOI:10.1007/s12010-018-2775-6

Two new endo-1,4-beta-xylanases encoding genes EpXyn1 and EpXyn3 were isolated from mesophilic fungus Eupenicillium parvum 4–14. Based on analysis of catalytic domain and phylogenetic trees, the xylanases EpXYN1 (404 aa) and EpXYN3 (220 aa) belong to glycoside hydrolase (GH) family 10 and 11, respectively. Both EpXYN1 and EpXYN3 were successfully expressed in Pichia pastoris and the recombinant enzymes were characterized using beechwood xylan, birchwood xylan, or oat spelt xylan as substrates, respectively. The optimum temperatures and pH values were 75?°C and 5.5 for EpXYN1, and 55?°C and 5.0 for EpXYN3. EpXYN1 exhibited a high stability at high temperature (65?°C) or at pH values from 8 to 10. EpXYN3 kept over 80% enzymatic activity after treatment at pH values from 3 to 10. The specific activities of EpXYN1 and EpXYN3 were 384.42 and 214.20?U/mg?using beechwood xylan as substrate, respectively. EpXYN1 showed lower K_m values and higher specific activities toward different xylans compared to EpXYN3. Thin-layer chromatography analysis indicated that the hydrolysis profiles of xylans or xylo-oligosacharides were different by EpXYN1and EpXYN3. EpXYN3 had a higher efficiency than EpXYN1 in production of feruloylated oligosaccharides (FOs) from de-starched wheat bran. The maximum levels of FOs released by EpXYN1 and EpXYN3 were 11.1 and 14.4?μmol/g, respectively. In conclusion, the two xylanases are potential candidates for various industrial applications.

Full text of DOI:10.1007/s12010-018-2775-6

Appl Biochem Biotechnol
https://doi.org/10.1007/s12010-018-2775-6
Characterization of Two New
Endo-β-1,4-xylanases from Eupenicillium parvum 4–14
and Their Applications for Production of Feruloylated
Oligosaccharides
Liangkun Long1,2 & Meijuan Xu1,2 & Yuexin Shi1,2
Qunying Lin3 & Jing Wang1,2 & Shaojun Ding1,2
&
Received: 6 November 2017 /Accepted: 27 April 2018
#
Springer Science+Business Media, LLC, part of Springer Nature 2018
Abstract Two new endo-1,4-beta-xylanases encoding genes EpXyn1 and EpXyn3 were isolated
from mesophilic fungus Eupenicillium parvum 4–14. Based on analysis of catalytic domain and
phylogenetic trees, the xylanases EpXYN1 (404 aa) and EpXYN3 (220 aa) belong to glycoside
hydrolase (GH) family 10 and 11, respectively. Both EpXYN1 and EpXYN3 were successfully
expressed in Pichia pastoris and the recombinant enzymes were characterized using beechwood
xylan, birchwood xylan, or oat spelt xylan as substrates, respectively. The optimum temperatures
and pH values were 75 °C and 5.5 for EpXYN1, and 55 °C and 5.0 for EpXYN3. EpXYN1
exhibited a high stability at high temperature (65 °C) or at pH values from 8 to 10. EpXYN3 kept
over 80% enzymatic activity after treatment at pH values from 3 to 10. The specific activities of
EpXYN1 and EpXYN3 were 384.42 and 214.20 U/mg using beechwood xylan as substrate,
respectively. EpXYN1 showed lower Km values and higher specific activities toward different
xylans compared to EpXYN3. Thin-layer chromatography analysis indicated that the
Liangkun Long and Meijuan Xu contributed equally to this work.
Electronic supplementary material The online version of this article (https://doi.org/10.1007/s12010-018-
2775-6) contains supplementary material, which is available to authorized users.
* Shaojun Ding
dshaojun@hotmail.com; dshaojun@njfu.edu.cn
Liangkun Long
longlk602@njfu.edu.cn
Jing Wang
wangj@njfu.edu.cn
1
College of Chemical Engineering, Nanjing Forestry University, Nanjing 210037 Jiangsu, China
2
Jiangsu Key Lab for the Chemistry & Utilization of Agricultural and Forest Biomass,
Nanjing 210037, China
3
Nanjing Institute for the Comprehensive Utilization of Wild Plants, Nanjing 210042, China

Appl Biochem Biotechnol
hydrolysis profiles of xylans or xylo-oligosacharides were different by EpXYN1and EpXYN3.
EpXYN3 had a higher efficiency than EpXYN1 in production of feruloylated oligosaccharides
(FOs) from de-starched wheat bran. The maximum levels of FOs released by EpXYN1 and
EpXYN3 were 11.1 and 14.4 μmol/g, respectively. In conclusion, the two xylanases are
potential candidates for various industrial applications.
.
.
.
Keywords Thermophilic xylanase Eupenicillium parvum Characterization Feruloylated
oligosaccharides Wheat bran
.
Introduction
Hemicellulose predominantly consists of heteroxylans and is a renewable resource for
production of liquid fuels, value-added chemicals, or biomaterials in energy, functional
foods, or pharmaceutical industries [1, 2]. Heteroxylans have a complex structure with
backbones of β-1,4-linked xylose residues and side chains of various substituent units
such as arabinose, glucuronic acid, or 4-O-methylglucuronic acid [3, 4]. Enzymatic
hydrolysis is a key step in industrial preparation of fermentable monosaccharides,
xylo-oligosaccharides (XOS), or other chemicals from heteroxylans [5, 6]. Due to its
structural complexity, the complete degradation of heteroxylans requires a diverse range
of cooperatively acting enzymes, primarily endo-1,4-β-xylanase and β-xylosidase, and
additional enzymes such as α-l-arabinofuranosidase, α-D-glucuronidase, and acetyl xylan
esterase [5, 7]. Endo-β-1,4-xylanase (EC 3.2.1.8) catalyzes the hydrolysis of internal β-
1,4-D-xylosidic bonds in xylans and generates various unsubstituted or branched XOS,
and plays a crucial role in effective degradation of hemicellulose [3, 5]. As an important
enzyme, xylanase has been widely used in biofuel production, animal feed production,
food and health industry, or pulping and laundry industry [8–10].
Xylanases can be produced by different organisms including fungi, bacteria, marine algae,
protozoa, snails, crustaceans, insect, and seeds [6, 10]. Among these organisms, filamentous
fungi are more suitable for large-scale production of xylanases because of their strong ability to
produce extracellular enzymes. Many species of Aspergillus, Trichoderma, or Penicillium have
been used widely in industrial production of xylanase for various applications [10–12].
T. reesei endo-xylanase II and endo-xylanase from A. niger var. awamori have been applied
in paper and pulp industry or bread baking, respectively [10, 11]. To date, a large number of
endo-β-1,4-xylanase genes have been reported and showed diverse sequences. According to
sequences comparisons of the catalytic domains, they were classified to glycoside hydrolases
(GH) families 5, 8, 10, 11, 30, or 43, in the Carbohydrate-Active enZYmes (CAZy) database
(http://www.cazy.org/) [5]. The majority of endo-β-1,4-xylanases belong to GH10 and GH11
families, and were extensively studied for the important value in industrial applications [11
–13]. GH10 family xylanases have an (α/ß)8 barrel structure which forms a bowl shape, and
show higher catalytic activity on highly branched xylan backbone. GH11 family xylanases are
densely packed and consist mainly of ß-sheets that form a ß-jelly roll fold structure and have
higher substrate specificity compared to GH10 family xylanases [3, 5, 13]. A carbohydrate-
binding module (CBM), which aids binding to cellulose, are usually found at the N-terminus
of some GH10 xylanases but not GH11 xylanases [14]. The functions of CBM domain in
xylanases involved in the binding ability of enzymes to natural substrates and enzymatic
thermostability [14, 15].

Appl Biochem Biotechnol
Xylanases from mesophilic microorganism generally show a low optimum temperature
(50–55 °C) and poor thermal stability (below 65 °C), and cannot withstand the high temper-
ature in many industrial processes [15, 16]. Thermotolerant xylanases have many advantages
in industrial applications including higher specific activity (lower cost of enzyme), increment
of substrate and product solubility, and decrement of microbial contamination [17]. Some
thermophilic fungi (e.g., Humicola insolens) and bacteria (e.g., Caldicellulosiruptor sp.) or
hyperthermophilic archaea (e.g., Thermococcus zilligii) have been reported to produce
thermotolerant xylanases, which exhibit increased specific activity and higher thermostability
[5, 15, 18]. Recently, some researchers enhanced the thermostable of GH11 xylanases through
protein engineering [16, 19]. Development of novel and thermotolerant xylanases is significant
for biodegradation of hemicellulose.
Wheat bran, a major agricultural by-product, is rich in arabinoxylans and ferulic acid (4 to
6 mg/g) [20]. Ferulic acid (4-hydroxy-3-methoxycinnamic acid, FA) is a very attractive
phenolic compound, which displays antioxidative ability [21]. In wheat bran, FA cross-links
arabinoxylan molecules via arabinose residues and strengthens cell wall by providing connec-
tion between lignin and heteroxylan [22, 23]. Feruloylated oligosaccharides (FOs) owing their
nutritional functions to both FA and oligosaccharides possess potential applications in func-
tional food and pharmaceutical industries [24]. FOs from wheat bran displayed strong
antioxidant activity against free radical-induced oxidative damage in rat erythrocytes and
human lymphocytes [23, 25]. FOs can be efficiently released from wheat bran by enzymatic
hydrolysis with single endo-β-1,4-xylanase [26]. The aim of this study was to find new
xylanases for preparation of FOs from wheat bran. In previous study, thermotolerant
(hemi)cellulolytic enzymes producer Eupenicillium parvum 4–14 showed a high efficiency
in extracting FA from wheat bran, suggesting efficient endo-β-1,4-xylanase produced by the
fungus [27]. In this study, two genes encoding GH10 or GH11 family xylanases were isolated
from E. parvum 4–14, and the recombinant enzymes were characterized and compared in the
releasing of FOs from wheat bran.
Materials and Methods
Strain, Media, and Growth Conditions
The filamentous fungus Eupenicillium parvum 4–14 (CCTCC M2015404), a producer of
thermotolerant (hemi)cellulolytic enzymes, was preserved on potato dextrose agar (PDA) slant
by our lab, and deposited in the China Center for Type Culture Collection (CCTCC, Wuhan,
China) [27]. Pichia pastoris KM71H strain was employed to express the target proteins.
Escherichia coli DH5α was used for plasmid propagation and grown at 37 °C in Luria-Bertani
(LB) medium with or without antibiotic.
Cloning of Xylanase Genes from E. parvum
Two integrated genes encoding endo-xylanase (named EpXyn1 and EpXyn3, respectively)
were found in the transcriptome data of E. parvum 4–14 (unpublished data). To clone the
genes, specific primers were designed by software Primer Premier 6.0 (Table 1). E. parvum
was cultured in solid state fermentation (SSF) medium for 72 h at 37 °C [27]. The collected
mycelia were subjected to total RNA extraction with a TransZol Plant kit (TransGen, Beijing,

Appl Biochem Biotechnol
Table 1 Primers used in this study
Primer
Sequence (5′ to 3′)a
enXyn1_f1
enXyn1_r1
enXyn1_f2
enXyn1_r2b
enXyn3_f1
enXyn3_r1
enXyn3_f2
enXyn3_r2b
ttgccgtccacgctctatc
acagcctacgaggaattaacaac
agagaggctgaagctgaattctcaggcctggatacagcggca
gagatgagtttttgttctagatcagtgatggtgatggtgatgcagacattgagagtacca
aacaacggcagcctctcat
ggtctctcaacatcgccacta
agagaggctgaagctgaattctctcccaccgcgatcgaggaa
gagatgagtttttgttctagatcagtgatggtgatggtgatgatggacggtaatgtccga
a The underline nucleotide sequences indicate restriction enzyme sites
b A Histidine-tag (the bold nucleotide sequences) is contained in the primer
China) according to the commercial manual. First-strand cDNAwas synthesized by EasyScript
One-Step gDNA Removal and cDNA Synthesis SuperMix (oligo (dT) was used) (TransGen,
Beijing, China). The cDNA of genes were amplified by primer sets enXyn1_f1/enXyn1_r1 for
EpXyn1 or enXyn3_f1/enXyn3_r1 for EpXyn3, and inserted into the vector pEASY-Blunt
(Transgene, Beijing, China). DNA sequences were determined by the BioSune Biotechnol-
ogies Co. Lid (Shanghai, China) using Sanger sequencing.
Expression of Xylanases in Yeast and Protein Purification
The genes EpXyn1 and EpXyn3 (removed native signal sequences) were amplified by specific
primer sets enXyn1_f2/enXyn1_r2 or enXyn3_f2/enXyn3_r2, respectively. After gel purifica-
tions, the corresponding DNA fragments were ligated into plasmid pPICZαB (terminated with
EcoRI-XbaI) by Hieff Clone™ One Step Cloning Kit (Yeasen, Shanghai, China), and yielding
plasmid pPIC-EpXyn1 or pPIC-EpXyn3, respectively. After linearization with SacI, the
recombinant plasmids were introduced into P. pastoris KM71H competent cells by electropo-
ration with a Gene Pulser® II Electroporation System (Bio-Rad, Hercules, CA, USA). Yeast
transformants were selected on YPD plates containing 100 μg/mL of Zeocin (Invitrogen,
USA). Randomly selected yeast transformants were cultured in 5 mL BMMY medium
containing 0.8% methanol according to the Pichia Expression Kit Instruction Manual
(Invitrogen, USA). Yeast transformants with high enzymatic activity were extendedly cultured
in 25 mL BMMY medium containing 1% methanol at 28 °C and 200 rpm for 8 days. After
centrifugation at 5000×g for 10 min, the fermentation supernatant was applied to the Ni-NTA
affinity column (Qiagen, Valencia, CA, USA) for protein purification. After dialysis treatment
at 4 °C for 24 h, the pure proteins were subjected to sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (12%, SDS-PAGE) and enzymatic activity determination. Proteins were
quantified with a BCA assay kit (Thermo Tech, USA).
Enzyme Assay
Xylanase activity was determined in 50 mM sodium citrate buffer (pH 4.8) using 0.5% (w/v) of
beechwood xylan, birchwood xylan, or oat spelt xylan (Sigma, USA) as substrates. The
enzymatic reaction system includes 1.0 mL of buffer, 100 μL of pure enzyme (0.2–0.5 μg),
and 400 μL of substrate solution. Reaction mixture was incubated at the experimentally
determined optimal temperature (55 °C for EpXYN3 or 75 °C for EpXYN1) for 10 min,

Appl Biochem Biotechnol
and the released reducing sugar was quantified by Somogyi-Nelson method [28]. Briefly, the
1.5 mL reaction mixture was added with 0.5 mL of Somogyi reagent and treated at 99 °C for
5 min. After cooling to room temperature, 0.5 mL of Nelson reagent was added and incubated
at 25 °C for 20 min. Per 200 μL of reaction solution was transfer to 96-well microplate,
measured the absorbance at 520 nm with a SpectraMAX190 Microplate Reader (Melecular
Devices, USA). Reducing sugar was quantified according to xylose standard curve. One unit
of xylanase activity was defined as the amount of enzyme required to liberate 1 μmol of xylose
from the substrate per minute under the assay conditions.
Effect of pH or Temperature on Enzymatic Activity and Stability
The effects of pH or temperature on recombinant xylanases were detected in universal pH
buffers (pHs values range from 3.0 to 9.5 with 0.5 interval) [29], or at temperatures range from
30 to 90 °C with 5 °C interval. Relative activity was calculated using the highest activity as
100%. For test of pH stability, pure enzyme (1 μg/μL) was mixed with universal pH buffer (v/
v, 1:2) and stored at 4 °C for 12 h. After 100- or 200-fold dilution with ddH2O, the residual
enzymatic activity was assayed under standard conditions. Thermal stability of enzyme was
estimated by determination of the residual activities under the conditions as described above
after pre-incubation of enzyme sample (1 μg/μL) at different temperatures for 5, 10, 20, 30, 60,
or 90 min. Relative activities (%) were calculated according to the radio of the activities of
treated enzyme and untreated enzyme, using the activity of untreated enzyme as 100%.
Effect of Metal Ions or Chemicals on Enzymatic Activity
Effects of metal ions or chemical reagents on different xylanase were estimated by addition of
these substances in reaction system individually. The additive concentrations were 1 or 5 mM
for MgCl2, FeCl3, MnCl2, CoCl2, ZnCl2, CuCl2, CaCl2, and NiSO4, or 0.1 to 1 mM for EDTA,
DTT, and SDS, respectively. Enzyme activities were assayed under standard conditions.
Relative activities (%) were calculated using the activity of untreated enzyme as 100%.
Determination of Kinetic Parameters
The kinetic parameters (Vmax and Km) of different xylanases were determined using
beechwood xylan, oat spelt xylan (insoluble), or birchwood xylan (Sigma, Louis, Missouri,
USA) as substrates, respectively. Per 0.4 μg of pure enzyme was mixed with 0.125, 0.25, 0.5,
1.0, 1.5, 2.0, or 2.5 mg/mL substrate, respectively. The enzymatic activity was determined
under standard conditions except that the reaction time was 5 min. The Vmax and Km values
were calculated by the software GraphPad Prism 5.0 using nonlinear regression (http://www.
graphpad.com/ prism/). Turnover number (kcat) was calculated as the ration of Vmax to the
concentration of enzyme used in the reaction [30].
Thin-Layer Chromatography Analysis of the Hydrolysis Products
The hydrolyzed products of different xylans or xylo-oligosaccharides (XOS, BZ Oligo,
Qingdao, China) by the recombinant xylanases were analyzed by thin-layer chromatography
(TLC). In 2 mL sodium citrate buffer (pH 5.0, 50 mM), beechwood xylan (10 mg), birchwood
xylan (20 mg), or oat spelt xylan (20 mg) were mixed with 25 μg of pure enzyme, and

Appl Biochem Biotechnol
incubated at 55 °C (for EpXYN3) or 75 °C (for EpXYN1) for an appropriate time. In the same
buffer, 1 mg/mL of XOS (from xylobiose to xylohexaose, X2 to X6) was hydrolyzed by
different xylanases (10 μg/mL) at the same temperatures for 24 h. The enzymatic reactions
were stopped by boiling for 10 min. After centrifugation at 5000×g for 10 min, per 3 μL of
supernatants were spotted onto TLC Silica gel 60 F254 glass plates (Merck, Whitehouse
Station, NJ, USA). The plates were developed in a solvent system consisting of acetonitrile–
ethyl acetate–2-propanol–water (v/v/v/v, 17:5:11:10) [31]. After air drying for 10 min, the
plates were visualized by spraying a methanol-sulfuric acid mixture (v/v, 9:1) with 0.2%
orcinol and heating at 85 °C for 5 min [32]. Xylose and X2–X6 were used as standards.
Releasing of FOs from Wheat Bran by Enzymatic Hydrolysis
De-starched wheat bran (DSWB) was prepared by the previous method [27]. To release
FOs from DSWB, single or double xylanases was put into a 2-mL centrifuged tube
containing 1 mL of sodium citrate buffer (pH 5, 50 mM) and 50 mg of substrate. For
single enzyme hydrolysis, 0–160 U/g (dry substrate) of enzyme was added and incubated
at 60 °C (for EpXYN1) or 50 °C (for EpXYN3), or 80 U/g of enzyme was added and
incubated at different temperatures. For double enzymes hydrolysis, 40 or 80 U/g of
EpXYN1 with the same amount of EpXYN3 were added and incubated at 50 °C. The
reaction mixtures were incubated at 1,500 rpm up to 48 h on a thermo shaker, and
stopped at 100 °C for 15 min. After centrifugation at 10,000g for 10 min, 100 μL of
suspension was diluted with 100 mM MOPS (3-(N-morpholino)-propanesulfonic acid,
pH 6.0) buffer. The same enzyme was deactivated by incubation at 100 °C for 20 min
and used as a control. FO content in the suspension was determined spectrophotometri-
cally by measuring absorbance at 286 and 323 nm, and calculated according to the
following formula [26].
½FOsŠ ¼ ðA323  ε286−A286  ε323Þ=½bðε0323  ε286−ε0286  ε323ފ:
The letter b indicates the path length of sample (cm). The molar absorption coefficients,
which determined at pH 6.0 in 100 mM MOPS, were 286 = 14,176 mol/L/cm and
=
323
10,350 mol/L/cm for free FA, and ′286 = 12,465 mol/L/cm and ′323 = 19,345 mol/L/cm for
esterified FA [26]. To verify the efficiency of spectrophotometry measure, free FA in hydro-
lytic mixture with or without alkaline treatment was determined by an Agilent 1260 Infinity
high-performance liquid chromatography (HPLC) system (Agilent, USA) equipped with a
ZORBAX Eclipse Plus C18 reversed-phase column [27]. A mobile phase of methanol to 0.1%
(v/v) acetic acid (v/v, 35:65) was used and monitored at 320 nm.
Bioinformatics Analysis
BioEdit 7.0 software was used to assemble and translate the nucleic acid sequences. Protein
sequences were analyzed by BLAST on line (http://www.NCBI.nim.nih.gov/). Putative signal
peptides were predicted with SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/).
Theoretical pI and molecular weight (Mw) of target proteins were calculated with ExPASy
Server (http://web.expasy.org/compute_pi/). ClustalX 1.83 software and Mega 6 program
were used for multiple sequences alignment and construction of phylogenetic tree,
respectively [33]. Structure-based sequence alignment was generated using ESPript 3.0 [34].

Appl Biochem Biotechnol
Statistics Analysis
For statistical analysis, one-way analysis of variance (ANOVA) was performed with the SPSS
20 software using LSD test. A P value of less than 0.05 was considered statistically significant.
Results
Molecular Characterization of EpXYN1 and EpXYN3
The integrated encoding region of xylanases genes EpXyn1 (1212 bp) and EpXyn3
(660 bp) were cloned from E. parvum 4–14, and the cDNA sequences were deposited
in GenBank under the accession numbers MF682063 and MF682064, respectively.
Signal peptides were predicted at the N-terminus of deduced proteins EpXYN1 or
EpXYN3 by the SignalP 4.1 Server, indicating that the two proteins are extracellular
enzymes. Theoretical pI and Mw are 4.97 and 40.75 kDa for mature EpXYN1, or 5.21
and 21.58 kDa for mature EpXYN3. By analysis of protein sequences with BLAST tool,
EpXYN1 has a typical catalytic domain of GH10 xylanases, a Ser/Thr-rich linker region,
and a carbohydrate-binding module (CBM), and EpXYN3 contains a typical catalytic
domain of GH11 xylanase (Fig. 1a, b). Structure-based sequence alignments revealed
that EpXYN1 had typical (β/α)8 elements of GH10 xylanases, EpXYN3 had a typical β-
Jelly roll fold of GH11 xylanases, and the conserved catalytic residues Glu existed in
these protein sequences (Fig. 1a, b).
BLAST analysis indicated that EpXYN1 was mostly related to endo-1,4-beta-xylanase
(GenBank: OOQ87260) from P. brasilianum with a 82% identity, and EpXYN3 was mostly
related to putative endo-1,4-beta-xylanase (XynG1, GenBank: OOQ87260.1) from A. fischeri
with a 68% identity. The constructed phylogenetic trees showed that EpXYN1 and EpXYN3
were affiliated with GH10 or GH11 xylanases, respectively (supplementary Fig. S1).
Expression and Purification of EpXYN1 and EpXYN3
Xylanase activities were detected in the fermentation liquid of selected yeast transformants.
The highest activities were produced after 5 or 7 days induction with methanol for xylanases
EpXYN1 and EpXYN3, respectively (supplementary Fig. S2). The recombinant proteins were
purified to near-homogeneity and analyzed on SDS-PAGE gel (Fig. 2). The result of electro-
phoresis showed that the actual Mw (approximately 53 kDa) of recombinant EpXYN1 was
obviously larger than the theoretical value of 41.58 kDa (including His-tag). At the same time,
the Mw of EpXYN1 did not change after treatment with endoglycosidases Endo Hf. The actual
Mw of recombinant EpXYN3 was similar to the theoretical value (Fig. 2).
Optimal pHs and Temperatures
Recombinant EpXYN1 and EpXYN3 displayed the maximum activities at pH values 5.5 and
5.0 toward three xylans, respectively (Fig. 3a, b). The relative enzyme activities decreased to
less than 50% when adjusted the pH to 7.5 for EpXYN1, or 7.0 for EpXYN3. Reducing the pH
to 3.5 led to 47–63% decrements of these activities. The two enzymes maintained a high
activity (above 87%) at the pH values from 4.5 to 5.5 using beechwood xylan or birchwood

Appl Biochem Biotechnol
Fig. 1 Structure-based sequence alignment of enzymes EpXYN1 (a) or EpXYN3 (b) with related xylanases. a
The secondary structural elements of EpXYN1 using the xylanase FoXyn10a from Fusarium oxysporum as a
template (PDB NO. 3U7B). XYN-Ps, xylanase D (OKO90312.1) from Penicillium subrubescens; XYN-Pb, a
xylanase (OOQ87260.1) from P. brasilianum; XYN-An, a xylanase from Aspergillus niger (AIC36735), CBM1,
carbohydrate-binding module family 1. b The secondary structural elements of EpXYN3 using the xylanase
TcXylC from Talaromyces cellulolyticus as a template (PDB NO. 3WP3). XynG1, a xylanase from A. fischeri
(KF233756); XYNB-An, xylanase B from Aspergillus niger (ACA24724.1); XYN-Ao, a xylanase from
A. oryzae (AFA51067); GH11-Po, a member of glycoside hydrolase family 11 from P. expansum
(XP_016599740). The secondary-structure elements α-helices, β-strands, and strict β-turns are denoted as
squiggles, arrows, and letters TT, respectively. The conserved catalytic residues Glu are rendered as arrows.
The figure was constructed with ESPript 3.0
xylan as substrate. EpXYN1 showed the maximum activity at 75 °C and kept about 90%
activity at 80 °C toward different xylans (Fig. 3c). At a lower temperature, the enzyme activity
was declined. At the same time, the optimal temperature of EpXYN3 was 55 °C, and quickly
lost the activity with the increment of temperature (Fig. 3d).

Appl Biochem Biotechnol
Fig. 2 SDS-PAGE gel
electrophoresis of the recombinant
xylanases. Lane 1, purified
EpXYN1; lane 2, purified
EpXYN3; and lane 3 and 4,
deglycosylation treatment of
EpXYN1 or EpXYN3 by Endo Hf
(70 kDa), respectively
pH Stability and Thermostability of Recombinant Xylanases
The results indicated that EpXYN1 was stable at low pH values (3.0 to 4.0) and high pH
values (9.0 to 10), and lost 24–35% activity after treated at the pH values from 5.0 to 8.0.
Fig. 3 Effect of pH and temperature on the activities of recombinant xylanases EpXYN1 or EpXYN3. a, b
Optimal pHs of recombinant EpXYN1 and EpXYN3, respectively. The enzyme activities were assayed at 55 °C
for EpXYN1 or 75 °C for EpXYN3 in universal pH buffers (pH values 3.0–9.5). c, d Optimal temperatures of
recombinant EpXYN1 and EpXYN3, respectively. The enzymatic activities were determined in 50 mM sodium
citrate buffer (pH 4.8) at different temperatures. Beechwood xylan (BeXy), birchwood xylan (BiXy), or oat spelt
xylan (OaXy) were using as substrates, respectively. The relative activities were calculated using the maximum
enzyme activity as 100%. Error bars represent standard deviations from three repeated detections

Appl Biochem Biotechnol
EpXYN3 kept over 80% activity at different pH values, and the lost activity less than 3%
at the pH values from 7.0 to 9.0 (Fig. 4). The thermostability test showed EpXYN1 was
stable at 65 °C, and sharply lost the activity when treated at higher temperatures (Fig. 5a).
At the same time, EpXYN3 quickly lost the activity at 55 °C, and displayed high
stability at 45 °C (Fig. 5b).
Effect of Metal Ions and Chemicals on Enzymatic Activity
The effects of metal ions or chemicals on the activities of recombinant xylanases were
evaluated using beechwood xylan as substrate. As described in Table 2, the activities of
EpXYN1 and EpXYN3 were slightly decreased when addition of Ca2+, Zn2+, Mg2+,
Cu2+, Co2+, or Ni2+ at a high concentration (5 mM). High concentration Fe3+ showed
strong repression effects on these activities. The addition of 0.1 or 1 mM EDTA led to
16.4 and 17.2% increments on the activity of EpXYN1. SDS with a final concentration
of 3.5 mM displayed sharp inhibition on the activities of EpXYN1 and EpXYN3.
Specific Activity and Kinetic Parameters
The specific activities of EpXYN1 with three xylans as substrates were higher than these
of EpXYN3. For the two enzymes, the specific activities toward birchwood xylan were
higher than the other two xylans (Table 3). The kinetic constants of two enzymes toward
different substrates were also listed in Table 3. EpXYN1 and EpXYN3 had the lowest
Michaelis constant (Km) values of 0.85 0.12 or 0.95 0.18 mg/mL toward beechwood
xylan, respectively. Using birchwood xylan or oat spelt xylan as substrate, the Km values
were 1.13 0.08 or 2.07 0.35 mg/mL for EpXYN1, and 3.84 0.61 or 3.58 0.46 mg/
mL for EpXYN1, respectively. The maximum initial velocities (Vmax) of EpXYN1 on
beechwood or oat spelt xylan were higher than those of EpXYN3. The two enzymes had
Fig. 4 pH stability of recombinant xylanases EpXYN1 or EpXYN3. Purified enzyme (1 μg/μL) were stored in
universal buffers with different pH values for 12 h at 4 °C, and the residual activities were determined under
standard conditions using beechwood xylan as substrate. The relative activities were calculated using the enzyme
activity of untreated samples as 100%. Error bars represent standard deviations from three repeated detections

Appl Biochem Biotechnol
Fig. 5 Thermostability of recombinant xylanases EpXYN1 (a) or EpXYN3 (b). Purified enzymes (1 μg/μL)
were incubated at different temperatures up to 90 min. The residual activities were determined under standard
conditions using beechwood xylan as substrate. The relative activities were calculated using the enzyme activity
of untreated samples as 100%. Error bars represent standard deviations from three repeated detections
similar Vmax values on birchwood xylan. The kcat values of EpXYN1 were higher than
these of EpXYN3 toward three xylans.
TLC Analysis of Hydrolytic Products
TLC analysis showed that different xylans and XOS (except xylobiose) were efficiently
hydrolyzed by the two xylanases (Fig. 6). For EpXYN1, the main hydrolytic products of
three xylans was xylobiose, followed by xylotriose and unidentified longer XOS, and appeared
a small amount of xylose with the extended hydrolysis time (Fig. 6a–c). All of the XOS except
xylobiose were hydrolyzed by EpXYN1, and xylobiose with a small amount of xylose were
the main hydrolytic product (Fig. 6d). For EpXYN3, xylotriose, xylobiose, and some longer
XOS were the main hydrolytic products from the three xylans (Fig 6e–g). Xylobiose could not
be hydrolyzed by EpXYN3. Xylotriose was partially degraded to xylobiose and xylose by the
enzyme. The longer XOS (X4 to X6) were efficiently hydrolyzed by EpXYN3 (Fig. 6h).

Appl Biochem Biotechnol
Table 2 Effect of metal ions or chemical reagents on the activities of recombinant xylanases
Chemicals
Concentration (mM)
Relative activity (%)
EpXYN1
EpXYN3
Control
Ca2+
100.0 1.7
103.5 0.8
96.2 5.8
101.0 2.2
95.7 3.2
107.6 2.9
94.7 0.7
92.6 1.7
51.6 4.7
101.3 1.0
96.3 2.6
105.6 3.6
96.0 1.90
99.2 2.3
94.6 6.9
99.5 2.8
92.2 2.5
116.4 7.3
117.2 1.9
98.1 1.3
53.1 1.8
100.0 1.6
101.0 1.6
99.1 3.7
100.8 2.6
96.3 1.8
100.6 1.3
98.2 0.6
99.3 3.6
53.9 3.0
108.9 4.3
106.7 1.7
102.5 2.2
81.4 2.8
99.7 1.2
90.0 7.7
92.4 1.7
88.1 3.1
101.8 4.0
106.7 7.5
101.9 3.1
28.8 1.7
1
5
1
5
1
5
1
5
1
5
1
5
1
5
1
5
Zn2+
Mg2+
Fe3+
Cu2+
Co2+
Ni+
Mn2+
EDTA
SDS
0.1
1
0.7
3.5
All of the enzymatic activities were assayed under standard conditions using beechwood xylan as substrate
Production of Feruloylated Oligosaccharides from Wheat Bran
Different amounts of FOs were extracted from DSWB by different enzymatic treatments. The
addition of 8 U/g of EpXYN1 or EpXYN3 led to release 4.4 or 9.2 μmol/g FOs from DSWB,
respectively. Increasing of the enzyme dosage to 40 U/g led to the extract levels of FOs up to
7.5 μmol/g for EpXYN1 or 13.0 μmol/g for EpXYN3. Further increment of enzyme dosage
significantly enhanced the FOs release by EpXYN1 but EpXYN3 (Fig. 7a). The optimum
enzyme dosages were 80 U/g for EpXYN1 and 40 U/g for EpXYN1 in releasing FOs from
DSWB.
The time curves of FOs release from DSWB by xylanases were analyzed at different
temperatures. For EpXYN1, the highest level of FOs was released when enzymatic hydrolysis
Table 3 Specific activity and kinetic constants of recombinant xylanases toward various xylans
Enzyme
Substrate
Specific activity (U/mg)
Km (mg/mL)
Vmax (μmol/mg)
k )
cat (s−1
EpXYN1 Beechwood xylan 384.42 29.42
Birchwood xylan 486.71 37.72
0.85 0.12
1.13 0.08
2.07 0.35
0.95 0.18
3.84 0.61
3.58 0.46
688.50 32.12
713.20 17.42
723.90 57.09
361.80 26.00
719.80 60.28
476.20 34.78
608.18 28.37
630.00 15.39
639.45 50.43
135.06 9.70
268.70 22.50
177.76 14.85
Oat spelt xylan
372.16 20.64
EpXYN3 Beechwood xylan 214.20 5.31
Birchwood xylan 264.74 10.83
Oat spelt xylan
194.98 8.06
To determine kinetic parameters, the enzyme activities were assayed under 75 °C, pH 5.5, and 5 min of reaction
for EpXYN1, or 55 °C, pH 5.0 and 5 min of reaction for EpXYN3. The kcat values of EpXYN1 and EpXYN3
were calculated based on the molecular weight of 53 kDa (according to SDS-PAGE analysis) and 22.4 kDa
(theoretical value), respectively

Appl Biochem Biotechnol
Fig. 6 TLC analysis of the hydrolytic products of various xylans or xylo-oligosaccharides by recombinant
xylanases. a–d Hydrolysis profiles of beechwood xylan, birchwood xylan, oat spelt xylan, or xylo-
oligosaccharides by EpXYN1, respectively. e–h Hydrolysis profiles of beechwood xylan, birchwood xylan,
oat spelt xylan, or xylo-oligosaccharides by EpXYN3, respectively. In a 2 mL sodium citrate buffer (pH 4.8,
50 mM), 20 mg xylans (10 mg of beechwood xylan) were mixed with 25 μg of pure enzymes and incubated at
standard temperatures for different time. Different xylo-oligosaccharides (X2 to X6, 1 mg/mL) were hydrolyzed
by the enzymes (10 μg/mL) under the same conditions for 24 h. S, xylose (X1) and xylo-oligosaccharides (X2 to
X6) were used as standards
at 60 °C. The FOs levels were decreased at higher or lower incubation temperatures (Fig. 7b).
Enzymatic hydrolysis with EpXYN3, the releasing level of FOs at 50 °C was higher than that
at 45 °C. Raising the temperature of incubation led to a lower extract level of FOs compared to
that at 50 or 45 °C (Fig. 7c). For the two enzymes, the optimum time was 36 h of incubation in
releasing FOs from DSWB (Fig. 7b, c). At the same time, the releasing levels of FOs were
compared among different treatments with single enzyme or double enzymes. For the single
hydrolysis, EpXYN3 released more FOs from the substrate than that by EpXYN1 under the
optimal temperatures. EpXYN3 combined with EpXYN1 did not significantly change the
extract level compared to single EpXYN3 (Fig. 7d). Under the experimental conditions, the
maximum levels of released FOs were 11.1 μmol/g for EpXYN1, and 14.4 μmol/g for
EpXYN3. For same samples, the FOs contents determined by spectrophotometry measure
(10.66 0.56 and 12.93 0.90 μmol/g) were close to those of HPLC analysis (9.97 0.41 and
11.80 1.10 μmol/g) (supplementary Table S1).
Discussion
Xylanases are attractive enzymes in many industrial fields including biofuel production, paper
and pulp industry, and food and health industry [6, 10]. In this study, two new xylanases
encoding genes EpXyn1 and EpXyn3 were isolated from E. parvum 4–14. EpXyn1 gene
encodes a high MW xylanase EpXYN1 (404 aa) belonging to GH10 family. As some other
GH10 xylanases [35, 36], a CBM family 1 domain was predicted in the C terminal of
EpXYN1, suggesting its potential ability of binding to cellulose. EpXyn3 gene encodes a

Appl Biochem Biotechnol
Fig. 7 Release of feruloylated oligosaccharides (FOs) from de-starched wheat bran (DSWB) by enzymatic
hydrolysis. a Comparison of the FOs release from DSWB by different enzyme dosage. Total 0–160 U/g (dry
substrate) of xylanase was added into the reaction mixture, and incubated at 60 °C (EpXYN1) or 50 °C
(EpXYN3) for 24 h. b, c Time course of FOs release from DSWB by EpXYN1 (b) or EpXYN3 (c) under
different temperatures. The enzyme dosage was 80 U/g for each treatment. d Comparison of the FOs release from
DSWB by single xylanase and double xylanases. Single enzyme group, 80 U/g of enzyme was added and
incubated at 60 °C (EpXYN1) or 50 °C (EpXYN3) for 48 h. Double enzymes I, the amount of EpXYN1 and
EpXYN3 was 40 U/g. Double enzymes II, the amount of EpXYN1 and EpXYN3 was 80 U/g. The hydrolysis of
double enzymes was conducted at 50 °C for 48 h. The concentration of FOs was determined by spectropho-
tometry method. Each data is the average of three replications. Different letters above the error bars indicate
significant differences by LSD test (P ≤ 0.05)
low MW of xylanase EpXYN3 (220 aa) which belongs to GH11 family. EpXYN1 and
EpXYN3 have low identities (82 and 68%) with known xylanases.
Pure xylanases were obtained by inducible expression of EpXyn1 or EpXyn3 genes in
P. pastoris cells. The actual Mw of recombinant EpXYN1 was larger than the theoretical
value of the protein. Deglycosylation treatment with EndoHf (action on N-linked glyco-
sylation) could not decrease the size of EpXYN1. Shibata et al. reported a same
phenomenon on the GH10 xylanase PspXyn10 from Penicillium sp. [35]. They specu-
lated that O-linked glycosylation led to the enlargement of the molecular size, because
the linker region of fungal cellulases with a CBM1 domain was highly modified by O-
glycosylation [35]. This explanation may be the case of EpXYN1. EpXYN1 and
EpXYN3 displayed best catalytic activities at low pH values (4.5 to 5.5) that is in
conformity with the action condition of many industrially important cellulolytic enzymes

Appl Biochem Biotechnol
(such as from T. reesei). Acid pretreatments have gained much interest as one of
important methods for promoting enzymatic saccharification of biomass materials [37].
These acid enzymes are more suitable for bioconversion of biomass such as preparation
of monosaccharides and oligosaccharides from brans, especially with an acid pretreat-
ment procedure [38]. EpXYN1 showed the best catalytic ability at 75 °C and a high
thermal stability, which is in conformity with previous study [27]. Thermostable enzymes
have excellent performances in bioprocessing applications [17]. The new thermophilic
xylanase EpXYN1 could be used in many fields with high-temperature process such as
textile, pulp, and paper industries. Enhanced thermostability of xylanases involved in
many unique strategies such as an increment of salt bridges and hydrogen, introduction
of disulfide bridges at the N- or C- termini or in the helix regions, and improved internal
packing [5]. It was reported that the CBM1 domain and linker region was important for
the thermostability of GH10 xylanase Xyn10A from A. fumigatus Z5 [36]. Structural
analysis of EpXYN1 protein should be done for understanding the thermotolerant
mechanism. At the same time, the optimum temperature of EpXYN3 indicates that it is
a mesophilic xylanase.
The specific activities and kinetic parameters of EpXYN1 or EpXYN3 toward different
xylans were similar to those of reported fungal xylanases [7, 37, 38]. The two xylanases
displayed higher substrate affinities (lower Km values) toward beechwood xylan than
birchwood xylan and oat spelt xylan, that is inconsistent with other xylanases from
P. oxalicum, T. reesei, and A. nidulans [7, 39, 40]. Beechwood xylans have good solubility
and more enzyme access due to its few modifications and containing approximately 94%
xylose [7]. It is suggested that beechwood xylan is more suitable substrate for these fungal
xylanases. TLC analysis indicated that the test xylans were mainly hydrolyzed into xylobiose
or longer XOS by EpXYN1 and EpXYN3. It was suggested that the enzymes randomly
cleaved the xylan backbone. XOS possess prebiotic effects, which can be used in functional
foods, animal feed, and pharmaceuticals [13, 41, 42]. The two new xylanases are valuable for
the production of XOS from biomass. In addition, xylotriose could be hydrolyzed into
xylobiose and xylose by EpXYN1 but EpXYN3. This is in agreement with the conclusion
that GH11 family xylanases have higher substrate specificity than the xylanases in GH10
family [5].
As excellent functional ingredients, FOs can be used in health foods and pharmaceutical
industries [24, 25]. FOs widely exist in agricultural by-products including corn bran and wheat
bran [25]. A GH10 family xylanase from Thermoascus aurantiacus released 12 μmol of
FeXOSs (feruloylated xylo-oligosaccharides) from 1 g of pretreated corn cobs [26]. In this
study, the xylanases EpXYN1 and EpXYN3 had good performance at releasing of FOs from
DSWB. Under the test conditions, the maximum levels of 11.1 and 14.4 μmol/g of FOs were
released by EpXYN1 and EpXYN3, respectively. Previous study indicated that 26.3 μmol/g
(0.51%, w/w) of FA was released from DSWB by alkaline extraction [27]. Calculation based
on this data, the releasing rates of FOs were 42.2 and 54.8% by EpXYN1 and EpXYN3,
respectively. The enzymatic hydrolysis with double enzymes did not enhance the extract level
compared to single EpXYN3. GH11 xylanase EpXYN3 showed a higher efficiency than
GH10 xylanase EpXYN1 at releasing of FOs from DSWB under the test conditions. This
result is in agreement with the findings of Beaugrand et al., which compared the liberation of
XOS from wheat bran by GH11 and GH10 xylanases from Thermobacillus xylanilyticus [43].
Wheat cell walls are composed of a complex interconnected network with pore radius ranging
from 1.5 to 4 nm [44]. Proteins with molecular weights greater than 20 kDa (Stokes radius

Appl Biochem Biotechnol
2.5 nm) would be excluded from most numerous of the pores in the wheat samples [44]. It is
suggested that the high MW of xylanase EpXYN1 (approximately 53 kDa) would have more
difficulty to penetrate the bran tissues compared to the low MW of EpXYN3 (21.58 kDa).
In conclusion, we have reported the genes, characterizations, and application of two new
endo-1,4-beta-xylanases from E. parvum 4–14. The most important feature of EpXYN1 lies in
its high-temperature catalysis (75 °C) and high thermostability. Main hydrolytic products of
three commercial xylans by the two xylanases are xylobiose and xylotriose. EpXYN3 showed
a higher efficiency in releasing FOs from wheat bran. The characteristics of two xylanases
provide a potential way for industrial preparations of FOs or XOS from biomass. In future
studies, understanding the synergistic reactions of the enzymes with other hemicelluloses is
important for industrial applications.
Funding This work was supported by grants from a 948 Research Project (No. 2013-4-16) from State
Forestry Administration of China, the Natural Science Fund for Provincial Colleges and University of
Jiangsu Province, China (15KJB220003), the Research Fund for the Advanced Talents, Nanjing Forestry
University (GXL201311), and the Priority Academic Program Development of Jiangsu Higher Education
Institutions.
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no conflict of interest.
References
1. Peng, F., Peng, P., Xu, F., & Sun, R. C. (2012). Fractional purification and bioconversion of hemicelluloses.
Biotechnology Advances, 30(4), 879–903.
2. Liu, J., Chinga-Carrasco, G., Cheng, F., Xu, W., Willför, S., Syverud, K., & Xu, C. (2016). Hemicellulose-
reinforced nanocellulose hydrogels for wound healing application. Cellulose, 23(5), 3129–3143.
3. Li, H., Wu, H., Jiang, F., Wu, J., Xue, Y., Gan, L., Liu, J., & Long, M. (2018). Heterologous expression and
characterization of an acidic GH11 family xylanase from Hypocrea orientalis. Applied Biochemistry and
Biotechnology, 184, 228–238.
4. Zhou, X., Li, W., Mabon, R., & Broadbelt, L. J. (2017). A critical review on hemicellulose pyrolysis.
Energy Technology, 5(1), 52–79.
5. Collins, T., Gerday, C., & Feller, G. (2005). Xylanases, xylanase families and extremophilic xylanases.
FEMS Microbiology Reviews, 29(1), 3–23.
6. Chakdar, H., Kumar, M., Pandiyan, K., Singh, A., Nanjappan, K., Kashyap, P. L., & Srivastava, A. K.
(2016). Bacterial xylanases: Biology to biotechnology. 3 Biotech, 6(2), 150.
7. Liao, H., Zheng, H., Li, S., Wei, Z., Mei, X., Ma, H., Shen, Q., & Xu, Y. (2015). Functional diversity and
properties of multiple xylanases from Penicillium oxalicum GZ-2. Scientific Reports, 5,12631.
8. Juodeikiene, G., Basinskiene, L., Vidmantiene, D., Makaravicius, T., & Bartkiene, E. (2012). Benefits of β-
xylanase for wheat biomass conversion to bioethanol. Journal of the Science of Food and Agriculture,
92(1), 84–91.
9. Murugesan, G. R., & Persia, M. E. (2015). Influence of a direct-fed microbial and xylanase enzyme on the
dietary energy uptake efficiency and performance of broiler chickens. Journal of the Science of Food and
Agriculture, 95(12), 2521–2527.
10. Juturu, V., & Wu, J. C. (2012). Microbial xylanases: Engineering, production and industrial applications.
Biotechnology Advances, 30(6), 1219–1227.
11. Chutani, P., & Sharma, K. K. (2015). Biochemical evaluation of xylanases from various filamentous fungi and
their application for the deinking of ozone treated newspaper pulp. Carbohydrate Polymers, 127, 54–63.
12. Zhang, H.-M., Wang, J.-Q., Wu, M.-C., Gao, S.-J., Li, J.-F., & Yang, Y.-J. (2014). Optimized expression,
purification and characterization of a family 11 xylanase (AuXyn11A) from Aspergillus usamii E001 in
Pichia pastoris. Journal of the Science of Food and Agriculture, 94(4), 699–706.

Appl Biochem Biotechnol
13. Morgan, N. K., Wallace, A., Bedford, M. R., & Choct, M. A. (2017). Efficiency of xylanases from families
10 and 11 in production of xylo-oligosaccharides from wheat arabinoxylans. Carbohydrate Polymers, 167,
290–296.
14. Miao, Y., Li, P., Li, G., Liu, D., Druzhinina, I. S., Kubicek, C. P., Shen, Q., & Zhang, R. (2017). Two
degradation strategies for overcoming the recalcitrance of natural lignocellulosic xylan by polysaccharides-
binding GH10 and GH11 xylanases of filamentous fungi. Environmental Microbiology, 19(3), 1054–1064.
15. Meng, D.-D., Ying, Y., Chen, X.-H., Lu, M., Ning, K., Wang, L.-S., & Li, F.-L. (2015). Distinct roles for
carbohydrate-binding modules of glycoside hydrolase 10 (GH10) and GH11 xylanases from
Caldicellulosiruptor sp. strain F32 in thermostability and catalytic efficiency. Applied and Environmental
Microbiology, 81(6), 2006–2014.
16. Tang, F., Chen, D., Yu, B., Luo, Y., Zheng, P., Mao, X., Yu, J., & He, J. (2017). Improving the
thermostability of Trichoderma reesei xylanase 2 by introducing disulfide bonds. Electronic Journal of
Biotechnology, 26, 52–59.
17. Kumar, V., Marín-Navarro, J., & Shukla, P. (2016). Thermostable microbial xylanases for pulp and paper
industries: Trends, applications and further perspectives. World Journal of Microbiology and Biotechnology,
32(2), 34.
18. Du, Y., Shi, P., Huang, H., Zhang, X., Luo, H., Wang, Y. R., & Yao, B. (2013). Characterization of three
novel thermophilic xylanases from Humicola insolens Y1 with application potentials in the brewing
industry. Bioresource Technology, 130, 161–167.
19. Silva, S. B., Pinheiro, M. P., Fuzo, C. A., Silva, S. R., Ferreira, T. L., Lourenzoni, M. R., Nonato, M. C.,
Vieira, D. S., & Ward, R. J. (2017). The role of local residue environmental changes in thermostable mutants
of the GH11 xylanase from Bacillus subtilis. International Journal of Biological Macromolecules, 97, 574–
584.
20. Gopalan, N., Rodriguez-Duran, L. V., Saucedo-Castaneda, G., & Nampoothiri, K. M. (2015). Review on
technological and scientific aspects of feruloyl esterases: A versatile enzyme for biorefining of biomass.
Bioresource Technology, 193, 534–544.
21. Kumar, N., & Pruthi, V. (2014). Potential applications of ferulic acid from natural sources. Biotechnology
Reports, 4, 86–93.
22. Uraji, M., Arima, J., Inoue, Y., Harazono, K., & Hatanaka, T. (2014). Application of two newly identified
and characterized feruloyl esterases from Streptomyces sp. in the enzymatic production of ferulic acid from
agricultural biomass. PLoS One, 9(8), e104584.
23. Lapierre, C., Pollet, B., Ralet, M.-C., & Saulnier, L. (2001). The phenolic fraction of maize bran: Evidence
for lignin-heteroxylan association. Phytochemistry, 57(5), 765–772.
24. Ou, J., & Sun, Z. (2014). Feruloylated oligosaccharides: Structure, metabolism and function. Journal of
Functional Foods, 7, 90–100.
25. Xie, C., Wu, Z., Guo, H., & Gu, Z. (2014). Release of feruloylated oligosaccharides from wheat bran
through submerged fermentation by edible mushrooms. Journal of Basic Microbiology, 54(S1), S14–S20.
26. Katapodis, P., & Christakopoulos, P. (2008). Enzymic production of feruloyl xylo-oligosaccharides from
corn cobs by a family 10 xylanase from Thermoascus aurantiacus. Lwt-Food Science and Technology,
41(7), 1239–1243.
27. Long, L., Ding, D., Han, Z., Zhao, H., Lin, Q., & Ding, S. (2016). Thermotolerant hemicellulolytic and
cellulolytic enzymes from Eupenicillium parvum 4-14 display high efficiency upon release of ferulic acid
from wheat bran. Journal of Applied Microbiology, 121(2), 422–434.
28. Zheng, F., Huang, J., Liu, X., Hu, H., Long, L., Chen, K., & Ding, S. (2016). N- and C-terminal truncations
of a GH10 xylanase significantly increase its activity and thermostability but decrease its SDS resistance.
Applied Microbiology and Biotechnology, 10, 3555–3565.
29. Turner, B. L. (2010). Variation in pH optima of hydrolytic enzyme activities in tropical rain forest soils.
Applied and Environmental Microbiology, 76(19), 6485–6493.
30. Mi, S., Jia, X., Wang, J., Qiao, W., Peng, X., & Han, Y. (2014). Biochemical characterization of two
thermostable xylanolytic enzymes encoded by a gene cluster of Caldicellulosiruptor owensensis. PLoS One,
9(8), e105264.
31. Amel, B.-D., Nawel, B., Khelifa, B., Mohammed, G., Manon, J., Salima, K.-G., Farida, N., Hocine, H.,
Bernard, O., Jean-Luc, C., & Marie-Laure, F. (2016). Characterization of a purified thermostable xylanase
from Caldicoprobacter algeriensis sp. nov. strain TH7C1T. Carbohydrate Research, 419, 60–68.
32. Liao, H., Sun, S., Wang, P., Bi, W., Tan, S., Wei, Z., Mei, X., Liu, D., Raza, W., Shen, Q., & Xu, Y. (2014).
A new acidophilic endo-β-1,4-xylanase from Penicillium oxalicum: Cloning, purification, and insights into
the influence of metal ions on xylanase activity. Journal of Industrial Microbiology and Biotechnology,
41(7), 1071–1083.
33. Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular evolutionary
genetics analysis version 6.0. Molecular Biology and Evolution, 30(12), 2725–2729.

Appl Biochem Biotechnol
34. Robert, X., & Gouet, P. (2014). Deciphering key features in protein structures with the new ENDscript
server. Nucleic Acids Research, 42(W1), W320–W324.
35. Shibata, N., Suetsugu, M., Kakeshita, H., Igarashi, K., Hagihara, H., & Takimura, Y. (2017). A novel GH10
xylanase from Penicillium sp. accelerates saccharification of alkaline-pretreated bagasse by an enzyme from
recombinant Trichoderma reesei expressing Aspergillus β-glucosidase. Biotechnology for Biofuels, 10(1), 278.
36. Miao, Y., Kong, Y., Li, P., Li, G., Liu, D., Shen, Q., & Zhang, R. (2018). Effect of CBM1 and linker region
on enzymatic properties of a novel thermostable dimeric GH10 xylanase (Xyn10A) from filamentous
fungus Aspergillus fumigatus Z5. AMB Express, 8(1), 44.
37. Rattanaporn, K., Tantayotai, P., Phusantisampan, T., Pornwongthong, P., & Sriariyanun, M. (2018). Organic
acid pretreatment of oil palm trunk: Effect on enzymatic saccharification and ethanol production. Bioprocess
and Biosystems Engineering, 41(4), 467–477.
38. Yuan, L., Scanlon, M. G., Eskin, N. A., Thiyam-Hollander, U., & Aachary, A. A. (2015). Effect of
pretreatments and endo-1,4-β-xylanase hydrolysis of canola meal and mustard bran for production of
oligosaccharides. Applied Biochemistry and Biotechnology, 175(1), 194–208.
39. He, J., Chen, D., Yu, B., & Zhang, K. (2010). Optimization of the Trichoderma reesei endo-1,4-beta-
xylanase production by recombinant Pichia pastoris. Biochemical Engineering Journal, 52(1), 1–6.
40. Maitan-Alfenas, G. P., Oliveira, M. B., Nagemc, R. A. P., de Vries, R. P., & Guimarães, V. M. (2016).
Characterization and biotechnological application of recombinant xylanases from Aspergillus nidulans.
International Journal of Biological Macromolecules, 91, 60–67.
41. Kumar, V., Dangi, A. K., & Shukla, P. (2018). Engineering thermostable microbial xylanases toward its
industrial applications. Molecular Biotechnology, 60(3), 226–235.
42. Ma, R., Bai, Y., Huang, H., Luo, H., Chen, S., Fan, Y., Cai, L., & Yao, B. (2017). Utility of thermostable
xylanases of Mycothermus thermophilus in generating prebiotic xylooligosaccharides. Journal of
Agricultural and Food Chemistry, 65(6), 1139–1145.
43. Beaugrand, J., Chambat, G., Wong, V. W. K., Goubet, F., Rémond, C., Paës, G., Benamrouche, S., Debeire,
P., O'Donohue, M., & Chabbert, B. (2004). Impact and efficiency of GH10 and GH11 thermostable
endoxylanases on wheat bran and alkali-extractable arabinoxylans. Carbohydrate Research, 339(15),
2529–2540.
44. Chesson, A., Gardner, P. T., & Wood, T. J. (1997). Cell wall porosity and available surface area of wheat
straw and wheat grain fractions. Journal of the Science of Food and Agriculture, 75(3), 289–295.