An enone reductase from Nicotiana tabacum: cDNA cloning, expression in Escherichia coli, and reduction of enones with the recombinant proteins

Article abstract of DOI:10.1016/j.bioorg.2007.08.005

In the course of the purification of enone reductase participating to the reduction of pulegone, two reductases (NtRed-1 and NtRed-2) were isolated from cultured cells of Nicotiana tabacum. The partial amino acid sequences of the reductases revealed that NtRed-1 was allyl-alcohol dehydrogenase (Accession No. BAA89423) and NtRed-2 was malate dehydrogenase (Accession No. CAC12826). cDNA cloning and expression of these reductases in Escherichia coli were performed. Reduction with recombinant proteins was examined with cyclic α,β-unsaturated ketones, such as pulegone, carvone and verbenone, as substrates. It was found that the recombinant NtRed-1 catalyses the hydrogenation of the exocyclic C-C double bond of pulegone.

Full text of DOI:10.1016/j.bioorg.2007.08.005

Available online at www.sciencedirect.com
Bioorganic Chemistry 36 (2008) 23–28
www.elsevier.com/locate/bioorg
An enone reductase from Nicotiana tabacum: cDNA cloning,
expression in Escherichia coli, and reduction of enones
with the recombinant proteins
a
b
b
b
Akihito Matsushima , Yuya Sato , Miki Otsuka , Takayoshi Watanabe ,
c
b,
*
Hiroaki Yamamoto , Toshifumi Hirata
a
Natural Science Center for Basic Research and Development, Radioisotope Center, Hiroshima University,
1-4-2 Kagamiyama, Higashi-Hiroshima 739-8526, Japan
b
Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University,
1-3-1 Kagamiyama, Higashi-Hiroshima 739-8526, Japan
c
R&D Management Corporate Development Center, Daicel Chemical Industries, Ltd., Himeji Research Center,
1239 Shinzaike, Aboshi-ku, Himeji, Hyogo 671-1283, Japan
Received 26 July 2007
Available online 22 October 2007
Abstract
In the course of the purification of enone reductase participating to the reduction of pulegone, two reductases (NtRed-1 and NtRed-2)
were isolated from cultured cells of Nicotiana tabacum. The partial amino acid sequences of the reductases revealed that NtRed-1 was
allyl-alcohol dehydrogenase (Accession No. BAA89423) and NtRed-2 was malate dehydrogenase (Accession No. CAC12826). cDNA
cloning and expression of these reductases in Escherichia coli were performed. Reduction with recombinant proteins was examined with
cyclic a,b-unsaturated ketones, such as pulegone, carvone and verbenone, as substrates. It was found that the recombinant NtRed-1
catalyses the hydrogenation of the exocyclic C–C double bond of pulegone.
ꢀ 2007 Elsevier Inc. All rights reserved.
Keywords: Nicotiana tabacum; Enone reductase; Allyl-alcohol dehydrogenase; Malate dehydrogenase; cDNA cloning; Recombinant proteins; Reduction
of pulegone; Reduction of enones
1. Introduction
One is responsible for reducing the exocyclic double bond
of enones, such as pulegone (1) [13], and the other reduces
the endocyclic double bond of enones, such as carvone (2)
[14] and verbenone (3) [15]. Recently, many researchers
have reported on enone reductases from plant cells in the
research of secondary metabolism [16–18]. Ringer et al.
reported [16] the characterization of pulegone reductase
from Mentha piperita (PulR; Accession No. AAQ75423)
by genetic engineering; the multiple alignment of PulR
was referred to allyl-alcohol dehydrogenase (allyl-ADH;
Accession No. BAA89423) from N. tabacum [19]. This
report suggested that allyl-ADH catalyzed the reduction
of the C–C double bond of enones.
Asymmetric hydrogenation of C–C double bonds is one
of the most important reactions for production of chiral
compounds from alkenes [1,2]. Many studies on the enan-
tioselective reduction of the enone C–C double bond by
biocatalysts such as microorganisms and plant cell cultures
have revealed that enone reductases are useful for the pro-
duction of chiral ketones [3–11].
Previously, we reported the isolation of two types of
enone reductase that differed with respect to the substrate
specificity from cultured cells of Nicotiana tabacum [12].
*
We have now investigated the structure and function of
the enone reductase that is involved in the reduction of the
Corresponding author. Fax: +81 82 424 7435.
E-mail address: thirata@sci.hiroshima-u.ac.jp (T. Hirata).
0045-2068/$ - see front matter ꢀ 2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.bioorg.2007.08.005

24
A. Matsushima et al. / Bioorganic Chemistry 36 (2008) 23–28
C–C double bond of pulegone (1) in N. tabacum cells, by
cDNA cloning, expression of recombinant reductase in
Escherichia coli, and biotransformation of enones with
the recombinant reductase.
R1
R2
O
O
O
2. Material and methods
2b
1a: R1=CH3, R2=H
1b: R1=H, R2=CH3
2a
2.1. General
Analytical and preparative thin-layer chromatography
(TLC) analyses were performed on glass sheets (0.25 and
0.5 mm) coated with silica gel (Merck silica gel 60;
GF254). Optical rotations were measured with a JASCO
DIP-370 digital polarimeter. Gas chromatography (GC)
analyses with flame ionization detector (FID) were per-
formed on a capillary column (0.25 mm · 25 m) coated
with 0.25-lm Rt-bDEXse (Shimadzu) using N2 as a carrier
gas (column temp: 140 ꢁC, split ratio: 50, make up:
50 ml minꢀ1). Gas chromatography–mass spectrometry
(GC–MS) was performed using a JEOL SX-102A mass
spectrometer equipped with an electron ionization (EI)
ion source (70 eV) and a gas chromatograph equipped with
a capillary column (0.25 mm · 25 m) coated with 0.25-lm
ZB-5 (Zebron). Matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF) MS was performed using an
Ultraflex Time-of-Flight Instrument (Bruker Daltonics)
COOH
O
CH2
O
O
COOH
3b
4
3a
R1
R1
R2
R2
OH
H
O
O
5
6a: R1=CH3, R2=H
7a: R1=H, R2=CH3
6b: R1=H, R2=CH3
7b: R1=CH3, R2=H
Fig. 1. Formulas 1a–7b.
1
equipped with a nitrogen laser operating at 337 nm. H
NMR spectra were obtained using a JEOL LA-500
(500 MHz) spectrometer, using tetramethylsilane (TMS)
as an internal standard in CDCl3. DNA sequences were
determined using an Applied Biosystems Model 373A
Automated Sequencer. Luria–Bertani (LB) medium con-
taining 1% tryptone, 0.5% yeast extract and 1% NaCl
was used for cultivation of E. coli cells. Protein concentra-
tions were determined using a Bio-Rad Protein Assay kit
(Bio-Rad laboratories) and bovine serum albumin was
used as the standard protein solution.
4 ꢁC. The cultured cells (200 g) of N. tabacum (cultivated
for 3 weeks) [4] were ground in a Waring blender with
400 ml of 0.1 M Na–Pi buffer (pH 6.8) containing 10 mM
2-mercaptoethanol and 5 mM dithiothreitol. The resulting
slurry was filtered through three layers of cheesecloth. The
filtrate was centrifuged at 10,000g for 15 min. The superna-
tant was fractionated stepwise by the addition of
(NH4)2SO4, and the fraction obtained between 40% and
60% saturation was collected by centrifugation. The pellet
was dissolved in 30 ml of 50 mM Tris–HCl buffer (pH
8.0) containing 1 mM 2-mercaptoethanol and 1 mM dith-
iothreithol (buffer A) and the crude enzyme solution was
separated from (NH4)2SO4 by passing through a Sephadex
G-25 column (3 · 40 cm) equilibrated with buffer A. The
desalted proteins were applied to a DEAE–Toyopearl col-
umn (2 · 20 cm) equilibrated with buffer A. The enzymes
were eluted with 200 ml of buffer A containing a 0–0.5 M
linear gradient of NaCl to give an enone reductase fraction,
which catalyzed the reduction of the C–C double bond of
pulegone (1a). The reductase fraction was further applied
to a Red–Toyopearl column (1 · 10 cm) equilibrated with
buffer A. After non-adsorbed proteins were eluted,
adsorbed proteins were eluted with buffer A containing a
0–1.0 M linear gradient of NaCl to yield pulegone
reductase.
2.2. Substrates
25
(R)-Pulegone (1a) {>99% pure on GLC, ½aꢁD þ 22:3
25
(neat); lit. [13]: ½aꢁD 25þ 22:4 (neat)}, (S)-pulegone (1b)
{>99% on GLC, ½aꢁD ꢀ 22:0 (neat)}, (S)-carvone (2a)
25
25
{99% on GLC, ½aꢁD ꢀ 60:1 (neat); lit. [14]: ½aꢁD ꢀ 59:7
25
(neat)}, (R)-carvone (2b) {>99% on GLC, ½aꢁD þ 57:1
(neat)}, (1S,5S)-verbenone (3a) {99% on GLC,
25
25
½aꢁD ꢀ 209:3 (neat); lit. [15]: ½aꢁD ꢀ 208 (neat)}, and
25
(1R,5R)-verbenone (3b) {99% on GLC, ½aꢁD þ 210:5 (neat)}
were purchased from Sigma–Aldrich. Oxalacetic acid (4) was
obtained from Wako Pure Chemical Industries. (2S,4S)-
Carveol (5) (99% pure on GLC) was prepared from (S)-carv-
one (2a) by NaBH4 reduction [19] (Fig. 1).
The purified reductase fraction was separated by SDS–
PAGE (12.5% gel); this showed two bands, one at
36.3 kDa (NtRed-1) and one at 36.8 kDa (NtRed-2). These
bands were excised from the SDS–PAGE gel, and each gel
2.3. Purification of pulegone reductase from N. tabacum cells
Native NtRed-1 was purified according to the procedure
described previously [13]. All operations were performed at

A. Matsushima et al. / Bioorganic Chemistry 36 (2008) 23–28
25
piece was subjected to digestion with trypsin directly to give a
2
1
crude peptide fraction. The peptide fraction was subjected to
preparative HPLC on a 3.5-lm C18 column (Waters;
1.0 · 150 mm). The resulting peptide fragments were
sequenced, and the amino acid sequences were identified as
(kDa)
97
66
Lys-Ile-Glu-Gly-X-Tyr-Val-Glu-X-Phe-Ala-Pro-Gly
for
NtRed-1 and Val-Leu-Val-Val-Ala-Asn-Pro-Ala-Asn-Thr-
Asn-Ala for NtRed-2. The obtained amino acid sequences
were analyzed by the NCBI ‘blastp’ program. Furthermore,
the crude peptide fractions were subjected to MALDI-TOF
MS analysis. The peptide fragments were identified by anal-
ysis with the peptide MS finger-print method using a soft-
ware MASCOT (http://www.matrixscience.com).
45
30
20
2.4. Cloning of the NtRed-1 cDNA for expression vector
Fig. 2. Expression and purification of recombinant NtRed-1. Lane 1,
crude soluble fraction; lane 2, purified recombinant NtRed-1.
Total cellular RNA was purified from cultured cells of N.
tabacum using ISOGEN (Nippon Gene Co.). Single-
stranded cDNA synthesis of the purified RNA was then
performed using oligo(dT)20-M13M4 adapter primer. Two
oligonucleotides, NtRed-1-1 (50 GGGATCCATGGCAGAA
GAAGTGAGCAAC 30 +31 to +55) and NtRed-1–2 (50
CACTCGAGACATTCATTCACGCGAAAC 30 +1048
to +1067), which were designed from the nucleotide
sequence of allyl-ADH (Accession No. AB036735), were
used as primers for polymerase chain reaction (PCR) ampli-
fication to produce NtRed-1 cDNA from single-stranded
cDNA. Both primers contain BamHI and XhoI restriction
sequences. The amplification involved 30 cycles of 94 ꢁC
for 1 min for denaturation, 68 ꢁC for 1 min for annealing,
and 72 ꢁC for 1 min for synthesis. The final PCR product
was 1051 bp, and this was ligated to the pPCR-Script
SK(ꢀ) vector (Stratagene), which was inserted into E. coli
DH5a competent cells. Double-stranded DNA sequencing
by the dideoxynucleotide chain termination was performed
using the DYEnamic ET Terminator Cycle Sequencing Kit
(Amersham Biosciences) and an ABI 373 DNA sequencer
(Applied Biosystems). The cDNA clone of NtRed-1 was then
digested with BamHI (TOYOBO) and XhoI (TOYOBO),
and ligated to the pGEX-6P-1 expression vector (Amersham
Bioscience) to construct pGEX-6P-1(NtRed-1). Finally,
pGEX-6P-1(NtRed-1) was transformed into E. coli BL21
competent cells. The DNA sequence of cloned NtRed-1
cDNA was also confirmed by DNA sequencing.
protease to release the recombinant NtRed-1 (rNtRed-1),
as shown in Fig. 2. The molecular weight of purified
rNtRed-1 was determined by SDS–PAGE and MALDI-
TOF MS. The molecular mass of the rNtRed-1 in a state
of non-denaturation was estimated by gel filtration chro-
matography on a Sephadex G-100 column using aldolase,
bovine serum albumin, ovalubumin and ribonuclease as
marker proteins.
2.6. Cloning and expression of recombinant NtRed-2 in
E. coli
All the procedures used for the cloning and expression of
recombinant NtRed-2 (r NtRed-2) in E. coli were similar to
those for the cloning and expression of rNtRed-1 described
above, except for the PCR conditions. Two oligonucleotides,
MDHF-1+BHI (50 GGATCCATGGCTAAAGATCCA
GTTCGCGTT 30 +55 to +78) and MDHR-1+XhoI (50
CTCGAGTCACATACACTCCCCATGAGTTGA 30 +1159
to +1178), which were designed from the nucleotide
sequence of malate dehydrogenase (Accession No.
CAC12826), were used as PCR primers to generate NtMDH
cDNA from single-stranded cDNA. Both primers contained
BamHI and XhoI restriction sequences. PCR amplification
involved 30 cycles of 94 ꢁC for 1 min for denaturation,
60 ꢁC for 1 min for annealing, and 72 ꢁC for 1 min for syn-
thesis. The final PCR product was 1136 bp. The DNA
sequence of cloned NtRed-2 cDNA was also confirmed by
DNA sequencing. After DNA sequencing, NtRed-2 was
ligated tothe pGEX-6P-1 expression vector (Amersham Bio-
science) to construct pGEX-6P-1(NtRed-2). rNtRed-2 was
expressed in the E. coli BL21 strain according to the proce-
dure described above. The expressed rNtRed-2 was also
purified using glutathione Sepharose 4B (Pharmacia
Biotech) affinity-column chromatography and digested by
PreScission proteases to release the rNtRed-2 from the
GST-fusion protein. The molecular weight of purified
2.5. Expression of recombinant NtRed-1 in E. coli
The expression and purification of NtRed-1 were per-
formed according to the manufacturer’s instructions. The
E. coli cells transformed with pGEX-6P-1(NtRed-1) in
50 ml of LB medium were cultivated at 30 ꢁC, and
0.1 mM of isopropyl-b-D-thiogalactopyranoside was then
added to the cultures and incubated at 16 ꢁC for 16 h. After
centrifugation, the E. coli pellet was sonicated. The gluta-
thione S-transferase (GST) fusion proteins ware purified
using glutathione Sepharose 4B (Pharmacia Biotech) affin-
ity-column chromatography and digested by PreScission

26
A. Matsushima et al. / Bioorganic Chemistry 36 (2008) 23–28
rNtRed-2 was confirmed by SDS–PAGE and MALDI-TOF
MS analyses.
The deduced amino acid sequence of NtRed-1 shared
high identity with 2-alkenal dehydrogenase from Arabidop-
sis thaliana (AtDBR1; Accession No. NP-197199), zeta-
crystallin homologue from A. thaliana (Accession No.
CAA89262), (+)-pulegone reductase from M. piperita
(PulR; Accession No. AAQ75423) and phenylpropenal
double-bond reductase from Pinus taeda (PtPPDBR;
Accession No. ABG91753) (Fig. 3). All of these enzymes
are known to catalyze the reduction of C–C double bond
of a,b-unsaturated ketones or aldehydes [16–18,20]. The
AXXGXXG motif (Fig. 3), which is known to participate
in binding of the phosphate group of NAD(P)+ or
NAD(P)H [21], is conserved in all these reductases. The
GXXS motif (Fig. 3), which stabilize both adenine and nic-
otinamide moieties of the cofactor in NADPH-bound form
of quinine oxidoreductase [22], is also conserved in all these
reductases. Crystallographic analyses of AtDBR1 indicate
that the deduced amino acid sequence of NtRed-1 may
comprise two domains: a substrate-binding domain (resi-
dues 1–135 and 304–343) and a nucleotide-binding domain
(residues 136–303) [18]. The amino acid residue that is
expected to stabilize the enol form of the transition state
was also conserved at Tyr-258 of NtRed-1 (indicated by
an asterisk in Fig. 3).
2.7. Enzyme activity assay
The standard assay mixture (2 ml) was composed of the
recombinant enzyme preparation (50 lg), 200 lmol
NADPH, 100 lmol substrate, 1 mM dithiothreitol, 1 mM
mercaptoethanol, and 0.2 ml 1% Triton X-100 in 50 mM
Na-phosphate buffer (pH 7.0). The mixture was incubated
at 35 ꢁC for 3 h and then extracted with ether (3 ml · 3).
The ether layer was dried over Na2SO4 and the solvent
was removed by evaporation. The concentrated ether layer
was subjected to GC analyses and the product yields were
determined by the results of the GC analyses. The final
products were identified by GC, GC–MS, and/or 1H
NMR spectrometry.
To determine the kinetic parameters for the recombinant
reductase, the assay mixture (2 ml) was composed of the
enzyme preparation (10 lg), 3 mM NADPH, 1 mM dithio-
threitol, 0.2 ml of 1% Triton X-100, 0.1–3.0 mM of the sub-
strate in 50 mM Na-phosphate buffer (pH 7.0). The mixture
was incubated at 35 ꢁC and then extracted with ether
(3 ml · 3). The ether layer was subjected to GC analyses.
3. Results and discussion
3.2. Expression of the recombinant reductases in E. coli
3.1. Purification and structure determination of reductases
For cloning of NtRed-1, the primers for amplification of
NtRed-1 cDNA were designed from the nucleotide sequence
of allyl-ADH (Accession No. AB036735). The cloned nucle-
otide sequence of NtRed-1 has 100% identity with allyl-
ADH [19] and 78% identity with pulegone reductase from
M. piperita (Accession No. AY300163) [16]. The MALDI-
TOF MS spectra showed that molecular mass of recombi-
nant NtRed-1 was 38482 10 Da (theoretical value:
38486.6 Da). The molecular mass in a state of non-denatur-
ation was estimated to be 74 kDa by gel filtration chroma-
tography. These may indicate that the rNtRed-1 is a
dimeric structure of 38 kDa subunits in a state of active
enzyme.
A soluble cell-free extract was obtained from cultured
cells of N. tabacum. The crude extract was subjected to
chromatography on a DEAE–Toyopearl column to give
a crude enzyme fraction that was involved in the reduction
of the C–C double bond of pulegone [12]. Further purifica-
tion of the pulegone reductase on a Red–Toyopearl column
resulted in about 160-fold increased reductase activity.
However, SDS–PAGE of the purified reductase revealed
two protein bands corresponding to molecular masses of
36.3 (NtRed-1) and 36.8 kDa (NtRed-2).
The partial amino acid sequences of two protein bands
were found to be Lys-Ile-Glu-Gly-X-Tyr-Val-Glu-X-Phe-
Ala-Pro-Gly for NtRed-1 and Val-Leu-Val-Val-Ala-Asn-
Pro-Ala-Asn-Thr-Asn-Ala for NtRed-2. A comparison of
the peptide sequence against a protein database using the
NCBI ‘blastp’ program showed a significant homology
with allyl-ADH from N. tabacum (Accession No.
BAA89423) [19] for NtRed-1 and malate dehydrogenase
from N. tabacum (NtMDH; Accession No. CAC12826)
for NtRed-2. The identity of NtRed-1 to allyl-ADH was
confirmed by the peptide mass finger-print method in the
mass spectroscopic analysis of NtRed-1. However, the
amino acid sequence of allyl-ADH does not contain the
previously reported partial sequence for the p74 reductase
catalyzing the hydrogenation of exocyclic C–C double
bond of enones [13]. This may indicate that there are two
different enzymes participating to the reduction of exocy-
clic C–C double bond of enones in N. tabacum.
On the other hand, for cloning of NtRed-2, the primers
used for amplification of NtRed-2 cDNA by PCR were
designed from the nucleotide sequence of NtRed-2 (Acces-
sion No. CAC12826). The cloned nucleotide sequence of
NtRed-2 shows 100% homology with malate dehydroge-
nase, as shown by the peptide mass finger-print mass spec-
troscopy method. The MALDI-TOF MS spectrum showed
that molecular mass of recombinant NtRed-2 was
35812 10 Da (theoretical value: 35805.9 Da).
3.3. Reduction of enones with the recombinant reductases
To determine the enzymatic activity of the recombinant
proteins rNtRed-1 and rNtRed-2, enzymatic reactions were
investigated with the following substrates: (R)-pulegone
(1a), (S)-pulegone (1b), (S)-carvone (2a), (R)-carvone
(2b), (1S,5S)-verbenone (3a), and (1R,5R)-verbenone (3b),

A. Matsushima et al. / Bioorganic Chemistry 36 (2008) 23–28
27
Fig. 3. Alignment of amino acid sequences deduced from the cDNA encoding pulegone reductase from N. tabacum (NtRed-1) and other reductases. The
amino acid residue depicted indicated by an asterisk ( ) functions as a general acid/base for hydride transfer. Identical and similar amino acid residues are
*
shown in black and gray, respectively. AtDBR1, 2-alkenal dehydrogenase from A. thaliana (Accession No. NP-197199); ZETA, zeta-crystallin homologue
from A. thaliana (Accession No. CAA89262); NtADH, allyl-alcohol dehydrogenase from N. tabacum (Accession No. BAA89423); PulR, (+)-pulegone
reductase from M. piperita (Accession No. AAQ75423); PtPPDBR, phenylpropenal double-bond reductase from P. taeda (Accession No. ABG91753).
Table 1
oxalacetic acid (4) and (2S,4S)-carveol (5). It was found
Substrate specificity in the reduction of enones with the recombinant
NtRed-1
that rNtRed-1 catalyzed a reduction of pulegones (1a and
1b) with an exocyclic C–C double bond to give the corre-
Entry
(reaction
time, h)
Substrates
Products
Conversion
(%)
sponding ketones, isomenthone (6) and menthone (7); how-
ever, there was no reduction of the enones, 2a, 2b, 3a and
3b, with an endocyclic C–C double bond, as shown in
Table 1. The kinetic parameters, Km and Kcat, in the reduc-
tion of pulegone with rNtRed-1 were summarized in Table
2. (R)-pulegone (1a) was a preferred substrate over that of
its (S)-enantiomer (1b). However, the substrate specificity
of rNtRed-1 for (R)-pulegone (1a) (Km 1.4 mM) was quite
low, as compared with that of previously reported native
reductase (Km 25 lM) [13].
By contrast, rNtRed-2 catalyzed the reduction of the
carbonyl group of oxalacetic acid (4), but no other sub-
strates, especially pulegone, were reduced. This may show
that malate dehydrogenase did not participate with the
reduction of enones, though the malate dehydrogenase
coincidently co-purified with the enone reductase.
1 (3)
(R)-Pulegone (1a)
(R)-Pulegone (1a)
(S)-Pulegone (1b)
(S)-Pulegone (1b)
(1R,4R)-Isomenthone (6a) 4.4
(1R,4S)-Menthone (7b) 6.8
(1R,4R)-Isomenthone (6a) 14.3
(1R,4S)-Menthone (7b) 15.7
(1S,4S)-Isomenthone (6b) 0.3
(1S,4R)-Menthone (7a) 0.5
(1S,4S)-Isomenthone (6b) 1.6
2 (12)
3 (3)
4 (12)
(1S,4R)-Menthone (7a)
—
—
2.1
5 (12)
6 (12)
7 (12)
8 (12)
9 (12)
(R)-Carvone (2a)
(S)-Carvone (2b)
N.d.a
N.d.
N.d.
N.d.
N.d.
N.d.
(1S,5S)-Verbenone (3a) —
(1R,5R)-Verbenone (3b) —
Oxalacetic acid (4)
—
—
10 (12) (2S,4S)-Carveol (5)
a
N.d. denotes not detected.
These results show that the enzyme involved in the
reduction of the C–C double bond of enones is NtRed-1.
However, recombinant NtRed-1 did not catalyze a dehy-
drogenation of (2S,4S)-carveol (5). This indicates that the
recombinant NtRed-1 lacked the catalytic function as
allyl-alcohol dehydrogenase [19]; although the recombinant
NtRed-1 was designed from the nucleotide sequence of
allyl-ADH (Accession No. AB036735).
Table 2
Kinetic parameters for the recombinant NtRed-1
Substrates
Km (mM)
Kcat (sꢀ1
)
Kcat/Km (mMꢀ1 sꢀ1
)
(R)-Pulegone (1a)
(S)-Pulegone (1b)
1.4
8.3
3.3
2.8
2.4
0.34

28
A. Matsushima et al. / Bioorganic Chemistry 36 (2008) 23–28
[6] A. Kergomard, M.F. Renard, H. Vashambre, D. Courtois, V.
In the reduction of enones with rNtRed-1, enones with
Petiard, Phytochemistry 27 (1988) 407–409.
[7] M. Kataoka, A. Kotaka, A. Hasegawa, M. Wada, A. Yoshizumi, S.
Nakamori, S. Shimizu, Biosci. Biotechnol. Biochem. 66 (2002) 2651–
2657.
[8] K. Matsumoto, Y. Kawabata, J. Takahashi, Y. Fujita, M. Hatanaka,
Chem. Lett. (1998) 283–284.
[9] P. Wanner, R. Tressl, Eur. J. Biochem. 255 (1998) 271–278.
[10] M.A. Swiderska, J.D. Stewart, J. Mol. Catal. B: Enzym. 42 (2006) 52–
54.
[11] A. Muller, B. Hauer, B. Rosche, J. Mol. Catal. B: Enzym. 38 (2006)
126–130.
the exocyclic C–C double bond were suitable substrates
and enones with the endocyclic C–C double bond were
not. However, the stereospecificity of hydrogenation was
lost with rNtRed-1 reduction, although the reduction of
(R)-pulegone (1a) with native enzyme was highly stereospe-
cific to give (1R,4R)-isomenthone (6a). The lack of stereo-
specificity in rNtRed-1 might mean that there are two
different enzymes participating to the hydrogenation of
exocyclic C–C double bond of enones in N. tabacum, or
this is caused by a lack of cofactors in the reaction with
rNtRed-1 or to changes in its quaternary structure during
the folding process of the recombinant protein.
[12] T. Hirata, K. Shimoda, T. Gondai, Chem. Lett. (2000) 850–
851.
[13] K. Shimoda, S. Izumi, T. Hirata, Bull. Chem. Soc. Jpn. 75 (2002) 813–
816.
Youn et al. [18] reported that the substrate versatility of
2-alkenal dehydrogenase (AtDBR1) from A. thaliana,
which is closely similar to NtRed-1, was fairly limited.
The substrate selectivity of enone reductases is due to var-
iability in the amino acid sequence of the substrate-binding
domain. Although the amino acid sequence homologies of
the nucleotide-binding domains of these proteins (Fig. 3)
are high (59–80%), the substrate-binding domains are var-
iable (residue 1–135, 32–58%; residue 136–303, 32–72%).
This variability may explain the substrate selectivity of
these reductases. Further investigations are necessary for
a complete understanding of the enone reductases.
[14] T. Hirata, Y.X. Tang, K. Okano, T. Suga, Phytochemistry 28 (1989)
3331–3333.
[15] K. Shimoda, D.I. Ito, S. Izumi, T. Hirata, J. Chem. Soc., Perkin
Trans. 1 (1996) 355–358.
[16] K.L. Ringer, M.E. McConkey, E.M. Davis, G.W. Rushing, R.
Croteau, Arch. Biochem. Biophys. 418 (2003) 80–92.
[17] H. Kasahara, Y. Jiao, D.L. Bedgar, S.-J. Kim, A.M. Pattern,
Z.-Q. Xia, L.B. Davin, N.G. Lewis, Phytochemistry 67 (2006)
1765–1780.
[18] B. Youn, S.-J. Kim, S.G.A. Moinuddin, C. Lee, D.L. Bedgar, A.R.
Harper, L.B. Davin, N.G. Lewis, C. Kang, J. Biol. Chem. 281 (2006)
40076–40088.
[19] T. Hirata, Y. Tamura, N. Yokobatake, K. Shimoda, T. Ashida,
Phytochemistry 55 (2000) 297–303.
[20] E. Babichuk, S. Kushnir, E. Belles-Boix, M.V. Montagu, D. Inze, J.
Biol. Chem. 270 (1995) 26224–26231.
[21] P.J.B. Pereira, S. Macedo-Ribeiro, A. Parrage, R. Perez-Luque, O.
Cunningham, K. Darcy, T.J. Mantle, M. Coll, Nat. Struct. Biol. 8
(2001) 215–220.
[22] I. Levin, R. Schwarzenbacher, D. McMullan, P. Abdubek, E.
Ambing, T. Biorac, J. Cambell, J.M. Canaves, H.-J. Chiu, X. Dai,
A.M. Deacon, M. DiDonato, M.-A. Elsliger, A. Godzik, C. Grittini,
S.K. Grzechnik, E. Hampton, L. Jaroszewski, C. Karlak, H.E. Klock,
E. Koesema, A. Kreusch, P. Kuhn, S.A. Lesley, T.M. McPhillips,
M.D. Miller, A. Morse, K. Moy, J. Ouyang, R. Page, K. Quijano, R.
Reyes, A. Robb, E. Sims, G. Spraggon, R.C. Stevens, H. van den
Bedem, J. Velasquez, J. Vincent, F. von Delft, X. Wang, B. West, G.
Wolf, Q. Xu, K.O. Hodgson, J. Wooley, I.A. Wilson, Proteins 56
(2004) 629–633.
References
[1] C. Wong, G.M. Whitesides, Enzymes in Synthetic Organic Chemistry,
Pergamon, Oxford, 1994.
[2] J.M. Brown, in: E.N. Jacobsen, A. Pfaltz, H. Yamamoto (Eds.),
Comprehensive Asymmetric Catalysis, vol. I, Springer-Verlag, New
York, 1999.
[3] A. Kergomard, M.F. Renard, H. Veshambre, J. Org. Chem. 47 (1982)
792–798.
[4] T. Hirata, H. Hamada, T. Aoki, T. Suga, Phytochemistry 21 (1982)
2209–2212.
[5] T. Suga, H. Hirata, H. Hamada, S. Murakami, Phytochemistry 27
(1988) 1041–1044.