New biocatalytic route for the production of enantioenriched β-alanine derivatives starting from 5- and 6-monosubstituted dihydrouracils

Article abstract of DOI:10.1016/j.procbio.2012.07.026

Taking advantage of the catalytic promiscuity of pyrimidine-catabolism enzymes (dihydropyrimidinase (E.C. 3.5.2.2), N-carbamoyl-β-alanine amidohydrolase (E.C. 3.5.1.6)), the production of different β-alanine derivatives starting from 5- and 6-monosubstituted dihydrouracils has been evaluated using a mimesis approach. In this work, the S-enantioselective character of dihydropyrimidinase from Sinorizhobium meliloti toward 6-monosubstituted dihydrouracil derivatives has been shown. An inverted R-/S-enantioselectivity of N-carbamoyl-β-alanine amidohydrolase from Agrobacterium tumefaciens toward two different N-carbamoyl-β-amino acids has been proved. Our results have shown for the first time that this mimetic tandem constitutes an interesting biotechnological tool for the preparation of different β-alanine derivatives in an environmentally friendly way, allowing the production of enantioenriched (R)-α-phenyl-β-alanine (e.e. > 95%) and (R)-α-methyl-β-alanine (e.e. > 90%).

Full text of DOI:10.1016/j.procbio.2012.07.026

Process Biochemistry 47 (2012) 2090–2096
Contents lists available at SciVerse ScienceDirect
Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio
New biocatalytic route for the production of enantioenriched ␤-alanine
derivatives starting from 5- and 6-monosubstituted dihydrouracils
Ana Isabel Martínez-Gómeza,b, Josefa María Clemente-Jiméneza,b, Felipe Rodríguez-Vicoa,b
,
Liisa T. Kanervac, Xiang-Guo Lic, Francisco Javier Las Heras-Vázqueza,b, Sergio Martínez-Rodrígueza,b,∗
a Departamento de Química Física, Bioquímica y Química Inorgánica, Universidad de Almería, Campus de Excelencia Internacional Agroalimentario, ceiA3, E-04120 Almería, Spain
b Centro de Investigación en Biotecnología Agroalimentaria, BITAL, Almería, Spain
c Institute of Biomedicine, Department of Pharmacology, Drug Development and Therapeutics/Laboratory of Synthetic Drug Chemistry, University of Turku, FIN-20014, Finland
a r t i c l e i n f o
a b s t r a c t
Article history:
Taking advantage of the catalytic promiscuity of pyrimidine-catabolism enzymes (dihydropyrimidi-
nase (E.C. 3.5.2.2), N-carbamoyl-␤-alanine amidohydrolase (E.C. 3.5.1.6)), the production of different
␤-alanine derivatives starting from 5- and 6-monosubstituted dihydrouracils has been evaluated
using a mimesis approach. In this work, the S-enantioselective character of dihydropyrimidinase
from Sinorizhobium meliloti toward 6-monosubstituted dihydrouracil derivatives has been shown. An
inverted R-/S-enantioselectivity of N-carbamoyl-␤-alanine amidohydrolase from Agrobacterium tume-
faciens toward two different N-carbamoyl-␤-amino acids has been proved. Our results have shown for
the first time that this mimetic tandem constitutes an interesting biotechnological tool for the prepa-
ration of different ␤-alanine derivatives in an environmentally friendly way, allowing the production of
enantioenriched (R)-␣-phenyl-␤-alanine (e.e. > 95%) and (R)-␣-methyl-␤-alanine (e.e. > 90%).
© 2012 Elsevier Ltd. All rights reserved.
Received 25 April 2012
Received in revised form 9 July 2012
Accepted 20 July 2012
Available online 27 July 2012
Keywords:
Hydantoinase
Dihydropyrimidinase
Carbamoylase
Ureidopropionase
␤-Amino acid
Biocatalysis
Kinetic resolution
Enzymatic preparation
1. Introduction
alternative environment-friendly approach for plant protection
which would contribute to the development of sustainable agricul-
␤-Amino acids have gained attention over the last decade
partly due to their involvement in several natural products such
as taxol, dolastatins, jasplakinolide, theopalauammide, and many
others [1 and references therein]. ␤-Amino acids are key structural
elements of peptides, peptidomimetics and many other physiolog-
ically active compounds [2]. Furthermore, a number of ␤-amino
acids show interesting pharmacological properties in their free
form [3], or as their cyclized (␤-lactam) derivates [4]. ␤-Alanine
supplementation is becoming popular in the sports field, as it has
been shown to increase muscle buffer capacity in humans, with
the potential to elicit enhanced physical performance during high-
intensity exercise, and also to delay the onset of neuromuscular
fatigue [5,6]. The racemic form of ␤-homoalanine (3-aminobutyric
acid, 3-ABA) protects numerous plants against various pathogens
[7 and references therein], by a natural defense machinery known
as “induced resistance”. This strategy has been proposed as an
ture [8]. ␣-Methyl-␤-alanine (3-AiBA) has recently been described
to reduce body weight in mice, suggesting it as an attractive
pharmacological strategy in order to prevent (and/or treat) obesity
in some individuals [9,10].
Chemical synthesis of ␤-amino acids has attracted the atten-
tion of many scientists over the last decade, as is evidenced by the
number of reviews on asymmetric synthesis strategies found in
the literature [1–3,11–17]. Several successful enzymatic strategies
have also been investigated [2,3,18–20]. However, as stated previ-
ously, the resolution of ␤2-amino acids have not been studied to
the same extent as their ␤3- and ␤2,3-counterparts,1 possibly due
to the more laborious synthesis of the former compounds [18].
␤-Alanine and 3-AiBA are produced naturally through the
reductive catabolism of pyrimidines [21]. Among the enzymes
involved in this metabolic pathway, dihydropyrimidinase (hydan-
toinase, E.C. 3.5.2.2) and N-carbamoyl-␤-alanine amidohydrolase
(␤-alanine synthase, ureidopropionase, E.C. 3.5.1.6) are
∗
Corresponding author at: Departamento de Química Física, Bioquímica
y
1
Química Inorgánica, Edificio CITE I, Universidad de Almería, Carretera de Sacramento
s/n, E-04120 Almería, Spain.
Substituted ␤-amino acids are denominated ␤2, ␤3, and ␤2,3, depending on the
position of the side chain(s) (R) at the 3-aminopropionic acid core [29]. For more
information, see Table 1, SD.
E-mail address: srodrig@ual.es (S. Martínez-Rodríguez).
1359-5113/$ – see front matter © 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.procbio.2012.07.026

A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
2.2. Plasmids and microbes
2091
responsible for the breakdown of the cyclic amide ring to
the corresponding ␤-amino acid, CO2 and NH3. Although
dihydropyrimidinases/hydantoinases2 are mainly known/studied
in the context of the “hydantoinase process” [22–31], enzymes
hydrolyzing different 5- and 6-monosubstituted dihydrouracils
have been reported [32–34]. This extended substrate promiscuity
allowed Liljeblad and Kanerva to hypothesize that hydantoinases
might “open up a new kinetic resolution route to enantiopure
␤-amino acids” [18]. This inference has been confirmed dur-
ing the development of this manuscript by two independent
groups [35,36], proving that different isolated and commercially
available hydantoinases hydrolyze enantioselectively several
6-monosubstituted dihydrouracils, and demonstrating their
potential for the biosynthesis of enantioenriched ␤3-amino acids
(Fig. 1, SD). Our group also proved that the ␤-alanine synthase
from Agrobacterium tumefaciens C58 (At␤car) is able to hydrolyze
compounds other than those that are naturally degraded [37,38],
making it the only ␤-alanine synthase to date that is known to do
so. This enzyme proved to be enantiospecific for N-carbamoyl-l-
␣-amino acid hydrolysis [37]. On the other hand, it proved to be
enantioselective toward N-carbamoyl-3-AiBA and N-carbamoyl-
GABOB (␤- and ␥-amino acid precursors, respectively [37]). Taking
advantage of the substrate promiscuity of dihydropyrimidinase
from Sinorizhobium meliloti (SmelDhp) and At␤car [33,37,38], we
have evaluated the production of different ␤-alanine derivatives
starting from dihydrouracil derivatives using a mimesis approach
(Fig. 1, SD). According to the literature, at least some dihydrouracils
derivatives can be synthesized from cheap materials such as urea
and the corresponding ␣,␤-unsaturated acid (acrylic, methacrylic
and crotonic acids [41]), and thus, our results provide additional
evidence that this enzymatic tandem might become an interesting
biotechnological tool for the preparation of different ␤2-amino
acids in an environment-friendly way.
Plasmids pSER38 and pAMG4 containing dihydropyrimidinase gene from S.
meliloti CECT4114 (SmelDhp; 1455 bp; Genbank accession no. DQ779921) and
N-carbamoyl-␤-alanine amidohydrolase gene from A. tumefaciens C58 (Atˇcar;
1248 bp; Genbank accession no. EF507843;), respectively, were used as DNA source
for PCR amplifications [38,46]. Plasmid pJOE4036.1 (based on the rhaBAD promoter
[47,48]) was used to reclone both genes. Escherichia coli DH5␣ (Stratagene, Agilent,
Barcelona, Spain) was used for the cloning of SmelDhp and Atˇcar genes, and E. coli
BL21 Gold (Stratagene, Agilent, Barcelona, Spain) were used to overexpress them.
Plasmids were purified with QIAprep spin Miniprep kit (Qiagen, Izasa, Barcelona,
Spain), from overnight cultures of E. coli grown in Luria-Bertani medium (LB) (1%
tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7.2) supplemented with 100 ␮g ml−1 of
ampicillin, incubated at 37 ◦C with shaking.
2.3. Cloning of Atˇcar and SmelDhp genes in pJOE4036.1
pAMG4 and pSER38 plasmids were used as templates for PCR ampli-
fication of Atˇcar and SmelDhp genes [38,46]. The primers used were
At␤car5 (GGAATTCCATATGAC-GGCGGGTAAAAACTTGACGGTC) and At␤car32
(TTAAGCTTTCAATGATGAT-GATGATGATGTTGCACGATCTCCGCAGTC) for the for-
mer, and SmelDhp52 (AAAAAAACATATGAGCACTGTCATCAAGGG) and SmelDhp32
(TTAAGCTTT-TAATGATGATGATGATGATGGACGCCGCTTGCGGGAATGCCGC) for the
latter. The PCR products and the vector pJOE4036.1 were digested with NdeI
and HindIII enzymes,4 gel-purified and ligated, to create the plasmids pAMG4rha
(containing Atˇcar gene) and pSER38rha (containing SmelDhp gen). Verification of
the sequence was carried out using the dye dideoxy nucleotide sequencing method
in an ABI 377 DNA Sequencer (Applied Biosystems).
2.4. Expression of the different genetic constructions
E. coli BL21 Gold harboring pAMG4rha and pSER38rha plasmids were grown
in LB medium supplemented with 100 ␮g ml−1 of ampicillin. A single colony was
transferred into 10 ml of LB medium with ampicillin at the above-mentioned con-
centration. This culture was incubated overnight at 37 ◦C with shaking. 1000 ml of
LB medium with the appropriate concentration of ampicillin was inoculated with
10 ml of the overnight culture. After 3–4 h of incubation at 37 ◦C with vigorous shak-
ing, the OD600 of the resulting culture was 0.3–0.5. For expression induction of the
Atˇcar and SmelDhp genes in pAMG4rha and pSER38rha, l-rhamnose was added to
a final concentration of 0.2% (w/v) and the culture was incubated at 32 ◦C overnight.
The cells were collected by centrifugation (Beckman JA2-21, 7000 g, 4 ◦C and 15 min)
and stored at −20 ◦C until use.
2. Materials and methods
2.5. Purification of Atˇcar and SmelDhp enzymes
2.1. General protocols and reagents
Procedures for the purification and preparation of the enzymes were the same
as those previously described using cobalt affinity chromatography [38,46]. An
additional gel filtration chromatography step was carried out using a Superdex
200 gel-filtration column (GE Healthcare, Madrid, Spain) in a BioLogic DuoFlow
fast-performance liquid chromatography (FPLC) system (Bio-Rad, Madrid, Spain)
to prevent any DNA or protein co-eluting with the protein of interest. The puri-
fied enzymes were concentrated using the vivaspin concentrators (Sartorius, Dicsa,
Almería, Spain), dialyzed against 0.1 M sodium phosphate buffer pH 8.0, and stored
at 4 ◦C until use. Protein concentrations were determined using the Lowry method.
Standard methods were used for the cloning and expression of the differ-
ent genes [42,43]. Restriction enzymes and T4 DNA ligase were purchased from
Roche Diagnostic S.L. (Barcelona, Spain), the primers for PCR from IDT (Biomol S.L.,
Sevilla, Spain) and the thermostable KAPA HiFi polymerase from Kapa Biosystems
(Cultek, Madrid, Spain). Talon metal-affinity resin was purchased from Clontech
Laboratories, Inc. (Biomol S.L., Sevilla, Spain).(R,S)-3-Aminobutyric acid3 (3-ABA),
(S)-3-ABA, 1,2,4-thiadiazinan-3-one-1,1-dioxide (SULDHU), taurine, (R,S)- and (S)-
3-amino-5-methylhexanoic acid, (R,S)- and (S)-3-amino-4-phenylbutyric acid and
(R)-3-amino-2-phenylpropionic acid ((R)-␣-phenyl-␤-alanine) were acquired from
Sigma–Aldrich Quimica (Madrid, Spain). ␤-Alanine, (R,S)-3-aminoisobutyric acid
(3-AiBA) and (R,S)-3-amino-3-phenylpropionic acid were purchased from Acros
(Scharlab, Barcelona, Spain). (R)-3-Amino-3-phenylpropionic acid was obtained
from Alfa Aesar (VWR, Barcelona, Spain). (R,S)-␣-Phenyl-␤-alanine was previously
obtained [38].
Dihydrouracil (DHU), the other monosubstituted dihydrouracils (5- and
6-methyl-dihydrouracil (METDHU), 6-phenyldihydrouracil (PHEDHU), 6-
benzyldihydrouracil (BzDHU), 6-isobutyldihydrouracil (iBUTDHU)), and the
corresponding N-carbamoyl-␤-amino acids used in this work were synthesized
using the same method used for ␣-amino acids described in the literature [44,45].
Briefly, the corresponding amino acids were refluxed in the presence of potassium
cyanate in water solution, resulting in the formation of N-carbamoyl-␤-amino acids.
The subsequent formation of monosubstituted dihydrouracils was accomplished
by refluxing the corresponding N-carbamoyl-␤-amino acids in dilute aqueous
HCl (0.3 M). All chemicals were analytical grade and were used without further
purification.
2.6. Bienzymatic system characterization
To analyze the effect of Ni2+ on enzymatic activity, samples of purified At␤car
and SmelDhp enzymes were incubated together in the presence of different concen-
trations of NiCl2 at 4 ◦C for several days. Standard enzymatic reaction was carried out
with (R,S)-5-METDHU as substrate (10 mM) in 100 mM sodium phosphate buffer (pH
8.0), at 30 ◦C in 1 ml reaction volume. Aliquots of 100 ␮l were taken and stopped by
addition of 900 ␮l of 1% H3PO4. After centrifuging, the resulting supernatants were
analyzed by high-performance liquid chromatography (HPLC). The HPLC system
(LC2000Plus HPLC System, Jasco, Madrid, Spain) equipped with a Luna C18 column
(4.6 × 250 mm; Phenomenex, Madrid, Spain) was used to determine the concentra-
tions of 5-METDHU, N-carbamoyl-3-AiBA, and 3-AiBA. The mobile phase used in the
analysis was 95% phosphoric acid (20 mM, pH 3.2) and 5% methanol, pumped at a
flow rate of 1 ml min−1. The UV detector was fixed at 200 nm. All reactions conducted
for the bienzymatic system characterization were carried out in triplicate.
Optimal temperature of the bienzymatic system was evaluated from 25 to
60 ◦C. Thermal stability was measured after 24 h of preincubation at tempera-
tures from 4 to 50 ◦C. A pH range of 6.0–9.0 was assayed (sodium phosphate
2
For ease of comprehension the present work does not distinguish between
dihydropyrimidinases and hydantoinases. For further knowledge on this topic, see
[39,40].
Due to the different nomenclature found in the literature for the ␤-amino acids
used in this work, a list of synonyms has been included in Supplementary data
(Table 1) for better understanding of the reader.
4
Although this plasmid directly allows insertion of any gene fused to a His-tag
3
by direct insertion in its NdeI-BamHI site, we could not use the latter enzyme as it
cut both Atˇcar and SmelDhp genes. Thus, we had to include a His-tag sequence in
the reverse PCR primers.

2092
A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
Table 1
HPLC measurement conditions for each of the compounds.
Substrate/intermediate/product
Mobile phasea
Flow (ml min−1
)
Reverse-phase HPLC separations
DHU/N-carb-␤-alanine/␤-alanine
SULDHU/N-carb-taurine/taurine
100% C
100% C
5% A:95% B
5% A:95% B
30% A:70% B
0.50
0.50
1.00
1.00
0.75
5-METDHU/N-carb-3-AiBA/3-AiBA
6-METDHU/N-carb-3-ABA/3-ABA
5-PHEDHU/N-carb-␣-phenyl-␤-alanine/␣-phenyl-␤-alanineb
Compound
Mobile phasea
Flow (ml min−1
)
Chiral HPLC separations
3-AiBAc
100% A
100% A
50% D:50% E
90% E:10% A
90% E:10% A
90% E:10% A
0.50
0.50
0.60
0.60
0.60
0.60
3-ABAc
␣-Phenyl-␤-alanine
6-PHEDHU
6-BzDHU
6-iBUTDHU
a
A, methanol; B, H3PO4 20 mM pH 3.2; C, NaH2PO4 50 mM pH 4.5; D, ethanol; E, H2O.
b
Although the order of elution for this kind of compounds is usually product < intermediate < substrate, for this amino acid and its derivatives it occurs as: prod-
uct < substrate < intermediate.
c
Assignment of the enantiomers is that reported previously [55].
and Tris/HCl buffers), at a concentration of 100 mM. Standard enzymatic reaction
was then carried out with the Ni-amended At␤car (1 ␮M) and SmelDhp (1 ␮M)
enzymes. The reaction progress was monitored by HPLC analysis as described
above.
standard reaction. The optimum activity was achieved with over
1 mM of cation and at least 24 h of incubation (Fig. 2, SD).
3.2. Enantioselectivity of Atˇcar and SmelDhp
Substrate specificity studies were performed with each different dihydrouracil
derivative dissolved in 100 mM sodium phosphate buffer (pH 8.0) together with
the purified enzymes (in triplicate). The enzyme ratio for each substrate was
calculated with Ni-amended At␤car and SmelDhp enzymes (concentrations rang-
ing from 1 to 1000 ␮M for the former and 1 to 10 ␮M for the latter, depending
The preference of At␤car for the R-enantiomer of N-carbamoyl-
3-AiBA was previously shown [37]. In this study, At␤car has
shown high enantioselectivity toward N-carbamoyl-(R)-␣-phenyl-
␤-alanine, where an enantiomeric excess (e.e.) of over 95% was
found for the production of (R)-␣-phenyl-␤-alanine (Fig. 1A).
The contrary was found toward the only N-carb-␤3-amino acid
derivative that At␤car was able to hydrolyze (N-carb-(R,S)-3-
ABA), where a preference toward the S-enantiomer could be
observed (Fig. 3, SD). Although the previous results with this
enzyme suggested that At␤car was R-enantioselective toward N-
carbamoylated-␤2-alanine derivatives, the S-enantiomer reacts
with the ␤3-alanine derivative.
on the substrate used). Reactions were carried out at 35 ◦
C and pH 8.0, and
stopped by addition of 1% H3PO4. The mobile phases used for each substrate and
its corresponding N-carbamoyl-␤-amino acid and ␤-amino acid are summarized
in Table 1. Compounds were detected with a UV detector at a wavelength of
200–210 nm.
Larger-scale reactions were carried out with (R,S)-5-METDHU at 0.1 and
1 M (10 ml reaction volume), using Ni-amended At␤car (10 and 100 ␮M)
and SmelDhp (10 and 100 ␮M) enzymes, at pH 8.0 and 35 ◦C. We also
considered the strategy known as “membrane-enclosed enzymatic cataly-
sis”, often called “tea-bags” [49,50]. For this approach, we used Spectra/Por®
Float-A-Lyzer® G2 devices (8–10 kD, 1 ml, Sigma–Aldrich Quimica, Madrid,
Spain).
The enantiopreference of SmelDhp toward different enan-
tiomers of 5- and 6-monosubstituted dihydrouracils has
not been previously studied. As chemical racemization of 5-
monosubstituted hydantoins is known to occur [51], we wanted to
know whether dihydrouacil derivatives have been studied in this
sense. Through literature revision, we only found a work related
with the racemization of dihydrouracil-derivatives [52]. In this
paper, the study on the interchange of protons in the carbon 5 (C5)
was proved, indicating that 5-monosubstituted dihydrouracils
also racemize spontaneously, as expected for an acidic proton at
the adjacent carbon to a carbonyl group. From the same work, it
also seemed clear that dihydroorotate (6-carboxy-dihydrouracil)
did not racemize. This has been further confirmed in this work: no
racemization was observed for (S)-6-BzDHU and (S)-6-IBDHU in
phosphate buffer pH 8.0 at 35◦ in 48 h. SmelDhp showed a marked
preference toward the S-enantiomer of 6-BzDHU, 6-iBUTDHU
(Fig. 1B) and 6-PHEDHU, with relative S/R rates of 7, 3 and 2,
respectively. On the other hand, this enzyme is R-specific for
5-monosubstituted hydantoins [33]. We could not determine the
enantioselectivity toward 5-METDHU, 6-METDHU and 5-PHEDHU
by chiral HPLC, as we were not able to separate the enantiomers
using different mobile phases. However, from the progression
curves of these compounds (see Fig. 4, SD), a preference toward
one of the enantiomers for 6-METDHU and 5-PHEDHU could be
inferred. Our results reaffirm the findings of O’Neill et al. [36]
and Engel et al. [35] during the development of this work: the
2.7. Enatioselectivity of Atˇcar and SmelDhp enzymes
Substrate specificity studies for At␤car and SmelDhp were performed in 100 mM
sodium phosphate buffer (pH 8.0) together with the Ni-amended enzymes (in trip-
licate, concentrations ranging from 0.5 to 20 ␮M, depending on the substrate used).
Reactions were carried out at 35 ◦C. The reaction was stopped by retrieval of 100 ␮l
aliquots and addition of the same volume of 1% H3PO4. 800 ␮l of the correspond-
ing mobile phase were added to each sample (retention times depended greatly
on the pH and the matrix effect). The mobile phases used for each compound are
summarized in Table 1. Compounds were detected with a UV detector at a wave-
length of 200–210 nm. To assess if spontaneous racemization of 6-monosubstituted
dihydrouracils occurs (S)-6-BzDHU and (S)-6-IBDHU (2 mM) were incubated in
phosphate buffer pH 8.0 at 35◦ for 48 h (1 ml). 100 ␮l aliquots were diluted with
100 ␮l of 1% H3PO4 and 800 ␮l of the corresponding mobile phase, and chromato-
graphically detected as stated above.
3. Results and discussion
3.1. Effect of nickel cation on the bienzymatic system
Previous works have demonstrated that At␤car and SmelDhp
are metalloenzymes [33,38]. The best cations for At␤car and
SmelDhp were Ni2+ and Zn2+, respectively. However, the lat-
ter inhibited At␤car activity [38]. As Ni2+ also greatly enhanced
SmelDhp activity [33], all experiments were conducted using this
cofactor. The bienzymatic system activity was tested at different
incubation times and different concentrations of NiCl2 using the

A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
2093
50000
(B)
(A)
40000
30000
20000
10000
0
40000
30000
20000
R-enantiomer
S-enantiomer
R-enantiomer
S-enantiomer
10000
0
10
15
20
25
30
35
16
18
20
22
24
Time (min)
Time (min)
1000
(C)
0
-1000
-2000
S-enantiomer
R-enantiomer
-3000
25
30
35
40
Time (min)
Fig. 1. Examples of the chiral separations carried out to asses the enantioselectivity of At␤car (A) and SmelDhp (B), and to determine the enantiomeric excess of 3-AiBA
produced using the bienzymatic system and (R,S)-5-METDHU as substrate (C). (A) Dotted line (R,S)-␣-phenyl-␤-alanine, solid line, reaction result using At␤car with racemic
(R,S)-carb-␣-phenyl-␤-alanine as substrate, showing appearance of (R)-␣-phenyl-␤-alanine. (B) Solid line (R,S)-6-iBUTDHU, dotted line, reaction course of SmelDhp using
(R,S)-6-iBUTDHU as substrate, showing faster consumption of the S-enantiomer. The inset represents the decreasing areas of both (R)- (᭹) and (S)-iBUTDHU (ꢀ) during
the reaction course, showing the S-stereoselectivity of SmelDhp toward this substrate. (C) Solid line, (R,S)-3-AiBA; dashed and dotted lines, reaction course of bienzymatic
system at the end of the reaction and at approximately 50% consumption of (R,S)-5-METDHU, respectively (this graph corresponds to the same experiment shown in Fig. 4B).
(R)-3-AiBA is preferentially produced at the beginning of the reaction [55].
commercially available hydantoinase from Vigna angularis and
several hydantoinases from bacterial sources are able to hydrolyze
enantioselectively several ␤3-amino acid derivatives.
3.4. Bienzymatic production of non-chiral and enantioenriched
ˇ-amino acids
The opposite enantioselectivity of both enzymes is in principle
a drawback for the application of a bienzymatic system. How-
ever, based on the substrate promiscuity of both enzymes and in
the reverse reaction known to occur for dihydropyrimidinase, we
decided to evaluate the possible application of the At␤car/SmelDhp
tandem for the production of different ␤-amino acids starting from
5- and 6-monosubstituted dihydrouracils, imitating the degrada-
tion of pyrimidines that occurs naturally in the metabolism [21].
Reactions were carried out with 10 mM of different substrates in
sodium phosphate buffer (pH 8.0) at 35 ◦C after preincubation of
the system with NiCl2 as described in materials and methods. Dif-
ferent concentrations of the enzymes were assayed based on (a) the
molar catalytic activity of both enzymes at the concentration used
in the reaction for the different substrates [33,37,38], and (b) using
an excess of At␤car, as it is the limiting step of the enantioenrich-
ment reaction. Using 1 ␮M of each enzyme, the natural substrates
DHU and 5-METDHU were totally converted into ␤-alanine and 3-
AiBA in 18 and 90 min, respectively (Fig. 3A and B). In this sense, an
e.e. > 90% of (R)-3-AiBA was monitored during the reaction course
until half of (R,S)-5-METDHU was consumed (Figs. 3B and 1C).
Total conversion of 6-METDHU into 3-ABA was accomplished in
3.3. Effect of pH and temperature
The bienzymatic system showed maximum activity in Tris and
phosphate buffers at pH 8.0 when it was examined in 100 mM
sodium phosphate buffer (pH 6.0–8.0) and 100 mM Tris–HCl buffer
(pH 8.0–9.0) (Fig. 2A). The optimum temperature for production of
3-AiBA was 45 ◦C (Fig. 2B), intermediate between the optimal tem-
peratures of the isolated enzymes [33,38]. Thermal stability of the
system was studied by preincubation of the system for 1 and 24 h
in 100 mM sodium phosphate buffer, pH 8.0, at different temper-
atures. Although the melting temperatures of both enzymes were
proved to be higher than 45 ◦C [37,53], the stability of the system
proved to be highly dependent on the incubation time (Fig. 2B).
Activity decreased drastically when the enzymes were incubated
at temperatures of over 35 ◦C for 24 h, and was lost completely at
over 45 ◦C (Fig. 2B). Thus, we can conclude that the results obtained
in this work are due to the prolonged incubation time, and more
specifically affect the second enzyme in the system. In view of the
above data, it would not be advisable to carry out reactions of over
24 h or over 35 ◦C.

2094
A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
120
100
80
60
40
20
0
450
(B)
400
(A)
350
300
250
200
150
100
50
0
5.5
6.0
6.5
7.0
7.5
pH
8.0
8.5
9.0
9.5
20
30
40
50
60
70
Temperature (ºC)
Fig. 2. (A) Optimal pH for 3-AiBA production using phosphate (ꢀ) and Tris (ꢁ) buffers. (B) Optimum temperature for 3-AiBA production (᭹), and remaining relative activity of
the bienzymatic system after 1-h (ꢀ) and 24-h (ꢂ) preincubation at 35 ◦C. The results are the means of three experiments, and the error bars indicate the standard deviations
of the means.
9.5 h, with an e.e. ≈ 50% for (S)-3-ABA before half consumption of
(R,S)-6-METDHU (2.5 ␮M SmelDhp and 100 ␮M At␤car, Fig. 3C).
Taurine production was not possible because SmelDhp was not
able to hydrolyze the substrate SULDHU in the conditions tested,
although At␤car was shown to hydrolyze the intermediate of the
reaction [36]. (R)-␣-phenyl-␤-alanine with a high enantiomeric
purity (e.e. > 95%) was obtained after 5 h of reaction, using 10 ␮M
of SmelDhp and 1 mM of At␤car (Fig. 3D). This occurs due to the
high enantioselectivity of At␤car toward the R-enantiomer of the
intermediate of the reaction (Fig. 1A). In comparative terms, the
120
120
(A)
100
(B)
100
80
60
40
20
0
80
60
40
20
0
0
20
40
60
80
100
120
0
2
4
6
8
10
12
14
16
18
20
22
Time (min)
Time (min)
120
100
80
60
40
20
0
120
100
80
60
40
20
0
(D)
(C)
0
5
10
15
20
25
0
100
200
300
400
500
60
Time (min)
Time (h)
Fig. 3. Profiles of ␤-alanine (A), 3-AiBA (B), 3-ABA (C) and ␣-phenyl-␤-alanine (D) production using the bienzymatic system. The symbols represent the substrate (᭹), the
intermediate (ꢀ) and the product (ꢂ) of the reaction. The squares (ꢀ) in (B), (C) and (D) represent the e.e. of the amino acid during the reaction. Reactions and measurements
were carried out in triplicate as described in Section 2.

A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
2095
120
100
80
60
40
20
0
120
(A)
(B)
100
80
60
40
20
0
0
10
20
30
40
50
60
70
80
90 100 110 120 130
0
100
200
300
400
Time (min)
Time (min)
Fig. 4. Profiles of conversion of 0.1 M (A) and 1 M (B) by 10 ␮M and 100 ␮M of each enzyme respectively (᭹, 5-METDHU; ꢀ, N-carb-3-AiBA; ꢂ, 3-AiBA). Reactions and
measurements were carried out in triplicate as described in Section 2.
conversion efficiency of the tandem for 6-METDHU and 5-PHEDHU
was three orders of magnitude lower than for the natural substrates
5-METDHU and DHU.
4. Conclusions
In brief, our results show that the mimetic tandem
dihydropyrimidinase/␤-carbamoylase is an interesting biotechno-
logical tool for the preparation of different ␤-alanine derivatives in
an environmentally friendly way. An analytical scale production of
enantiomerically enriched (R)-␣-phenyl-␤-alanine (e.e. > 95%) and
(R)-3-AiBA (e.e. > 90%) has been achieved. As the enzymes stand
high concentrations of substrate and product, they might show
high potential in preparative scale as well. On the other hand,
further studies should be carried out to improve the economy
of the system, as for example, in this work the substrates were
prepared from ␤-amino acids as to show the potential of the
enzymatic tandem. The necessity for new enzymes with different
substrate spectrum and enhanced enantioselectivity is mandatory
to increase the versatility of this bienzymatic system in the future.
Following our hypothesis on the use of a ␤-alanine synthase
for this approach [38], O’Neill et al. also tried to hydrolyze the
N-carbamoyl-␤-derivative produced by the hydantoinase of V.
angularis using a commercially available carbamoylase [36]. They
found that this was not possible. This may be explained by their
using a d-carbamoylase (E.C. 3.5.1.77) instead of a ␤-alanine syn-
thase (E.C. 3.5.1.6), which to the best of our knowledge has not been
yet reported to hydrolyze N-carbamoyl-␤-d-amino acids [40]. On
the other hand, our previous results showed that At␤car would
not be a good candidate for the hypothetical production of ␤3-
amino acids, as it was only able to hydrolyze the precursor of
3-ABA, but not carbamoyl derivatives of larger substituents [38].
Thus, enriched ␤3-amino acids such as 3-amino-3-phenylpropionic
acid, ␤-homoleucine and ␤-homophenylalanine could not be pro-
duced by the bienzymatic approach. On the other hand, enriched
(S)-␤3-amino acids could be produced using SmelDhp alone, with
subsequent treatment of the reaction intermediate with NaNO2, as
proposed by the groups of Turner and Syldatk [35,36] (Fig. 1, SD).
The behavior of any enzymatic system at high substrate and
product concentrations is of considerable interest, as its subse-
quent scale-up depends on several factors, such as whether high
concentrations of substrate/products inhibit the enzymatic reac-
tion. For this reason, we have analyzed the bienzymatic system for
3-AiBA production using 0.1 and 1 M (R,S)-5-METDHU in phosphate
buffer (pH 8.0) at 35 ◦C in a reaction volume of 10 ml. Starting from
0.1 M substrate, total conversion was achieved in 90 min (Fig. 4A),
similar to the time observed with in the small-scale experiment
(Fig. 3B). Using 1 M 5-METDHU (the substrate was not completely
dissolved), total conversion was achieved after 300 min (Fig. 4B).
The higher time found for 1 M 5-METDHU seems to be due to a com-
bination of the lower ratio of Ni2+ cation/enzyme in the reaction
(cation precipitates over 1 mM at pH 8.0) and the solubility process
of the non-dissolved substrate. The same effect observed in small-
scale reactions with (R,S)-5-METDHU occurred in this case, with
an e.e. > 90% of (R)-3-AiBA before half consumption of 5-METDHU
(data not shown). We also evaluated the use of the “tea-bag” strat-
egy [49,50], as it allows the reuse of any enzymatic system, thus
decreasing production costs. Under the conditions assayed, total
conversion was achieved after 5 days (Fig. 5, SD), meaning that it
proved less effective than the system with the free enzymes. The
evidence increasingly supports diffusional limitations, as has been
observed with other “tea-bag” systems [54].
Acknowledgments
This work was supported by the Spanish Ministry of Sci-
ence and Innovation and European Regional Development Fund
(ERDF) through projects BIO2007-67009 and BIO2011-27842, and
AIMG Grant BES-2008-003751 (FPI subprogram), the Andalusian
Regional Council of Innovation, Science and Technology through
projects CV7-02651, and TEP-4691 and the European Science
Foundation COST Action CM0701. S.M.R. was supported by the
Andalusian Government. The authors thank Andy Taylor for crit-
ical discussion of the manuscript and Pedro Madrid-Romero for
technical assistance.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/
j.procbio.2012.07.026.
References
[1] Juaristi E, López-Ruiz H. Recent advances in the enantioselective synthesis of
␤-amino acids. Curr Med Chem 1999;6:983–1004.
[2] Weiner B, Szyman´ ski W, Janssen DB, Minnaard AJ, Feringa BL. Recent advances
in the catalytic asymmetric synthesis of ␤-amino acids. Chem Soc Rev
2010;39:1656–91.
[3] Juaristi E, Soloshonok VA. Enantioselective synthesis of ␤-amino acids. 2nd ed.
Hoboken, NJ: John Wiley and Sons, Inc.; 2005.

2096
A.I. Martínez-Gómez et al. / Process Biochemistry 47 (2012) 2090–2096
[4] Magriotis PA. Recent progress in the enantioselective synthesis of beta-
lactams: development of the first catalytic approaches. Angew Chem Int Ed
2001;40:4377–9.
[5] Artioli GG, Gualano B, Smith A, Stout J, Lancha Jr AH. Role of beta-alanine sup-
plementation on muscle carnosine and exercise performance. Med Sci Sports
Exerc 2010;42:1162–73.
[6] Derave W, Everaert I, Beeckman S, Baguet A. Muscle carnosine metabolism and
beta-alanine supplementation in relation to exercise and training. Sports Med
2010;40:247–63.
[7] Cohen YR. ␤-Aminobutyric acid-induced resistance against plant pathogens.
Plant Dis 2002;86:448–57.
[32] Martínez-Rodríguez S, Martínez-Gómez AI, Pozo-Dengra J, Rodríguez-Vico F,
Clemente-Jiménez JM, Las Heras-Vázquez FJ. Abstr P-109. Abstr. International
symposium on environmental biocatalysis. European Federation of Biotechnol-
ogy Section on Applied Biocatalysis. Cordoba, Spain; 2006.
[33] Martínez-Rodríguez S, Martínez-Gómez AI, Clemente-Jiménez JM, Rodríguez-
Vico F, García-Ruíz JM, Las Heras-Vázquez FJ, et al. Structure of dihy-
dropyrimidinase from Sinorhizobium meliloti CECT4114: new features in an
amidohydrolase family member. J Struct Biol 2010;169:200–8.
[34] Servi S, Syldatk C, Vielhauer O, Tessaro D. Abstr. Biotrans, 7th international
symposium on biocatalysis and biotransformations, abstr. P-318. Delft, The
Netherlands; 2005.
[8] Edreva A. A novel strategy for plant protection: induced resistance. J Cell Mol
Biol 2004;3:61–9.
[35] Engel U, Syldatk C, Rudat J. Stereoselective hydrolysis of aryl-substituted dihy-
dropyrimidines by hydantoinases. Appl Microbiol Biotechnol; in press.
[9] Begriche K, Massart J, Abbey-Toby A, Igoudjil A, Lettéron P, Fromenty B. Beta-
aminoisobutyric acid prevents diet-induced obesity in mice with partial leptin
deficiency. Obesity (Silver Spring) 2008;16:2053–67.
[36] O’Neill M, Hauer B, Schneider N, Turner NJ. Enzyme-catalyzed enantioselective
hydrolysis of dihydrouracils as a route to enantiomerically pure ␤-amino acids.
ACS Catal 2011;1:1014–6.
[10] Begriche K, Massart J, Fromenty B. Effects of ␤-aminoisobutyric acid on leptin
production and lipid homeostasis: Mechanisms and possible relevance for the
prevention of obesity. Fundam Clin Pharmacol 2010;24:269–82.
[11] Abele S, Seebach D. Preparation of achiral and of enantiopure gemi-
nally disubstituted ␤-amino acids for ␤-peptide synthesis. Eur J Org Chem
2000;2000:1–15.
[12] Cardillo G, Tomasini C. Asymmetric synthesis of ␤-amino acids and ␣-
substituted ␤-amino acids. Chem Soc Rev 1996;25:117–28.
[13] Cole DC. Recent stereoselective synthetic approaches to ␤-amino acids. Tetra-
hedron 1994;50:9517–82.
[14] Fülöp F. The chemistry of 2-aminocycloalkanecarboxylic acids. Chem Rev
2001;101:2181–204.
[15] Lelais G, Seebach D. ␤2-Amino acids-syntheses, occurrence in natural products,
and components of ␤-peptides. Biopolymers 2004;76:206–43.
[16] Liu M, Sibi MP. Recent advances in the stereoselective synthesis of ␤-amino
acids. Tetrahedron 2002;58:7991–8035.
[37] Martínez-Gómez AI, Andújar-Sánchez M, Clemente-Jiménez JM, Neira JL,
Rodríguez-Vico F, Martínez-Rodríguez S, et al. N-Carbamoyl-␤-alanine ami-
dohydrolase from Agrobacterium tumefaciens C58: a promiscuous enzyme for
the production of amino acids. J Chromatogr B: Anal Technol Biomed Life Sci
2011;879:3277–82.
[38] Martínez-Gómez AI, Martínez-Rodríguez S, Pozo-Dengra J, Tessaro D, Servi S,
Clemente-Jiménez JM, et al. Potential application of N-carbamoyl-␤-alanine
amidohydrolase from Agrobacterium tumefaciens C58 for ␤-amino acid pro-
duction. Appl Environ Microbiol 2009;75:514–20.
[39] Dürr R, Neumann A, Vielhauer O, Altenbuchner J, Burton SG, Cowan DA, et al.
Genes responsible for hydantoin degradation of a halophilic Ochrobactrum sp.
G21 and Delftia sp. I24-new insight into relation of d-hydantoinases and dihy-
dropyrimidinases. J Mol Catal B 2008;52–53:2–12.
[40] Martínez-Rodríguez S, Martínez-Gómez AI, Rodríguez-Vico F, Clemente-
Jiménez JM, Las Heras-Vázquez FJ. Carbamoylases: characteristics and
applications in biotechnological processes. Appl Microbiol Biotechnol
2010;85:441–58.
[41] Zee-Cheng K-Y, Robins RK, Cheng CC. Pyrimidines. III. 5,6-Dihydropyrimidines.
J Org Chem 1961;26:1877–83.
[42] Ausubel F, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. Short
protocols in molecular biology. New York, NY: John Wiley and Sons, Inc.;
1992.
[43] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd
ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
[44] Boyd WJ. The isolation of amino-acids in the form of the corresponding
carbamido-acids and hydantoins. J Biochem 1933;27:1838–48.
[45] Las Heras-Vázquez FJ, Clemente-Jiménez JM, Martínez-Rodríguez S, Rodríguez-
Vico F. Engineering cyclic amidases for non-natural amino acid synthesis.
Methods Mol Biol 2012;794:87–104.
[17] Ma J-A. Recent developments in the catalytic asymmetric synthesis of ␣- and
␤-amino acids. Angew Chem Int Ed 2003;42:4290–9.
[18] Liljeblad A, Kanerva LT. Biocatalysis as a profound tool in the preparation of
highly enantiopure ␤-amino acids. Tetrahedron 2006;62:5831–54.
[19] Turner NJ. Ammonia lyases and aminomutases as biocatalysts for the synthesis
of ␣-amino and ␤-amino acids. Curr Opin Chem Biol 2011;15:234–40.
[20] Wu B, Szyman´ ski W, Heberling MM, Feringa BL, Janssen DB. Aminomutases:
mechanistic diversity, biotechnological applications and future perspectives.
Trends Biotechnol 2011;29:352–62.
[21] Wasternack C. Degradation of pyrimidines-enzymes, localization and role in
metabolism. Biochem Physiol Pflanzen 1978;173:467–99.
[22] Altenbuchner J, Siemann-Herzberg M, Syldatk C. Hydantoinases and related
enzymes as biocatalysts for the synthesis of unnatural chiral amino acids. Curr
Opin Biotechnol 2001;12:559–63.
[46] Martínez-Rodríguez S, González-Ramírez LA, Clemente-Jiménez JM,
Rodríguez-Vico F, Las Heras-Vázquez FJ, Gavira JA, et al. Crystallization
and preliminary crystallographic studies of the recombinant dihydropyrim-
idinase from Sinorhizobium meliloti CECT4114. Acta Crystallogr Sect F: Struct
Biol Cryst Commun 2006;62:1223–6.
[23] Aranaz I, Acosta N, Heras A. Encapsulation of an Agrobacterium radiobacter
extract containing d-hydantoinase and d-carbamoylase activities into alginate-
chitosan polyelectrolyte complexes. Preparation of the biocatalyst. J Mol Catal
B: Enzym 2009;58:54–64.
[24] Burton SG, Dorrington RA, Hartley C, Kirchmann S, Matcher G, Phehane V. Pro-
duction of enantiomerically pure amino acids: characterisation of South African
hydantoinases and hydantoinase-producing bacteria. J Mol Catal B: Enzym
1998;5:301–5.
[25] Burton SG, Dorrington RA. Hydantoin-hydrolysing enzymes for the enantiose-
lective production of amino acids: new insights and applications. Tetrahedron:
Asymmetry 2004;15:2737–41.
[26] Liu Y, Li Q, Hu X, Yang J. Construction and co-expression of polycistronic plasmid
encoding d-hydantoinase and d-carbamoylase for the production of d-amino
acids. Enzyme Microb Technol 2008;42:589–93.
[27] Martínez-Gómez AI, Martínez-Rodríguez S, Clemente-Jiménez JM, Pozo-
Dengra J, Rodríguez-Vico F, Las Heras-Vázquez FJ. Recombinant polycistronic
structure of hydantoinase process genes in Escherichia coli for the production
of optically pure d-amino acids. Appl Environ Microbiol 2007;73:1525–31.
[28] Martínez-Rodríguez S, Las Heras-Vázquez FJ, Clemente-Jiménez JM,
Mingorance-Cazorla L, Rodríguez-Vico F. Complete conversion of d,l-5-
monosubstituted hydantoins with a low velocity of chemical racemization
into d-amino acids using whole cells of recombinant Escherichia coli. Biotechnol
Prog 2002;18:1201–6.
[29] Park J-H, Kim G-J, Kim H-S. Production of d-amino acid using whole cells of
recombinant Escherichia coli with separately and coexpressed d-hydantoinase
and N-carbamoylase. Biotechnol Prog 2000;16:564–70.
[30] Syldatk C, May O, Altenbuchner J, Mattes R, Siemann M. Microbial
hydantoinases—industrial enzymes from the origin of life. Appl Microbiol
Biotechnol 1999;51:293–309.
[47] Stumpp T, Wilms B, Altenbuchner J. Ein neues l-rhamnose-induzierbares
expressions system für Escherichia coli. Biospektrum 2000;6:33–6.
[48] Wilms B, Wiese A, Syldatk C, Mattes R, Altenbuchner J, Pietzsch M. Cloning,
nucleotide sequence and expression of a new l-n-carbamoylase gene from
Arthrobacter aurescens DSM 3747 in E. coli. J Biotechnol 1999;68:101–13.
[49] Bednarski MD, Chenault HK, Simon ES, Whitesides GM. Membrane-enclosed
enzymatic catalysis (MEEC): a useful, practical new method for the manipula-
tion of enzymes in organic synthesis. J Am Chem Soc 1987;109:1283–5.
[50] Faber K. Immobilization. In: Biotransformations in organic chemistry: a text-
book. 6th ed. Berlin Heidelberg, Germany: Springer; 2011. p. 356–367.
[51] Reist M, Carrupt P-A, Testa B, Lebmann S, Hansen JJ. Kinetics and mechanisms of
racemization: 5-substituted hydantoins (=imidazolidine-2,4-diones) as mod-
els of chiral drugs. Helv Chim Acta 1996;79:767–78.
[52] Argyrou A, Washabaugh MW. Proton transfer from the C5-proR/proS positions
of l-dihydroorotate: general-base catalysis, isotope effects, and internal return.
J Am Chem Soc 1999;121:12054–62.
[53] Martínez-Rodríguez S, Encinar JA, Hurtado-Gómez E, Prieto J, Clemente-
Jiménez JM, Las Heras-Vázquez FJ, et al. Metal-triggered changes in the stability
and secondary structure of a tetrameric dihydropyrimidinase: a biophysical
characterization. Biophys Chem 2009;139:42–52.
[54] Monti D, Ferrandi EE, Zanellato I, Hua L, Polentini F, Carrea G, et al. One-
pot multienzymatic synthesis of 12-ketoursodeoxycholic acid: subtle cofactor
specificities rule the reaction equilibria of five biocatalysts working in a row.
Adv Synth Catal 2009;351:1303–11.
[55] Pataj Z, Ilisz I, Berkecz R, Misicka A, Tymecka D, Fülöp F, et al. Comparison of
performance of Chirobiotic T, T2 and TAG columns in the separation of beta2-
and beta3-homoamino acids. J Sep Sci 2008;31:3688–97.
[31] Wilms B, Wiese A, Syldatk C, Mattes R, Altenbuchner J. Development of an
Escherichia coli whole cell biocatalyst for the production of L-amino acids. J
Biotechnol 2001;86:19–30.