Enzymatic hydrogenation of trans-2-nonenal in barley

Article abstract of DOI:10.1021/jf050696l

Conversion of undesirable, taste-active compounds is crucial for using barley as a suitable raw material for beer production. Here, ALH1, a barley alkenal hydrogenase enzyme that reduced the α,β-unsaturated double bond of aldehydes and ketones, was found to convert trans-2-nonenal (T2N), a major contributor to the cardboard-like flavor of aged beer. Although the physiological function of ALH1 in barley development remains elusive, it exhibited high specificity with NADPH as a cofactor in the conversion of several oxylipins-including T2N, trans-2-hexenal, traumatin, and 1-octen-3-one. ALH1 action represents a previously unknown mechanism for T2N conversion in barley. Additional experimental results resolved the genomic sequence for barley ALH1, as well as the identification of a paralog gene encoding ALH2. Interestingly, T2N was not converted by purified, recombinant ALH2. The possibility to enhance ALH1 activity in planta is discussed-not only with respect to the physiological consequences thereof-but also in relation to improved beer quality.

Full text of DOI:10.1021/jf050696l

8714 J. Agric. Food Chem. 2005, 53, 8714−8721
Enzymatic Hydrogenation of trans-2-Nonenal in Barley
GUSTAV HAMBRAEUS* AND NILS NYBERG
Carlsberg Research Center, Gamle Carlsberg Vej 10, DK-2500 Copenhagen, Denmark
Conversion of undesirable, taste-active compounds is crucial for using barley as a suitable raw material
for beer production. Here, ALH1, a barley alkenal hydrogenase enzyme that reduced the R,â-
unsaturated double bond of aldehydes and ketones, was found to convert trans-2-nonenal (T2N), a
major contributor to the cardboard-like flavor of aged beer. Although the physiological function of
ALH1 in barley development remains elusive, it exhibited high specificity with NADPH as a cofactor
in the conversion of several oxylipinssincluding T2N, trans-2-hexenal, traumatin, and 1-octen-3-
one. ALH1 action represents a previously unknown mechanism for T2N conversion in barley. Additional
experimental results resolved the genomic sequence for barley ALH1, as well as the identification of
a paralog gene encoding ALH2. Interestingly, T2N was not converted by purified, recombinant ALH2.
The possibility to enhance ALH1 activity in planta is discussedsnot only with respect to the
physiological consequences thereofsbut also in relation to improved beer quality.
KEYWORDS: Malt; beer; taste stability; alkenal hydrogenase; nonenal; 1-octen-3-one
INTRODUCTION
of the barley (Hordeum Vulgare) used to make the malt, a
property that opens up the possibility to explore new targets
that affect beer aging. Provided that the T2N precursor is a
nitrogenous adduct formed through a reaction with the corre-
sponding malt-derived aldehyde, then blocking the synthesis of
T2N in the malt could improve the aging characteristics of the
corresponding beer.
Beer is one of the most widely consumed products in the
beverage market, motivating brewers to perfect beer quality and
taste stability. Better knowledge of brewing procedures, bottle
materials, and storage conditions has reduced the effect of beer
aging and allowed longer shelf life of the packaged product.
However, for example, during distribution in warm climates,
adequate storage conditions of beer cannot always be followed.
trans-2-Nonenal (T2N), which has an extremely low taste
threshold [0.11 ppb; (1)], is widely considered to be a major
contributor to the unpleasant cardboard flavor in aged beer (2).
Only a few days at 38 °C suffice to increase the concentration
of the aldehyde above taste threshold (3), but exactly how it is
formed in the beer remains elusive. Whereas linoleic acid and
its trihydroxy derivatives have been described to be transformed
into T2N during heating at low pH (4, 5), there is still no direct
evidence that these reactions occur in a beer during normal
aging. Recent findings suggested that T2N was released in beer
by a nonoxidative mechanism (6), with the aldehyde derived
from a precursor consisting of T2N bound to a nitrogenous
compound (7).
Over the past decade numerous publications have focused
on alternative ways to resolve the beer aging issue. Sulfite has
received particular attention because it protects beer by forming
nonvolatile, flavor-inactive adducts with several of the released
aldehydes during aging, including T2N (8). Accordingly, a
longer shelf life can be achieved in the presence of additional
sulfite, either produced by yeast during fermentation or added
to the finished beer before packaging. It is generally acknowl-
edged that beer quality also is dependent on intrinsic properties
Plants degrade linoleic acid through the action of lipoxygenase
(LOX) pathway enzymes, resulting in the generation of T2N
and other oxylipins, a collective term for lipid- or fatty acid-
derived molecules involved in plant defense, gene regulation,
and plant-to-plant signaling (9). The enzymes and branches of
the pathways are widely known in several plants including
alfalfa and cucumber. Here, the reactions of the branch leading
to T2N have been established (10, 11). It was found to be
generated from linoleic acid by two consecutive reactions, first
catalyzed by a LOX enzyme and subsequently by a 9-hydro-
peroxide lyase (9-HPL). Whereas 9-LOX oxidized linoleic acid
to 9-hydroperoxyoctadecadienoic acid (9-HPODE), 9-HPL
cleaved the hydroperoxylinoleic acid to 9-oxononanoic acid and
cis-3-nonenal, with the latter aldehyde further isomerized to
T2N. Although little is known about the synthesis of T2N in
barley, three LOXs have been identified in kernels (12). LOX-1
and LOX-2 predominantly catalyze the formation of 9-HPODE
and 13-HPODE, respectively, whereas the specificity of LOX-3
remains elusive. 9-HPL activity has also been demonstrated in
barley (13), but data on the corresponding gene and protein
sequences are lacking. Recently, null-LOX-1 barley mutants
were described (14, 15), with the corresponding beer produced
thereof reported to have improved taste stability and reduced
levels of T2N, again implying that products of the LOX pathway
affect beer quality. This discovery should not only stimulate
further studies on the biological generation of T2N but also pave
* Corresponding author (telephone +45 33 27 53 30; e-mail
gustav.hambraeus@crc.dk).
10.1021/jf050696l CCC: $30.25
© 2005 American Chemical Society
Published on Web 09/30/2005

trans-2-Nonenal Conversion
J. Agric. Food Chem., Vol. 53, No. 22, 2005 8715
To construct an uninterrupted ORF encoding ALH1, each of the
five exonssincluding 20-bp overhangs with the neighboring exons
were amplified by PCR using the following set of primers (forward
primer followed by reverse primer): P1 and ACGCCCAGAGTGGT-
TAACACCTCCCCCTGGACGAAGTCCG for exon 1, CGGACT-
TCGTCCAGGGGGAGGTGTTAACCACTCTGGGCGT and GGCAG-
TAAGGCCAGGCATGCCAAGAACTCCTGTGTAGTAT for exon 2,
ATACTACACAGGAGTTCTTGGCATGCCTGGCCTTACTGCC and
TTTGTTTTTAGGAGGTTGACCTTCTCATCGGAACCGGCAC for
exon 3, GTGCCGGTTCCGATGAGAAGGTCAACCTCCTAAAAAC-
AAA and CGATGCCCTCCGGGAAGCACCTCTTCAGTGTGG-
CGTTCAG for exon 4, and CTGAACGCCACACTGAAGAGGTG-
CTTCCCGGAGGGCATCG and P2 for exon 5. The amplified frag-
ments representing exons 1 and 2 were fused using splicing by overlap
extension [SOE (22)] and subsequently fused with exon 3, etc.
Eventually, the full-length fragment was inserted into pCR2.1 TOPO,
yielding plasmid pCR-ALH1, and the entire sequence was verified,
including the flanking sites for NdeI and BamHI.
the way to improved taste stability by manipulating the
enzymatic conversion of the aldehyde in barley or malt.
T2N belongs to the group of R,â-unsaturated aldehydes,
which can react with nucleic acids and proteins to generate
mutations and inactivation of enzymes (16). Consequently,
organisms have evolved enzymatic ways for aldehyde detoxi-
fication, some of which have been elucidated: Glutathione
(GSH)-S-transferases catalyze the conjugation of aldehydes with
GSH (17), and aldo-keto reductases reduce aldehydes to the
corresponding alcohols (18), whereas alcohol dehydrogenases
oxidize aldehydes to the corresponding carboxylates (19).
Recently, Mano et al. (20) identified an enzyme in Arabidopsis
thaliana that catalyzed hydrogenation of the carbon-carbon
double bond of R,â-unsaturated aldehydes. The enzyme was
denoted alkenal hydrogenase (ALH; EC 1.3.1.74) and found to
have exceptionally high affinity for T2N, a property indicating
to us a direct link between a similar enzymatic activity and T2N
levels in barley.
Total RNA was extracted from embryos of germinating kernels
following instructions of the FastRNA Pro Green kit (Bio101 Systems).
In analogy with the data described above, we suggest that
conversion and/or degradation of T2N in barley can be enhanced
such that less T2N will end up in the beer. To date, however,
there is no direct evidence pointing to a specific barley enzyme
with capacity to convert T2N. With that in mind, the aim of
the present study was to establish whether barley synthesizes
ALH orthologs, possibly followed by an enzymic characteriza-
tion.
Synthesis of Recombinant ALH1 and ALH2. The NdeI-BamHI
fragments consisting of the cDNA sequences for ALH1 and ALH2 were
inserted into vector pET19b (Novagen) yielding plasmids pET19b-
ALH1 and pET19b-ALH2, respectively. The ligation introduced the
DNA code for MGHHHHHHHHHHSSGHIDDDDKH immediately
upstream of the start codons for either protein. Next, Escherichia coli
BL21(DE3)pLysS cells, purchased from Novagen, were transformed
with the expression plasmids.
His-tagged recombinant ALH1 and ALH2 were expressed and
purified as follows. Separate flasks containing 250 mL of Luria-Bertani
broth, supplemented with 100 mg L-1 ampicillin, were inoculated with
bacteria harboring pET19b-ALH1 or pET19b-ALH2 and propagated
at 37 °C on a rotary shaker. After 1 h, protein expression was induced
by adding 1 mM IPTG. The cultures were incubated overnight before
cells were collected by centrifugation, then resuspended in 12.5 mL of
BugBuster HT (Novagen), and lysed by incubation for 20 min at room
temperature. Cell debris was pelleted by centrifugation, and the
supernatants containing the recombinant proteins were further purified
by Ni-HiTrap column chromatography according to established
procedures (Amersham Biosciences). Elution of bound protein was done
with a 0.1 M sodium phosphate buffer, pH 6.5, supplemented with
500 mM imidazole. The purity and concentration of eluted proteins
was analyzed by sodium dodecyl sulfate-polyacrylamide gel eletro-
phoresis (SDS-PAGE) using molecular mass standards at known
concentrations. When stored at 8 °C, the proteins remained fully active
for at least 2 weeks.
MATERIALS AND METHODS
Chemicals. All reagents employed in this study were obtained from
commercial sources and used without further purification. T2N, trans-
2-hexenal (T2H), and 1-octen-3-one were purchased from Sigma
Aldrich, whereas traumatin and 12-oxophytodienoic acid (OPDA) were
from Larodan (Malmo¨, Sweden). For nuclear magnetic resonance
(NMR) analysis, deuterated chloroform (CDCl3, 99.8% D) was
purchased from Dentero (Heresback, Germany).
Nucleic Acids. Genomic DNA (gDNA) of H. Vulgare cv. Barke
was extracted using the Plant DNA Isolation kit (Roche). Using the A.
thaliana ALH protein sequence as query [(20); GenBank accession
number CAA89838], a search for homologues was done in the database
of H. Vulgare expressed sequence tags (ESTs) at The Institute for
Genomic Research (TIGR), using the BLAST algorithm (21). Two
tentative consensus sequences containing open reading frames (ORFs)
encoding proteins with high identity to the A. thaliana ALH were
identified. Subsequent sequence alignments were made using the
blosum62mt2 scoring matrix with the ALIGNX software (Vector NTI,
InforMax).
The DNA fragment specifying the ORF for ALH1 was amplified
by PCR from gDNA of H. Vulgare with the forward primer P1,
CATATGGCGGCGGCGGCGGCGGAGGTGGGCAACAG (NdeI site
underlined; start codon in bold letters), and the reverse primer P2,
GGATCCTCACTCCCGTGCGACGGCCACCAGCTG (BamHI site
underlined; stop codon in bold letters). Cycling parameters were
94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, for a total of 30
cycles. Following amplification of the 1864-bp genomic fragment, it
was inserted into vector pCR2.1 TOPO (Invitrogen), resulting in plasmid
pCR-ALH1, and subsequently sequenced using the MegaBace 9600
sequencer (Amersham Bioscience). The entire DNA sequence spanning
five exons and four introns is available in the GenBank library under
the accession number AY904340.
In parallel running reactions, the DNA fragment for the ORF
specifying ALH2 was amplified by PCR from gDNA of H. Vulgare.
Here, reactions using the forward primer P3, CATATGGCGGAGCT-
CAAGAGCCGGCGGGTG (NdeI site underlined; start codon in bold
letters), and reverse primer P4, GGATCCTCACTCGGTGTCGGG-
GGTGGTGAGCTTG (BamHI site underlined; stop codon in bold
letters), yielded a 1062-bp fragment. This was inserted into vector
pCR2.1 TOPO yielding pCR-ALH2, and subsequent sequencing
revealed that it contained the entire ORF, but was without introns.
Activity of the Purified Enzyme. ALH activity was measured by
adding 2 µg of the purified enzyme to 2.5 mL of a 0.1-M potassium
phosphate buffer, pH 6.6, supplemented with 1 mM NADPH and
various concentrations of electron acceptors, that is, substrates (T2H,
T2N, 1-octen-3-one, traumatin). These were dissolved in ethanol such
that the resulting alcohol concentration was kept under 1% in the
reaction buffer. Oxidation of NADPH was followed by a decrease in
A340 using a spectrophotometer (Lambda 16; Perkin-Elmer). Initial
reaction velocities were determined for the various substrate concentra-
tions, with the kinetic constants Km and Vmax calculated using the
Michaelis-Menten equation.
Synthesis of Aldehyde Conjugates. Dinitrophenylhydrazine (DNPH)
conjugates were synthesized by combining 200 µL of pure aldehyde
(1 mM), or ALH1 reaction product, with 250 µL of DNPH (0.2 M)
and 50 µL of concentrated HCl. Following incubation in the dark at
37 °C for 1 h, the derivatized compounds were extracted twice with
1 mL of hexane. The combined hexane fractions were dried under N2,
followed by resuspending the precipitate in 100 µL of acetonitrile.
Measurement of Oxylipins. High-pressure liquid chromatography
(HPLC) analysis was done on a HP-1100 apparatus (Hewlett-Packard),
equipped with a 4.6 × 250 mm column (5-µm Symmetry C18, Waters).
Chromatography was performed with the following gradient solvent
system: 40% water (solvent A) and 60% acetonitrile (solvent B) for
15 min, ramped to 70% solvent B over 5 min, and then to 80% B over

8716 J. Agric. Food Chem., Vol. 53, No. 22, 2005
Hambraeus and Nyberg
Figure 1. Alignment of ALH homologous sequences from A. thaliana (AtALH) and H. vulgare (HvALH1 and HvALH2). Identical amino acids are shaded
in black and similar residues in gray. The predicted secondary structure of the Rossman fold, based on the E. coli QOR structural data (26), is marked
with a or b to indicate
R-helixes and â-strands, respectively. The putative NADPH/NADH discriminating residue is marked with X.
the next 15 min. The flow rate was 1.5 mL min-1, and A365 of the
effluent was monitored.
defined a gene structure with five exons and four introns. The
G-C contents of these exons and introns were 59.1 and 40.7%,
respectively, in accordance with numerous plant genes. BLAST
searches in the Gramene database (24) identified an alh1
ortholog on chromosome 12 of rice, characterized by four introns
at identical, relative positions as those of barley alh1. An alh2
ortholog was identified on chromosome 4 in rice. Sequence
alignment of ALH1 and ALH2 with their respective orthologs
in rice showed that the proteins share 72.8 and 59.5% identity,
respectively.
Product Analysis by NMR. All of the 1H NMR spectra were
recorded at 37 °C in solutions of CDCl3 on a Bruker DRX-250 Avance
spectrometer. A total of 128 scans were made. Spectral width of
5.2 kHz and collection of 32K data points were recorded with water
during 2-s relaxation delays. The free induction decays (FID) were
multiplied by an exponential function corresponding to a 0.3 Hz line-
broadening factor. The spectra were referenced against the residual
signal of CHCl3 at 7.27 ppm.
Extraction of Barley Enzymes. Barley enzyme extracts, each of
three 2-day-old germinating kernels, were obtained by homogenizing
the tissues in 500 µL of water supplemented with 10 µL of 10% (v/v)
Triton-X. The suspension was incubated for 15 min at 4 °C and then
centrifuged, and the resulting supernatant was stored at 4 °C.
On the basis of sequence similarities, ALHs belong to the
leukotriene B4 dehydrogenases (LTBDH) family of in the
medium-chain dehydrogenases and reductases (MDR) super
family (25). Several of the enzyme members, for example,
alcohol dehydrogenasessbut not those of the LTBDH familys
contain one or two Zn atoms. In general, the MDR enzymes
are predicted to share an N-terminal catalytic domain and a
C-terminal nucleotide-binding domain, where the latter is
characterized by the â,R,â motif known as the Rossman fold
[(26); Figure 1].
RESULTS
Cloning and Sequence Analysis of alh1. Searches with the
A. thaliana ALH sequence revealed two matches in the TIGR
barley EST database, corresponding to the tentative consensus
sequences TC140031 and TC131828. These consisted of 1044-
and 1062-bp-long ORFs encoding proteins with 62.3 and 58%
identity to the query, respectively (Figure 1). Both ORFs have
a typical monocot-specific sequence around the putative start
codon (23). In addition, the 1044-bp-long ORF is preceded by
two, in-frame, stop codons. Using specific primers, either ORF
was amplified from barley gDNA, resulting in fragments of 1864
bp for alh1 and 1062 bp for alh2. Sequence analysis revealed
that alh2 contained a full-length ORF, whereas that for alh1
MDR enzymes utilize either NAD(H) or NADP(H) as
cofactor, a property partially conferred by the sequence motif
GxGxxG/A (G, Gly; A, Ala; x, any amino acid) in the Rossman
fold and the charge of the residue at the end of the second
â-strand in the nucleotide-binding domain (26). In this respect,
substituting the negatively charged Asp-223 residue with glycine
in yeast alcohol dehydrogenase was found to increase its
specificity for NADP+. However, because the enzyme still could

trans-2-Nonenal Conversion
J. Agric. Food Chem., Vol. 53, No. 22, 2005 8717
were followed spectrophotometrically at 340 nm to determine
possible enzyme-catalyzed conversion of the cofactor. On the
basis of these experiments, it was established that ALH1 reduced
T2N rapidly with very high affinity, Km ) 1.0 µM (Table 1).
When the cofactor NADPH was replaced with NADH, no
conversion was observed, thus verifying the presumption that
ALH1 action is NADPH-dependent. The highest conversion rate
of T2N was measured at pH 6.5.
Unlike ALH1, attempts to obtain ALH2 action with NADPH
and T2N caused no oxidation of the cofactor, raising the
possibility of different substrate profiles for the paralogs.
Additional electron acceptors were therefore tested as substrates
for ALH2. One, traumatin, was shown to be reduced by the
enzyme with a Km of 110 µM. Although this demonstrated that
heterologously expressed ALH2 was active, further studies of
ALH2 action were beyond the scope of this work, as T2N
remained inaccessible as a substrate. No ALH2-catalyzed
reduction of traumatin was observed when NADPH was
replaced with NADH.
Figure 2. SDS-PAGE. Affinity purification of His-tagged ALH1 protein.
Proteins bound to the affinity column were eluted and collected in a 1-mL
fraction. Ten-microliter aliquots thereof were separated on 12% SDS-
PAG. Elutions were with 20 mM imidazole (lanes 1 and 2), 120 mM
imidazole (lanes 3 and 4), and 500 mM imidazole (lanes 5−7). M,
molecular mass standards (in kDa). The horizontal arrow points to stained
ALH1 protein.
ALH1 Catalyzes Hydrogenation of the Carbon-Carbon
Double Bond of T2N. The reaction product of ALH1-catalyzed
conversion of T2N was first examined by HPLC analysis. To
facilitate handling and detection of the reaction compounds,
volatile aldehydes were reacted with DNPH to form stable
conjugates that are characterized by good light absorption
properties. Reaction mixtures of T2N, NADPH, and ALH1 were
incubated for 10 min at room temperature, then derivatized with
DNPH, and subsequently examined by HPLC analysis (Figure
3). Derivatized, pure T2N was found to elute from the C18
column in two peaks with retention times of 33.0 and 34.1 min,
primarily because isomeric products were obtained by isomer-
ization with DNPH. However, the reaction product eluted as a
single peak at 35.8 min, corresponding to that of derivatized
nonanal. Accordingly, the experiment established that ALH1
catalyzed the expected reduction of T2N to nonanal. The
reaction was enzymatic, as no conversion of T2N was observed
when heat-inactivated ALH1 replaced active enzyme (data not
shown).
reduce NAD+, it was suggested that other residues contribute
to its substrate specificity. The corresponding motif in barley
ALH1 and ALH2, AxxGxxG, is identical to that of E. coli
quinone oxidoreductase (QOR) and ALH of A. thaliana, each
requiring NADPH for activity (20, 26). Moreover, the proposed
cofactor-determining residue, at the end of the second â-strand,
is uncharged in both ALH1 and ALH2 (Ala-189 and Ala-186),
suggesting that enzymic action depends on the availability of
NADPH (Figure 1).
Recombinant ALH1 and ALH2. Heterologous expression
of ALH1 and ALH2 was achieved in E. coli cells. To allow
bacterial expression of ALH1, the introns of the genomic
sequence were removed by SOE-PCR to yield a 1044-bp ORF.
This and the 1062-bp alh2 ORF were separately ligated
downstream of a stretch for 10 His residues to simplify
subsequent purification of the expressed proteins. E. coli BL21-
(DE3)pLysS cells, transformed with the resulting constructs,
were propagated according to standard procedures, followed by
extraction of the recombinant enzymes. The homogenities of
affinity-purified ALH1 and ALH2 were examined by SDS-
PAGE, which showed single, ∼38-kDa protein bands
(Figure 2).
NMR analysis was employed to experimentally assess the
identity of the enzymatic product of ALH1 action. Nonanal,
T2N, and T2N supplemented with ALH1 were combined in
separate tubes with buffer and NADPH. After incubation
overnight at room temperature, the reaction mixtures were
T2N Is a substrate for ALH1, Not for ALH2. In a first
series of analyses, combinations of ALH1, NADPH, and T2N
1
extracted with CDCl3. Examination of H NMR spectra of the
Table 1. Structures of the Compounds Tested for Electron Acceptors and Kinetic Constants for Recombinant ALH1 Determined at 30
Using NADPH as Cofactor
°C and pH 6.6

8718 J. Agric. Food Chem., Vol. 53, No. 22, 2005
Hambraeus and Nyberg
antimicrobial substance (28, 29), traumatin is considered to be
a growth-stimulating agent formed in response to plant tissue
damage (30). Kinetic analyses using recombinant ALH1 re-
vealed that the enzyme reacted quickly with T2H and traumatin
to form hexanal and 12-oxododecanoic acid, respectively.
Although the affinity for traumatin was similar to that of T2N
(0.8 µM), reactions with T2H yielded a >10-fold higher value
(Km ) 10 µM; Table 1).
Finally, an interesting aroma compound, 1-octen-3-one, was
tested as an electron acceptor for ALH1. The ketone is
characterized by having a double bond between the R and â
carbons, and a mushroom-like flavor with a taste threshold of
0.025 ppb, which is one-fifth of that for T2N (1). In the context
of beer production, infections of malt with fungi may generate
1-octen-3-one and spoil the beer product. Because both A.
thaliana ALH and LTB4DH are known to reduce R,â double
bonds of ketones (1, 20, 31), it was assessed whether 1-octen-
3-one might be a substrate for an ALH1-catalyzed reduction.
An experiment with a mixture consisting of 1-octen-3-one,
NADPH, and ALH1 showed that the ketone was a good
substrate for the enzyme (Km ) 2.0 µM; Table 1). This result
makes it conceivable that ALH1 exhibits wide substrate
specificity and hints at useful applications of the enzyme in the
conversion of flavor-intense ketone/aldehyde compounds.
Figure 3. HPLC analysis of aldehydes. DNPH-derivatized T2N eluted as
two peaks at 33.0 and 34.1 min (A), whereas DNPH-derivatized nonanal
eluted at 35.8 min (B), identical to that of the derivatized reaction product
from ALH1-catalyzed reduction of T2N (C).
Aldehydes without an R,â-unsaturated bondsnonanal, octa-
nal, and hexanalswere also tested as substrates, but ALH1 could
not reduce these molecules. In addition, OPDA did not serve
as a substrate for ALH1, suggesting that the enzyme cannot
readily reduce R,â-unsaturated bonds of cycloalkones. In
summary, ALH1 was shown to share enzymatic properties with
A. thaliana ALH, properties that support the categorization of
ALH1 as an alkenal hydrogenase.
alh1 Expression and ALH Activity in the Barley Embryo.
The identification and characterization of the ALH1 enzyme
prompted an examination of the expression of the corresponding
gene in barley kernels during germination. The focus was on
kernels not only because they are known to contribute to the
generation of LOX pathway-specific aldehydes but also because
germinating kernels are highly relevant for processes involved
in beer making. In a first step, searches in the TIGR database
revealed 25 ESTs with absolute identity to alh1 mRNA. The
ESTs were derived from various plant parts, including leaves,
endosperm, germinating kernel, and embryo. Accordingly, we
hypothesize that alh1 expression is constitutive and not restricted
to specific tissues or developmental stages.
RNA was extracted from embryos of germinating barley
kernels that had been incubated for 2 days in Petri dishes
supplemented with water. RT-PCR was employed to amplify
possible alh1-specific transcripts. For that purpose, the forward
and reverse primers were designed to anneal in exon 2 and exon
5, respectively, such that an amplified fragment derived from
processed alh1 mRNA would have a length of 410 bp, whereas
possible contaminating gDNA would yield a fragment of 820
bp. The PCR reaction products were analyzed by agarose gel
electrophoresis, revealing a DNA band of 410 bp, which was
confirmed by sequencing to be specific for alh1 (data not
shown). This result revealed that alh1 was expressed in
germinating kernels and confirmed the annotations given in the
TIGR barley EST database.
Figure 4. NMR analysis. 250 MHz 1H NMR spectra of aldehydes extracted
from reactions consisting of pure nonanal (A), pure T2N (B), and T2N
and enzyme (C).
extracted aldehydes revealed that the product of enzyme-
converted T2N was identical to nonanal and that NADPH alone
could not reduce T2N. Figure 4 shows the signals of the two
different aldehyde protons at 9.77 ppm (triplet, 3JH,H ) 1.6 Hz,
3
assigned to H-1 of nonanal) and 9.51 ppm (doublet, JH,H
)
7.8 Hz, H-1 of T2N). Other informative signals were those of
the methylene protons in the trans double bond in T2N at 6.85
and 6.13 ppm (not shown).
Substrates. Instead of a full examination on potential
substrates for ALH1 action, emphasis was on key intermediates
of the LOX pathway. Here, T2H and traumatin represented two
R,â-unsaturated aldehydes generated by 13-HPL-catalyzed
cleavage of 13-HPODE (27). Whereas T2H has been suggested
to function as an attractant for herbivore predators and as an
To determine whether ALH1 contributes to the conversion
of T2N in germinating barley kernels, aliquots of an embryo
extract of water-soluble proteins were supplemented with
combinations of T2N and NADPH, followed by incubation for
5 h at room temperature. However, although much of the T2N

trans-2-Nonenal Conversion
J. Agric. Food Chem., Vol. 53, No. 22, 2005 8719
was converted during the incubation, no traces of nonanal could
be detected by the methods applied (data not shown). It remains
unclear whether the majority of the T2N is converted by
enzymes other than ALH1 or, alternatively, nonanal is a short-
lived intermediate.
activity is possible using a transgenic approach. However, the
success of any attempt to manipulate ALH1 activity will depend
on the enzyme’s biological role in the plant.
The substrate(s) of highest relevance for barley ALH1 action
in vivo remain(s) elusive. Because ALH1 reduces the carbon-
carbon double bond of R,â-unsaturated aldehydes/ketones, the
enzyme can be active in numerous metabolic reactions outside
the context of T2N conversion, for example, in the reduction
of OPDA in the LOX pathway (9) and in the conversion of
campesterol to campestanol within the brassinolide synthesis
pathway (32). However, OPDA did not serve as substrate for
ALH1 (data not shown), indicating that the enzyme is incapable
of reducing R,â-unsaturated bonds of cycloalkones, similar to
that observed for A. thaliana ALH and LTBDH (20, 31).
DISCUSSION
T2N is widely considered to be an important aldehyde that
contributes to the stale flavor of aged beer. However, despite
extensive analyses of the chemical reactions involved in the
release of T2N in beer, its immediate precursor remains
unknown. This lack of information has limited the development
of new ways to prolong beer taste stability as alternatives to
the conventional addition of sulfite. Nevertheless, the T2N-
generating pathway in malt has been studied, eventually resulting
in the identification of the LOX-1 enzyme which catalyzes the
conversion of linoleic acid into 9-HPODE, a precursor of T2N
in plants. Recently, a barley mutant lacking LOX-1 activity was
described, and beer made from the corresponding malt revealed
improved properties (14, 15). This finding led to the suggestion
that enzymatic generation of the aldehyde in malt affects, in
part, the taste stability of beer, possibly such that the T2N level
in malt correlates with the corresponding potential of beer.
Further physiological studies of the metabolism of T2N in barley
and malt should therefore facilitate a more comprehensive
approach to its elimination. The work presented here represents
a first step in this direction.
Using sequence searches for similarity with the alkenal-
converting enzyme of A. thaliana (ALH), we identified and
characterized a barley gene encoding a T2N-converting enzyme
denoted ALH1. This was shown to catalyze an efficient
reduction of T2N to nonanal, which has a taste threshold of
0.018 ppm, >150 times higher than that of T2N (1). In extracts
of embryos of germinating kernels we could demonstrate the
presence of alh1 transcripts. It is therefore possible that T2N
hydrogenation is part of cellular mechanisms for adjusting
aldehyde levels, a property expected to affect the level of T2N
in malt.
To evaluate ALH1 activity, we determined the Vmax, which
is a measure of the maximal velocity of the catalytic reaction,
and Km, a measure of the affinity of the enzyme for the substrate
(Table 1). Considering the tight binding between enzyme and
T2N (Km ) 1.0 µM) and a high ratio of Vmax/Km (1.6 min-1
µg-1), it is likely that enhanced ALH1 activity in barley can be
exploited to decrease the amount of T2N in the corresponding
malt. Because this approach could result in reduced levels of
T2N precursors in the corresponding beer, a prolonged shelf
life seems to be achievable for the packaged product. It is
possible that the addition of recombinant ALH1 to the mash
could increase the rate of T2N conversion. However, this would
represent an economically expensive solution, as NADPH is
required for enzymic action. Utilization of malt with enhanced
ALH1 activity represents an alternative approach.
To identify or generate novel barley plants with enhanced
ALH1 activity, at least two approaches are possible: (i)
screening of barley for high levels or activities of ALH1 or (ii)
overexpression of the alh1 gene in transgenic barley. A
screening could be employed on either existing or mutagenized
barley cultivars, but the approach seems to be practically
applicable only for the identification of mutants with decreased
ALH activity. Few, if any, mutations result in increased activity,
making the screening for hyperactive ALH1 plants very
laborious with an uncertain outcome. In contrast, overexpression
of the alh1 gene and the subsequent increase in total ALH1
Other molecules identified as putative ALH1 substrates
include T2H and traumatin, oxylipins that have been implicated
in various stress responses in plants. Whereas T2H is known to
possess antimicrobial properties (29) and may attract herbivore
predators (28), the function of traumatin remains unknown,
although it has been suggested to play a role in cell division
processes (30). The function and metabolism of these two
oxylipins are of particular interest, because they are synthesized
in equimolar amounts upon cleavage of 13-HPODE by 13-HPL
(27). Concomitant ALH1-catalyzed reduction of both T2H and
traumatin to the corresponding saturated molecules is possible,
but with substantially different kinetics. Because the ratio of
V
max/Km is ∼25-fold higher for traumatin than for T2H (Table
1), it is conceivable that ALH1 has a function in regulating the
relative amounts of T2H and traumatin.
Plant-derived R,â-unsaturated aldehyde oxylipins are widely
considered to be associated with various types of physical stress.
The molecules are very reactive and have been reported to
inactivate enzymes and induce mutations (16). Aldehyde detoxi-
fication is considered to be important, and several experiments
have demonstrated a relationship between stress and expression
of oxylipin-converting enzymes (33, 34). Moreover, the over-
expression of an aldehyde dehydrogenase in A. thaliana (33)
and of an aldose/aldehyde reductase in tobacco (35) resulted in
plants with improved stress tolerance. These data, and the fact
that unsaturated aldehydes are much more toxic than the
corresponding saturated molecules (29), suggest that barley
ALH1 represents an enzyme that is actively involved in plant
stress responses. Accordingly, overexpression of ALH1 in barley
could have beneficial commercial effects, not only in brewing
by decreasing the amount of T2N in the corresponding malt
but also in breeding by improving the plant’s stress tolerance.
A practical consideration in malting is the occasional infec-
tions of fungi that give the brew a mushroom-like flavor, which
is attributed to the presence of the fungal fatty acid-derived
metabolite 1-octen-3-one (27, 36). Because ALH1 converts
1-octen-3-one to 3-octanone, a product with a 20000-fold higher
taste threshold in beer than its corresponding substrate (1), it is
possible that malt overexpressing alh1 could suppress some
adverse effects of fungal infections.
It is likely that barley expresses several enzymes with the
ability to convert R,â-unsaturated aldehydes, a notion supported
by the finding of four potential ALH1 orthologs in a BLAST
search of the rice genome. The orthologs were found on
chromosomes 1, 4, 11, and 12, with the respective identities to
barley ALH1 being 56.7, 67.8, 63.8, and 72.7%. A barley
paralog, ALH2, with 56.5% identity to ALH1, was identified
in the TIGR barley EST database. Following cloning and
characterization of the gene encoding ALH2, we discovered that
the corresponding heterologous enzyme catalyzed the same

8720 J. Agric. Food Chem., Vol. 53, No. 22, 2005
Hambraeus and Nyberg
(17) Hubatsch, I.; Ridderstrom, M.; Mannervik, B. Human glutathione
transferase A4-4: an R class enzyme with high catalytic
efficiency in the conjugation of 4-hydroxynonenal and other
genotoxic products of lipid peroxidation. Biochem. J. 1998, 330,
175-179.
(18) Burczynski, M. E.; Sridhar, G. R.; Palackal, N. T.; Penning, T.
M. The reactive oxygen species and Michael acceptor-inducible
human aldo-keto reductase AKR1C1 reduces the R,â-unsaturated
aldehyde 4-hydroxy-2-nonenal to 1,4-dihydroxy-2-nonene. J.
Biol. Chem. 2001, 276, 2890-2897.
(19) Sellin, S.; Holmquist, B.; Mannervik, B.; Vallee, B. L. Oxidation
and reduction of 4-hydroxyalkenals catalyzed by isozymes of
human alcohol dehydrogenase. Biochemistry 1991, 30, 2514-
2518.
(20) Mano, J.; Torii, Y.; Hayashi, S.; Takimoto, K.; Matsui, K., et
al. The NADPH:quinone oxidoreductase P1-ú-crystallin in
Arabidopsis catalyzes the R,â-hydrogenation of 2-alkenals:
detoxication of the lipid peroxide-derived reactive aldehydes.
Plant Cell Physiol. 2002, 43, 1445-1455.
reaction as ALH1, that is, hydrogenation of the double bond of
R,â-unsaturated aldehydes (data not shown). However, com-
parison of reaction kinetics between ALH1 and ALH2 revealed
distinct differences. ALH2 could, for example, not convert T2N,
leaving open the possibility that the ALH paralogs have different
biological roles. So far, traumatin is the only substrate identified
for ALH2, but a high Km value (110 µM) suggests that other
molecules exhibit more important biological roles in vivo.
It is likely that an examination of the regulation of the alh
genes would provide important clues to the physiological
role(s) of this gene family. In addition, studying barley plants
with reduced or increased ALH activity could be helpful. In
any case, the potential commercial value of such mutants should
motivate both brewers and breeders to further study these genes
and enzymes.
ACKNOWLEDGMENT
We thank Ole Olsen for valuable discussions and critical reading
of the manuscript.
(21) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman,
D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215,
403-410.
(22) Horton, R. M.; Hunt, H. D.; Ho, S. N.; Pullen, J. K.; Pease, L.
R. Engineering hybrid genes without the use of restriction
enzymes: gene splicing by overlap extension. Gene 1989, 77,
61-68.
(23) Joshi, C. P.; Zhou, H.; Huang, X.; Chiang, V. L. Context
sequences of translation initiation codon in plants. Plant Mol.
Biol. 1997, 35, 993-1001.
(24) Ware, D.; Jaiswal, P.; Ni, J.; Pan, X.; Chang, K., et al.
Gramene: a resource for comparative grass genomics. Nucleic
Acids Res. 2002, 30, 103-105.
(25) Nordling, E.; Jornvall, H.; Persson, B. Medium-chain dehydro-
genases/reductases (MDR). Family characterizations including
genome comparisons and active site modeling. Eur. J. Biochem.
2002, 269, 4267-4276.
LITERATURE CITED
(1) Meilgaard, M. C. Flavor chemistry of beer: part II. Flavor and
threshold of 239 aroma volatiles. MBAA Tech. Q. 1975, 12, 151-
168.
(2) Jamieson, A. M.; van Gheluwe, J. E. A. Identification of a
compound responsible for cardboard flavor in beer. Proc. Am.
Soc. Brew. Chem. 1974, 192-197.
(3) Wang, P.; Siebert, K. Determination of trans-2-nonenal in beer.
MBAA Tech. Q. 1974, 11, 110-117.
(4) Drost, B. W.; van Eerde, P.; Hoekstra, S. F.; Strating, J. Fatty
acids and staling of beer. EBC Proc. 1971, 451-458.
(5) Witt, P. R.; Burdick II, A. Lipids in brewing and brewing
materials. ASBC Proc. 1961, 19, 104-110.
(26) Edwards, K. J.; Barton, J. D.; Rossjohn, J.; Thorn, J. M.; Taylor,
G. L., et al. Structural and sequence comparisons of quinone
oxidoreductase, ú-crystallin, and glucose and alcohol dehydro-
genases. Arch. Biochem. Biophys. 1996, 328, 173-183.
(27) Noordermeer, M. A.; Veldink, G. A.; Vliegenthart, J. F. Fatty
acid hydroperoxide lyase: a plant cytochrome P450 enzyme
involved in wound healing and pest resistance. ChemBioChem
2001, 2, 494-504.
(28) Halitschke, R.; Ziegler, J.; Keinanen, M.; Baldwin, I. T. Silencing
of hydroperoxide lyase and allene oxide synthase reveals
substrate and defense signaling crosstalk in Nicotiana attenuata.
Plant J. 2004, 40, 35-46.
(29) Trombetta, D.; Saija, A.; Bisignano, G.; Arena, S.; Caruso, S.,
et al. Study on the mechanisms of the antibacterial action of
some plant R,â-unsaturated aldehydes. Lett. Appl. Microbiol.
2002, 35, 285-290.
(30) Zimmermann, D. C.; Coudron, C. A. Identification of traumatin,
a wound hormone, as 12-oxo-trans-10-dodecenoic acid. Plant
Physiol. 1979, 63, 536-541.
(31) Dick, R. A.; Kwak, M. K.; Sutter, T. R.; Kensler, T. W.
Antioxidative function and substrate specificity of NAD(P)H-
dependent alkenal/one oxidoreductase. A new role for leukotriene
B4 12-hydroxydehydrogenase/15-oxoprostaglandin 13-reductase.
J. Biol. Chem. 2001, 276, 40803-40810.
(32) Noguchi, T.; Fujioka, S.; Takatsuto, S.; Sakurai, A.; Yoshida,
S., et al. Arabidopsis det2 is defective in the conversion of (24R)-
24-methylcholest-4-en-3-one to (24R)-24-methyl-5R-cholestan-
3-one in brassinosteroid biosynthesis. Plant Physiol. 1999, 120,
833-840.
(33) Sunkar, R.; Bartels, D.; Kirch, H. H. Overexpression of a stress-
inducible aldehyde dehydrogenase gene from Arabidopsis thaliana
in transgenic plants improves stress tolerance. Plant J. 2003,
35, 452-464.
(6) Lermusieau, G.; Noel, S.; Liegeois, C.; Collin, S. Nonoxidative
mechanism for development of trans-2-nonenal in beer. J. Am.
Soc. Brew. Chem. 1999, 57, 29-33.
(7) Liegeois, C.; Meurens, N.; Badot, C.; Collin, S. Release of
deuterated (E)-2-nonenal during beer aging from labeled precur-
sors synthesized before boiling. J. Agric. Food Chem. 2002, 50,
7634-7638.
(8) Nyborg, M.; Outtrup, H.; Dreyer, T. Investigations of the
protective mechanism of sulfite against beer staling and formation
of adducts with trans-2-nonenal. J. Am. Soc. Brew. Chem. 1999,
57, 24-28.
(9) Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu.
ReV. Plant Biol. 2002, 53, 275-297.
(10) Noordermeer, M. A.; Veldink, G. A.; Vliegenthart, J. F. Alfalfa
contains substantial 9-hydroperoxide lyase activity and a 3Z:
2E-enal isomerase. FEBS Lett. 1999, 443, 201-204.
(11) Matsui, K.; Ujita, C.; Fujimoto, S.; Wilkinson, J.; Hiatt, B., et
al. Fatty acid 9- and 13-hydroperoxide lyases from cucumber.
FEBS Lett. 2000, 481, 183-188.
(12) van Mechelen, J. R.; Schuurink, R. C.; Smits, M.; Graner, A.;
Douma, A. C., et al. Molecular characterization of two lipoxy-
genases from barley. Plant Mol. Biol. 1999, 39, 1283-1298.
(13) Kuroda, H.; Furusho, S.; Maeba, H.; Takashio, M. Characteriza-
tion of factors involved in the production of 2(E)-nonenal during
mashing. Biosci., Biotechnol., Biochem. 2003, 67, 691-697.
(14) Hirota, N.; Kaneko, T.; Kuroda, H.; Takoi, K.; Takeda, K. Barley
lipoxygenase 1 gene, method of selecting barley variety, material
of malt alcoholic drinks and process for producing malt alcoholic
drink. PCT Int. Appl. WO04/085652, 2004.
(15) Hirota, N.; Kuroda, H.; Takoi, K.; Kaneko, T.; Kaneda, H., et
al. Brewing performance of lipoxygenase-1-less barley. Brew.
Dig. 2004, 35.
(16) Witz, G. Biological interactions of R,â-unsaturated aldehydes.
Free Radical Biol. Med. 1989, 7, 333-349.

trans-2-Nonenal Conversion
J. Agric. Food Chem., Vol. 53, No. 22, 2005 8721
(34) Kirch, H. H.; Nair, A.; Bartels, D. Novel ABA- and dehydration-
inducible aldehyde dehydrogenase genes isolated from the
resurrection plant Craterostigma plantagineum and Arabidopsis
thaliana. Plant J. 2001, 28, 555-567.
1-octen-3-ol and 10-oxo-trans-8-decenoic acid in mushrooms
(Psalliota bispora). Biochim. Biophys. Acta 1984, 794, 18-24.
(35) Oberschall, A.; Deak, M.; Torok, K.; Sass, L.; Vass, I., et al. A
novel aldose/aldehyde reductase protects transgenic plants against
lipid peroxidation under chemical and drought stresses. Plant J.
2000, 24, 437-446.
(36) Wurzenberger, M.; Grosch, W. Origin of the oxygen in the
products of the enzymatic cleavage reaction of linoleic acid to
Received for review March 29, 2005. Revised manuscript received
August 5, 2005. Accepted August 23, 2005. This research has been
supported by a Marie Curie Fellowship of the European Community
Fifth Framework Programme under Contract HPMI-CI-1999-00027.
JF050696L