Galactose-clicked curcumin-mediated reversal of meropenem resistance among klebsiella pneumoniae by targeting its carbapenemases and the AcrAB-TolC efflux system

antibiotics

Article

Galactose-Clicked Curcumin-Mediated Reversal of Meropenem

Resistance among Klebsiella pneumoniae by Targeting Its

Carbapenemases and the AcrAB-TolC Efﬂux System

Shivangi Yadav ¹^,^†, Ashish Kumar Singh

1,2,†

, Anand K. Agrahari , Akhilesh Kumar Pandey ,

3

4

1

2,5

3,

1,

Munesh Kumar Gupta , Dipshikha Chakravortty

, Vinod Kumar Tiwari * and Pradyot Prakash *

1

Bacterial Bioﬁlm and Drug Resistance Research Laboratory, Department of Microbiology, Institute of Medical

Sciences, Banaras Hindu University, Varanasi 221005, India; yadavshivi2706@gmail.com (S.Y.);

chunchunpratapsingh@gmail.com (A.K.S.); guptamuneshkumar@gmail.com (M.K.G.)

Department of Microbiology and Cell Biology, Indian Institute of Science, Bengaluru 560012, India;

dipa@iisc.ac.in

Department of Chemistry, Institute of Science, Banaras Hindu University, Varanasi 221005, India;

anand32bhu@gmail.com

Department of Biochemistry, Institute of Science, Banaras Hindu University, Varanasi 221005, India;

akppdy@googlemail.com

2

3

4

5

Center for Biosystem Science and Engineering, Indian Institute of Science, Bengaluru 560012, India

Correspondence: tiwari_chem@yahoo.co.in (V.K.T.); pradyot_micro@bhu.ac.in (P.P.)

These authors contributed equally to this work.

*

†

Citation: Yadav, S.; Singh, A.K.;

Agrahari, A.K.; Pandey, A.K.; Gupta,

M.K.; Chakravortty, D.; Tiwari, V.K.;

Prakash, P. Galactose-Clicked

Abstract: In over eighty years, despite successive antibiotics discoveries, the rapid advent of mul-

tidrug resistance among bacterial pathogens has jolted our misapprehension of success over them.

Resistance is spreading faster than the discovery of new antibiotics/antimicrobials. Therefore, the

search for better antimicrobials/additives becomes prudent. A water-soluble curcumin derivative

Curcumin-Mediated Reversal of

Meropenem Resistance among

(

Curaq) was synthesised, employing a Cu (I) catalysed 1, 3-cyclo addition reaction; it has been

evaluated as a potential treatment for multidrug-resistant isolates and as an antibiotic adjuvant

for meropenem against hypervirulent multidrug-resistant Klebsiella pneumoniae isolates. We also

investigated its solubility and effect over carbapenemase activity. Additionally, we investigated its

impact on the AcrAB-TolC system. We found that Curaq inhibited bacterial growth at a minimal

Klebsiella pneumoniae by Targeting Its

Carbapenemases and the AcrAB-TolC

Efﬂux System. Antibiotics 2021 , 10 ,

3

88. https://doi.org/10.3390/

antibiotics10040388

concentration of 16

nine (9.4%) Klebsiella isolates were sensitive to meropenem; however, after synergising with Curaq

(8 g/mL), 85 (88.54%) hvKP isolates became sensitive to the drug. The Cur_a_qalso inhibited the

AcrAB-TolC efﬂux system at 1 g/mL concentration by disrupting the membrane potential and caus-

µg/mL; at a 32 µg/mL concentration, it killed bacterial growth completely. Only

Academic Editor: Nuno

Manuel Xavier

µ

ing depolarisation. The kinetic parameters obtained also indicated its promise as a carbapenemase

inhibitor. These results suggest that Curaq can be an excellent drug candidate as a broad-spectrum

antibacterial and anti-efﬂux agent.

Received: 11 March 2021

Accepted: 2 April 2021

Published: 4 April 2021

Keywords: bliss modelling; synergism; AcrAB-TolC; bla_KPC; mCIM; eCIM

Publisher’s Note: MDPI stays neutral

with regard to jurisdictional claims in

published maps and institutional afﬁl-

iations.

1

. Introduction

Klebsiella pneumoniae, a Gram-negative bacillus of the Enterobacteriaceae family, is an op-

portunistic pathogen noted for commonly infecting immunocompromised individuals [ ].

1

Klebsiella pneumoniae is distributed far and wide, from soil to vegetation. It accounts for

many healthcare-associated infections in humans, including pneumonia, wound/surgical

site infections, septicemia, and meningitis. Additionally, it forms bioﬁlms efﬁciently over

Licensee MDPI, Basel, Switzerland.

This article is an open access article

distributed under the terms and

conditions of the Creative Commons

Attribution (CC BY) license (https://

creativecommons.org/licenses/by/

medical devices (e.g., catheters and endotracheal tubes) [

of phenotypically unique hypervirulent isolates of Klebsiella pneumoniae (hvKP), efﬁciently

producing capsular polysaccharides [ ]. These hvKP isolates are astoundingly invasive,

2]. Reports have noted an upsurge

3

adapted for infecting even healthy individuals. They are responsible for community-

acquired infections, such as severe pneumonia, urinary tract infections, pyogenic liver

4

.0/).

Antibiotics 2021, 10, 388. https://doi.org/10.3390/antibiotics10040388

https://www.mdpi.com/journal/antibiotics

Antibiotics 2021, 10, 388

2 of 30

abscess, and necrotising fasciitis. Exceptionally, these hvKP isolates are capable of dis-

seminating to infect other organs as well, complicating treatment—unlike their classical

counterparts. Moreover, K. pneumoniae have developed antimicrobial resistance, most

recently to the virtually last resort of treatment: carbapenems [4,5]. Multidrug pumps

(predominantly in the clinically relevant AcrAB-TolC and Mex pumps of the resistance-

nodulation-division (RND) superfamily among Klebsiella pneumoniae) not only arbitrate

intrinsic and acquired multidrug resistance (MDR); they are also implicated in stress re-

sponse and pathogenicity. Furthermore, these efﬂux pumps are also reported to interact

synergistically with other resistance mechanisms that further intensify resistance levels [6].

Among other Enterobacteriaceae members like E. coli, it has been ascertained that

carbapenem-resistant isolates devoid of carbapenemase production present a noticeable

reduction in intracellular antibiotic accumulation, owing to the overexpression of various

efﬂux pumps and porin alteration [

of K. pneumoniae against both ertapenem and imipenem is attributed to the overexpres-

sion of resistance-nodulation-division (RND) family efﬂux genes [ ]. However, against

7]. Reports suggest that the reduced susceptibility

8

meropenem, the sensitivity remained unperturbed. In synergy with other resistance mech-

anisms (e.g., alterations in membrane permeability, enzyme-mediated inactivation and

modiﬁcation of antibiotics, target alteration), these resistant bacterial infections become

almost impossible to treat [

extended-spectrum -lactamases, Metallo-

degrade various -lactam antibiotics and carbapenems [

9

]. K. pneumoniae produces several enzymes—oxacillinases,

-lactamases, and carbapenemases—that can

]. These features become more

β

5

devastating in the current scenario due to the dwindling number of effective antibiotics.

Therefore, it has been listed as one of the critical threats by the World Health Organization.

The escalated carbapenem resistance among K. pneumoniae isolates witnessed in the last

decade across the globe (and ostensible lack of in-depth study of carbapenem resistance,

especially meropenem) reveals the dire necessity for baseline exploration [8]. Detailed

knowledge about antimicrobial susceptibility patterns and carbapenemase production sta-

tus is a prerequisite for managing and treating K. pneumoniae infections. Genetic diversity

(in terms of clonal relatedness, for identifying the more prevalent strain) can help prevent

and control infections in hospitals.

Considering the signiﬁcant role of efﬂux pumps in arbitrating resistance in Klebsiella

pneumoniae, targeting the bacterial efﬂux systems is very relevant. AcrAB-TolC efﬂux

pump-mediated carbapenem resistance has been well documented against imipenem and

ertapenem but was not reported to be signiﬁcantly associated with meropenem resistance.

In our present study, we observed the role of the efﬂux pump against meropenem.

Further, in addition to contributing to the multidrug resistance phenotype, the AcrAB

efﬂux pump may represent a novel virulence factor required for K. pneumoniae to resist

innate immune defense mechanisms of the lung, thus facilitating the onset of pneumo-

nia [10,11]. To the best of our knowledge, among Klebsiella pneumoniae isolates, the efﬂux

pump’s role in acquiring meropenem resistance has not been elucidated.

Curcumin is one of the most studied polyphenols extracted from Curcuma longa’s

rhizomes; literature is inundated with reports documenting its promise to target the com-

plex features of multidrug resistance (MDR) [12]. However, the doses required are much

higher due to phenolic rings and their β-diketone unit [13]. The major limitation of using

curcumin as a treatment option is its high hydrophobicity and instability at elevated pH

levels. Despite various attempts to improve its aqueous solubility and stability, the problem

remains largely unanswered [14]. A more recent approach reported attempted use of nano

and quantum formulations. These quantum dots’ biological activities have shown promise,

but as it is the nano/quantum formulation, its systemic use is still debatable [15,16].

Addressing the urgent need for better antibacterial agents/antibiotic adjuvants, we

herein reported a water-soluble bifunctional curcumin derivative and evaluated it’s po-

tential to combat efﬂux-mediated resistance of meropenem. A signiﬁcant number of

meropenem-resistant isolates showed minimum inhibitory concentration (MIC) against

Antibiotics 2021, 10, 388

3 of 30

meropenem in the sensitive range in the presence of a sub-inhibitory concentration of

water-soluble curcumin.

This study aimed to report water-soluble bifunctional curcumin as a biocompatible

efﬂux-pump inhibitor, carbapenemase inhibitor and meropenem-potentiating possible

drug candidate, outlining the mechanistic underpinnings.

2. Results

2.1. Antimicrobial Susceptibility Proﬁle

One hundred thirty-one isolates (131, 83.44%) of K. pneumoniae were multidrug-

resistant as per our set criteria (Supplementary Figure S5). A majority of isolates (n = 155,

8.72%) were resistant to the aminopenicillin class (ampicillin). Similarly, 144 (91.72%),

54 (98.08%), and 138 (87.89%) isolates were found resistant to cephalosporins (namely

9

1

cefepime, cefuroxime, and ceftazidime, respectively). Worryingly, a very similar trend was

noted against carbapenem antibiotics. A total of 98 (62.42%), 115 (73.25%), and 111 (70.70%)

isolates were found resistant to ertapenem, meropenem, and imipenem, respectively.

2.2. Detection of Carbapenemase Production

Out of 157 clinical Klebsiella pneumoniae isolates, 31 isolates (19.51%) were found

positive for carbapenemase production by mCIM, while 65 isolates (41.40%) were found to

be eCIM positive. Of note, a total of 61 isolates (38.85%) were found to be mCIM negative,

indicating other mechanisms of resistance against meropenem, imipenem, and ertapenem

(Table 1, Supplementary File S3). Interestingly, in the current study, we did not ﬁnd any

isolate exhibiting indeterminate results. Figure 1a,b represents, respectively, the phenotypic

view of mCIM negative (ATCC BAA1706) and mCIM positive (ATCC BAA1705) control

strains (Figure 1). Figure 1c–e represents test strains with three different results (Figure 1).

Table 1. mCIM and eCIM results for clinical isolates of Klebsiella pneumoniae.

Condition

Number of Isolates (n = 157)

Interpretation

mCIM positive, eCIM positive

mCIM positive, eCIM negative

mCIM negative, eCIM negative

65 (41.40%)

31 (19.51%)

61 (38.85%)

Member of Ambler Class B

Member of Ambler Class A or D

Non-carbapenemase producer

2

.3. Molecular Typing of Klebsiella Pneumoniae Isolates Using Enterobacterial Repetitive

Intergenic Consensus (ERIC)-PCR

The ERIC-PCR proﬁles demonstrated that many isolates were genetically diverse,

e.g., isolates 1, 3, and 12. However, some isolates (e.g., 7, 10, 30, 31, 79, and 82) were

closely related. The phylogenetic tree (dendrogram) and the diced gel lanes generated

after ERIC-PCR (Supplementary Figure S6) indicated signiﬁcant intraspeciﬁc variations.

The 96 clinical isolates that were found to be carbapenemase producers seemed to form

79 clusters. Each cluster depicted a different ERIC proﬁle, describing the genetic diversity

of Klebsiella pneumoniae clinical isolates (Supplementary Figure S6).

2.4. Synthesis of Water-Soluble Curcumin (Curaq)

The synthesis of galactose-clicked curcumin was accomplished as delineated ear-

lier [17]. Brieﬂy: initially, curcumin was propargylated by treating it with propargyl

bromide in the presence of K CO in dry DMF under an argon atmosphere at room temper-

2

3

ature for 48 h. This yielded curcumin di-alkyne, as orange-red colored semisolid, in good

yield (55%). After the synthesis of the alkyne part, a clickable azide part was constructed

from D-galactose by implementing high yielding steps, including acetate protection (using

acetic anhydride), followed by selective anomeric bromination (2,3,4,6-Tetra-O-acetyl-D-

galactopyranosyl bromide). We then substituted, employing sodium azide in DMF to

afford the galactose azide (2) in overall 74% yield. Furthermore, galactose azide (2) was

reacted with curcumin di-alkyne (4) using CuSO₄5H O and NaAsc in the presence of

·

2

Antibiotics 2021, 10, 388

4 of 30

THF/H O, which resulted in regioselective 1, 4 triazolyl product (

5) in good yield. In

2

the end, the synthesised scaffold 5 was deacetylated using the (Zemplèn reaction)-a pro-

cedure to obtain a free hydroxyl group of curcumin 1,4 triazolyl di-galactose (6). (For

detailed experimentation, see the Results section). All reactions were performed at room

temperature under standard conditions. Thin-layer chromatography (TLC) was executed

on Merck 60 F₂₅₄silica gel, precoated on aluminum plates and exposed under a UV lamp

(

λmax @ 254 nm) by spraying with the methanolic-H SO solution. This was followed by

2 4

◦

charring (for carbohydrate moieties) by heating at ~100 C–120 C. NMR spectra were

recorded on a JEOL AL500 FT-NMR spectrometer (500 MHz for H NMR and 125 MHz

for C NMR) in CDCl₃_,DMSO, and D O (for deacetylated scaffold). Chemical shifts

1

13

2

were provided in ppm downﬁeld from internal TMS, and J values were depicted in Hz.

Column chromatography was performed using silica gel 234–400 mesh, E-Merck grade

using n-hexane, ethyl acetate and DCM as the eluent.

Figure 1. Pictorial demonstration of modiﬁed carbapenem inactivation method (mCIM), EDTA-carbapenem inactivation

method (eCIM). ( ) A negative control, where both mCIM and eCIM results are negative (ATCC BAA1706). ( ) Positive

control, where both mCIM and eCIM results are positive (ATCC BAA1705). ( ) Representative clinical isolate (no-447)

where both mCIM and eCIM results are negative. ( ) Representative clinical isolate (no-754) where both mCIM and eCIM

results are positive. ( ) Representative clinical isolate (no-1974) where mCIM assay is positive while eCIM result is negative.

A

B

C

D

E

Antibiotics 2021, 10, 388

5 of 30

2.5. Photophysical Behaviour and Solubility

At ﬁrst, we dissolved the Curaq (10 mg/mL) in MilliQ water to see its physical

appearance (Figure 2b). Unlike the aqueous insolubility of native curcumin (perceived as

yellow ﬂoccules present at the top of the aqueous phase and heterogeneity of suspension,

seen throughout, as reported earlier) we noted a dark yellow (mustard oil) color in the

water-soluble curcumin derivative [12].

Figure 2.

spectrum of Curaq and native curcumin (nCur). Inset is the zoomed-in view of the spectrum from 300 nm to 550 nm.

D) Standard plots of absorbance v/s concentration for Curaq and nCur at 272 nm.

(A) Scheme for the synthesis of water-soluble curcumin (Curaq). (B) Physical appearance of Curaq. (C) UV-Vis

(

Antibiotics 2021, 10, 388

6 of 30

The UV-Visible absorption spectrum of Curaq was recorded in water (Figure 2c). Three

absorption bands were obtained for Curaq at ~192, 272, and 324 nm. The absorption bands

at ~192 and 272 nm were obtained in the UV region of the electromagnetic spectrum. In

contrast, a broad absorption band was obtained at ~425–512 nm region and a shoulder at

~

324 nm extending to the visible region (Figure 2c).

Finally, we compared the solubility of Curaq with native curcumin. We plotted the

calibration curve by plotting the concentrations versus absorbance at λmax ~272 nm, and

then the slope was calculated from the plot (~0.2359 for Curaq slope, ~0.5409 for native

curcumin slope). We then dissolved the maximum dissolvable amount of Curaq into

MilliQ water and removed the undissolved part by centrifugation. At the same λmax, we

determined the absorbance of unperturbed MilliQ and native curcumin. We then calculated

the solubility by applying the following Equation (1):

Solubility = (Absorbanceatλmax)/Slope

(1)

The solubility of Curaq was 32,146.91 times higher than its native form (soluble up to

5.934 mg/mL, while native curcumin is soluble up to 0.185 µg/mL).

2

.6. Minimum Inhibitory Concentration (MIC) Determination among Carbapenemase Producers

2.6.1. Minimum Inhibitory Concentration (MIC) Determination

The MIC of meropenem for 7 (7.3%) out of the 96 tested clinical isolates was less than

1

µg/mL (Table 2). Only 9 (9.4%) out of 96 clinical isolates were found to be sensitive to

meropenem. However, among the carbapenem class, the sensitivity proﬁle of ertapenem

n = 13, 13.54%) was better than that of meropenem, which in turn was followed by

imipenem (n = 11, 11.45%) (Table 2). Among the protonophores, valinomycin was highly

effective with a MIC value ranging from 1–64 g/mL. Similarly, the most ineffective was

verapamil, whose MIC ranged from 32–512 g/mL. However, the MIC of CCCP ranged

g/mL. Similarly, the MIC of Curaq ranged from 16–64 g/mL (Supplementary

(

µ

from 16–32

Figure S4).

µ

Table 2. The tally of the range of minimum inhibitory concentration (µg/mL) of meropenem, imipenem, and ertapenem—

along with protonophore, efﬂux pump inhibitor, proton pump inhibitor, and soluble Curcumin (Curaq)—against

carbapenemase-producing clinical isolates of K. pneumoniae (n = 96).

Drug Concentration

<

1

2

4

8

16

32

64

128

256

512

1024

>1024

Drugs

µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL

Mero

Imi

Erta

CCCP

Vera

Vali

7

5

7

-

2

6

-

5

-

44

-

6

13

4

-

29

-

18

20

22

-

17

-

16

19

15

12

-

6

14

18

14

16

43

-

82

17

8

13

37

-

11

9

8

4

-

1

2

-

42

-

31

-

23

-

Curaq

-

Mero, Imi, Erta, Vera, Vali, and Curaq stand for meropenem, imipenem, ertapenem, verapamil, valinomycin and water-soluble curcumin,

respectively.

2

.6.2. Alteration in Minimum Inhibitory Concentration (MIC) after Adding CCCP,

Verapamil, Valinomycin and Curaq

The effect of CCCP, verapamil, valinomycin and Curaq on the growth of drug-resistant

Klebsiella isolates combined with meropenem was investigated in microtiter plates by the

log₁₀CFU/mL reduction, and a tally of fold reduction is represented in Table 3. However,

the MIC of meropenem was found to range between 4–256

tant isolates of K. pneumoniae; after adding Curaq, the MIC was reduced signiﬁcantly to

between 1–8 g/mL. Earlier, only 9 (9.4%) Klebsiella isolates were found to be sensitive

µg/mL (n = 87) against resis-

≤

µ

Antibiotics 2021, 10, 388

7 of 30

to meropenem. After adding Curaq (8

µg/mL), 85 (88.54%) isolates became sensitive to

meropenem. However, native curcumin failed to potentiate meropenem in the tested

concentration range. Similarly, 59 (61.45%), 36 (37.5%), and 74 (77.08%) isolates became

sensitive to meropenem after adding CCCP, verapamil, and valinomycin, respectively

(

Table 4).

Table 3. The fold reduction in minimum inhibitory concentration (

µg/mL) of meropenem combined with CCCP, verapamil,

valinomycin, and soluble curcumin against clinical isolates of K. pneumoniae (n = 97) and their gross numbers.

Meropenem +

CCCP

No of Isolates)

Meropenem +

Verapamil

(No of Isolates)

Meropenem +

Valinomycin

(No of Isolates)

Meropenem +

Soluble Curcumin

(No of Isolates)

Fold Reduction in

MIC

(

No Change

13

3

8

19

26

17

8

20

36

27

11

2

-

3

21

42

23

6

1

-

3

24

51

13

5

∆

2

4

6

8

∆

10

12

14

∆

-

2

-

Table 4. The change in the number of meropenem sensitive isolates when combined with CCCP, verapamil, valinomycin,

and soluble curcumin against clinical isolates of K. pneumoniae (n = 97).

Meropenem +

CCCP

No of Isolates)

Meropenem +

Verapamil

(No of Isolates)

Meropenem +

Valinomycin

(No of Isolates)

Meropenem +

Soluble Curcumin

(No of Isolates)

(

No of meropenem sensitive

isolates without the addition

No of meropenem sensitive

isolates after addition

9

(9.4%)

9 (9.4%)

5

9 (60.82%)

36 (37.11%)

74 (76.28%)

85 (87.62%)

2.6.3. Phenotypic Observation of Synergy and Its Quantiﬁcation Using the Bliss Model

The signiﬁcant reduction in MIC of meropenem upon addition with Curaq indicated its

potential synergism. Therefore, at ﬁrst, it was observed over a solid medium by dissolving

the sub-inhibitory concentrations of native curcumin and Curaq in the agar mediums.

Then, a change in the zone of inhibition was observed against in-vogue drugs, particularly

meropenem. We noted a signiﬁcant increase in the zone of inhibitions of all in-vogue

drugs over the plate with Curaq compared to untreated ones (Figure 3a,b). However,

native curcumin failed to show such signiﬁcant alterations (Figure 3c). After phenotypic

observations, the possible synergism of meropenem with Curaq was then quantiﬁed using

the Bliss model of synergy. The degree of synergism was found to be 0.87, which indicated

signiﬁcant synergy between meropenem and Curaq at all investigated concentrations

(

Figure 3d).

Subsequently, we determined the FIC index as 0.15, which endorsed the potential

synergism.

Antibiotics 2021, 10, 388

8 of 30

Figure 3.

strain against 7 drugs, namely: imipenem (7 mm), meropenem (11 mm), ertapenem (8 mm), cefepime (5 mm), piperacillin-

tazobactam (5 mm), amikacin (5 mm), and ceftriaxone (5 mm). ( ) Phenotypic depiction of resistance (employing Kirby–

Bauer disc diffusion method) of a Klebsiella pneumoniae strain against 6 drugs, namely: imipenem (28 mm), meropenem

29 mm), ertapenem (28 mm), cefepime (16 mm), piperacillin-tazobactam (27 mm), and amikacin (26 mm) after adding

g/mL Curaq in the agar medium. ( ) Phenotypic depiction of resistance (employing Kirby–Bauer disc diffusion

method) of a Klebsiella pneumoniae strain against 6 drugs, namely: imipenem (21 mm), meropenem (18 mm), ertapenem

10 mm), cefepime (8 mm), piperacillin-tazobactam (7 mm), and amikacin (5 mm) after adding 16 g/mL nCur in the agar

medium. ( ) The Bliss Model for synergy, conﬁrming a synergistic effect (S = 0.87), between Curaq and meropenem against

Klebsiella pneumoniae.

(A) Phenotypic depiction of resistance (employing Kirby–Bauer disc diffusion method) of a Klebsiella pneumoniae

B

(

8

µ

C

(

µ

D

2.7. Detection of Multidrug Resistance and Virulence Determinants Using PCR

Figure 4A depicts the gel image of bla__K_P_Cgene detection. The results obtained by

mCIM and eCIM phenotypic assays were endorsed by genetic determination by detect-

ing the bla__K_P_Cgene. The FimH-1 gene coding for type 1 and type 3 ﬁmbrial adhesins

was found in all pus and blood isolates (Figure 4B). However, FimH-1 was found less

prevalently among urine isolates (Figure 4C). Similarly, all the tested Klebsiella isolates,

irrespective of their source of isolation, tested positive for the presence of the RmpA gene,

responsible for capsular polysaccharide synthesis (Figure 4D). It is worth mentioning that

virulence proﬁles were found to vary among K. pneumoniae strains that possessed the same

clonal relationship by ERIC-PCR.

Antibiotics 2021, 10, 388

9 of 30

Figure 4. (A) Gel image of the PCR for bla__K_P_Cgene detection. Lane 1: bla__K_P_Cgene present (size 1010 bp) in the positive

control. Lane 2: bla__K_P_Cgene present (size 1010 bp) in representative isolate 754. Lane 3: bla__K_P_Cgene present (size 1010 bp)

in representative isolate 1974. Lane 4: bla__K_P_Cgene absent (size 1010 bp) in representative isolate 447. Lane 5: bla__K_P_Cgene

absent (size 1010 bp) in the negative control. (

isolates. Lane 1: FimH-1 gene (size 180 bp) present in the positive control. Lanes 2–12: FimH-1 gene (size 180 bp) present

in the test blood (lanes 2–7) and pus (lanes 8–12) isolates. ( ) Gel image of the PCR product for FimH-1 detection among

urine isolates. Lane 1: FimH-1 gene (size 180 bp) present in the positive control. Lanes 2–12: FimH-1 gene (size 180 bp)

present in the test urine isolates. Note the absence of FimH-1 bands in lanes 2, 9 and 12. ( ) Gel image of the PCR product

for RmpA gene detection. Lane 1: RmpA gene (size 435 bp) present in the positive control. Lanes 2–10: RmpA gene (size

35 bp) present in the test isolates. Lane 11: RmpA gene (size 435 bp) absent in the negative control.

B) Gel image of the PCR product for FimH-1 detection among blood and pus

C

D

4

2.8. Detection of Major Efﬂux Pumps System

The high prevalence of the multidrug efﬂux pump system (AcrAB-TolC) was signiﬁ-

cantly correlated with the MDR pattern in our study. The AcrAB-TolC efﬂux pump system

was present among 87.62% of the total tested ICU isolates of Klebsiella pneumoniae. However,

among 12 isolates, an incomplete AcrAB-TolC efﬂux pump system was detected, signifying

that TolC was not present (Figure 5a).

0

2

.9. 1,2 -Dinaphthylamine Accumulation Assay

The current study found that both Curaq and CCCP inhibited 1,2’ DNA efﬂux in a

dose-dependent manner (Figure 5b). The ﬁrst efﬂux inhibitory effects of Curaq were seen at

g/mL, whereas Curaq abolished the efﬂux almost entirely at 8 g/mL. Efﬂux inhibition

at 2 µg/mL concentration was not signiﬁcantly higher than that at 1 µg/mL.

1

µ

Antibiotics 2021, 10, 388

10 of 30

Figure 5. (A) Gel image of the PCR product for AcrAB-TolC efﬂux pump system detection. Lane 1: TolC gene (size 527 bp)

present in the positive control (red arrow). Lane 2: Neither TolC nor AcrAB genes present in the negative control. Lane 3:

TolC gene present (size 527 bp) in the test isolate (red arrow). Lane 4: Neither TolC nor AcrAB genes present in the test

isolate. Lane 5: AcrAB gene (size 312 bp) present in the positive control (blue arrow). Lane 6: Both TolC (red arrow)

and AcrAB (blue arrow) genes present in the test isolate. Lane 7: AcrAB gene (size 312 bp, blue arrow) present in the

test isolate. Lane 8: Both TolC (red arrow) and AcrAB genes (blue arrow) present in the test isolate. Lane 9: TolC gene

present (size 527 bp, red arrow) in the test isolate. (

Klebsiella pneumoniae. Energization initiated with 50 mM glucose at 20 s. Pre-energization ﬂuorescence intensity adjusted to

00 relative ﬂuorescence units (RFU).

B) Dose-dependent inhibition of 1,2’ DNA efﬂux by Curaq in the

1

2.10. Expression Pattern of acrA, acrB and TolC in the Presence of Curaq

Meropenem-induced over-expression of the AcrAB-TolC efﬂux system was noted

among eighty-four isolates (86.6%); however, the differential expressions of acrA, acrB, and

tolC in the presence of different concentrations of meropenem were found to be changed.

For instance, meropenem triggered the over-expression of acrA in a dose-dependent man-

ner. At all the tested concentrations, meropenem signiﬁcantly triggered the expression of

acrA; however, at 1 and 4

Figure 6a). The synthesised Curaq signiﬁcantly downregulated the meropenem-induced

overexpression of acrA (Figure 6a). However, the expression of acrB was different. It re-

mained almost the same at all tested concentrations except for 0.5 and 1 g/mL. (Figure 6b).

µg/mL concentration, the augmentation was more signiﬁcant

(

µ

The Curaq was found to downregulate the expression of acrB; however, compared to acrA,

downregulation was not very pronounced. Interestingly, the transcriptional expression of

tolC was signiﬁcantly augmented in response to the increasing concentration of meropenem

(

Figure 6c). Similarly, to the case of acrA, Curaq signiﬁcantly inhibited the expression of

tolC. Overall, the synthesised Curaq was found to dramatically downregulate the tripartite

AcrAB-TolC efﬂux system, except for acrB (in comparison to acrA and tolC). However, it

was found to be signiﬁcantly downregulated in comparison to the meropenem-induced

expression (Figure 6d).

Antibiotics 2021, 10, 388

11 of 30

Figure 6. Effect of different variables on the expression proﬁle of the AcrAB-TolC system. (

of Curaq (8 g/mL), CCCP (10 g/mL), various concentrations of meropenem (0.5–4

and meropenem (4 g/mL) with Curaq (8 g/mL) on the expression of acrA. ( ) Effect of Curaq

g/mL), various concentrations of meropenem (0.5–4 g/mL), and meropenem

g/mL) with Curaq (8 g/mL) on the expression of acrB. ( ) Effect of Curaq (8 g/mL), CCCP

g/mL), various concentrations of meropenem (0.5–4 g/mL), and meropenem (4 g/mL) with

g/mL) on the expression of tolC. ( ) Effect of Curaq (8 g/mL) and combinations of

meropenem (4 µg/mL) with Curaq (8 µg/mL) on the expression of acrA, acrB and tolC.

A

) Effect

µ

µg/mL),

µ

B

(

8

4

10

µ

g/mL), CCCP (10

µ

C

µ

Curaq (8

µ

D

µ

2.11. Effect over Carbapenemases

2.11.1. Spectrophotometric Analysis of Meropenem

The absorption spectrum of meropenem in phosphate-buffered saline (PBS) was

examined within the wavelength range of 220 nm to 400 nm. We noted the absorption peak

at 295 nm (Figure 7a). The absorbance of meropenem at 295 nm correlated linearly with

concentrations of up to 128 µg/mL (Figure 7b).

Antibiotics 2021, 10, 388

12 of 30

2.11.2. Hydrolysis of Meropenem by Bacterial Cells

Enzymatic hydrolysis of meropenem by carbapenemase-producing and non-

carbapenemase-producing strains was examined by spectrophotometry. The direct com-

parison of the gross absorbance of carbapenemase-producing and non-producing bacterial

suspensions with meropenem was cumbersome at 295 nm, owing to differences in the

baseline absorbance spectra of each bacterial type (Figure 7c). Therefore, we performed

baseline correction by subtracting a bacterial suspension’s absorbance without meropenem

from the meropenem containing the bacterial suspension. Carbapenemase-producing

bacteria-hydrolysed meropenem was evident from the disappearance of the absorption

peak of meropenem at 295 nm. In contrast, the meropenem peak remained almost intact in

non-carbapenemase-producing bacterial suspension (Figure 7d).

Figure 7.

(A) Absorption spectra of meropenem at 50, 100, and 200 µg/mL concentrations. The bars show standard

deviations of three independent replicates. (

at 295 nm. Curve-ﬁtting with linear regression analysis performed (R = 0.9972). (

B

) Relationship between the meropenem concentration and the absorbance

2

C) Spectral analysis of meropenem

hydrolysis before background correction. (D) Spectral analysis of meropenem hydrolysis after background correction.

2.11.3. Quantiﬁcation of Bacterial Hydrolytic Activity to Meropenem

The hydrolytic activities of clinical test isolates were investigated using spectrophotom-

etry, and % hydrolysis was calculated. Metallo

β-lactamase-type carbapenemase producers

(both mCIM and eCIM positive, n = 25) exhibited signiﬁcantly higher hydrolytic activi-

ties compared to serine-type carbapenemases (mCIM positive but eCIM negative, n = 25)

after a 30-min incubation with meropenem (Figure 8). With increasing incubation times,

%

hydrolysis by both types of carbapenemase producers gradually increased (Figure 8).

However, after 120 min of incubation, no signiﬁcant difference in % hydrolysis was noted

among isolates with different MICs (Figure 8).

Antibiotics 2021, 10, 388

13 of 30

Figure 8. The time-dependent % hydrolysis of meropenem by Metallo

β-lactamase (MBLs)-producing

Klebsiella pneumoniae (n = 25) and serine carbapenemase-producing Klebsiella pneumoniae (n = 25)

isolates after 30, 60, 120, and 180 min of incubation. The black bars show the median with the

interquartile range. The horizontal dashed lines show the separation zones for each time.

2.11.4. Carbapenemases Inhibition Kinetics by Curaq

In the presence of Curaq, the carbapenemase inhibition was found nearly linear at all

time points. The initial reaction rate for each substrate or substrate-inhibitor concentration

under steady-state conditions (<5% of substrate consumed) was calculated from the slope

of the initial linear phase of the respective time course. Inhibition constants (K ) were

i

evaluated by nonlinear ﬁtting of the initial velocities at various concentrations of the

substrates and inhibitors. The equations for different inhibition models were implemented

in GraphPad 8.3.0. Best ﬁts were obtained with the noncompetitive inhibition model using

the Equation (2):

Vmax [S]

v =

ꢀ

ꢁ

(2)

[

K_i

I]

(

Km + [S]) 1 +

The inhibition constants (K ) and % inhibitions are shown with their corresponding

i

standard errors obtained from the ﬁt (Table 5). The reaction progress curves reﬂected a

single unperturbed velocity (at each concentration) for the onset and inhibition progression

(Figure 9). However, the addition of Curaq at 8

µg/mL concentration inhibited meropenem

hydrolysis by 50% in tested Klebsiella isolates. At higher doses of 16 and 32

µg/mL,

inhibition was relatively weaker (44.86% and 44.96%, respectively). The somewhat lessened

hydrolysis inhibition may have been due to differences in cellular permeability based on

the concentration gradient. This needs further elucidation.

Table 5. Kinetic parameters of noncompetitive inhibition of carbapenemases by Curaq (I).

Parameters

Untreated

[I] = 4.46 µM

[I] = 9.34 µM

[I] = 18.69 µM

[I] = 37.38 µM

Km (µM)

Vmax (µM/Sec)

4.702

0.7742

4.702

0.727

8.741

0.984

33.7%

4.702

0.628

9.063

0.981

50%

4.702

0.659

23.02

0.984

44.86%

4.702

0.647

45.75

0.980

44.96%

K (µM)

-

i

2

R

%

Inhibition

2

.12. Measurement of the Electrical Potential

The ﬂow cytometry and confocal microscopic studies revealed Curaq-mediated per-

turbations in membrane electric potential using DiOC (3)-based assay. As depicted

2

in Figure 10, we conﬁrmed that Curaq and meropenem in combination (8

µg/mL and

4

µ

g/mL) fostered considerable back-shift in the DiOC (3) ﬂuorescence—and hence aug-

2

mented left shifting (Figure 10). This was analogous to the known electric potential

disrupter CCCP. However, the incorporation of native curcumin, even at a concentration of

Antibiotics 2021, 10, 388

14 of 30

512

µg/mL, resulted only in slight left shifting, indicating moderately perturbed electric

potential (Figure 10). The results suggest that the membrane potential of the Gram-negative

Klebsiella pneumoniae was signiﬁcantly altered after exposure to Curaq and meropenem. For

area selection (in %) see Supplementary Information S7.

Figure 9.

(A) Michaelis–Menten (MM) plot of the hydrolysis of meropenem by carbapenemase crude extract for 15 min.

(

B) MM plot of inhibition of carbapenemase-mediated meropenem hydrolysis by Curaq in crude extract for 15 min.

Figure 10. Flow cytometry analyses of Klebsiella pneumoniae with DiOC (3) to explore changes in its electrical potential,

2

unveiling the progressive leftward shifting indicative of alterations in electric potential. In total, 1,000,000 cells taken

into account for each analysis. (

most of the cell population (97.6%) retain the dye, indicating unperturbed membrane electric potential. (

Curaq (8 g/mL)-treated Klebsiella isolates labeled with DiOC (3). Note the signiﬁcant left-shifting (78.8%) and decrease in

intensity, indicating perturbations in membrane electrical potential. (

g/mL) combination-treated Klebsiella isolates labeled with DiOC (3). Note the further left-shifting of the treated cell

A) Histogram of untreated logarithmic Klebsiella cells labeled with DiOC (3). Note that

2

B) Histogram of

µ

2

C

) Histogram of Curaq (8 µg/mL) and meropenem

(4 µ

2

population (67.5%) and a considerable decrease in intensity compared to the untreated population, indicating signiﬁcant

perturbations in the membrane electrical potential. ( ) Dot plot of untreated logarithmic Klebsiella pneumoniae cells labeled

with DiOC (3). ( ) The overlay of the dot plot of Curaq (8 g/mL)-treated Klebsiella pneumoniae tagged with DiOC (3). Note

the left-shifting (78.8%) of the red dots from the bulk purple dots, indicating perturbations in membrane electrical potential.

) The overlay of the dot plot of Curaq (8 g/mL) and meropenem (4 g/mL) combination-treated Klebsiella isolates labeled

D

E

µ

2

(F

µ

with DiOC (3). Note the left-shifting (67.5%) of the red dots from the bulk purple dots indicating augmented perturbations

2

in membrane electrical potential fostered by the combination.

Antibiotics 2021, 10, 388

15 of 30

The disruption of electric potential orchestrated by the Curaq and meropenem on

multidrug-resistant clinical Klebsiella pneumoniae isolate (10825/2019) was further inves-

tigated by confocal microscopy. The freshly grown bacteria were then challenged with

a sub-lethal concentration of Curaq (8 µg/mL) and meropenem (0.5, 1, 2, and 4 µg/mL),

followed by staining with DiOC (3) and subsequent imaging. Panel A depicts the untreated

2

Klebsiella pneumoniae at the start time, while panel B is the CCCP-treated Klebsiella pneumo-

niae after 18 h of growth (Figure 11A,B). One can note intense green signals coming out,

specifying the astounding CCCP-mediated membrane electrical potential perturbations.

Interestingly, panel C represents the meropenem (4

ter 18 h, showing some green signals—indicating some alterations in the electrical potential

Figure 11C).

µg/mL)-treated Klebsiella pneumoniae af-

(

Figure 11. The confocal microscopic validation of electric potential perturbations mediated by meropenem (4

µ

g/mL),

g/mL) over multidrug-resistant clinical

) CCCP-treated Klebsiella pneumoniae at t = 18 h.

) Curaq (8 g/mL)-treated Klebsiella pneumoniae at

g/mL)-treated Klebsiella pneumoniae at t = 18 h. ( ) Curaq (8 g/mL)-

and meropenem (4 µg/mL)-treated Klebsiella pneumoniae at t = 18 h.

Curaq (8

Klebsiella pneumoniae. (

) Meropenem (4

t = 18 h. ( ) Curaq (8

µg/mL), and the combinations of Curaq (8

µ

g/mL) and meropenem (2, 4

µ

A

) Untreated Klebsiella pneumoniae at t = 0 h. (B

(

C

µg/mL)-treated Klebsiella pneumoniae at t = 18 h. (

D

µ

E

µ

g/mL)- and meropenem (2

µ

F

µ

Interestingly, the test Klebsiella isolates exhibited a signiﬁcant increase in green signals

after treatment with Curaq (8 g/mL), indicating the disruption of the bacterial cells’ elec-

tric potential (Figure 11D). Of note, the combination of Curaq (8 g/mL) and meropenem

g/mL) triggered a substantial increase in green signals, showing their relatively strong

capacity to affect electric potential (Figure 11E). However, when the meropenem concentra-

tion was escalated to 4 g/mL, extensive disruption in electric potential was perceived, as

µ

(2 µ

µ

evinced by the intense green signals and diminished red signals (Figure 11). The results

portray a dose-dependent impact on electrical potential through the combination of Curaq

and meropenem.

2.13. Membrane Depolarisation Assay

The results of efﬂux inhibition and perturbed electric potential were very encourag-

ing; therefore, we evaluated Curaq and meropenem’s capacity for fostering membrane

depolarisation (i.e., triggering the decrease in membrane potential). To explore if Curaq

combined with meropenem resulted in membrane depolarisation, ﬂow cytometry-based

Antibiotics 2021, 10, 388

16 of 30

investigations were executed, employing the membrane potential-sensitive dye, DiSC -5.

3

The dye DiSC -5 partitions in the polarised cells showed reduced/quenched ﬂuorescence.

3

However, it failed to partition in the depolarised membrane; hence, ﬂuorescence intensity

increased. Therefore, the untreated control cells produced a low signal intensity, whereas

the depolarised and leaky cells produced a high signal intensity. The meropenem and

Curaq alone fostered membrane depolarisation in 33.2% and 74.4% of the total bacterial cell

population, respectively (Figure 12C,D). Strikingly, exposure to the combination enabled a

colossal increase in the depolarised/leaked cell population (0.6% to 96.0%) compared to

the untreated cells (Figure 12A,E,F). The meropenem and Curaq combination results were

comparable to the CCCP-treated cells (Figure 12B). For area selection, see Supplementary

Information (Supplementary Information S8).

Figure 12. Flow cytometry analysis of Klebsiella pneumoniae with membrane potential-sensitive dye (DiSC -5) to explore

3

its membrane potential alterations. (

control). ( ) Histogram of CCCP (10

The panels show the increase in cell population (96.8%) that took up DiSC -5, depicting almost complete membrane

A) Histogram of untreated Klebsiella pneumoniae cells labeled with DiSC -5 (negative

3

B

µg/mL)-treated Klebsiella pneumoniae cells labeled with DiSC -5 (positive control).

3

depolarisation. (C) Histogram of meropenem (4 µg/mL)-treated Klebsiella pneumoniae cells labeled with DiSC -5. The panels

3

show the increase in the cell population (33.2%) that took up DiSC -5, denoting the increase in membrane depolarisation.

3

(

D) Histogram of the Curaq (8

µg/mL)-treated Klebsiella pneumoniae cells labeled with DiSC -5. The panel demonstrates

3

the considerable right-shifting of the cell population (74.4%) that took up DiSC -5, indicating signiﬁcant depolarisation.

3

(

E) Histogram of Curaq-meropenem (8

µg/mL + 2 µg/mL)-treated Klebsiella pneumoniae cells labeled with DiSC -5. The

3

panel demonstrates the signiﬁcant right-shifting of the cell population (91.4%) that took up DiSC -5, indicating massive

3

depolarisation. (F) Histogram of Curaq-meropenem (8 µg/mL + 4 µg/mL)-treated Klebsiella pneumoniae cells labeled with

DiSC -5. The panel demonstrates the cell population’s signiﬁcant right-shifting, encompassing 96.0% of the total cell

3

population that took up DiSC -5, indicating colossal depolarisation.

3

3. Discussion

K. pneumoniae is one of the primary agents responsible for nosocomial infections

across the globe. It harbors a wide array of virulence and pathogenicity factors, e.g., the

capsule, lipopolysaccharide, carbapenemase, efﬂux systems, adhesins, etc. [18]. Globally,

Antibiotics 2021, 10, 388

17 of 30

the rapid surge in the incidence of Klebsiella infections in recent years indicates the indis-

criminate use of antibiotics that has fostered the emergence of multidrug resistance among

K. pneumoniae. With time, K. pneumoniae isolates have exhibited augmented carbapene-

mases and efﬂux pump expression, indicating the most common reasons for its multidrug

resistance [6,8,19–21].

In K. pneumoniae, mainly AcrAB and mdtK efﬂux systems are operative, belonging

to the resistance-nodulation-division (RND) and multi-antimicrobial extrusion (MATE)

families of efﬂux pumps, respectively [22]. The AcrAB-TolC efﬂux system is responsi-

ble for imparting resistance against quinolones, tetracyclines, and chloramphenicol in

various MDR isolates. Some reports suggest their role in conferring resistance against

cephalosporins and carbapenems [10

resort used to treat and manage Gram-negative isolates. Among all the Enterobacteriaceae

members, the most MDR has. been observed in Klebsiella pneumoniae isolates [ 26 27].

,23–25]. Currently, carbapenems are the drugs of last

8, ,

Therefore, molecular typing and analyses of these clinical isolates’ major virulence deter-

minants may lead to more in-depth insights into multidrug-resistant Klebsiella pneumoniae

infections. Enterobacterial repetitive intergenic consensus (ERIC) PCR was utilised to as-

sess clonal relatedness in the present study. ERIC sequences occurred in extragenic regions

of bacterial genomes in multiple copies in Enterobacteriaceae members and are imperfect

palindromes of 127-bp. ERIC-PCR has widely been used as a method for distinguishing

bacterial isolates. It is believed that the positions of copies of the ERIC sequence vary

among different isolates of the same bacteria [28]. Therefore, the variation can easily

be documented using ampliﬁcation products when running on an agarose gel. Out of

9

7

7 multidrug resistant K. pneumoniae isolates in the current study, ERIC-PCR revealed

9 unique patterns. The present study’s observations agreed with Lai et al., who reported

high heterogeneity due to variations in nucleotide sequences among K. pneumoniae iso-

lates [29]. However, in the present study, ERIC-PCR genotypic analyses failed to reveal

meaningful correlations with resistance patterns of K. pneumonia. Therefore, the current

study also highlights the inadequacy of ERIC genotyping in predicting resistance patterns

of K. pneumoniae. However, ERIC-PCR was sufﬁcient for highlighting clonal similarities

or differences, as in this method, two or more band differences are used as cut-offs for

distinction.

Furthermore, the resistance patterns and major virulence determinants among these

isolates were investigated. In the present study, 82.38% of the total isolates of K. pneumoniae

exhibited the multidrug resistance phenotype. However, in other studies carried out, the

prevalence of MDR K. pneumoniae isolates was found to be 71.1% [19]. The astoundingly

high rates of antimicrobial resistance detected in our study can be attributed to unrestricted

use of antibiotics.

In the present study, a total of 74 isolates (76.29%) were resistant to both imipenem

and meropenem. In this context, it is essential to highlight the signiﬁcant increase in

carbapenem resistance among K. pneumoniae isolates in India and the western world over

time. As highlighted by Hanna Sidjabat et al., as much as 70% of Klebsiella pneumoniae

isolates were found to be KPC-producing [30]. Similarly, as per the Centre for Disease

Dynamics, Economics and Policy (CDDEP) reports, up to 80% of all K. pneumoniae isolates

are resistant to cephalosporins. Up to 60% of isolates are nonsusceptible to carbapenems in

India. As per the data highlighted by Veeraraghavan et al., the percentage of carbapenem

resistance among Enterobacteriaceae members in India in 2010 was 44%, whereas it was

only 9% in 2008 [31]. This rapid upsurge in carbapenem resistance is indeed a serious

concern not for India but also for the whole world. Speciﬁcally, K. pneumoniae has evolved

a wide array of mechanisms (e.g., AmpC production, ESBL production, carbapenemase

production, etc.) [32]. In the present study, a total of 65 (41.40%) isolates (of 157) were

found to be metallo beta-lactamase producers, while 31 (19.51%) isolates were found to

be producers of serine carbapenemases. Similarly, 61 (38.85%) isolates were found to

be non-carbapenem producers. However, many of these isolates were also resistant to

meropenem and imipenem (which are carbapenems), indicating other resistance modes.

Antibiotics 2021, 10, 388

18 of 30

Treatment options against these carbapenemase-producing K. pneumoniae isolates

are minimal, and can include colistin or minocycline [33]. India’s minocycline resistance

trend is comparable with meropenem; therefore, minocycline can be incorporated into the

treatment regime as a carbapenem-sparing agent [34]. Similarly, owing to toxicity, the use

of colistin is limited. However, due to a recent scarcity of treatment options, the use of

colistin has been permitted for acute and life-threatening infections caused by Pseudomonas

aeruginosa and Acinetobacter baumannii [34]. Interestingly, in the present study, all the tested

K. pneumoniae isolates were sensitive to colistin (as investigated through the micro broth

dilution method).

Similarly, for adherence, type 1 and type 3 ﬁmbrial adhesins were the primary require-

ments among Enterobacteriaceae [35]. In the current study, the FimH-1 gene was present

in all pus and blood isolates. However, FimH-1 was found to be less prevalent among

urine isolates. Similarly, irrespective of the source of isolation, the RmpA gene was present

among all the tested isolates, indicating the inevitable role of capsular polysaccharides in

pathogenicity [36].

In all, the present study results suggest a need for an increased search for molecules or

tailored/fabricated compounds that may be effective against major virulence factors like

the production of carbapenemases, efﬂux systems, and bioﬁlm formation. Furthermore,

additives must be sought for their synergistic relationships with and ability to improve the

efﬁcacy of existing drugs.

Over time, the course of the development of antibiotics has signiﬁcantly changed.

For instance, more than 20 different antibiotics were synthesised/extracted/formulated

and then approved between 1940 and 1962 (22 years, an average of 1 antibiotic per year).

However, between 1962 and 2010, only two new antibiotics made it to the market. There-

fore, newer antibiotics’ paucity and an unprecedented increase in drug-resistant strains

compel us to look for other alternatives, e.g., phytochemicals or repurposing existing

antibiotics [37,38].

The present study sought to understand the contribution of efﬂux pumps in the current

prevalence of multidrug resistant K. pneumoniae from our tertiary care health center. Further,

the study aimed to evaluate the effects of Curaq over the efﬂux status and mechanistic

underpinnings of Curaq-mediated efﬂux inhibition of the tested pathogens. The incidence

of carbapenem resistance, especially against meropenem, has increased. To ensure efﬂux

pumps’ role among these resistant isolates, three different efﬂux pump inhibitors were

utilised: CCCP, verapamil, and valinomycin. All these EPIs have reduced the MIC of

meropenem. However, the MIC of meropenem among 13, 20, and 3 of the tested isolates

remained unperturbed even after adding CCCP, verapamil, and valinomycin, respectively.

Interestingly, in the present study, after adding Curaq, all the tested Klebsiella isolates

showed a reduction in the MIC of meropenem. Earlier, only 9 (9.27%) Klebsiella isolates

were found to be sensitive to meropenem; however, after adding Curaq (8

µg/mL), 85

(87.62%) isolates became sensitive to meropenem. The reduction in MIC to the susceptibility

breakpoint implies the efﬂux pumps’ involvement in resistance to antibiotics. Interestingly,

among carbapenems, ertapenem was more effective than imipenem and meropenem.

However, the increase in susceptibility of meropenem post-supplementation endorsed the

involvement of efﬂux pumps; as soon as Curaq blocked the efﬂux activity, the inhibitory

activity of meropenem grew more pronounced.

Subsequently, we quantiﬁed the degree of antimicrobial synergy for Curaq (Bliss coef-

ﬁcient) against Klebsiella pneumoniae at different concentrations, combined with increasing

meropenem concentrations. We considered positive values the marker of the synergistic

combination; negative values demonstrated antagonistic effects. The synthesised Curaq

exhibited complete synergy over the tested range of meropenem concentrations. Interest-

ingly, the highest synergy of Curaq was noted at 8 µg/mL concentration. Interestingly,

while the Bliss independence model indicated that some measurable synergy levels were

observed at all tested Curaq tested range, the FIC indices indicated synergy for the isolates

against which the MIC of Curaq was found to be 8 µg/mL.

Antibiotics 2021, 10, 388

19 of 30

However, the reduction in MIC in combination supports synergy. This may be impor-

tant for medical use and dose optimisation. It is well-documented that meropenem imparts

cellular toxicity, and if its effective dose gets reduced, it may alleviate meropenem-mediated

cytotoxicity [39]. Furthermore, the lower concentration and aqueous solubility could have

tremendous utility in the complex microenvironments of the lungs. The lower dose of

additives and antibiotics could also minimise the risks of developing further antibiotic

resistance.

The most prevalent efflux systems in K. pneumoniae belong to resistance-nodulation-

division (RND) and multi-antimicrobial extrusion (MATE) families [22]. The MIC reduction—

post-supplementation of Curaq and other EPIs—conﬁrmed the efﬂux system’s role. There-

fore, to validate our ﬁndings, we further typed the Klebsiella isolates for the most common

efﬂux reported for carbapenem resistance, the AcrAB-TolC system. The AcrAB-TolC system

is a tripartite assembly comprised of three distinct parts spanning across different layers: a

periplasmic component (AcrA), a secondary transporter located in the inner membrane

(

AcrB), and the outer membrane channel (TolC) [40]. Recently, Padilla et al. and Wasﬁ et al.

reported functional synergy between efﬂux pumps and various virulence determinants

among Klebsiella pneumoniae [10 41]. Reports suggest that for upregulation of many genes

,

involved in invasion and survival of Klebsiella pneumoniae, the AcrAB-TolC efﬂux system’s

activity is a prerequisite [11]. Therefore, studying the presence and prevalence of the

AcrAB-TolC efﬂux system among Klebsiella isolates is prudent. In the present study, 87.62%

of all the tested ICU isolates of Klebsiella pneumoniae were found to harbor the AcrAB-TolC

efﬂux system. However, 12 strains had an incomplete AcrAB efﬂux pump system (i.e.,

either TolC or AcrAB was absent). Such a high prevalence of the AcrAB-TolC efﬂux pump

system indicates a dire need to develop biocompatible efﬂux pump inhibitors to potentiate

frontline carbapenem drugs—especially meropenem.

In the case of meropenem, we did not know its inﬂux rate. We had to determine the

efﬁciency of Curaq to inhibit meropenem efﬂux by using a different system in which efﬂux

could be triggered conveniently (in bacterial cells preloaded with meropenem). Then, the

efﬂux could be measured directly as a function of time. Similar approaches were recently

published in a highly optimised format wherein the direct measurement of AcrAB-TolC

0

mediated the Nile red, and 1,2 -dinaphthylamine efﬂux were measured [42]. For the current

0

study, we utilised 1,2 -dinaphthylamine assays. As suggested by Bohnert et al., 1,2-DNA

could be used to probe membrane and membrane transport due to its second emission

maxima in the near-infrared region at 810 nm. At this wavelength, cellular autoﬂuorescence

is almost undetectable, and also, interference with substrates or competitors is hardly

encountered [43]. The Curaq-mediated efﬂux inhibition started at 1

µg/mL concentration,

whereas more than 90% efﬂux was abolished at 8

using Curaq as an anti-efﬂux agent.

µg/mL. This indicated the possibility of

After Curaq-mediated efﬂux inhibition was conﬁrmed, we checked the AcrAB-TolC

efﬂux system’s expression proﬁle in various permutations and combinations. We found

that meropenem signiﬁcantly trigger acrA, acrB, and tolC expression at all tested concen-

trations. However, comparatively, acrB expression was less pronounced after infusion

with meropenem. Interestingly, Curaq alone inhibited the expression of all the tripartite

assemblies of the AcrAB-TolC efﬂux system. However, even in the presence of meropenem—

when the expression of acrA, acrB, and tolC was much exaggerated—Curaq downregulated

their expression signiﬁcantly, showing its promise as a better efﬂux pump inhibitor.

We further tested our hypothesis that Curaq would perturb bacterial energy homeosta-

sis, leading eventually to efﬂux inhibition. The effect of Curaq on the bacterial membrane

potential was investigated using ﬂow cytometry and confocal laser scanning microscopy

employing DiOC (3)-based assay. We utilised the known protonophore CCCP as a positive

2

control for depolarisation. The membrane potential collapsed over 96%. These results

showed that our synthesised Curaq depolarised Klebsiella pneumoniae membranes by inter-

fering with the proton gradient. Next, to evaluate if the perturbations in electric potential

had depolarised the cells, we used DiSC -5-based ﬂow cytometry investigation. Results

3

Antibiotics 2021, 10, 388

20 of 30

endorsed the previously discussed ﬁndings of altered membrane potential. Interestingly,

the combination of Curaq and meropenem (8 µg/mL + 4 µg/mL) fostered colossal depolar-

ization in Klebsiella pneumoniae (96.0%).

In all, the present study reports efﬂux-mediated resistance against meropenem among

Klebsiella pneumoniae isolates. Additionally, the current research unveils the controlling

strategy of the efﬂux—utilising our synthesised water-soluble curcumin.

4. Materials and Methods

4.1. Ethical Approval

The study was commended by the Institutional Ethical Committee of the Institute of

Medical Sciences, Banaras Hindu University (Dean/2018/EC/594).

4.2. Bacterial Isolation and Culture Conditions

In the present study, 157 nonrepetitive, consecutive K. pneumoniae isolates from in-

tensive care unit patients were collected from the routine bacteriology laboratory of the

Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University

Varanasi, India, from March 2019 to December 2019. Deﬁnitive identiﬁcation of collected

isolates was performed using established biochemical tests as described earlier [44]. Af-

ter identiﬁcation, the K. pneumoniae isolates were stocked in brain heart infusion broth

◦

(

BHI) (HiMedia, India) with 10% glycerol (Merck, Germany) at –80 C. All isolates were

freshly subcultured on cysteine lactose electrolyte deﬁcient (CLED) agar (HiMedia, India)

before every analysis. The K. pneumoniae isolates with nonsusceptibility to any carbapenem

drugs (e.g., meropenem, ertapenem or imipenem) as outlined by the Clinical and Labora-

tory Standards Institute (CLSI, 2019) were deﬁned as carbapenem-resistant K. pneumoniae

(

CRKP).

4.3. Antimicrobial Susceptibility Testing

Antibiotic susceptibility testing of Klebsiella pneumoniae isolates was performed ac-

cording to the modiﬁed Kirby–Bauer disc diffusion method, utilising 17 antibiotics and

inhibition zone diameters measured in millimeters and interpreted following C.L.S.I. guide-

lines (2019, described previously except for colistin) [17]. The following antibiotic discs

(

HiMedia, India) were used: (1) Cephalosporins: ceftazidime (caz, 30

cxm, 30 g), and cefepime (cfm, 30 g), (2) Carbapenems: ertapenem (erta, 10

g) and imipenem (Imi, 10

µ

g), cefuroxime

g),

g), (3) Aminoglycosides: gentamicin

µ

meropenem (Mero, 10

Genta, 10 g), and amikacin (Amika, 30

levoﬂoxacin (Levo, 5

acid (amc, 20/10 g), Piperacillin-tazobactam (ptz, 110/10

onam (azm, 30 g), (7) Tetracycline (tetra, 30 g), (8) Trimethoprim-Sulfamethoxazole

cot, 23.75 + 1.25 g), and (9) Colistin (10 g). In the present study, we deﬁned multidrug

µ

(

µ

µg), (4) Quinolones: ciproﬂoxacin (Cipro, 5 µg) and

µg), (5) Penicillins: Ampicillin (amp, 10

µg), Amoxicillin/Clavulanic

µ

µg) (6) Monobactams: aztre-

µ

(

µ

resistance among isolates (MDR) if an isolate was found to be nonsusceptible to at least

one agent in three or more antimicrobial classes.

4.4. Detection of Carbapenemases

The mCIM and eCIM phenotypic assays were performed using the approach described

elsewhere with minor modiﬁcations [45,46]. Brieﬂy, 1 µL loopful of the freshly cultured

test Klebsiella pneumoniae isolates with suspected carbapenemase activity was resuspended

in two microcentrifuge tubes containing 2 mL of brain heart infusion broth (BHI), and the

bacterial suspension was gently vortexed for 15 s. For mCIM execution, one microcentrifuge

tube was devoid of EDTA, while the other was supplemented with 10

µL EDTA (5 mM)

(

eCIM). A meropenem disk (10

µ

g) was gently added to each tube, and the tubes were

◦

incubated statically at 35 C in ambient air for 4 h. After 4 h, the disks were taken out of the

tubes and placed on cation-adjusted Mueller–Hinton agar plates and freshly lawn cultured

(

just before completion of the stipulated incubation) with carbapenem-susceptible reporter

◦

E. coli ATCC 25922 strain. The plates were incubated at 35 C in ambient air for 24 h before

Antibiotics 2021, 10, 388

21 of 30

the zone sizes were documented. In cases of negative mCIM results, the eCIM result was

not read and reported. Zone size

diameters between 5–16 mm were considered mCIM positive in this study.

≥

19 mm was interpreted as negative mCIM, while zone

Zone sizes between 16–18 mm were interpreted as intermediate. The presence of

pinpoint colonies in the zone of growth inhibition in the intermediate range (16–18 mm)

was also considered a positive mCIM result. Similarly, eCIM was deemed positive when

the zone diameter was ≥5 mm increased compared to the positive mCIM zone size.

4

.5. Molecular Typing of Klebsiella Pneumoniae Isolates Using Enterobacterial Repetitive

Intergenic Consensus (ERIC) PCR

The genetic proﬁles and clonal connotations among all carbapenem-resistant clini-

cal K. pneumoniae isolates were appraised by polymorphism analysis of genomic DNA

0

employing two primers, ERIC-1 5 -TGTAAGCTCCTGGGGATTAAC-3 and ERIC-2 5 -

0

AAGTAAGTGACTGGGGTGAGCG-3 for repetitive intergenic enterobacterial consensus

PCR typing, as described previously with minor modiﬁcations [47]. The typing was per-

◦

formed in cycles with an initial denaturation at 94 C for 15 min followed by 40 cycles.

◦

Each cycle consisted of 1 min at 94 C for denaturation, 1 min for primer annealing, and

an extension at 72 C for 8 min. ERIC fragments were visualised by 1.5% w/v agarose

◦

gel electrophoresis. Two observers visually analysed the ampliﬁcation proﬁles, and their

observations were transformed into binary data in a matrix, according to the presence (1)

or absence (0) of bands. To evaluate the isolates’ genetic relationships, the matrix was sub-

jected to cluster analysis by the nearest neighbor method (UPGMA) based on the Jaccard

coefﬁcient for automatic generation of the dendrogram using the software NTSYSpc ver-

sion 2.0 (NY, USA). A previously identiﬁed nosocomial strain of K. pneumoniae encoding

the bla-KPC gene was used as a positive control. As a negative control, Staphylococcus

aureus strain ATCC 43300 was used.

4.6. Synthesis of Water-Soluble Curcumin

4

.6.1. Synthesis of Galactose Azide (2,3,4,6-Tetra-O-Acetyl-β-D-Galactopyranosyl

Azide) (2)

Acetylated galactose (4.0 g, 10.25 mmol) was poured in dry DCM, maintaining the

◦

temperature at 0 C. Hydrogen bromide solution (HBr 33% w/w in acetic acid) 12.0 mL was

added slowly under anhydrous conditions, and the reaction mixture was stirred for 3–4 h

◦

at 0 C to 10 C. After completing the reaction (monitored by TLC), the reaction mixture

was extracted with DCM and neutralised by NaHCO . The organic layer was collected,

3

dried over sodium sulphate and evaporated under reduced pressure to obtain per-O-

acetylated galactose bromides. Next, the obtained anomeric bromide (3.80 g, 9.24 mmol)

was dissolved in dry DMF followed by the addition of sodium azide (1.8 g, 3.0 equivalent).

◦

Then, the reaction was stirred at 80 C for 5 h. After completion of the reaction monitored

by TLC, the solvent was evaporated, and the resulted residue was extracted with EtOAc.

After washing with ice water, subsequent evaporation of the organic layer occurred. The

generated crude mass was loaded over column chromatography to obtain the pure product

(

2.55 g, 74%) (Figure 2a, Supplementary Figure S1).

White solid, 2.55 g, yield 74%; R = 0.4 (40% ethyl acetate/n-hexane); H NMR

1

f

(

500 MHz, CDCl₃):

δ 5.41 (d, J = 4.0 Hz, 1H), 5.17–5.13 (m, 1H), 5.04–5.01 (m, 1H), 4.59 (d,

J = 7.0 Hz, 1H), 4.19–4.12 (m, 2H), 4.02–3.99 (m, 1H), 2.16 (s, 3H), 2.08 (s, 3H), 2.05 (s, 3H),

.98 (s, 3H); ¹³C NMR (125 MHz, CDCl₃):

170.3, 170.0, 169.9, 169.3, 88.2, 72.8, 70.7, 68.0,

6.8, 61.2, 20.6, 20.5, 20.4 ppm.

1

δ

6

4

.6.2. Synthesis of Curcumin Di-Alkyne (4)

A round bottom ﬂask was charged with the mixture of curcumin (1.0 g, 2.71 mmol)

and K CO (0.75 g, 5.42 mmol, 2.0 equiv.) in dry DMF under argon atmosphere, followed by

2

3

addition of propargyl bromide (0.54 mL, 6.78 mmol) and then stirred at room temperature

for 48 h (Figure 2a). After the completion of the reaction (monitored by TLC), the reaction

mixture was concentrated under reduced pressure to obtain crude mass. Next, the crude

Antibiotics 2021, 10, 388

22 of 30

mass was subjected to column chromatography (ethyl acetate: hexane) to obtain the

curcumin-di-alkyne. Yield (55%); Orange-red-colored semisolid, R = 0.5, (15% ethyl

f

1

acetate/n-hexane); H NMR (500 MHz, CDCl ):

δ 7.70–7.53 (m, 2H), 7.15–6.93 (m, 6H),

3

6

(

.72–6.45 (m, 2H), 4.74 (d, J = 6.5 Hz, 4H), 3.88–3.84 (m, 6H), 3.15–3.11 (m, 2H), 2.51–2.49

m, 2H); ¹³C NMR (125 MHz, CDCl₃):

δ193.3, 193.2, 183.0, 182.4, 149.6, 149.4, 145.4, 145.1,

1

7

3

44.8, 141.9, 140.1, 130.9, 130.5, 129.3, 129.0, 127.9, 127.8, 123.4, 123.1, 122.3, 121.9, 121.6,

18.5, 118.3, 115.9, 115.1, 113.66, 113.60, 133.3, 110.8, 110.7, 110.5, 101.3, 78.8, 77.9, 77.6, 76.2,

−

1

6.1, 72.0, 70.5, 66.8, 63.0, 56.46, 56.44, 55.9, 55.8 and 55.7 ppm. I.R. (cm ) 3511.29, 3378.49,

015.33, 2845.98, 1843.84, 1627.15, 1602.92, 1504.47, 1278.88.

4.6.3. Synthesis of Curcumin Clicked Di-Acetylated Galactose (5)

Curcumin di-alkyne(0.5 g, 1.12 mmol) was dissolved in 20 mL of THF/water (1:1), fol-

lowed by addition of 2,3,4,6-Tetra-O-acetyl-

β-D-galactopyranosyl azide (1.25 g, 3.37 mmol,

3

.0 equiv.) in presence of CuSO₄5H O (224 mg, 0.899 mmol, 0.8 equiv.) and sodium

·

2

ascorbate (178 mg, 0.899 mmol, 0.8 equiv.) (Figure 2a, Supplementary Figure S2). The

mixture was stirred at room temperature for 12 h. Reaction monitoring was executed by

TLC; after the completion of reaction on TLC, reaction mixture was concentrated under

reduced pressure to obtain crude. Puriﬁcation of crude mass by ﬂash chromatography

(

ethyl acetate: hexane) afforded 1,4-disubstituted triazole derivative, yield 63%, isolated

1

through column chromatography. H NMR (500 MHz, CDCl ):

δ 7.93 (s, 2H), 7.72–7.42

3

(m, 4H), 7.14–6.99 (m, 4H), 5.83 (d, J = 8.5 Hz, 2H), 5.52–5.51 (m, 4H), 5.28–5.22 (m, 6H),

4

.22–4.11 (m, 10H), 3.90–3.86 (m, 6H), 2.19 (s, 6H), 2.01–1.96 (m, 12H), 1.82–1.81 (m, 6H);

1

3

C NMR (125 MHz, CDCl₃):

δ 193.9, 183.1, 170.2, 170.1, 169.8, 169.7, 168.9, 150.2, 149.6,

1

6

49.0, 144.2, 144.1, 142.1, 139.1, 132.0, 131.9, 129.0, 128.5, 128.4, 123.8, 122.5, 121.6, 120.5,

19.0, 118.4, 133.9, 113.8, 113.6, 110.9, 110.5, 86.1, 73.9, 70.6, 67.7, 67.6, 66.8, 62.78, 62.71, 61.1,

−

1

1.0, 56.0, 56.9, 20.5, 20.3, 20.1, and 20.0 ppm. I.R.(cm ) 3422.7, 2924.86, 2854.44, 1742.2,

639.26, 1465.26, 1095.12.

1

4.6.4. Synthesis of De-O-Acetylated Curcumin Di-Galactose (6)

Per-O-acetylated-galactose-linked curcumin derivative (200 mg) was dissolved in a

mixture of dry MeOH/dry THF/dry DCM (8 mL in the ratio 3:0.5:0.5 respectively). After

that, the solution of NaOMe (1 M)—typically 40–50 L—was added, and the reaction

µ

mixture was stirred for 48 h (Figure 2a, Supplementary Figure S2). After the reaction was

complete, the solution was completely evaporated, then diluted with distilled water. This

+

was followed by neutralization (6–7 pH) using ion exchange resin (Amberlite IR 120 H ).

Resin was ﬁltered out and the resulting solution was condensed to achieve compound

1

(

6) with 88% yield. H NMR (500 MHz, CDCl ):

δ

8.12 (s, 2H), 7.27–6.75 (m, 4H), 6.16 (d,

3

J = 16.0 Hz, 1H), 5.50 -5.48 (m, 2H), 5.02–4.96 (m, 2H), 4.04 (br, 2H), 3.90 (br, 3H), 3.79–3.37

m, 22H); ¹³C NMR (125 MHz, CDCl₃):

182.2, 181.5, 175.7, 171.1, 164.0, 148.7, 147.6, 143.3,

40.5, 129.4, 126.5, 124.4, 123.4, 122.7, 121.7, 116.1, 113.9, 110.5, 88.1, 78.3, 72.9, 72.1, 69.7,

(

δ

1

6

−

1

8.5, 62.5, 61.6, 61.5, 60.8 and 55.6 ppm. I.R. (cm ); 3226.15, 2924.59, 2853.98, 1634.99,

1567.74, 1411.43, 1096.70.

4.7. Photophysical Behavior and Solubility

The absorbance proﬁle was evaluated using a UV-Vis absorption spectrometer

(PerkinElmer, Waltham, Massachusetts, USA) with a 10 mm optical path length. The

aqueous solubility of the synthesised curcumin derivatives (compared to the native form)

were assessed by UV-Vis spectrophotometry. We ﬁrst went for general spectral scanning

and then prepared the calibration curve by plotting the concentrations versus absorbance

at

λmax. Then, the slope was calculated from the plot. We then dissolved the maximum

dissolvable amount into MilliQ water, and the remaining undissolved part was removed

Antibiotics 2021, 10, 388

23 of 30

by centrifugation. At the same λmax, we determined the absorbance of unperturbed MilliQ.

We then calculated the solubility by applying the following Equation (3):

Solubility = (Absorbanceatλmax)/Slope

(3)

4.8. Minimum Inhibitory Concentration (MIC) Determination

4.8.1. Antibiotics and Efﬂux Inhibitors

We employed ten antibiotics, namely meropenem, meropenem/sulbactam, imipenem,

ertapenem, amikacin, gentamicin, levoﬂoxacin, ciproﬂoxacin, ceftazidime, and ceftazidime/

avibactam. Additionally, we also used carbonyl cyanide m-chlorophenylhydrazine (CCCP)

as a protonophore along with verapamil and valinomycin as efﬂux pump inhibitor (EPI)

and proton pump inhibitor (PPI), respectively. Water-soluble curcumin (Curaq) was also

utilised. Stock solutions of Curaq, verapamil, valinomycin were prepared in MilliQ water

while CCCP was dissolved in dimethyl sulfoxide (DMSO). However, we used ﬁxed sub-

inhibitory concentrations of soluble curcumin, CCCP, verapamil, and valinomycin (8, 10,

128, and 1

µg/mL, respectively) to delineate their possible effects on the resistance proﬁle

of meropenem.

4.8.2. Phenotypic Evaluation of Drug Synergy

We compared the synergism phenotypically, ﬁrst by diluting the agar with a ﬁxed

sub-inhibitory concentration of curcumin (128

curcumin (8 g/mL), with simultaneous evaluation of changes in the zone of inhibition of

the in-vogue drugs (employing modiﬁed Kirby–Bauer method).

µg/mL) and the water-soluble variant of

µ

4

.8.3. Quantifying Synergy Using the Bliss Independence Model and Calculating the

Fractional Inhibitory Concentration Index

Drug synergism was further calculated using the Bliss Independence Model described

previously, using the below-mentioned Equation (4) [17]:

S = (Fxo/Foo)(Fyo/Foo) − (Fxy/Foo)

(4)

Fxy refers to the growth rate in the combination of test compounds at the concentration

X, Curaq, and Y for the meropenem. Similarly, Fxo and Fyo refer to the growth rates in the

presence of the Curaq and meropenem at concentrations X and Y, respectively. Foo refers

to the growth rate in the absence of Curaq and meropenem. S is the degree of synergy that

establishes a synergistic interaction for its positive values and an antagonistic interaction

for its negative values. At various time points, growth rates were ascertained by calculating

the slope of the growth curve being analysed for 4.5 h, as described previously [44].

The FIC index was calculated as described earlier [48]. Brieﬂy, the FIC index was

calculated for the ﬁrst well with no perceivable growth (i.e., non-turbid well) for each

row and column, representing the Curaq-meropenem combinations that inhibited the

K. pneumoniae growth. We considered OD₆₀₀values of 0.01–0.02 as the marker of a non-

turbid well in case of any confusion. The following Equation (5) determined the FIC:

CombinedMICo f Curaq∧meropenem

FIC =

+

(5)

MICo f sCuralone

MICo f meropenemalone

Subsequently, we determined the FIC index median and its range. The values were

interpreted as per standard protocol. The FIC index value of 0.5 indicated synergism,

≤

while the values ranging >0.5 to 1 suggested additive behavior. Similarly, values ranging

from 1–4 were interpreted as indifferent, while values >4 depicted antagonism.

4.9. Determination of Various Virulence Factors

The virulence factors investigated were related to the carbapenemase production

(bla_{_}_K_P_C), bioﬁlm formation and adherence (RmpA, FimH-1). For PCR-based detection,

the following primers were used (Table 6).

Antibiotics 2021, 10, 388

24 of 30

Table 6. List of primers.

Amplicon Size

Sequence

5’→3’)

Melting Temperature

Gene

Reference

◦

(

(bp)

(Tm in C)

F: TGTCACTGTATCGCCGTC

R: CTCAGTGCTCTACAGAAAACC

F: ACTGGGCTACCTCTGCTTCA

R: CTTGCATGAGCCATCTTTCA

F: GCCAACGTCTACGTTAACCTG

R: ATATTTCACGGTGCCTGAAAA

F: ATCAGCGGCCGGATTGGTAAA

R: CGGGTTCGGGAAAATAGCGCG

F: ATCAGCAACCCCGATCTGCGT

R: CCGGTGACTTGACGCAGTCCT

F: AAGGCGAATCCAGCTTGTTCAGC

R: GACGTTGCATGTTCGCACCCATCA

F: GTCCTCAGGTCAGTGGCATTA

R: ATTGCTCTGCTGCGCCGTT

bla_{_}_K_P_C

RmpA

FimH-1

AcrAB

TolC

1010

60

53

43

53

51

[49]

[50]

[41]

[51]

[52]

[53]

435

180

312

527

rpoB

For Real-time

Acr A

Acr B

F: AAACTTCGCCACTACGTCATA

R: AGCTTAACGCCTCGATCAT

4.10. Detection of Major Efﬂux Pumps System

The AcrAB-TolC efﬂux system’s prevalence among all the meropenem-resistant clin-

ical K. pneumoniae isolates was established by amplicon analysis (Table 6) as outlined

previously with minor modiﬁcations [41].

4

.11. Mechanistic Underpinnings

0

4.11.1. 1,2 -Dinaphthylamine (1,2 -DNA) Efﬂux Assay

0

1

,2 -dinaphthylamine (1,2 -DNA) efﬂux assay was performed as described previously

with minor modiﬁcations [43]. Brieﬂy, the exponential phase cells (1 mL) were harvested

and resuspended in 1 mL phosphate-buffered saline (PBS, pH 7.2). Subsequently, the cells

were pelleted, rinsed, and resuspended in PBS, followed by exposure with 8

µ

g/mL CCCP

◦

0

with shaking at 240 rpm for 20 min at 35 C. Then, 1,2 -DNA (20

incubated for 1 hr at 37 C, secluded from light to ensure its minimal degradation and

µg/mL) was added and

◦

maximum uptake. The exposed cells were then centrifuged at 13,000 g for 2 min at 25 C

0

to remove excess CCCP and 1,2 -DNA. The pellet was resuspended in the same freshly

prepared PBS volume (pH 7.2) containing 1 mM MgCl . To the suspension obtained, 1, 2,

2

4

, or 8

µ

g/mL of water-soluble curcumin (Curaq) was added. However, to trigger efﬂux,

0

glucose (0.1% w/v) was infused into the wells. The 1,2 -DNA efﬂux was determined by

measuring its ﬂuorescence for 60 s with

0

λ_e_x_i/

λ

emi

370/810 nm. The 1,2 -DNA ﬂuorescence

was normalised to 100 relative ﬂuorescence signals of the untreated/preenergized cells

and was utilised as the negative control.

4

.11.2. Quantitative Real-Time PCR (qRT-PCR) for Determination of Expression of acrA,

acrB and TolC in Presence and Absence of Soluble Curcumin or CCCP, Along with

Meropenem at Different Concentrations

Total RNA was isolated by the Trizol-based method described previously [54]. After

4

5 min of treatment with Curaq (8

µ

g/mL) or CCCP (10

µ

g/mL) along with meropenem at

®

different concentrations (0.5–4

µg/mL), total RNA was extracted using Trizol reagent (Am-

bion, USA). Total RNA was ﬁrst digested with RNAse free DNase (Fermantas, Germany)

to avoid DNA contamination before use. Isolated RNAs were immediately preserved

◦

at

−

80 C. For cDNA preparation, 1

µ

g total RNA was subjected to reverse transcrip-

tion employing the cDNA conversion kit (Qiagen, Germany). The expression of genes

involved in the efﬂux (AcrAB-TolC) was assessed using SYBR green master mix (Thermo

Scientiﬁc, Waltham, Massachusetts USA) on ABI 7500 Fast system (Applied Biosystems)

using 5 pmol/µL of speciﬁc primers with rpoB as an endogenous control (Table 1). The

Antibiotics 2021, 10, 388

25 of 30

abundance/decline of RNA was normalised to the geometric average of endogenous

control rpoB for

the expression of AcrAB-TolC in the presence and absence of Curaq, CCCP, meropenem

0.5–4 g/mL), and Curaq with meropenem (8 g/mL + 4 g/mL). We incorporated three

biological replicates and two technical replicates for the tested genes, and their relative

∆Ct. The fold change (∆Ct) was calculated as the difference between

(

µ

−

∆∆ct

expression was subsequently calculated by the 2

method.

4.11.3. Spectrophotometric Analysis of Meropenem

The concentration-dependent spectral analysis of meropenem (50, 100, and 200

µg/mL)

(

TCI, Japan) was performed using an H1 synergy multimode reader at room temperature

approximately 25 C) in a UV-transparent 96-well plate (Nunc, Denmark). Measurements

◦

with bandwidths of 5 nm were implemented for analysing absorption spectra. Subse-

quently, we plotted the concentration versus absorbance plot for meropenem at 295 nm.

4.11.4. Meropenem Hydrolysis by Bacterial Cells

A hundred microliters of either meropenem solution (32

µ

g/mL) or PBS was mixed

8

with 100

µL of each bacterial suspension (1.5

×

10 CFU/mL) and incubated for 60 min

◦

at 37 C. Subsequently, the absorbance was read in the range of 220–400 nm. Klebsiella

pneumoniae ATCC 4352 served as the control for the non-carbapenemase producer, while

ATCC BAA-1705 served as the control for carbapenemase production.

4.11.5. Estimation of Background Absorbance

We selected ten representative isolates with high MIC against meropenem ( 33 µg/mL).

≥

A bacterial suspension of each strain was prepared at an optical density at 600 nm of 3.0.

Two-fold serial dilutions (64 dilution) were performed to generate bacterial suspensions

at eight different concentrations. The control comprised PBS without bacteria. A hundred

×

microliters of the bacterial suspension were mixed with 100

32

µ

L of meropenem solution

◦

(

µ

g/mL) or PBS. Absorbance was measured at 295 nm after incubation at 37 C for

60 min. The experiment was done in triplicate.

4.11.6. Quantiﬁcation of Bacterial Meropenem Hydrolytic Activities

Five meropenem-resistant isolates within each MIC category (except 256

µg/mL) were

tested for meropenem hydrolysis. Strains were cultured on CLED agar plates overnight,

and 0.5 McFarland’s match bacterial suspension was made in 100

µ

L of meropenem solution

◦

(64

µg/mL) directly. The incubation was made at 37 C for 30, 60, and 120 min and the

absorbance of each reaction mixture was read at 295 nm.

The percent hydrolysis was calculated as follows Equation (6):

%

hydrolysis = 1 − (Absorbance @ 295 nm at the time o f incubation

−

Absorbance @ 295 nm a f ter de f ined time o f incubation)

(6)

/

(Absorbance o f meropenem at that concentration − Absornabce o f PBS) × 100

4

.11.7. Quantiﬁcation of the Effect of Curaq on Bacterial Meropenem Hydrolytic Activities

Five meropenem resistant strains within each MIC category (except 256 g/mL) were

µ

utilised for this study. Strains were cultured on CLED agar plates overnight, and 0.5

McFarland’s match bacterial suspension was made in 100

µ

L of meropenem solution

◦

(64

µg/mL) directly. The incubation was made at 37 C for 30, 60, and 120 min in the

presence of different concentrations of Curaq (4, 8, 16, 32

each reaction mixture was read at 295 nm.

µg/mL) and the absorbance of

The percent hydrolysis was calculated as follows Equation (7):

%

hydrolysis = 1 − (Absorbance @ 295 nm at the time o f incubation

−

Absorbance @ 295nm a f ter de f ined period o f incubation)

(

7)

/

(Absorbance o f meropenem at that concentration at 295 nm

Absorbance o f Curaq at 295 nm − Absornabce o f PBS) × 100

−

Antibiotics 2021, 10, 388

26 of 30

4.11.8. Preparation of Cell-Free Extracts

Bacteria were harvested during the late logarithmic growth phase into 0.1 M Tris

◦

buffer (pH 8.0). Harvested cells were then centrifuged at 17,000

×

g for 8 min at 4 C.

The resulting pellet was washed thrice and resuspended in 0.1 M Tris buffer. Cells were

lysed by repeatedly freezing and thawing the suspensions. The suspension was allowed to

thaw completely before refreezing. To get crude extracts, the cell lysate was centrifuged at

◦

20 C.

27,000

×

g for 10 min at 4 C, and the supernatant carefully separated and stored at

−

4.11.9. Protein Measurement

Protein concentration was determined by the Bradford method. The bovine serum

albumin was the standard used. The standard curve was used to determine the protein

amount in the extracts (mg/mL).

4.11.10. Inhibition Assays on Carbapenemases

Hydrolysis of meropenem by carbapenem was monitored using an H1 Synergy multi-

−

1

−1

.

mode reader by following the absorbance changes at 295 nm using ∆ε₂₉₅

=

−

9023 M cm

g/mL BSA,

The reaction medium employed was 10 mM HEPES, pH 7.5, 200 mM NaCl, 50

µ

◦

and 20

µ

M ZnSO at 30 C. Reactions were carried out in tissue culture plates in a ﬁnal

4

volume of 200

µL, with the crude bacterial extract. Curaq was dissolved in MilliQ to a ﬁnal

concentration of 256

µg/mL and then serially diluted 2-fold (to 4 µg/mL). The assay was

initiated by the addition of crude bacterial extract to the mixture of substrate and Curaq.

4.11.11. Measurement of the Electrical Potential

The electrical potential was measured via the membrane-permeable DiOC (3) dye, as

2

outlined previously with minor modiﬁcations [55]. Cells were ﬁrst grown to the mid-log

phase in BHI supplemented with either meropenem, Curaq or meropenem and Curaq. A

total of 1 mL mid-log phase growing treated Klebsiella pneumoniae cells was collected after

centrifugation at 4500

buffer [10 mM Tris–HCl (pH 7.6), 1 mM EDTA and 10 mM glucose]. The cells were

incubated for 30 min with 2 L DiOC (3) dye (5 mg/mL) (Invitrogen) at room temperature.

Subsequently, the cells were recollected at 4500

resuspended in 500 L of permeabilisation buffer. The stained bacterial suspension was

×

g for 15 min and then resuspended in 1 mL of permeabilisation

µ

2

×

g. Then, the obtained cell pellet was

µ

then assayed in a ﬂow cytometer (C6 BD Accuri, Becton–Dickinson, San Jose, CA, USA)

equipped with laser excitation at 488 nm. Fluorescence was then monitored in the green

and red channels. The forward scatter, side scatter, and ﬂuorescence was collected with

logarithmic signal ampliﬁcation.

However, the ﬁndings of ﬂow cytometry were further validated by confocal laser

scanning microscopy. For this, the cells were dropped onto the glass slide and covered

with the coverslip. The samples were then immediately examined using the Zeiss LSM

5

10 inverted confocal laser-scanning microscope (Carl Zeiss, Jena, Germany) ﬁtted with a

Plan-Neoﬂuar 63X/1.3 oil objective with a z-step of 2.0 m or 40X objective with a z-step

of 5.0 m and analysed using ZenBlue software (Carl Zeiss, Jena, Germany). The excitation

was made at 488 nm, while the emission was recorded at 530 (green) and 610 (red) nm.

µ

4.11.12. Membrane Depolarisation Assay

The plasma membrane depolarisation of bacterial membranes was measured, em-

ploying potential-sensitive dye DiSC -5 by steady-state ﬂuorimetry and ﬂow cytometry

3

by the method described previously with minor modiﬁcations [16]. Brieﬂy, the overnight-

grown test Klebsiella pneumoniae isolates were diluted in BHI broth to the absorbance index

of 0.05 at λmax 600. This was followed by the addition of 50

µ

L of Curaq (8

µ

g/mL),

◦

meropenem (4

DiSC -5 (1

µ

g/mL), and their combinations for 2 h at 37 C. Subsequently, 50

µL of

µ

M) was added and incubated for the next 30 min. Negative control was devoid

of any drug/Curaq while a CCCP-treated bacterial panel acted as the positive control.

The steady-state ﬂuorescence was monitored and recorded at _e_m_i~622 nm/670 nm

3

λ

exi/

Antibiotics 2021, 10, 388

27 of 30

(Synergy H1 Hybrid Multi-Mode Reader). However, membrane depolarisation was further

validated by ﬂow cytometry.

4.12. Statistical Analysis

The differences between samples (control and test isolates with and without the

drug(s)) were computed with the help of one-way ANOVA followed by Dunnett’s and

Tukey-Kramer (Tukey’s W) multiple comparison tests as and when required. However, in

the experiment with protonophores, EPIs, and galactose-clicked curcumin, the fold change

of

% level when p < 0.05. GraphPad Prism version 8.2 was used for all statistical analysis

and graph plotting.

≥

2 was considered signiﬁcant. Differences were considered statistically signiﬁcant at a

5

5. Conclusions

In conclusion, Curaq seems to be a suitable candidate to extend studies further in

the ongoing effort to ﬁnd an altogether newer generation of RND efﬂux pump inhibitors

that act by disrupting the proton motive force and membrane potential. Additionally,

it shows its broad usefulness as an efﬂux pump inhibitor in combination with cell wall

acting drugs like meropenem, due to its membrane permeabilising properties. Our results

further revealed that the combination of Curaq and meropenem is highly synergistic against

Klebsiella pneumoniae, reducing drug dose regimes and toxicity. Almost all efﬂux pump

systems rely on energy (ATP); therefore, the drug that inhibits the PMF will inhibit ATP

generation and eventually shut down the efﬂux system. Accordingly, being embodied

with this property, Curaq can be utilised in newer putative adjuvants to in-use drugs,

especially meropenem. However, further design of such molecules would be needed for

better treatment outcomes in K. pneumoniae pathogenesis and to overcome the mechanisms

of resistance.

Supplementary Materials: The following are available online at https://www.mdpi.com/article/

1

13

1

0.3390/antibiotics10040388/s1 as additional data. Figure S1: H and C NMR spectrum of the

synthesised compounds ( ) (Supplementary information 1), Figure S2. IR spectra of the compounds

and (Supplementary information 2), Figure S3: The mCIM and eCIM results for clinical isolates of

K. pneumoniae, Figure S4: The minimum inhibitory concentration ( g/mL) of in-vogue antibiotics—

2–6

5

6

µ

along with protonophore, efﬂux pump inhibitor, proton pump inhibitor, and soluble curcumin—

against clinical isolates of K. pneumoniae, Figure S5: Antibiogram, Figure S6: Dendrogram.

Author Contributions: P.P.: V.K.T., M.K.G., and A.K.S. conceived and designed the study. S.Y., A.K.S.,

A.K.A., A.K.P. executed the experiments, P.P., V.K.T., A.K.S., S.Y., A.K.A., and M.K.G. analysed data,

and the manuscript was written by A.K.S., and S.Y., V.K.T. and A.K.A. analysed the synthesis data

while P.P., D.C., S.Y., and A.K.S. analysed the biological data. All authors have read and agreed to the

published version of the manuscript.

Funding: We sincerely acknowledge the ﬁnancial support of the contingency grant offered to S.Y. by

the Council of Scientiﬁc and Industrial Research (CSIR), New Delhi as SRF [File No: 09/013(0722)/2017-

EMR-1], and University Grants Commission (UGC), New Delhi to A.K.S. as SRF [2061430918 vide

22/06/2014(i) EU-V]. Also, we acknowledge the Science and Engineering Research Board (SERB),

New Delhi [Project code (EMR/2016/001123), Department of Science and Technology, Government

of India for funding the synthesis of the click-based conjugate reported herein. We sincerely ac-

knowledge the DST-PURSE grant sanctioned by the Department of Microbiology, IMS, BHU for

instrumentation. We recognise the DBT-IISc partnership grant, DAE-SRC grant, Infosys foundation

grant and ASTRA Chair professorship grant to D.C.

Institutional Review Board Statement: Not applicable.

Informed Consent Statement: Not applicable.

Data Availability Statement: No new data were created or analysed in this study. Data sharing is

not applicable to this article.

Conﬂicts of Interest: The authors declare no conﬂict of interest.

Antibiotics 2021, 10, 388

28 of 30

References

1

.

Paczosa, M.K.; Mecsas, J. Klebsiella pneumoniae: Going on the Offense with a Strong Defense. Microbiol. Mol. Biol. Rev. 2016, 80,

29–661. [CrossRef ] [PubMed ]

6

2

.

Podschun, R.; Ullmann, U. Klebsiella spp. as Nosocomial Pathogens: Epidemiology, Taxonomy, Typing Methods, and Pathogenicity

Factors. Clin. Microbiol. Rev. 1998, 11, 589–603. [CrossRef ]

3.

4.

5.

Patel, P.K.; Russo, T.A.; Karchmer, A.W. Hypervirulent Klebsiella pneumoniae. Open Forum Infect. Dis. 2014, 1, ofu028. [CrossRef ]

Shon, A.S.; Russo, T.A. Hypervirulent Klebsiella pneumoniae: The next superbug? Future Microbiol. 2012, 7, 669–671. [CrossRef ]

Piperaki, E.-T.; Syrogiannopoulos, G.A.; Tzouvelekis, L.S.; Daikos, G.L. Klebsiella pneumoniae: Virulence, Bioﬁlm and Antimicrobial

Resistance. Pediatr. Infect. Dis. J. 2017, 36, 1002–1005. [CrossRef ]

6

.

Li, X.-Z.; Plésiat, P.; Nikaido, H. The Chall enge of Efﬂux-Mediated Antibiotic Resistance in Gram-Negative Bacteria. Clin.

Microbiol. Rev. 2015, 28, 337–418. [CrossRef ] [PubMed ]

Atzori, A.; Malloci, G.; Cardamone, F.; Bosin, A.; Vargiu, A.V.; Ruggerone, P. Molecular Interactions of Carbapenem Antibiotics

with the Multidrug Efﬂux Transporter AcrB of Escherichia coli. Int. J. Mol. Sci. 2020, 21 , 860. [CrossRef ]

Codjoe, F.S.; Donkor, E.S. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [CrossRef ]

7

8

9

1

.

Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4, 4. [CrossRef ]

0. Padilla, E.; Llobet, E.; Doménech-Sánchez, A.; Martínez-Martínez, L.; Bengoechea, J.A.; Albertí, S. Klebsiella pneumoniae AcrAB

Efﬂux Pump Contributes to Antimicrobial Resistance and Virulence. Antimicrob. Agents Chemother. 2010, 54, 177–183. [CrossRef ]

1. Bengoechea, J.A.; Pessoa, J.S. Klebsiella pneumoniae infection biology: Living to counteract host defences. FEMS Microbiol. Rev.

1

2

019, 43, 123–144. [CrossRef ] [PubMed ]

2. Singh, A.K.; Prakash, P.; Singh, R.; Nandy, N.; Firdaus, Z.; Bansal, M.; Singh, R.K.; Srivastava, A.; Roy, J.K.; Mishra, B.; et al.

Curcumin Quantum Dots Mediated Degradation of Bacterial Bioﬁlms. Front. Microbiol. 2017, 8, 1517. [CrossRef ]

3. Singh, A.K.; Yadav, S.; Sharma, K.; Firdaus, Z.; Aditi, P.; Neogi, K.; Bansal, M.; Gupta, M.K.; Shanker, A.; Singh, R.K.; et al.

Quantum curcumin mediated inhibition of gingipains and mixed-bioﬁlm of Porphyromonas gingivalis causing chronic periodontitis.

RSC Adv. 2018, 8, 40426–40445. [CrossRef ]

1

4. Wang, Y.-J.; Pan, M.-H.; Cheng, A.-L.; Lin, L.-I.; Ho, Y.-S.; Hsieh, C.-Y.; Lin, J.-K. Stability of curcumin in buffer solutions and

characterization of its degradation products. J. Pharm. Biomed. Anal. 1997, 15, 1867–1876. [CrossRef ]

5. Krausz, A.E.; Adler, B.L.; Cabral, V.; Navati, M.; Doerner, J.; Charafeddine, R.A.; Chandra, D.; Liang, H.; Gunther, L.; Clendaniel,

A.; et al. Curcumin-encapsulated nanoparticles as innovative antimicrobial and wound healing agent. Nanomed. Nanotechnol. Biol.

Med. 2015, 11, 195–206. [CrossRef ]

1

6. Singh, A.K.; Mishra, H.; Firdaus, Z.; Yadav, S.; Aditi, P.; Nandy, N.; Sharma, K.; Bose, P.; Pandey, A.K.; Chauhan, B.S.; et al.

MoS -Modiﬁed Curcumin Nanostructures: The Novel Theranostic Hybrid Having Potent Antibacterial and Antibioﬁlm Activities

2

against Multidrug-Resistant Hypervirulent Klebsiella pneumoniae. Chem. Res. Toxicol. 2019, 32, 1599–1618. [CrossRef ] [PubMed ]

7. Yadav, S.; Singh, A.K.; Agrahari, A.K.; Sharma, K.; Singh, A.S.; Gupta, M.K.; Tiwari, V.K.; Prakash, P. Making of water soluble

curcumin to potentiate conventional antimicrobials by inducing apoptosis-like phenomena among drug-resistant bacteria. Sci.

Rep. 2020, 10, 14204. [CrossRef ]

1

8. Martin, R.M.; Bachman, M.A. Colonization, Infection, and the Accessory Genome of Klebsiella pneumoniae. Front. Cell. Infect.

Microbiol. 2018, 8, 4. [CrossRef ]

9. Ferreira, R.L.; Da Silva, B.C.M.; Rezende, G.S.; Nakamura-Silva, R.; Pitondo-Silva, A.; Campanini, E.B.; Brito, M.C.A.; Da Silva,

E.M.L.; Freire, C.C.D.M.; Da Cunha, A.F.; et al. High Prevalence of Multidrug-Resistant Klebsiella pneumoniae Harboring Several

Virulence and β-Lactamase Encoding Genes in a Brazilian Intensive Care Unit. Front. Microbiol. 2019, 9, 3198. [CrossRef ]

0. Kumar, P.; Bag, S.; Ghosh, T.S.; Dey, P.; Dayal, M.; Saha, B.; Verma, J.; Pant, A.; Saxena, S.; Desigamani, A.; et al. Molecular

Insights into Antimicrobial Resistance Traits of Multidrug Resistant Enteric Pathogens isolated from India. Sci. Rep. 2017, 7,

2

1

4468. [CrossRef ]

2

1. Peterson, E.; Kaur, P. Antibiotic Resistance Mechanisms in Bacteria: Relationships between Resistance Determinants of Antibiotic

Producers, Environmental Bacteria, and Clinical Pathogens. Front. Microbiol. 2018, 9, 2928. [CrossRef ] [PubMed ]

2. Nikaido, H.; Pagès, J.-M. Broad-speciﬁcity efﬂux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS

Microbiol. Rev. 2012, 36, 340–363. [CrossRef ]

3. Routh, M.D.; Zalucki, Y.; Su, C.-C.; Long, F.; Zhang, Q.; Shafer, W.M.; Yu, E.W. Efﬂux Pumps of the Resistance-Nodulation-Division

Family: A Perspective of their Str ucture, Function, and Regulation in Gram-Negative Bacteria. Adv. Enzymol. Relat. Areas Mol.

Biol. 2011, 77, 109–146. [CrossRef ] [PubMed ]

2

4. Poole, K. Efﬂux-Mediated Resistance to Fluoroquinolones in Gram-Negative Bacteria. Antimicrob. Agents Chemother. 2000, 44,

2

233–2241. [CrossRef ] [PubMed ]

5. Rupp é , É .; Woerther , P.-L.; Barbier, F. Mechanisms of antimicrobial resistance in Gram-negative bacilli. Ann. Intensiv. Care 2015, 5,

1. [CrossRef ] [PubMed ]

6

6. Koppe, U.; Von Laer, A.; Kroll, L.E.; Noll, I.; Feig, M.; Schneider, M.; Claus, H.; Eckmanns, T.; Abu Sin, M. Carbapenem

non-susceptibility of Klebsiella pneumoniae isolates in hospitals from 2011 to 2016, data from the German Antimicrobial Resistance

Surveillance (ARS). Antimicrob. Resist. Infect. Control 2018, 7, 71. [CrossRef ]

2

7. Pitout, J.D.D.; Nordmann, P.; Poirel, L. Carbapenemase-Producing Klebsiella pneumoniae, a Key Pathogen Set for Global Nosocomial

Dominance. Antimicrob. Agents Chemother. 2015, 59, 5873–5884. [CrossRef ]

Antibiotics 2021, 10, 388

29 of 30

2

3

8. Wilson, L.A.; Sharp, P.M. Enterobacterial Repetitive Intergenic Consensus (ERIC) Sequences in Escherichia coli: Evolution and

Implications for ERIC-PCR. Mol. Biol. Evol. 2006, 23, 1156–1168. [CrossRef ]

9. Lai, Y.-C.; Yang, S.-L.; Peng, H.-L.; Chang, H.-Y. Identiﬁcation of Genes Present Speciﬁcally in a Virulent Strain of Klebsiella

pneumoniae. Infect. Immun. 2000, 68, 7149–7151. [CrossRef ]

0. Sidjabat, H.; Nimmo, G.R.; Walsh, T.R.; Binotto, E.; Htin, A.; Hayashi, Y.; Li, J.; Nation, R.L.; George, N.; Paterson, D.L.

Carbapenem Resistance in Klebsiella pneumoniae Due to the New Delhi Metallo-

CrossRef ]

β-lactamase. Clin. Infect. Dis. 2011, 52, 481–484.

[

3

1. Veeraraghavan, B.; Shankar, C.; Karunasree, S.; Kumari, S.; Ravikar, R.; Ralph, R. Carbapenem resistant Klebsiella pneumoniae

isolated from bloodstream infection: Indian experience. Pathog. Glob. Health 2017, 111, 240–246. [CrossRef ]

2. Thomson, K.S. Extended-Spectrum-

CrossRef ] [PubMed ]

β-Lactamase, AmpC, and Carbapenemase Issues. J. Clin. Microbiol. 2010, 48, 1019–1025.

[

3. Morrill, H.J.; Pogue, J.M.; Kaye, K.S.; Laplante, K.L. Treatment Options for Carbapenem-Resistant Enterobacteriaceae Infections.

Open Forum Infect. Dis. 2015, 2, ofv050. [CrossRef ] [PubMed ]

4. Veeraraghavan, B.; Pragasam, A.K.; Bakthavatchalam, Y.D.; Anandan, S.; Swaminathan, S.; Sundaram, B. Colistin-Sparing

Approaches with Newer Antimicrobials to Treat Carbapenem-Resistant Organisms: Current Evidence and Future Prospects.

Indian J. Med. Microbiol. 2019, 37, 72–90. [CrossRef ]

3

5. Murphy, C.N.; Mortensen, M.S.; Krogfelt, K.A.; Clegg, S. Role of Klebsiella pneumoniae Type 1 and Type 3 Fimbriae in Colonizing

Silicone Tubes Implanted into the Bladders of Mice as a Model of Catheter-Associated Urinary Tract Infections. Infect. Immun.

2

013, 81, 3009–3017. [CrossRef ] [PubMed ]

3

6. Hsu, C.-R.; Lin, T.-L.; Chen, Y.-C.; Chou, H.-C.; Wang, J.-T. The role of Klebsiella pneumoniae rmpA in capsular polysaccharide

synthesis and virulence revisited. Microbiology 2011, 157, 3446–3457. [CrossRef ] [PubMed ]

3

7. Fair, R.J.; Tor, Y. Antibiotics and Bacterial Resistance in the 21st Century. Perspect. Med. Chem. 2014, 6, 25–64. [CrossRef ]

8. Schillaci, D.; Spanò, V.; Parrino, B.; Carbone, A.; Montalbano, A.; Barraja, P.; Diana, P.; Cirrincione, G.; Cascioferro, S. Pharmaceu-

tical Approaches to Target Antibiotic Resistance Mechanisms. J. Med. Chem. 2017, 60, 8268–8297. [CrossRef ]

9. Cannon, J.P.; Lee, T.A.; Clark, N.M.; Setlak, P.; Grim, S.A. The risk of seizures among the carbapenems: A meta-analysis. J.

Antimicrob. Chemother. 2014, 69, 2043–2055. [CrossRef ]

3

4

0. Du, D.; Wang-Kan, X.; Neuberger, A.; Van Veen, H.W.; Pos, K.M.; Piddock, L.J.V.; Luisi, B.F. Multidrug efﬂux pumps: Structure,

function and regulation. Nat. Rev. Microbiol. 2018, 16, 523–539. [CrossRef ]

1. Wasﬁ, R.; Elkhatib, W.F.; Ashour, H.M. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae

clinical isolates recovered from Egyptian hospitals. Sci. Rep. 2016, 6, 38929. [CrossRef ]

2. Blair, J.M.A.; Piddock, L.J.V. How to Measure Export via Bacterial Multidrug Resistance Efﬂux Pumps. mBio 2016, 7, e00840-16.

[CrossRef ]

3. Bohnert, J.A.; Schuster, S.; Szymaniak-Vits, M.; Kern, W.V. Determination of Real-Time Efﬂux Phenotypes in Escherichia coli

0

AcrB Binding Pocket Phenylalanine Mutants Using a 1,2 -Dinaphthylamine Efﬂux Assay. PLoS ONE 2011, 6, e21196. [CrossRef ]

[PubMed ]

4

4. Singh, A.K.; Yadav, S.; Chauhan, B.S.; Nandy, N.; Singh, R.; Neogi, K.; Roy, J.K.; Srikrishna, S.; Singh, R.K.; Prakash, P. Classiﬁcation

of Clinical Isolates of Klebsiella pneumoniae Based on Their in vitro Bioﬁlm Forming Capabilities and Elucidation of the Bioﬁlm

Matrix Chemistry With Special Reference to the Protein Content. Front. Microbiol. 2019, 10, 669. [CrossRef ] [PubMed ]

5. Sfeir, M.M.; Hayden, J.A.; Fauntleroy, K.A.; Mazur, C.; Johnson, J.K.; Simner, P.J.; Das, S.; Satlin, M.J.; Jenkins, S.G.; Westblade,

L.F. EDTA-Modiﬁed Carbapenem Inactivation Method: A Phenotypic Method for Detecting Metallo-β-Lactamase-Producing

Enterobacteriaceae. J. Clin. Microbiol. 2019, 57, e01757-18. [CrossRef ]

6. Tsai, Y.-M.; Wang, S.; Chiu, H.-C.; Kao, C.-Y.; Wen, L.-L. Combination of modiﬁed carbapenem inactivation method (mCIM)

and EDTA-CIM (eCIM) for phenotypic detection of carbapenemase-producing Enterobacteriaceae. BMC Microbiol. 2020, 20, 315.

[CrossRef ] [PubMed ]

7. Ribeiro, P.C.S.; Monteiro, A.S.; Marques, S.G.; Monteiro, S.G.; Monteiro-Neto, V.; Coqueiro, M.M.M.; Marques, A.C.G.; de Jesus

Gomes Turri, R.; Santos, S.G.; Bomﬁm, M.R.Q. Phenotypic and molecular detection of the blaKPC gene in clinical isolates from

inpatients at hospitals in São Luis, MA, Brazil. BMC Infect. Dis. 2016, 16, 737. [CrossRef ]

8. Meletiadis, J.; Pournaras, S.; Roilides, E.; Walsh, T.J. Deﬁning Fractional Inhibitory Concentration Index Cutoffs for Additive

Interactions Based on Self-Drug Additive Combinations, Monte Carlo Simulation Analysis, and In Vitro-In Vivo Correlation Data

for Antifungal Drug Combinations against Aspergillus fumigatus. Antimicrob. Agents Chemother. 2010, 54, 602–609. [CrossRef ]

9. Mosca, A.; Miragliotta, L.; Del Prete, R.; Tzakis, G.; Dalﬁno, L.; Bruno, F.; Pagani, L.; Migliavacca, R.; Piazza, A.; Miragliotta,

G. Rapid and sensitive detection of blaKPC gene in clinical isolates of Klebsiella pneumoniae by a molecular real-time assay.

SpringerPlus 2013, 2, 31. [CrossRef ] [PubMed ]

5

0. Moghadas, A.J.; Kalantari, F.; Sarﬁ, M.; Shahhoseini, S.; Mirkalantari, S. Evaluation of Virulence Factors and Antibiotic Resistance

Patterns in Clinical Urine Isolates of Klebsiella pneumoniae in Semnan, Iran. Jundishapur J. Microbiol. 2018, 11, e63637. [CrossRef ]

1. Bialek-Davenet, S.; Marcon, E.; Leﬂon-Guibout, V.; Lavigne, J.-P.; Bert, F.; Moreau, R.; Nicolas-Chanoine, M.-H. In Vitro Selection

of ramR and soxR Mutants Overexpressing Efﬂux Systems by Fluoroquinolones as Well as Cefoxitin in Klebsiella pneumoniae.

Antimicrob. Agents Chemother. 2011, 55, 2795–2802. [CrossRef ] [PubMed ]

5

Antibiotics 2021, 10, 388

30 of 30

5

2. Li, D.-W.; Onishi, M.; Kishino, T.; Matsuo, T.; Ogawa, W.; Kuroda, T.; Tsuchiya, T. Properties and Expression of a Multidrug Efﬂux

Pump AcrAB-KocC from Klebsiella pneumoniae. Biol. Pharm. Bull. 2008, 31, 577–582. [CrossRef ]

5

3. Wang, X.; Chen, H.; Zhang, Y.; Wang, Q.; Zhao, C.; Li, H.; He, W.; Zhang, F.; Wang, Z.; Li, S.; et al. Genetic characterisation of

clinical Klebsiella pneumoniae isolates with reduced susceptibility to tigecycline: Role of the global regulator RamA and its local

repressor RamR. Int. J. Antimicrob. Agents 2015, 45, 635–640. [CrossRef ] [PubMed ]

5

4. Tiwari, N.; Kumar, V.; Gedda, M.R.; Singh, A.K.; Singh, V.K.; Singh, S.P.; Singh, R.K. Identiﬁcation and Characterization of

miRNAs in Response to Leishmania donovani Infection: Delineation of Their Roles in Macrophage Dysfunction. Front. Microbiol.

2

017, 8, 314. [CrossRef ] [PubMed ]

5. McAuley, S.; Huynh, A.; Czarny, T.; Brown, E.D.; Nodwell, J.R. Membrane activity proﬁling of small molecule B. subtilis growth

inhibitors utilizing novel duel-dye ﬂuorescence assay. MedChemComm 2018, 9, 554–561. [CrossRef ]

Article Doi

Galactose-clicked curcumin-mediated reversal of meropenem resistance among klebsiella pneumoniae by targeting its carbapenemases and the AcrAB-TolC efflux system

DOI: 10.3390/antibiotics10040388

Source and publish data:

Authors:

Article abstract of DOI:10.3390/antibiotics10040388

Full text of DOI:10.3390/antibiotics10040388

Products guided by the article

R&D Labs maybe for 1192838-52-0

Relevant to this article

Hot Product