Evolution of the indole alkaloid biosynthesis in the genus Hordeum: Distribution of gramine and DIBOA and isolation of the benzoxazinoid biosynthesis genes from Hordeum lechleri

Article abstract of DOI:10.1016/j.phytochem.2005.01.024

Two indole alkaloids with defense related functions are synthesized in the genus Hordeum of the Triticeae. Gramine (3(dimethyl-amino-methyl)-indole) is found in H. spontaneum and in some varieties of H. vulgare, the benzoxazinoid 2,4-dihydroxy-2H-1,4-benzoxazin-3(4H)-one (DIBOA) is detected in H. roshevitzii, H. brachyantherum, H. flexuosum, H. lechleri. Biosynthesis of DIBOA and of gramine was found to be mutually exclusive in wild Hordeum species, indicating that there was selection against simultaneous expression of both pathways during evolution. The full set of genes required for DIBOA biosynthesis in H.lechleri was isolated and the respective enzyme functions were analyzed by heterologous expression. The cytochrome P450 genes Bx2-Bx5 demonstrate a monophyletic origin for H. lechleri, Triticum aestivum and Zea mays. HlBx2-HlBx5 share highest homology to the orthologous genes of T. aestivum. In contrast, the branch point enzyme of the DIBOA pathway, the indole-3-glycerol phosphate lyase BX1, might have evolved independently in H. lechleri. In all Hordeum species that synthesize DIBOA, DNA sequences homologous to Bx genes are found. In contrast, these sequences are not detectable in the genomes of H. vulgare and H. spontaneum that do not synthesize benzoxazinoids.

Full text of DOI:10.1016/j.phytochem.2005.01.024

PHYTOCHEMISTRY
Phytochemistry 66 (2005) 1264–1272
www.elsevier.com/locate/phytochem
Evolution of the indole alkaloid biosynthesis in the genus
Hordeum: Distribution of gramine and DIBOA and isolation of the
q
benzoxazinoid biosynthesis genes from Hordeum lechleri
Sebastian Gr u¨ n , Monika Frey b,*, Alfons Gierl b
a
a
Institute for Biochemical Plant Pathology, GSF-National Research Center for Environment and Health, Ingolst a¨ dter Landstraße 1,
D-85746 Neuherberg, Germany
b
Lehrstuhl f u¨ r Genetik, Technische Universit a¨ t M u¨ nchen, Am Hochanger 8, D-85350 Freising, Germany
Received 16 November 2004; received in revised form 28 January 2005
Available online 23 May 2005
Abstract
Two indole alkaloids with defense related functions are synthesized in the genus Hordeum of the Triticeae. Gramine (3(dimethyl-
amino-methyl)-indole) is found in H. spontaneum and in some varieties of H. vulgare, the benzoxazinoid 2,4-dihydroxy-2H-1,4-benz-
oxazin-3(4H)-one (DIBOA) is detected in H. roshevitzii, H. brachyantherum, H. flexuosum, H. lechleri. Biosynthesis of DIBOA and
of gramine was found to be mutually exclusive in wild Hordeum species, indicating that there was selection against simultaneous
expression of both pathways during evolution. The full set of genes required for DIBOA biosynthesis in H.lechleri was isolated
and the respective enzyme functions were analyzed by heterologous expression. The cytochrome P450 genes Bx2–Bx5 demonstrate
a monophyletic origin for H. lechleri, Triticum aestivum and Zea mays. HlBx2–HlBx5 share highest homology to the orthologous
genes of T. aestivum. In contrast, the branch point enzyme of the DIBOA pathway, the indole-3-glycerol phosphate lyase BX1,
might have evolved independently in H. lechleri. In all Hordeum species that synthesize DIBOA, DNA sequences homologous to
Bx genes are found. In contrast, these sequences are not detectable in the genomes of H. vulgare and H. spontaneum that do not
synthesize benzoxazinoids.
ꢀ
2005 Elsevier Ltd. All rights reserved.
Keywords: Gramineae; Hordeum species; DIBOA; Gramine; Cytochrome P450 enzymes; Indole biosynthesis; Evolution
1
. Introduction
metabolites that are abundant in the Gramineae, includ-
ing the major agricultural crops maize, wheat and rye.
Outside the Gramineae these secondary metabolites
are found dispersed in isolated dicotyledonous species
(Sicker et al., 2000). Benzoxazinoids are important fac-
tors of plant resistance against microbial diseases and
insects, and serve allelochemical functions. A unique sit-
uation is observed in the Triticeae genus Hordeum L.
The benzoxazinoid 2,4-dihydroxy-2H-1,4-benzoxazin-
Plant secondary metabolites have committed func-
tions in communication, and serve often as weapons in
chemical defense. Benzoxazinoids represent protective
Abbreviations: PCR, polymerase chain reaction.
q
Accession numbers: HlBx1, AY462226; HlBx2, AY462227; HlBx3,
AY462228; HlBx4, AY462229; HlBx5, AY462230.
3
(4H)-one (DIBOA) is synthesized in some Hordeum
species but is missing in others, including H. vulgare
Niemeyer, 1988). A second defense related indole
alkaloid, 3(dimethyl-amino-methyl)-indole (gramine),
*
Corresponding author. Tel.: +49 8161 715642; fax: +49 8161
(
715636.
E-mail address: Monika.Frey@wzw.tum.de (M. Frey).
0
031-9422/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2005.01.024

S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
1265
is detected in Hordeum. Benzoxazinoids and gramine
have common features: they control a broad spectrum
of pests and pathogens, and the in planta concentrations
are highest in seedlings and young plants. Both second-
ary metabolites are derived from tryptophan biosynthe-
sis. Gramine is synthesized via tryptophan (Gross et al.,
Hordeum provides the possibility to study the evolu-
tion of pathways with functional equivalent products
that compete for substrates from tryptophan biosynthe-
sis. Due to the missing data on genes involved in gra-
mine biosynthesis, the investigations on co-evolution
of DIBOA and gramine biosynthesis were restricted to
the evaluation of the product pattern. We show that
the two pathways are mutually exclusive. The knowl-
edge about benzoxazinoid biosynthesis in Zea mays
allowed the isolation of the orthologous genes from H.
lechleri. The data demonstrate a monophyletic origin
of the P450 genes of benzoxazinoid biosynthesis in the
Gramineae and a collective loss of these genes in the
non-DIBOA producing species. The Bx1 gene function
may have evolved by independent duplications of the
TSA gene.
1
974), and indole-3-glycerol phosphate (IGP) is the
branch point for DIBOA biosynthesis. While no genes
have been identified for gramine biosynthesis, the bio-
synthetic pathway of benzoxazinoids has been eluci-
dated in maize (Frey et al., 1997, 2003; v. Rad et al.,
2
001). The committing enzyme of benzoxazinoid biosyn-
thesis, BX1, evolved via gene duplication and modifica-
tion from the alpha subunit of the tryptophane synthase.
Indole-3-glycerol phosphate (IGP) is cleaved by BX1
into indole and glyceraldehyde-3-phosphate. The intro-
duction of four oxygen atoms into the indole moiety
that yields DIBOA is catalyzed by the cytochrome
P450 enzymes BX2–BX5 (Fig. 1). Orthologues to Bx1–
Bx5 have been identified for wheat (TaBx1–TaBx5,
Nomura et al., 2002, 2003).
2. Results
2.1. Biosynthesis of defense related indole alkaloids is
restricted to one structural class, DIBOA or gramine, in
Hordeum species
Five different wild barley species (H. brachyanthe-
rum), karyotype H, diploid; H. flexuosum, karytope H,
diploid; H. lechleri, karyotype H, hexaploid; H. ros-
hevitzii, karyotype H, diploid, and three different lines
of H. spontaneum, karyotype I, diploid (Jacob et al.,
2004) and four lines of cultivar barley H. vulgare (Alexis,
Baccara, Nuernberg and Tellus, karyotype I, diploid,)
were analyzed for their indole alkaloid content at the
seedling stage (first fully expanded leaf) via HPLC. No
concurrent production of both types of indole alkaloids
was detected in any line (Table 1). The four cultivar lines
contain neither gramine nor benzoxazinoids (Table 1).
Seedlings of the wild barley species H. brachyantherum,
H. flexuosum, H. lechleri, H. roshevitzii contain DIBOA
Indole-3-glycerol phosphate
BX1
Indole
N
H
BX2
Indolin-one
N
H
O
BX3
OH
O
ꢀ
1
3-Hydroxy-indolin-one
in concentrations of 300–1000 nmol g fresh weight,
gramine concentrations remained below the detection
N
H
ꢀ
1
limit (100 nmol g fresh weight) in these species. In
the three tested H. spontaneum lines gramine concentra-
ꢀ
BX4
BX5
1
tions of 300–1600 nmol g
fresh weight are found
O
OH
O
whereas benzoxazinoid concentrations remained below
the detection limit.
2
3
-Hydroxy-1,4-benzoxazin-
-one (HBOA)
N
H
2.2. Characterization of the indole-3-glycerolphosphate
lyase HlBX1
O
OH
O
2
3
,4-Dihydroxy-1,4-benzoxazin-
-one (DIBOA)
The branch point gene Bx1 of DIBOA biosynthesis is
derived from the a-subunit of tryptophan synthase,
TSA, via gene duplication and modification. TSA and
BX1 catalyze the same reaction, the conversion of in-
dole-3-glycerol phosphate (IGP) to indole and glyceral-
dehyde-3-phosphate. There are two fundamental
differences between BX1 and TSA: monomeric BX1
N
OH
Fig. 1. Schematic presentation of the DIBOA biosynthetic pathway
showing enzyme reactions catalyzed by the enzymes BX1–BX5. The
pathway was first elucidated in maize (Frey et al., 1997) and later in
wheat (Nomura et al., 2002, 2003).

1266
S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
Table 1
DIBOA and gramine content in seedlings of Hordeum species
maximum DIBOA concentrations are found in the H.
lechleri seedling and no other Bx1-homologous clone
was detected in the seedling-specific cDNA library,
HlBX1 is very likely the BX1 function of H. lechleri.
Species
Line
DIBOA [nmol/g Gramine [nmol/g
fresh weight]
fresh weight]
H. vulgare
Alexis
0
0
0
0
0
0
0
0
Baccara
N u¨ rnberg
tellus
2
.3. Isolation of HlBx2–HlBx5 from H. lechleri
Indole is converted to DIBOA by the action of four
H. spontaneum
42–48
0
0
0
364 (±52)
829 (±105)
1401 (±216)
cytochrome P450 enzymes, BX2–BX5, that introduce
four oxygen atoms. The genes Bx2–Bx5 are members
of the CYP71C subfamily of plant cytochrome P450
1
1
50–31
60–53
H. brachyantherum (H 2012) 647 (±121)
H. flexuosum
H. lechleri
0
genes and share overall amino acid identities of 45–
6
(H 1110) 404 (±124)
(H 1550) 977 (±163)
0
+
5%. Poly(A) RNA was extracted from H. lechleri
0
n.d.
H. roshevitzii
(H 179)
327 (±16)
seedlings and used in an RT-PCR approach to isolate
partial sequences with homology to the maize genes
Bx2–Bx5. Two fragments were isolated and used for
screening of a cDNA library. Six recombinant phages
were isolated and the sequence of the cloned cDNAs
determined. Four different cDNAs, named HlBx2,
HlBx3, HlBx4 and HlBx5 according to their respective
closest maize homologue, were identified. Two clones
represented partial sequences of the HlBx2 sequence.
Identities of the deduced amino acid sequences con-
stitute 80% for HlBX2 and ZmBX2, 76% for HlBX3
and ZmBX3, 81% for HlBX4 and ZmBX4 and 78%
for HlBX5 and ZmBX5 (Table 3). This is significantly
higher than the respective identities of HlBX sequences
among themselves (47–67%, Table 3) and of the four
maize BX sequences among themselves (43–60%, Frey
et al., 1995).
n.d., not determined.
catalyzes the reaction and the formed indole is released.
In contrast, efficient catalysis by TSA requires the for-
mation of a complex with the b-subunit (TSB) of the
tryptophan synthase (TS), the synthesized indole is not
released but travels through a tunnel connecting the ac-
tive sites of the a- and b-subunits and is used for the for-
mation of tryptophan by TSB within the complex. A
second indole-3-glycerol phosphate lyase with homology
to TSA and Bx1 and the characteristic enzymatic
properties of BX1, has been identified in maize. This
BX1-type enzyme, termed IGL, is induced by herbivore
attack and delivers indole in the so-called tritrophic
interaction (Alborn et al., 1997; Frey et al., 2000).
In order to isolate the gene that catalyzes the forma-
tion of indole for DIBOA biosynthesis in H. lechleri, a
cDNA library derived from seedling tissue was screened
with the maize Bx1 gene cDNA (ZmBx1) as a probe at
reduced stringency. One hybridization signal was de-
tected and the recombinant phage isolated. The isolated
sequence was named HlBx1. Sequencing revealed a
strong homology with ZmBx1 (72% identity). The gene
was expressed in Escherichia coli and the kinetic data of
the purified recombinant enzyme were determined (Ta-
ble 2). HlBX1 catalyzes efficiently the biosynthesis of in-
2.4. Substrate specificity of the enzymes HlBX2–HlBX5
The stepwise conversion of indole to DIBOA in
maize starts with the formation of indolin-2(1H)-one
catalyzed by BX2. Indolin-2(1H)-one is converted to 3-
hydroxy-indoline-2(1H)-one by BX3. Then BX4 cata-
lyzes the conversion of 3-hydroxy-indoline-2(1H)-one
to 2-hydroxy-2H-1,4-benzoxazin3(4H)-one (HBOA).
The N-hydroxylation of HBOA to DIBOA is catalyzed
by BX5 (Fig. 1). Substrate specificity of the ZmBX2–
ZmBX5 enzymes was tested by heterologous expression
cat
dole, the Km and k values for the substrate IGP are
close to the constants determined for the indole-3-glyc-
erol phosphate lyases BX1 and IGL from Z. mays.
ꢀ1 ꢀ1
cat
IGP
The homomeric HlBX1 (k =Km 31 mM s ) is
Table 3
Comparison of the amino acid sequences of H. lechleri and Z. mays
about 4-fold more efficient in catalyzing IGP cleavage
cat
IGP
m
ꢀ1 ꢀ1
than the E. coli TS a b (k =K
7.4 mM s ). Since
HlBX2
HlBX3
HlBX4
HlBX5
2
2
HlBX3
HlBX4
HlBX5
ZmBX2
ZmBX3
ZmBX4
ZmBX5
51/70
52/71
47/66
80/90
50/72
52/72
46/65
–
–
–
67/83
67/80
51/71
76/88
62/79
61/76
–
–
Table 2
Comparison of catalytic properties
58/76
50/68
64/80
81/90
54/74
–
49/69
65/81
57/77
78/86
Z. mays
H. lechleri
BX1
IGL
HlBX1
IGP
m
K
k
(mM)
)
0.013
2.8
215
0.1
2.3
23
0.080
2.5
31
Percentage of identities/percentage of similarities are given. Combi-
nations with the highest degree of identity and similarity are high-
lighted by bold letters.
cat ꢀ1
(s
cat
IGP
ꢀ1 ꢀ1
s )
k
=Km (mM

S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
1267
in S. cerevisiae WAT11 (Frey et al., 1997; Glawischnig
et al., 1999). This yeast system expresses an A. thaliana
P450 reductase gene (ATR1) (Pompon et al., 1996)
and the same system was used for expression of
HlBX2–HlBX5. Intermediates of the DIBOA biosynthe-
sis pathway were incubated with microsomal fractions
from yeast cells expressing one of the H. lechleri P450
enzymes. As their maize homologues, HlBX2 converts
specifically indole to indolin-2(1H)-one and HlBX4 spe-
cifically 3-hydroxy-indolin-2(1H)-one to HBOA. HlBX5
had to be modified to meet the requirements for efficient
translation in yeast cells to get detectable enzyme
activity (see Section 4). The modified HlBX5 specifically
converts HBOA to DIBOA. None of the other
substrates was converted by one of these enzymes. All
efforts to get a functional expression of HlBX3 failed,
most likely due to limitations of the heterologous yeast
system. However the wheat enzyme TaBX3 (Nomura
et al., 2002) and HlBX3 share 95% identity and 98%
similarity, this extremely high degree of sequence con-
servation makes it most likely that the H. lechleri
sequence indeed represents the BX3 function although
in this one case a functional verification of the HlBX
enzyme function in the recombinant yeast system was
not possible.
Fig. 2. Southern analysis of genomic DNAs (HindIII digest) from
various Hordeum species and T. aestivum with H. lechleri Bx gene
cDNA. Representative data for hybridization probes (HlBx1 and
HlBx2) are shown. Hybridization with HlBx2 revealed no signal for H.
spontaneum ssp. and H. vulgare cultivars, bands light up for all plants
that synthesize DIBOA. The same distribution of hybridization signals
was displayed for HlBx3, HlBx4, HlBx5 (data not shown). The
membrane was probed consecutively with the probes. + and ꢀ indicate
the presence and absence of DIBOA in the investigated species. (a,h,i)
H. vulgare cultivars Alexis, Nade and B87; (b) H. spontaneum ssp. 42–
48; (c) H. spontaneum ssp. 160–130; (d) H. lechleri; (e) H. brachyan-
therum; (f) H. roshevitzii; (g) H. flexuosum; (j) T. aestivum cultivar
Trakos.
2.5. Distribution of HlBx-homologous sequences in
Hordeum species
We examined whether the genes orthologous to
HlBx1–HlBx5 are present in different wild barley spe-
cies and H. vulgare cultivars. A clear correlation be-
tween DIBOA biosynthesis and presence of HlBx
gene sequences was detected. Strong hybridizing bands
were observed for all Hordeum species producing DI-
BOA for all five genes assayed (Fig. 2, representative
data for HlBx1 and HlBx2 hybridization probes are
shown). Under the same hybridization conditions no
hybridization bands were detected for H. vulgare culti-
vars and H. spontaneum ssp. with the probes of the
P450 genes HlBx2–HlBx5, although clear signals were
displayed in parallel with wheat DNA. All four modi-
fying genes of the pathway seem to be absent from the
genomes of these non-DIBOA producing species.
HlBx1 homologous sequences were detected in all
Hordeum species independent of the status in DIBOA
biosynthesis. Interestingly, the hybridization pattern
with the HlBx1 probe is identical for H. vulgare and
H. spontaneum ssp., this result is in accord with the
assumption that H. spontaneum is the progenitor of
cultivated barley. However, it is not clear whether the
bands lighting up in H. vulgare and H. spontaneum rep-
resent an orthologue of HlBx1 ore simply the TSA
gene. The maize ZmBx1-probe cross-hybridizes with
Igl and maize TSA under the hybridization conditions
used.
3. Discussion
3.1. Biosynthesis of DIBOA and of gramine is mutually
exclusive in wild Hordeum species
The genus Hordeum L. comprises 31 species which
occur under a wide variety of climates in Eurasia and
the New World. The species can be grouped into four
clades (Xu, Xa, H and I). Clade H includes Asian
(H1) and New World members (H2). Representatives
of subclades H1 (H. roshevitzii) and H2 (H. brachyanthe-
rum, H. flexuosum, H. lechleri) contain DIBOA, H.
spontaneum ssp, grouped in clade I, have substantial lev-
els of gramine while DIBOA is not detectable (Table 1).
Nothing is published about indole alkaloid content in
Hordeum species from clade Xu and Xa.
Benzoxazinoids are found in the subfamilies Panicoi-
deae (e.g., Z. mays), and Pooideae (e.g., Triticum aes-
tivum), suggesting that the acquisition of the pathway
occurred relatively early in the evolution of the Grami-
neae. Gramine is synthesized in Hordeum and Phalaris,
both belonging to the subfamily Pooideae but grouped
into the tribes Triticeae and Avenae, respectively. It

1268
S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
can be assumed that gramine biosynthesis evolved prior
to the division into the two tribes. Hence, it can be
hypothesized that the pathways for the biosynthesis of
gramine and DIBOA were coexisting in the precursors
of Hordeum. The overlap in biological function of the
two secondary metabolites may have allowed the loss
of one pathway without unfavorable consequences. Loss
may even be beneficial, since biologically relevant con-
centrations of DIBOA and gramine in defence reactions
are relatively high (0.1–1.0 mg per g fresh weight, Sicker
et al., 2000; Hanson et al., 1981), and a substantial chan-
neling of intermediates from the tryptophan biosyn-
thetic pathway into the secondary metabolic pathways
is required. The loss of one secondary biosynthetic path-
way might help to balance primary and secondary
metabolism of the plant. Another example of two plant
secondary metabolites that share the biosynthetic origin
and are mutually exclusive is given by glucosinolates
and cyanogenic glucosides. Both derive from amino
acids that are converted into aldoximes by cytochrome
P450 enzymes belonging to the CYP79 family (Gla-
wischnig et al., 2003). Cyanogenic glucosides occur
widely throughout the plant kingdom, glucosinolates
are found among the order Capparales and in the genus
Drypetes in the order Euphorbiales. Carica papaya is the
only known example that contains both groups of sec-
ondary metabolites (Tang, 1971; Spencer and Seigler,
is converted to its 7-methoxy derivative DIMBOA and
glucosylated (Niemeyer, 1988). The biosynthesis of DI-
BOA-glucoside can be considered as the basic biosyn-
thetic pathway of defence related benzoxazinoids in
the Gramineae. Recently, orthologous genes, TaBx1–
TaBx5, have been identified in wheat (Nomura et al.,
2002, 2003) and the respective enzymatic functions have
been described in rye (Glawischnig et al., 1999). A phy-
logenetic tree (Fig. 3) was constructed using the deduced
amino acid sequence data from maize, wheat and H.
lechleri. The genes can be divided into two functional
sets, the branch point gene Bx1 (Fig. 3A) and the cyto-
chrome P450 genes Bx2–Bx5 (Fig. 3B) that are required
for modification of the branch point reaction product.
In the phylogenetic analysis of the cytochrome P450 en-
zymes, proteins with identical functions group together.
The closest relationship exists between the genes from
wheat and those from H. lechleri (between 95% and
97% identity on amino acid level), hence the phylogeny
of these Bx genes reflects the phylogenetic relationship
of the plant species. The data demonstrate a monophy-
letic origin of the P450 genes involved in DIBOA
biosynthesis.
The picture may be different for the BX1 enzyme
function. In the phylogenetic tree, the TSA proteins
and the BX1-type enzymes group into two branches.
In the case of a monophyletic origin of BX1-function,
a closer relationship of HlBX1 and TaBX1 compared
to ZmBX1 would be expected, but almost identical lev-
els of identity were revealed in the analysis (identities on
amino acid level: HlBX1and ZmBX1, 72%; HlBX1 and
TaBX1, 73%). Hence the phylogeny of maize, wheat and
H. lechleri is not reflected, and independent TSA gene
duplication events very likely have created Bx1-function
in maize and wheat on the one hand, and in barley on
the other hand. Likewise Igl might also represent an
independent gene duplication event in maize.
1
984; Bennett et al., 1997). When the sorghum cyano-
genic glucoside-specific pathway is expressed in Arabid-
opsis thaliana a competition for substrates shared by the
two pathways is observed (Bak et al., 2000). Such a com-
petition may eventually lead to the elimination of one
pathway.
DIBOA biosynthesis was lost already in H. sponta-
neum, the proposed wild progenitor of barley, and like-
wise, DIBOA is not present in H. vulgare cultivars. The
picture is not consistent for gramine. All cultivars in our
analysis do not have gramine at detectable levels, but
other cultivars have 0.2–0.4 mg/g fresh weight of gra-
mine in young leaves (e.g., Argando n˜ a et al., 1987).
The amount of gramine might increase after fungal at-
tack and elicitation (Matsuo et al., 2001). The dispersed
occurrence of gramine biosynthesis in cultivated barley
shows that breeding processes did not select for gramine
biosynthesis.
3
.2. Evolution of DIBOA biosynthesis in the Gramineae
Fig. 3. Phylogenetic tree of indole-3-glycerole phosphate lyases and
cytochrome P450 enzymes involved in DIBOA biosynthesis. Neighbor
joining trees (Saitou and Nei, 1987) were constructed using the
ClustalW program. (A) The amino acid sequences of Bx1 orthologues
from Z. mays, T. aestivum and H. lechleri were compared with Igl and
TSA genes from Z. mays and Arabidopsis thaliana. (B) The comparison
of the amino acid sequences of the P450 genes involved in benzoxaz-
inoid biosynthesis comprised the genes from Z. mays, T. aestivum, and
H. lechleri. There are two functional genes for Bx2 in T. aestivum. Data
were taken from Frey et al. (1997, 2000) and Nomura et al. (2002,
2003).
Benzoxazinoid biosynthesis first has been elucidated
in maize (Frey et al., 1997). Conversion of IGP to indole
by BX1 is the branch reaction that leads to the produc-
tion of the benzoxazinoids. The biosynthesis continues
with the conversion of indole to DIBOA catalyzed by
the P450 enzymes BX2–BX5. In certain grasses like
rye and wild species of Hordeum DIBOA is glucosylated
and stored in the vacuole. In maize and wheat, DIBOA

S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
1269
In maize eight genes of benzoxazinoid biosynthesis,
Bx1–Bx8, are found within 23 cM on the short arm of
chromosome 4 (Frey et al., 2003). This gene cluster is
split in wheat. The genes TaBx1 and TaBx2 are located
at chromosome 4, while TaBx3–TaBx5 map on chromo-
some 5 (Nomura et al., 2002). In rye these two gene
groups are found at syntenic positions (chromosomes
and 160–53 were from Risø National Laboratory, Ros-
kilde, Denmark. H. brachyantherum Nevski (H2012), H.
flexuosum Steud. (H1110), H. lechleri (Steud.) Schenck
(H1550), H. roshevitzii Bowden (H179) and H. vulgare
cultivar Tellus were obtained from Institute of Plant
Genetics and Crop Plant Research, Gatersleben Ger-
many, Z. mays ‘‘LG11’’ from Lima Grain, France and
Secale cereale ‘‘Halo’’ from Lochow-Petkus, Bergen,
Germany.
5
and 7, Nomura et al., 2003). The chromosomal loca-
tion for Hordeum has not yet been determined. It can
be assumed that the genes were present in the progenitor
of Hordeum. The age of the branching point between the
Hordeum I-clade that includes H. spontaneum, H. vulg-
are, and the H-clade, comprising the DIBOA-producing
species, was estimated with 12 Myr (Jacob et al., 2004).
During this time of independent evolution Bx-gene
homologous sequences were lost in H. vulgare and H.
spontaneum. A detailed analysis of the genome size in
Hordeum revealed considerable differences between dip-
loid species that evolved during this time, e.g., H. spon-
taneum ssp. have about 10.7 pg DNA per haploid
genome, Hordeum flexuosum about 8.5 pg per haploid
genome (Jacob et al., 2004). Hence processes like gene
duplications, deletions, and inversions were active.
Nomura et al. (2003) hypothesize that the original
arrangement of Bx genes in the Gramineae is a cluster.
This might explain the concomitant loss of Bx2–Bx5
by rearrangement of that chromosomal region.
Seeds were germinated after stratification on wet filter
paper under following conditions: 16 h daylight 16 ꢁC,
2
8 h dark, 12 ꢁC, light intensity: 400 l Einstein/m s.
4.3. Isolation of indole alkaloids from seedlings
Gramine was isolated from seedlings as described by
Hoult and Lovett (1993). 0.2–3.0 g of plant material
ground in liquid nitrogen were homogenized and incu-
bated for 24 h in 30 ml of 0.01% acetic acid. After filtra-
tion the pH of the homogenate was adjusted to 9.15 with
0.2 M KOH, followed by centrifugation (5 min,
3000 rpm). Sep-Pak C18 Cartridges (Waters Associates)
were washed with 2 ml acetonitrile and equilibrated with
2 ml of 1 mM KH PO , pH 7.0. 10 ml of the plant ex-
2
4
tract were applied to the cartridge. After washing with
2 ml of 0.05 M KH PO , pH 9.5/isopropanol (70/30)
and 2 ml of 0.05 M KH PO , pH 9.5/isopropanol (95/
2
4
2
4
5), gramine was eluted with 2 ml of 0.05 M KH PO ,
pH 2.3/isopropanol (70/30). After lyophilisation the res-
2 4
4
. Experimental
idue was dissolved in 120 ll of 0.05 M KH PO + 0.1%
2
4
triethylamine, pH 7.65/acetonitrile (60/40) and analyzed
by HPLC.
4
.1. Chemicals
DIBOA was purified from seedlings according to Bai-
ley and Larson (1991) and Glawischnig et al. (1999) with
2.0 g of plant material. The ground material was incu-
Indole and indolin-2-one were purchased from Fluka
Chemie, Buchs, CH, 1,4-benzoxazin-3-one from Al-
drich. 2-Hydroxy-1,4-benzoxazin-3-one (HBOA) was
synthesized chemically according to Honkanen and Vir-
tanen (1960) and Glawischnig et al. (1999). DIBOA was
purified from rye seedlings according to Bailey and Lar-
son (1991) and Glawischnig et al. (1999). DIMBOA was
purified from maize seedlings according to Hartenstein
et al. (1992). 3-Hydroxyindolin-2-one was obtained by
reducing isatin (indole-2,3-dione, Sigma) according to
Frey et al. (1997). Gramine was purchased from Sig-
ma–Aldrich. Oligonucleotides were purchased from
MWG Biotech, GIBCO BRL and Sigma Genosys.
bated for 1 h in 5 volumes of H O to generate the aglu-
2
con of the benzoxazinoid. After adjusting the pH to 2.0
with HCl the homogenate was incubated at 65 ꢁC for
5 min. and centrifuged (10 min, 5000 rpm). The superna-
tant was extracted two times with each 0.7 volumes ethyl
acetate. The organic phases were evaporated by centri-
fugation in vacuum at room temperature and the DI-
BOA containing residue was dissolved in 60 ll
methanol for HPLC-analysis.
Two replicates of every plant sample were analyzed in
duplicate.
4
.2. Plant material and growth conditions
4.4. HPLC-based quantification of indole alkaloids and
their biosythesis intermediates from plant extracts and
P450 enzyme assays
H. vulgare cultivars Alexis, Baccara, and N u¨ rnberg,
were obtained from the Bavarian State Research Center
for Agriculture, Germany; H. vulgare cultivars B87 and
Nade and T. aestivum cv. Trakos, respectively, from the
Department of Plant Sciences, Center for Life and Food
Sciences, Weihenstephan, Technical University Munich,
Germany. The three H. spontaneum lines 42–48, 150–31
Plant extracts and enzyme assays were analyzed by
reverse phase high performance liquid chromatography
(HPLC) using LiChroCart RP18 columns (125 · 4, flow
rate 1 ml/min) and the system ‘‘Gold V810’’ or ‘‘Gold
Nouveau’’ Beckman. Gramine was eluted for 12 min

1270
S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
under isocratic conditions (0.05 M KH PO + 0.1% tri-
2
but the complete amino terminal region of ZmBx4 is en-
coded. Hence HlBx4 seems to have an extended amino
terminal anchor domain. For heterologous expression
the ACC codon located at homeologous position to
the start codon in ZmBx4 was replaced by the codon
ATG using an adaptor sequence.
4
ethylamine, pH 7.65/acetonitrile (60/40)). Benzoxazi-
noids and intermediates of the DIBOA-biosynthesis
were eluted for 5 min in isocratic conditions with solvent
A (H O/acetic acid, 9:1) followed by a linear gradient
2
from solvent A to B (methanol/H O/acetic acid,
2
7
(
0:27:3) for 7 min. Analytes were detected at 254 nm
benzoxazinoids) and 221 nm (gramin) and analyzed as
described (Glawischnig et al., 1999).
Adaptor HlBx4:
0
fw: 5 CTAGAGAATTCGGCACCATGGCTCTTG
0
AAGCAGCGTACCACTACCTGCA3 ;
0
4.5. Construction and screening of the H. lechleri cDNA
library
rev: 5 CCATCACCATGCGACGAAGTTCTCGGT
0
ACCACGGCTTAAGA3 .
RNA was isolated from 10 days old H. lechleri seed-
+
The yeast expression vector pYeDP60 (Urban et al.,
1990) was modified by ligation of an adaptor between
the BamHI and EcoRI restriction sites. cDNAs cloned
in the lambda-ZAP system are integrated in the yeast
vector in the correct orientation for expression after
digestion with EcoRI and XhoI.
lings according to Logemann et al. (1987). Poly(A)
RNA was prepared using Oligotex Direct mRNA Midi
Kit (Qiagen). cDNA was synthesized from 1 lg
poly(A) RNA with the TagMan Kit (Perkin–Elmer).
+
The cDNA library was constructed using the Lambda-
ZAP system (Stratagene) according to the manufac-
Adapter pYad:
5
turerÕs specifications. The primary library (5 · 10 pfu)
5
0
was amplified and 5 · 10 pfu of the amplified library
were screened.
fw: 5 GATCCGAATTCATACGTTAGCATGGCT
0
ACGGTCGACC3 ;
0
For the identification of sequences homologous to
Bx1 the maize cDNA was used for hybridization (Frey
et al., 1997). The fragments for screening the cDNA li-
brary for sequences homologous to Bx2–Bx5 were iso-
lated by an RT-PCR approach that combines
enrichment for cytochrome P450 genes (Fischer et al.,
rev: 5 TTAACCAGCTGGCATCGGTACGATTGC
0
ATACTTAAGC3 .
Grasses and yeast differ in their codon usage. Genes
of grasses are biased to G/C-codons. This can result in
reduced gene expression. For expression of HlBx3 and
0
2
001, primer perf-1, -5) and specific amplification using
HlBx5 an A/T-rich region was introduced and the 5 -
sequence information of isolated Bx genes (primer 2df,
c2wr). A first PCR was performed as described by
Fischer et al. (2001). The combination of primers perf-
untranslated leader was reduced in size. The site directed
mutagenesis altered the DNA sequence without chang-
ing the encoded amino acid sequence, 129 bp of the
0
1
and perf-5 with the T-anchor primer was productive.
HlBx3 and 123 bp of the HlBx5 at the respective 5 -ends
0
The generated DNA fragments were subjected to a sec-
ond PCR with specific primer pairs. Two fragments with
homology to Bx2 (435 bp, primer 2df) and Bx3 (179 bp,
primer c2wr) were amplified. Fragments were labeled
were exchanged. For each sequence the 5 -end was re-
placed by a combination of mutagenesis-adaptor and
site directed mutagenesis PCR derived fragment in a
three point ligation. The resulting clones were sequenced
to exclude primer- and PCR-based errors of the modi-
fied sequences. The following adaptor and primer pairs
were employed:
3
2
with P and used for hybridization of the cDNA library
under low stringency conditions (2· SSPE, 55 ꢁC).
4
.6. Heterologous expression of HlBx1 in E. coli
HlBx3:
0
HlBx1 was expressed in the pET3a E. coli expression
adaptor1fw: 5 GATCCATGGCTCTTGAAGCAGC
0
system and assayed as described (Frey et al., 1997,
000). Transit peptide sequences at the amino terminus
were not included in the expression clone.
ATACCACTACCTGCA3 ;
0
2
adaptor1rev: 5 CCATCACCATACGACGAAGTT
0
CTCGGTAC3 ;
0
adaptor2fw: 5 GATCCATATAAATGGCTTTGGA
AGCTGCTTACCACTACTTGCAAATCGCTGTC
GGCCATGGTACTTCTACGCCAGCTGCTTTGT
4
.7. Heterologous expression of the cytochrome P450
genes HlBx2 to HlBx5
0
T3 ;
adaptor2rev: TTGTTTCGTCGACCGCTACTTCA
TGGAACCGGCTGTCGCTAAACGTTCATCACC
The alignment gave strong evidence that the isolated
sequences were full-size cDNAs of HlBx2, HlBx3,
HlBx5 since the ATG codon is present at analogous po-
sition to the translational start of each respective maize
Bx gene. In the HlBx4 cDNA a start codon is missing
0
ATTCGTCGAAGGTTTCGG TAAATATAC3 ;
0
mismatch primer fw: 5 TCTACGCCAGCTGCTTT
GTTGACTGTTTTGTTGTTGTTGATTATTAGA

S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
1271
TTGGCTTGGGTTAGAACTACTACTGCTTCTA
0
are grateful to A. B o¨ rner, IPK Gatersleben for the gen-
erous gift of seed material and valuable discussions.
Benzoxazinoids were kindly made available by D. Sicker,
Institute of Organic Chemistry, University Leipzig. The
excellent technical assistance by R. H u¨ ttl is acknowl-
edged. This work was supported by Deutsche Fors-
chungsgemeinschaft (SFB 369).
CTAGATTGAGCAAGCAGCAGCAGCTC3 ;
0
mismatch primer rev: 5 GAATGATGGCCGGCGG
0
CCATGGATG3 .
HlBx5:
0
adaptor1fw: 5 AATTCATATAAATGGCTCTTGA
AGCTGCTCATCACTACTTGAGACACGCTTGG
0
TCATGGTACTTCTGCTCCAG3 ;
0
References
adaptor1rev: 5 GACCTCGTCTTCATGGTACTGG
TTCGCACAGGAGTTCATCACTACTCGTCGAA
Alborn, H.T., Turlings, T.C.J., Jones, T.H., Stenhagen, G., Loughrin,
J.H., Tumlinson, J.H., 1997. An elicitor of plant volatiles from beet
armyworm oral secretion. Science 276, 945–949.
0
GTTCTCGGTAAATATAC3 ;
mismatch primer1fw: AGTTGTGGACGGAATTC
Altschul, S.F., Madden, T.L., Sch a¨ ffer, A.A., Zhang, J., Zhang, Z.,
Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST a
new generation of protein database search programs. Nucleic Acids
Res. 25, 3389–3402.
0
0
ATGGCTCTTGAAG3 ;
mismatch primer2fw: 5 GGTACTTCTGCTCCAG
CTGCTTTGTTGTTGGTTTGTGTTCCATTGTTG
TTGTTGTTGTTGTTGTTCGCTTCTTTGAGAA
Argando n˜ a, V.H., Zuniga, G.E., Corcuera, L.J., 1987. Distribution of
gramine and hydroxamic acids in barley and wheat leaves.
Phytochemistry 26, 1917–1919.
0
CCTCAGCGTCGACAAGA3 ;
0
mismatch primer1/2rev: 5 AAGGGCGAGAAGG
0
Bailey, B.A., Larson, R.L., 1991. Maize microsomal benzoxazinone N
monooxygenase. Plant Physiol. 95, 792–796.
CGACGTCGGTGG3 .
Bak, S., Olsen, C.E., Halkier, B.A., Møller, B.L., 2000. Transgenic
tobacco and Arabidopsis plants expressing the two multifunc-
tional sorghum cytochrome P450 ennzymes, CYP79A1 and
CYP71E1, are cyanogenic and accunulate metabolites derived
from intermediates in dhurrin biosynthesis. Plant Physiol. 123,
1437–1448.
4
.8. DNA sequencing and computer analysis
Sequence analysis was done with an ABI PRISM 377
Becker, M.D., Guarente, L., 1991. High-efficiency transformation of
yeast by electroporation. Methods Enzymol. 194, 182–187.
Bennett, R.N., Kiddle, G., Wallsgrove, R.M., 1997. Biosynthesis of
benzylglucosinolate, cyanogenic glucosides and phenylpropanoids
in Carica papaya. Phytochemistry 45, 59–66.
DNA Sequencer (Perkin–Elmer). Sequence data were
analyzed using the program SeqMan (DNA-Star, Laser-
gene) and homology searches were done with BLAST
analysis (Altschul et al., 1997). Phylogenetic trees were
generated using CLUSTALW (http://clustalw.genome.
jp/), based on the Neighbor Joining (NJ) algorithm.
Fischer, T.C., Klattig, J.T., Gierl, A., 2001. A general cloning strategy
for divergent plant cytochrome P450 genes and its application in
Lolium rigidum and Ocimum basilicum. Theor. Appl. Genet. 103,
1
014–1021.
4.9. Transformation of yeast cells and preparation of
microsomal fractions
Frey, M., Kliem, R., Saedler, H., Gierl, A., 1995. Expression of a
cytochrome P450 gene family in maize. Mol. Gen. Genet. 24, 100–
1
09.
Frey, M., Chomet, P., Glawischnig, E., Stettner, C., Grun, S.,
Winklmair, A., Eisenreich, W., Bacher, A., Meeley, R.B., Briggs,
S.P., Simcox, K., Gierl, A., 1997. Analysis of a chemical plant
defense mechanism in grasses. Science 277, 696–699.
Yeast cells of the Arabidopsis P450 reductase ATR1
expressing S. cerevisiae WAT11 were grown according
to Pompon et al. (1996) and transformed by heat shock
according to Gietz et al. (1992) or electroporation
according to Becker and Guarente (1991). Yeast micro-
somal proteins containing heterologously expressed
barley P450 enzymes were prepared according to Urban
et al. (1990).
Frey, M., Stettner, C., Pare, P.W., Schmelz, E.A., Tumlinson, J.H.,
Gierl, A., 2000. An herbivore elicitor activates the gene for
indole emission in maize. Proc. Natl. Acad. Sci. USA 97, 14801–
1
4806.
Frey, M., Huber, K., Park, W.J., Sicker, D., Lindberg, P., Meeley,
R.B., Simmons, C.R., Yalpani, N., Gierl, A., 2003. A 2-oxoglu-
tarate-dependent dioxygenase is integrated in DIMBOA-biosyn-
thesis. Phytochemistry 62, 371–376.
The cytochrome P450 enzyme mediated conversions
of different substrates were analyzed according to
Glawischnig et al. (1999).
Gietz, D., St Jean, A., Woods, R.A., Schiestl, R.H., 1992. Improved
method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res. 20, 1425.
Glawischnig, E., Gr u¨ n, S., Frey, M., Gierl, A., 1999. Cytochrome P450
monooxygenase of DIBOA biosynthesis: specificity and conserva-
tion among grasses. Phytochemistry 50, 925–930.
Acknowledgements
Glawischnig, E., Mikkelsen, M.D., Halkier, B., 2003. Glucosinolates:
biosynthesis and metabolism. In: Abrol, Y.P., Ahmad, A. (Eds.),
Sulphur in Plants. Kluwer Academic Press, Dortecht, Boston,
London, pp. 145–162.
We appreciate the assistance of D. Werck-Reichhart,
CNRS, Universit e´ Louis Pasteur Strasbourg, with the
expression of Hordeum lechleri P450 genes in yeast.
We thank A. Jahoor, Risø National Laboratory,
Roskilde, Denmark, for providing seed material. We
Gross, D., Lehmann, H., Sch u¨ tte, H.R., 1974. Zur Biosynthese des
Gramins. Biochem. Physiol. Pflanz. 166, 281–287.

1272
S. Gr u¨ n et al. / Phytochemistry 66 (2005) 1264–1272
Hanson, A.D., Traynor, P.L., Ditz, K.M., Reicosky, D.A., 1981.
Gramine in barley forage – effects of genotype and environment.
Crop Sci. 21, 726–730.
Nomura, T., Ishihara, A., Imaishi, H., Ohkawa, H., Endo, T.R.,
Iwamura, H., 2003. Rearrangement of the genes for the biosyn-
thesis of benzoxazinones in the evolution of Triticeae species.
Planta 217, 776–782.
Hartenstein, H., Lippmann, T., Sicker, D., 1992. A efficient procedure
for the isolation of pure 2,4-dihydroxy-7-methoxy-2H-1,4-benzox-
azin-3(4H)-one (DIMBOA) from maize. Ind. J. Heterocycl. Chem.
Nomura, T., Ishihara, A., Imaishi, H., Endo, T.R., Ohkawa, H.,
Iwamura, H., 2002. Molecular characterization and chromosomal
localization of cytochrome P450 genes involved in the biosynthesis
of cyclic hydroxamic acids in hexaploid wheat. Mol. Genet.
Genom. 267, 210–217.
2, 75–76.
Honkanen, E., Virtanen, A., 1960. The synthesis of precursor II of
benzoxazolinone formed in rye plants and the enzymatic hydrolysis
of precursor I, the glucoside. Acta Chem. Scand. 14, 504–507.
Hoult, A.H.C., Lovett, J.V., 1993. Biologically active secondary
metabolites of barley. III. A method for identification and
quantification of hordenine and gramine in barley by high-
performance liquid chromatography. J. Chem. Ecol. 19, 2245–
Pompon, D., Louerat, B., Bronine, A., Urban, P., 1996. Yeast
expression of animal and plant P450s in optimized redox environ-
ments. Methods Enzymol. 272, 51–64.
v. Rad, U., H u¨ ttl, R., Lottspeich, F., Gierl, A., Frey, M., 2001. Two
glucosyltransferases are involved in detoxification of benzoxazi-
noids in maize. Plant J. 28, 633–642.
2254.
Jacob, S.S., Meister, A., Blattner, F.R., 2004. The considerable
genome size variation of Hordeum species (Poaceae) is linked to
phylogeny, life form, ecology and speciation rate. Mol. Biol. Evol.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new
method for reconstructing phylogenetic Trees. Mol. Biol. Evol. 4,
406–425.
2
1, 860–870.
Sicker, D., Frey, M., Schulz, M., Gierl, A., 2000. Role of natural
benzoxazinones in the survival strategy of plants. Int. Rev. Cytol.
198, 319–346.
Logemann, J., Schell, J., Willmitzer, L., 1987. Improved method for the
isolation of RNA from plant tissues. Anal. Biochem. 163, 16–20.
Matsuo, H., Taniguchi, K., Hiramoto, T., Yamada, T., Ichinose, Y.,
Toyoda, K., Takeda, K., Shiraishi, T., 2001. Gramine increase
associated with rapid and transient systemic resistance in barley
seedlings induced by mechanical and biological stresses. Plant Cell
Physiol. 42, 1103–1111.
Spencer, K.C., Seigler, D.S., 1984. Cyanogenic glucosides of Carica
papaya and its phylogenic position with respect to the violales and
capparales. Am. J. Bot. 71, 1444–1447.
Tang, C.S., 1971. Benzylthioisozyanate of papaya fruit. Phytochem-
istry 15, 117–131.
Niemeyer, H.M., 1988. Hydroxamic acids (4-hydroxy-1,4-benzoxazin-
Urban, P., Cullin, C., Pompon, D., 1990. Maximizing the expression of
mammalian cytochrome P450 monooxygenase activities in yeast
cells. Biochimie 72, 463–472.
3
3
-ones) defence chemicals in the Gramineae. Phytochemistry 27,
349–3358.