Not as easy as π: An insertional residue does not explain the π-helix gain-of-function in two-component FMN reductases

Article abstract of DOI:10.1002/pro.3504

The π-helix located at the tetramer interface of two-component FMN-dependent reductases contributes to the structural divergence from canonical FMN-bound reductases within the NADPH:FMN reductase family. The π-helix in the SsuE FMN-dependent reductase of the alkanesulfonate monooxygenase system has been proposed to be generated by the insertion of a Tyr residue in the conserved α4-helix. Variants of Tyr118 were generated, and their X-ray crystal structures determined, to evaluate how these alterations affect the structural integrity of the π-helix. The structure of the Y118A SsuE π-helix was converted to an α-helix, similar to the FMN-bound members of the NADPH:FMN reductase family. Although the π-helix was altered, the FMN binding region remained unchanged. Conversely, deletion of Tyr118 disrupted the secondary structural properties of the π-helix, generating a random coil region in the middle of helix 4. Both the Y118A and Δ118 SsuE SsuE variants crystallize as a dimer. The MsuE FMN reductase involved in the desulfonation of methanesulfonates is structurally similar to SsuE, but the π-helix contains a His insertional residue. Exchanging the π-helix insertional residue of each enzyme did not result in equivalent kinetic properties. Structure-based sequence analysis further demonstrated the presence of a similar Tyr residue in an FMN-bound reductase in the NADPH:FMN reductase family that is not sufficient to generate a π-helix. Results from the structural and functional studies of the FMN-dependent reductases suggest that the insertional residue alone is not solely responsible for generating the π-helix, and additional structural adaptions occur to provide the altered gain of function.

Full text of DOI:10.1002/pro.3504

Review
Protein Science
DOI 10.1002/pro.3504
Not as easy as π: an insertional residue does not explain the π-helix gain-of-function in two
component FMN reductases
Jeffrey S. McFarlane2, Richard Hagen1, Annemarie S. Chilton2, Dianna Forbes1, Audrey Lamb2,
Holly R. Ellis1*
1 The Department of Chemistry and Biochemistry, 179 Chemistry Building, Auburn University,
Auburn, Alabama, 36849
2
Molecular Biosciences, University of Kansas, 1200 Sunnyside Avenue, Lawrence, KS 66045,
USA.
*Correspondence to: Holly R. Ellis, Department of Chemistry and Biochemistry, Auburn
University, Auburn, AL 36849
E-mail: ellishr@auburn.edu.
Running Title: -helical structures in two-component FMN reductases
Pages:
Manuscript: 24
Supplementary materials: 3
Tables: 3
Figures: 4
Supplementary material:
Figure S1: Kinetic plots
Figure S2: ∆118 SsuE helix 4
Figure S3: FMN binding site
This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process which may lead to
differences between this version and the Version of Record. Please cite this article as
doi: 10.1002/pro.3504
© 2018 The Protein Society
Received: Jul 10, 2018; Revised: Aug 25, 2018; Accepted: Aug 27, 2018
This article is protected by copyright. All rights reserved.

Abstract
The π-helix located at the tetramer interface of two-component FMN-dependent reductases
contributes to the structural divergence from canonical FMN-bound reductases within the
NADPH:FMN reductase family. The π-helix in the SsuE FMN-dependent reductase of the
alkanesulfonate monooxygenase system has been proposed to be generated by the insertion of a
Tyr residue in the conserved α4-helix. Variants of Tyr118 were generated, and their X-ray
crystal structures determined, to evaluate how these alterations affect the structural integrity of
the π-helix. The structure of the Y118A SsuE π-helix was converted to an α-helix, similar to the
FMN-bound members of the NADPH:FMN reductase family. Although the π-helix was altered,
the FMN binding region remained unchanged. Conversely, deletion of Tyr118 disrupted the
secondary structural properties of the π-helix, generating a random coil region in the middle of
helix 4. Both the Y118A and Δ118 SsuE SsuE variants crystallize as a dimer. The MsuE FMN
reductase involved in the desulfonation of methanesulfonates is structurally similar to SsuE, but
the π-helix contains a His insertional residue. Exchanging the π-helix insertional residue of each
enzyme did not result in equivalent kinetic properties. Structure-based sequence analysis further
demonstrated the presence of a similar Tyr residue in a FMN-bound reductase in the
NADPH:FMN reductase family that is not sufficient to generate a π-helix. Results from
structural and functional studies of the FMN-dependent reductases suggest that the insertional
residue alone is not solely responsible for generating the π-helix, and additional structural
adaptions occur to provide the altered gain of function.
2
This article is protected by copyright. All rights reserved.

Keywords: flavin reductases, flavin monooxygenases, two-component FMN-dependent systems,
-helix, NAD(P)H-FMN reductase family, SsuE, SsuD, MsuE, MsuD.
Impact statement: Two-component flavin-dependent enzymes consist of a flavin reductase and
a flavin-dependent monooxygenase that utilize a comprehensive range of structural features to
carry out their innovative mechanistic strategies. We have performed kinetic and structural
studies to evaluate the relationship between distinct structural properties of the two-component
FMN-dependent reductases with their overall function. The results obtained from these studies
can be broadly applied to other enzymes that utilize similar structural features to enhance
catalytic function.
1Abbreviations used: FMN, oxidized flavin mononucleotide; FMNH2, reduced flavin
mononucleotide; NADPH, reduced nicotinamide adenine dinucleotide phosphate; NADH,
reduced nicotinamide adenine dinucleotide SsuE, alkanesulfonate monooxygenase flavin
reductase; SsuD, alkanesulfonate monooxygenase; SfnF, dimethylsulfone monooxygenase flavin
reductase; SfnG, dimethylsulfone monooxygenase; MsuE, methanesulfonate monooxygenase
flavin reductase; MsuD, methanesulfonate monooxygenase.
3
This article is protected by copyright. All rights reserved.

Introduction
In the majority of flavoprotein monooxygenases, the flavin is tightly bound and both the
reductive and oxidative half-reactions occur on the same enzyme. However, a group of
flavoprotein monooxygenases have been identified that rely on a separate flavin-dependent
reductase to catalyze the reductive half reaction, with the reduced flavin transferred to a flavin-
dependent monooxygenase to catalyze the oxidative half reaction generating an oxygenated
product. While the substrates for the monooxygenases of two-component systems are quite
diverse, several FMN-dependent two-component monooxygenase systems have been identified
that are involved in bacterial sulfur acquisition. A common means for acquiring sulfur during
sulfur limitation in diverse bacteria is the two-component alkanesulfonate monooxygenase
system [Fig. 1(A)]. The majority of kinetic studies have focused on the alkanesulfonate
monooxygenase system in Escherichia coli.1–6 but these systems are widely conserved
suggesting an essential role in maintaining cellular sulfur concentrations.7 Pseudomonas sp. have
a more complex mechanism for sulfur acquisition when sulfur in the environment is limiting.8
Certain pseudomonads contain multiple two-component FMN-dependent systems that form a
pathway to convert dimethylsulfone (DMSO2) to sulfite, but also allow them to utilize long chain
aliphatic sulfonates. DMSO2 is derived through the oxidation of dimethyl sulfide, a secondary
metabolite in some marine algae, and is the most abundant biological sulfur compound emitted
to the atmosphere.9 DMSO2 is converted to methanesulfinate by dimethylsulfone
monooxygenase (SfnF/SfnG) [Fig. 1(B)].10–14 The methanesulfinate produced is oxidized in
some Pseudomonas sp. to methanesulfonate by the methanesulfinate monooxygenase system
(MsuE/MsuC) [Fig. 1(C)], and the methanesulfinate is further oxidized to sulfate and
4
This article is protected by copyright. All rights reserved.

formaldehyde by methanesulfonate monooxygenase (MsuE/MsuD) [Fig. 1(D)].15 P. aeruginosa
contains a complete pathway for the conversion of DMSO2 to sulfite release.
Two NAPDH:FMN reductases with high structural similarity to SsuE are YdhA from
Bacillus subtilis and ArsH from Shigella flexneri.16–18 The YdhA enzyme is classified as a
quinone reductase, and ArsH is a reductase involved in arsenic resistance.17–20 Unlike the
reductases of the two-component systems, YdhA and ArsH do not require a monooxygenase
partner, performing the oxidation of substrate molecules themselves. All four enzymes, YdhA,
ArsH, SfnF, and SsuE, are grouped into the NAD(P)H:FMN reductase family based on the
flavodoxin fold. These enzymes are further divided into subgroups of the family based on helix
4. While helix 4 in YdhA and ArsH is an α-helix, in the two-component FMN-dependent
reductases helix 4 is a -helix structure. The -helix is characterized by a wider turn due to i + 5
→ i hydrogen bonding that causes a bulge in the helix. It has been proposed that π-helices arise
due to an amino acid insertion in an established α-helix, which becomes the basis of a new
structural element with a defined function. The π-helix has been proposed to provide a gain-of-
function, thereby counterbalancing the relative structural instability compared to a continuous α-
helix. Specified functional roles for π-helices have been experimentally identified in a limited
number of proteins, and include active site features to promote metal or cofactor binding, or
introduction of catalytic residues.21,22
The -helix in SsuE has been proposed to be generated by the insertion of a Tyr residue in
the conserved 4-helix.16 In the three-dimensional structure of apo-SsuE (PDB 4PTY), π-
stacking interactions are observed between the aromatic rings of Tyr118 residues across the
tetramerization interface. In a flavin-bound SsuE structure the hydroxyl group of Tyr118
hydrogen bonds to the oxygen atom backbone carbonyl of Ala78 across the tetramer interface;
5
This article is protected by copyright. All rights reserved.

however, this structure was generated by soaking tetrameric crystals with excess flavin.16 In
solution, the SsuE enzyme has been shown to undergo a tetramer to dimer oligomeric change
upon binding of FMN [Fig. 2(A)], and this oligomeric change may promote protein-protein
interactions that facilitate the release of reduced flavin to SsuD [Fig. 2(B), 2(C)]. Therefore, the
π-helix may provide a gain-of-function by promoting the release of reduced flavin to the
monooxygenase. Previous studies showed that conversion of Tyr118 to alanine (Y118A SsuE)
generated protein that stably bound oxidized FMN and showed no NADPH oxidase activity.23,24
A deletion variant of Tyr118 (∆Y118 SsuE) was not purified with FMN bound, but the variant
also lacked reductase activity. While the initial flavin reduction was observed in the SsuE
variants, the FMNH2 was trapped in the closed active site preventing steady state reductase
activity.23 Although the FMN was reduced, both Y118A and ∆Y118 SsuE were also unable to
support desulfonation by the SsuD monooxygenase.
In addition to modification of the kinetic properties, variants of Tyr118 showed altered
oligomeric states compared to wild-type SsuE.23,24 Whereas apo wild-type enzyme is tetrameric
in solution and in crystals, addition of FMN promotes conversion to a dimeric state.25 In the
structure of wild-type SsuE, the Tyr118 insertional residue sits near the 222 symmetry of the
tetramer, but it is not known how FMN binding alters contacts to promote the conversion from
tetramer to dimer. The structure of FMN-bound wild-type SsuE was determined by soaking apo
crystals in a large excess of FMN. Therefore, the oligomerization state is the result of the crystal
lattice of the apo-protein and does not represent the physiological oligomeric state upon FMN
binding. The Y118A variant is dimeric in solution.23 Taken together, the above data suggest that
removing the tyrosine sidechain (Y118A) prevents flavin release and also suggest that the
transition from the tetrameric to dimeric state may be important in FMNH2 transfer from SsuE to
6
This article is protected by copyright. All rights reserved.

the monooxygenase SsuD. Deletion of Tyr118 (∆Y118 SsuE) also eliminates reductase activity;
23
however, this variant was tetrameric in solution.
We hypothesized that in both Y118A and
∆Y118 SsuE, helix 4 would be a continuous α-helix due to removal of the tyrosine insertional
residue.
In Pseudomonas putida SfnF (PDB 4C76 – we note that this protein is misannotated in the
PDB as MsuE), the insertional residue is a histidine (His128), which potentially plays a similar
π-stacking role as Tyr118 SsuE. Amino acid sequence analyses and structural modeling of MsuE
from Pseudomonas aeruginosa indicate that the overall structure is similar to SsuE and SfnF,
with a -helix His insertional residue. Therefore, we tested the hypothesis that interchanging the
-helix insertional residues would generate variant proteins, Y118H and H126Y MsuE, with
kinetic properties consistent with those of the wild-type enzyme.
7
This article is protected by copyright. All rights reserved.

Results
Preparation of Y118A and ∆Y118 SsuE
Crystal structures of -helix variants Y118A SsuE, with and without FMN, and Y118
SsuE without FMN were obtained to high resolution (all better than 2 Å) to assess how variations
at the critical -helix alters the structure, and potentially contributes to changes in function. The
previously published crystallization conditions for wild-type did not produce diffraction quality
crystals for Y118A SsuE and produced no crystals for ∆Y118 SsuE; thus, it became necessary to
screen for new conditions. Indeed, each variant structure determined in these studies was from
an independent crystallization condition. The original conditions for wild-type protein used
PEG3350 as a precipitant and citrate as an additive. The apo Y118A SsuE structure was
determined from crystals that used lithium sulfate as a precipitant. The FMN-bound Y118A
SsuE crystals did use PEG3350 as a precipitant, but at more than double to concentration (20%
as opposed to 7%), with thiocyanate as an additive. Finally, ∆Y118 SsuE crystals required 30%
PEG3000 as a precipitant. Not surprisingly, these different crystals were not isomorphous
(different unit cell parameters and space groups) to each other or to the wild-type conditions.
Overall structure of π-helix variants
As with all structures determined to date, only the first 172-174 residues of 191 total are
resolved in the maps. As expected, the monomers of the Tyr118 variants maintain a high overall
structural conservation compared to the previously determined wild-type SsuE structure
(PDB:4PTY), with root mean squared deviation values from 0.59 to 0.76 for 168-172 residues.22
8
This article is protected by copyright. All rights reserved.

Unlike wild-type SsuE, which crystallizes as a tetramer, the Tyr118 variant structures determined
here all crystallized as dimers [Fig. 3(A)]. The -helices do not contribute to the dimeric
assembly [Fig. 3(B)], and the variants show no difference at the dimeric interface compared to
wild-type. The primary difference is found at the π-helix [Fig. 4(A)]. The Y118A SsuE variant
no longer contained a π-helix, but instead helix 4 was a standard α-helix similar to that observed
in ArsH and YdhA [Fig. 4(B)]. The original hypothesis was that the ∆Y118 SsuE variant would
also form a continuous α-helix for residues 110-127 through removal of the insertional tyrosine
residue. However, the electron density maps clearly demonstrate that the deletion of residue 118
prevents a helical hydrogen bonding pattern for residues 115-119 (Fig. S2), causing the helix to
be broken into two smaller helices N- and C-terminal to the deletion with a random coil for the
intervening 4 residues [Fig. 4(B)].
FMN binding to Y118A SsuE
A superposition of Y118A SsuE with and without FMN bound demonstrates the same
global fold, for the active site, with minor variances seen within the loop regions. The rmsd
between apo and FMN-bound Y118A SsuE, 0.53 – 1.0 Å for 173 Cα, indicate their remarkable
similarity, despite their differing crystallization conditions and unit cell parameters. Complete
density for the active site FMN is present (Fig. S3). A second FMN that likely represents a
crystallographic artifact is stacked along the isoalloxazine ring of the active site FMN with
partial electron density for two conformations. A similar crystallographic FMN is observed the
in FMN-bound wild-type structure.16 In the wild-type structure, a hydrogen bond forms between
the Tyr118 and a carbonyl oxygen of Ala78 from the opposing dimer, which in turn hydrogen
bonds to the isoalloxazine ring system of the FMN. This network was hypothesized to aid in
communication between the oligomerization interface and FMN binding.16 While the Y118A
9
This article is protected by copyright. All rights reserved.

SsuE variant clearly cannot hydrogen bond to Ala78 through the deleted hydroxyl, the Ala78-
FMN hydrogen bond remains intact and the loop containing Ala78 has not shifted in
conformation. The structure of the loop containing Ala78 is also maintained in the ∆118 SsuE
structure.
Oligomeric assembly of π-helix variants
Comparison of the wild-type tetramer with the dimeric structures of FMN-bound Y118A
and Y118 SsuE illustrates that key interactions composing the tetrameric interface are no
longer possible (Fig. 5). The irregular helical turns in the wild-type -helix provides a pattern of
alternating hydrophobic residues that pack with the opposite homodimer (residues 110-114) [Fig.
5(A)]. The Y118A substitution results in helical turns of equal diameter (a continuous α-helix),
but disrupts the hydrophobic packing pattern. This shift brings the N-termini of the helices in too
close proximity for a stable interaction. Residues 111-114 take up a new positions in the Y118A
SsuE variant and reside in the three dimensional space of the tetramerization interface of wild-
type SsuE. While only one π-helix is shown, the 222 symmetry of the tetramer means that this
steric clash would have to be overcome twice to form a stable tetramer [Fig. 5(B)]. A similar
clash is predicted for the ∆Y118 variant based on the structure determined here: a shift in
residues 111-114 due to disruption of the helix is seen in the deletion mutant that would prevent
tetramerization [Fig. 5(C)]. However, solution studies indicate that the primary ∆Y118 SsuE
oligomer is the tetramer.24 Therefore, the less rigid broken helix must allow rearrangement of
residues 115-119 to allow for packing of residues 111-114 to regenerate the tetramerizaton
interface in solution.
Kinetic Properties of the SsuE and MsuE π-helix Chimeras
10
This article is protected by copyright. All rights reserved.

The insertional residue that generates the -helix in SsuE is Y118, whereas in MsuE this
residue is H126. We have hypothesized that aromatic π-stacking may be key in the
tetramerization interaction that may be mediated by these residues. We therefore hypothesized
that interchanging these residues would result in chimeric proteins (Y118H SsuE and H126Y
MsuE) that had kinetic values that were unchanged in comparison to the wild-type. Initial
kinetic studies were performed to evaluate the reductase activity of wild-type P. aeruginosa
MsuE, as kinetic parameters had not been determined previously. The purified MsuE did not
possess a characteristic flavin spectrum similar to SsuE. The wild-type MsuE enzyme had a
higher kcat/Km value (32 ± 10)  104 M-1 s-1 for NADH compared to (1.9 ± 0.4)  104 M-1 s-1 for
NADPH (Table I). A kinetic preference for NADH was previously observed with MsuE from P.
fluorescens.15 Similar kcat/Km values were obtained for FMN varying NADH or NADPH at (7 ±
1)  106 M-1 s-1 and (6 ± 2)  106 M-1 s-1, respectively. The H126Y MsuE variant showed similar
kinetic parameters as wild-type for both NADH and NADPH (Table II). The comparable kinetic
parameters suggest that substitution of the His insertional residue with Tyr did not disrupt the
ability of the enzyme to reduce FMN. Unexpectedly, the Y118H SsuE variant behaves like the
Y118A SsuE and ∆Y118 SsuE variants. Y118H SsuE showed no measurable activity under any
of the assay conditions tested, suggesting that Y118H SsuE protects the reduced FMN from
release and reoxidation, preventing the enzyme from entering the steady state.
Coupled assays that include the FMN reductase (SsuE or MsuE) and monooxygenase
(SsuD or MsuD) were performed to evaluate the ability of the SsuE and MsuE variants to
effectively transfer flavin to their respective monooxygenase partner. Desulfonation activity by
the monooxygenase was observed with the H126Y MsuE/MsuD pair with a kcat/Km value of (4 ±
2)  104 M-1 s-1, comparable to the wild-type MsuE/MsuD value of (3 ± 1)  104 M-1 s-1(Table
11
This article is protected by copyright. All rights reserved.

III). Although activity was observed, the fit to the initial rates obtained in the assay were not
optimal, and suggested the H126Y MsuE variant was not effectively coupled with MsuD (Fig.
S1). Since it is possible that the reduced flavin may be released from the Y188H SsuE when
triggered by interaction with SsuD, desulfonation was also measured with this variant despite the
enzyme’s inability to enter the steady state for reductase activity. However, there was no
measurable desulfonation activity observed in coupled assays monitoring sulfite production with
the Y118H SsuE variant and SsuD, compared to the wild-type SsuE/SsuD value of (3.1 ± 0.3) 
104 M-1 s-1 (Table III).
The release of FMNH2 from the reductase enzymes may be triggered by monooxygenase
binding, and the π-helix insertional residue may be important in this interaction. Therefore, the
MsuE and SsuE variants were evaluated to see if they could transfer reduced flavin to the
opposite monooxygenase partner. The kinetic parameters for desulfonation by SsuD were similar
with wild-type MsuE as when SsuE was included in the assay with a kcat/Km value of (7 ± 2) 
104 M-1 s-1 (Table II). Similarly, SsuE was able to effectively transfer flavin to MsuD with a
kcat/Km value of (1.9 ± 0.7)  104 M-1 s-1. These kinetic parameters were analogous to the kcat/Km
value of (3.1 ± 0.3)  104 M-1 s-1 obtained in the SsuE /SsuD coupled reaction. Comparable
desulfonation activity was observed with the H126Y MsuE variant regardless of which
monooxygenase was included in the assay (Table III). Y118H SsuE variant was unable to
support flavin transfer to either monooxygenase. The absence of desulfonation activity with the
Y118H SsuE variant suggests that the substitution of histidine for tyrosine did not maintain the
same functional properties to support catalysis as observed for H126Y MsuE.
12
This article is protected by copyright. All rights reserved.

Discussion
The -helix, which was originally thought to be a rare occurrence, is now considered a
more prevalent secondary structure in enzymes. It has been proposed that some -helices are
generated by the insertion of an amino acid within a conserved -helix found in other members
within a family.21,22 The overall conformation of the conserved helix in the protein family would
need to be adjusted in order to accommodate the insertional residue.22 Furthermore, the
instability of the -helix would destabilize the structure of a protein relative to members of the
protein family that retain an-helix. Therefore, the generation of a -helix would be selected
against if it did not provide a gain-of-function for the enzyme.
The -helix identified in the FMN-dependent reductase SsuE is hypothesized to be
generated by the insertion of a Tyr in the conserved 4-helix.16 The conserved nature of the -
helix in the two-component NAD(P)H:FMN reductases MsuE and SfnF (albeit by insertion of a
histidine at the same site) suggests that it plays a defined mechanistic role for this subgroup of
enzymes that diverges from FMN-bound reductases within this family, such as ArsH and YdhA.
The -helix in SsuE located at the tetramer interface has been proposed to trigger the oligomeric
changes necessary for protein-protein interactions with SsuD. Alternatively, introduction of the
π-helix may result in a more flexible protein capable of release of the reduced FMN to the
monooxygenase partner.16
13
This article is protected by copyright. All rights reserved.

Previous studies have shown that the Y118A SsuE, which removes the sidechain
potentially involved in aromatic π-stacking across the tetramer interface, is incapable of release
of the reduced flavin and is predominantly dimeric in solution. In agreement with these data,
helix 4 of the Y118A SsuE structure is a continuous α-helix, like those of reductases that do not
release their flavin. Perplexingly, the ∆Y118 SsuE protein, which deletes the entire insertional
residue, is incapable of releasing the reduced flavin but is tetrameric in solution. The structure
determined here shows that helix 4 of ∆Y118 SsuE is broken and the protein is dimeric in the
crystal. The more flexible nature of the broken ∆Y118 SsuE helix 4 may allow it to repack as a
tetramer. In other words, removal of the sidechain reverts helix 4 to and α-helix as seen in the
homologous single component reductases, whereas removal of the insertional residue altogether
generates a unique conformation – neither α- nor π-helix.
The insertional residue in SfnF and MsuE is a histidine and is positioned at the bulge site
of the π-helix in the three-dimensional structure of SfnF. This position is homologous to Y118 in
SsuE, also at the bulge of the π-helix. A histidine insertional residue would still be able to form
similar interactions as Tyr118 in SsuE. While MsuE is from P. aeruginosa and SsuE is from E.
coli, they have a high amino acid sequence identity in the π-helical region. Therefore,
interchanging the proposed insertional residues, one would expect comparable kinetics effects:
Y118H SsuE and H126Y MsuE should be kinetically equivalent. Instead, Y118H SsuE is
kinetically equivalent to Y118A and ∆Y118 SsuE, whereas H126Y MsuE is equivalent to wild-
type MsuE. Indeed, H126Y MsuE can donate FMNH2 to MsuD and SsuD with comparable
success, and within error to wild-type MsuE. The results suggest that a protein-protein docking
interaction for flavin transfer is not severely impacted by the generation of the variant. The less
than optimal fit for the kinetic parameters could be due to a slight alteration of the protein-
14
This article is protected by copyright. All rights reserved.

protein interaction region during flavin transfer. Furthermore, the Y118H SsuE is incapable of
releasing FMNH2 in the reductase assay, and is not triggered to release the flavin by addition of
SsuD or MsuD in the desulfonation assay.
A structure-based sequence alignment for the NADPH:FMN reductases and variants
discussed herein shows that the “insertional residue” hypothesis is problematic (Fig. 6). First,
when considering the rmsd of α-carbons, the Y118 residue of SsuE and the H126 residue of SfnF
do not result in a gap (insertion) within helix 4. Furthermore, ChrR, a quinone reductase from
Escherichia coli, is a FMN reductase with a flavodoxin fold and an α-helical helix 4 that is more
structurally distant than the other homologues discussed so far (2.8 Å rmsd for 164 Cα).26
Nevertheless, ChrR has a tyrosine at the equivalent Y118-SsuE site that aligns directly with that
of the alanine in the Y118A SsuE variant. Clearly, a tyrosine at the insertion site in ChrR is not
sufficient to develop a π-helix and convert a reductase into one that can deliver reduced FMN to
a monooxygenase in a two-component system. Two possibilities may explain the alternative
functions in the two-component FMN reductases. First, the presence of the π-helix may not fully
explain the ability of two component reductases to release flavin to a monooxygenase and other
structural features may also be important. For example, the C-terminal ~20 residues have never
been resolved in these reductases. A reductase-monooxygenase complex structure would be of
significant import in deciding this question. Second, if the π-helix is indeed of functional
significance, generation of a π-helix through evolutionary adaptation is not as simple as insertion
of a residue, and compensatory variations are likely also required for gain-of-function.
15
This article is protected by copyright. All rights reserved.

Materials and methods
Materials
The Pseudomonas aeruginosa (PAO1) cell line was purchased from ATCC type culture
collection (ATCC15692). E. coli strains [XL-1 Blue and BL21(DE3)] were purchased from
Stratagene (La Jolla, CA). Plasmid vectors and pET21a were obtained from Novagen (Madison,
WI). DNA primers were synthesized by Invitrogen (Carlsbad, CA). Pfu Turbo DNA polymerase
was purchased from Agilent (La Jolla, CA). Zero Blunt PCR Cloning Kit was from
ThermoFisher (Waltham, MA). Difco-brand Luria-Bertani (LB) media was purchased from
Becton, Dickinson and company (Sparks, MD). Phenyl SepharoseTM 6 Fast Flow (high sub) was
purchased from GE Healthcare Biosciences, (Uppsala, Sweden). Macro-Prep® High Q Support
(Bio-Rad Laboratories, Hercules, CA) Sodium dodecyl sulfate (SDS) and acrylamide was
purchased from Biorad (Hercules, CA). Buffer components and chemicals for kinetic assays
were purchased from Sigma (St. Louis, MO). Isopropyl-β-D 1-thiogalactoside (IPTG), sodium
chloride, and glycerol were obtained from Macron Fine Chemicals (Center Valley, PA).
Oligonucleotide primers were purchased from Invitrogen (Carlsbad, CA).
Cloning and Site-directed Mutagenesis of MsuE and SsuE.
Cloning of the msuE and msuD gene into an expression vector was performed by PCR
amplification of the gene from P. aeruginosa. A 100 mL culture of P. aeruginosa was grown
16
This article is protected by copyright. All rights reserved.

overnight at 37˚C. The cells were pelleted following an overnight incubation, and the
chromosomal DNA from P. aeruginosa was extracted using the QIAprep Spin Miniprep Kit. The
msuE gene was PCR-amplified using the primers (5' GAT GAT CAT ATG ACC AGC CCC
TTC AAA) and (5' GAT GAT CTC GAG TCA GGC GAT CTT CAA) which included
engineered Nde I and Xho I restriction sites for ligation into the pET21a expression vector. A
hairpin existed between the msuC and msuD operon, which made in difficult to amplify msuD
from the genome. Both msuC and msuD were first PRC-amplified using the primers (5'
ATGAACGTGTTCTGGTTCCTCCC) and (5' TATGGGTAGCTCGAGTCATGAGTAG), and
the resulting PCR product was cloned in to the pCR-Blunt cloning vector using the Zero Blunt
PCR Cloning Kit. The DNA vectors containing representative clones were submitted for DNA
sequence analysis (Eurofins/Genomics, Louisville, KY). The ssuD gene was PCR-amplified
from the pCR-Blunt vector containing msuC/msuD using the primers (5'
GCGCATATGAACGTGTTCTGGTTC) and (5' CCCCTCGAGTCAAGCGCC), which included
engineered Nde I and Xho I restriction sites for ligation into the pET21a expression vector. The
T7 RNA polymerase-dependent expression vector pET21a (Novagen, Madison, WI) and the
msuE and msuD PCR products were digested with restriction enzymes Nde I and Xho I for 1 hr at
37˚C. A 3:1 ratio of either msuE or msuD insert to pET21 a vector were ligated with T4 DNA
ligase at 16˚C overnight, and transformed into Top10 cells following the overnight incubation.
The DNA vectors containing representative clones were submitted for DNA sequence analysis
(Eurofins/Genomics, Louisville, KY).
Variants of Tyr118 in SsuE and His 126 in MsuE were generated to investigate the
importance of these residues in preserving the -helix. The primers were designed as 27-base
oligonucleotides for the Y118H SsuE and H126Y MsuE variants. The primers were ordered from
17
This article is protected by copyright. All rights reserved.

Life Technologies by substituting the ssuE codon TAT representing Tyr118 with TCT, and
substituting the msuE codon TCT representing His with TAT. The Qiagen kit plasmid
purification protocol was utilized to prepare the SsuE plasmid for site-directed mutagenesis.
Following site-directed mutagenesis, the SsuE variants were confirmed through DNA
sequencing analysis (Eurofins/Genomics, Louisville, KY). The FMN-dependent reductase and
monooxygenase enzymes were expressed and purified in E. coli strain BL21(DE3) as previously
described.2 The concentrations of SsuD and SsuE proteins were determined from A280
measurements using a molar extinction coefficient of 47.9 mM-1 cm-1 and 20.3 mM-1 cm-1,
respectively.2 Concentrations of MsuD and MsuE were determined from A280 measurements
using a molar extinction coefficient of 49.4 mM-1 cm-1 and 7.5 mM-1 cm-1, respectively.
Steady-state Kinetic Assays of SsuE and MsuE
The NAD(P)H oxidase activity for wild-type MsuE was initially evaluated to determine
steady-state kinetic parameters and substrate specificity for MsuE. Kinetic parameters for FMN
were determined with 0.1 µM wild-type or H126Y MsuE at varying concentrations of FMN
(0.01-3 µM) with fixed concentrations of NADPH (100 µM), or varying concentrations of FMN
(0.3-13 µM) with fixed concentrations of NADH (200 µM). The kinetic parameters for NADH
and NADPH were determined with 0.1 µM MsuE at varying concentrations of NADPH (2.5-150
µM) with fixed concentrations of FMN (2 µM), or varying concentrations of NADH (2.5-150
µM) with fixed concentrations of FMN (10 µM). The SsuE enzyme can utilize either NADH or
NADPH in NAD(P)H oxidase assays, but has a flavin preference for FMN. Steady-state kinetic
parameters for wild-type or Y118H SsuE were performed as previously described in order to
maintain consistency with previous studies.2 All assays were performed in triplicate, and the
initial rates were obtained by monitoring the decrease in absorbance at 340 nm with the
18
This article is protected by copyright. All rights reserved.

oxidation of the reduced pyridine nucleotide. The steady-state kinetic parameters were
determined by fitting the data to the Michaelis-Menten equation.
The steady-state coupled assay was performed as previously described.4 The reactions
were initiated with the addition of 500 µM NADPH into a reaction mixture containing wild-type
or Y118H SsuE (0.6 µM), FMN (2 µM), SsuD (0.2 µM), and varied concentrations of
octanesulfonate (10-1000 µM) in 25 mM Tris-HCl (pH 7.5), and 0.1 M NaCl at 25˚C. The
desulfonation assays with SsuD were also performed using wild-type and Y118H MsuE (0.6
µM) in the reaction to provide reduced flavin The reaction was quenched after 3 min with 8 M
urea, and the sulfite product was quantified as previously described.4 Conditions for the coupled
reactions with MsuD were performed similar to SsuD, but the concentration of methanesulfonate
was varied from 5-500 µM. All assays were performed in triplicate, and steady-state kinetic
parameters were determined by fitting the data to the Michaelis-Menten equation.
Crystallization of the SsuE variants
All crystals were grown in hanging drops composed of 1.5 µL of well solution and 1.5 µL of
protein in 10 mM HEPES pH 8.5, 100 mM NaCl and 10% (v/v) glycerol. The apo Y118A SsuE
crystals were grown using 68 mg/mL protein and a well solution of 100 mM Tris HCl pH 8.5
and 800 mM lithium sulfate. Crystals grew within 5 days and were cryoprotected with well
solution containing 2.25 M lithium sulfate prior to flash cooling. The FMN-bound Y118A SsuE
crystals were grown using 12.5 mg/mL protein, supplemented with flavin mononucleotide
(FMN) to 10 mM, before combining with well solution composed of 200 mM sodium
thiocyanate pH 6.9 and 20% (w/v) PEG 3350. Crystals grew within 5 days and were
cryoprotected with well solution containing 30% glycerol prior to flash cooling. The 118 SsuE
19
This article is protected by copyright. All rights reserved.

crystals were grown using 35 mg/mL protein and a well solution composed of 100 mM CHES:
NaOH pH 9.5 and 30% (w/v) PEG 3000. Crystals grew within 5 days and were cryoprotected
with well solution containing 25% glycerol prior to flash cooling.
Data Collection and Structural Determination of the SsuE Variants
Diffraction data were collected remotely using BluIce on beamline 12-2 at the Stanford
Synchrotron Radiation Lightsource (SSRL, Menlo Park, CA).27 All data sets were collected at a
wavelength of 0.97946 Å with 0.15 oscillation and 0.2 s exposure at a temperature of 100 K.
For Y118A SsuE, 180 of data were collected at a detector distance of 325 mm and processed to
1.95 Å in XDS.28 A phasing solution was determined by molecular replacement in Phaser3 using
apo SsuE (PDB: 4PTY) as a model with a resulting LLG of 1,462 and TFZ of 39.9. For FMN-
bound Y118A SsuE, 360 of data were collected at a detector distance of 315 mm and processed
to 1.71 Å using AutoPROC.29 A phasing solution was determined by molecular replacement, as
above, with a resulting LLG of 904 and TFZ of 31.8. For 118 SsuE, 240 of data were collected
at a detector distance of 250 mm and processed to 1.55 Å using AutoPROC2. A phasing solution
was determined by molecular replacement as above with a resulting LLG of 2,581 and TFZ of
47.9. For each structure, rounds of model building and refinement were completed in Coot and
Phenix Refine and waters were placed by Phenix Refine, corrected manually and verified, using
a 2mFoDFc electron density map contoured at 1.5 휎ꢀ, following a round of refinement.30,31 For
FMN-bound Y118A SsuE, complete density for the active site FMN was visible following
molecular replacement, but was not modeled until after refining the polypeptide backbone. For
20
This article is protected by copyright. All rights reserved.

the 118 SsuE variant, TLS refinement was used during the last two rounds of refinement.
Statistics for data collection and refinement are listed in Table I.
Crystallographic Model Analysis
The apo Y118A, FMN-bound Y118A, and118 SsuE models were analyzed by MolProbity and
each show good geometry with no Ramachandran outliers.33 Apo Y118A SsuE has two
monomers in the asymmetric unit with density for residues 1-172 and 1-174. Residues H148 and
R149 are in a surface loop with discontinuous backbone density in both chains. The apo Y118A
SsuE model contains 124 water molecules and one sulfate ion bound in the phosphate binding
site of FMN (lithium sulfate was the precipitant and cryoprotectant). The Y118A SsuE variant
with FMN bound has one monomer in the asymmetric unit with continuous density for residues
1-172, as well as 59 waters and one glycerol. Complete density for the active site FMN is present
[Fig. S2(B)]. A second FMN with partial electron density for two conformations is stacked along
the isoalloxazine ring of the active site FMN. The mFo-DFc map shows positive density over the
positions of the isoalloxazine ring oxygens in both conformers. It is possible that water
molecules maintain partial occupancy in these positions. The 118 SsuE variant has 2 monomers
in the asymmetric unit with continuous density for residues 1-172 and 1-173, with 193 waters
and two glycerol molecules. The two monomers seen in the asymmetric unit of apo Y118A and
118 SsuE form a dimeric assembly. The FMN-bound Y118A SsuE variant also crystallized in
this dimeric assembly, but it is generated using symmetry operations with the monomer in the
adjacent asymmetric unit. PISA predicts interface surface areas of 1125, 1196 and 1171 Å2 for
the three structures, consistent with the previously reported wild-type dimer interface of 1160
Å2.16,32
Supplementary Material
21
This article is protected by copyright. All rights reserved.

Figure S1. Kinetic plots from coupled assays with wild-type and H126Y MsuE with MsuD.
Figure S2. ∆118 SsuE helix 4 demonstrating helix disruption.
Figure S3. FMN binding at the active site of Y118A SsuE.
22
This article is protected by copyright. All rights reserved.

Acknowledgements
This work was supported by Grant 1244320 (to H.R.E.) from the National Science Foundation.
Research reported in this publication was made possible by funds from The National Science
Foundation (CHE-1403293 to ALL). JSM was supported by the National Institutes of Health
Graduate Training Program in the Dynamic Aspects of Chemical Biology (T32 GM008545) and
by an American Heart Association Predoctoral Fellowship (18PRE33960374). Use of the
Stanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, is
supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences
under Contract No. DE-AC02-76SF00515. The SSRL Structural Molecular Biology Program is
supported by the DOE Office of Biological and Environmental Research, and by the NIH and
NIGMS (including P41GM103393). Thank you to the staff at the SSRL for their generous
assistance. We are grateful to KM Meneely for technical assistance.
References
1.
Eichhorn E, van der Ploeg JR, Leisinger T (1999) Characterization of a two-component
alkanesulfonate monooxygenase from Escherichia coli. J Biol Chem 274:26639-26646.
2.
Gao B, Ellis HR (2005) Altered mechanism of the alkanesulfonate FMN reductase with
the monooxygenase enzyme. Biochem Biophys Res Commun 331:1137-1145.
3.
Gao B, Ellis HR (2007) Mechanism of flavin reduction in the alkanesulfonate
monooxygenase system. Biochim Biophys Acta 1774:359-367.
4.
Zhan X, Carpenter RA, Ellis HR (2008) Catalytic importance of the substrate binding
order for the FMNH2-dependent alkanesulfonate monooxygenase enzyme. Biochemistry
47:2221-2230.
5.
Robbins JM, Ellis HR (2012) Identification of critical steps governing the two-
component alkanesulfonate monooxygenase catalytic mechanism. Biochemistry 51:6378-6387.
6.
Robbins JM, Ellis HR (2014) Steady-state kinetic isotope effects support a complex role
of Arg226 in the proposed desulfonation mechanism of alkanesulfonate monooxygenase.
Biochemistry 53:161-168.
23
This article is protected by copyright. All rights reserved.

7.
van der Ploeg JR, Cummings NJ, Leisinger T, Connerton IF (1998) Bacillus subtilis
genes for the utilization of sulfur from aliphatic sulfonates. Microbiology 144:2555-2561.
8.
Hummerjohann J, Kuttel E, Quadroni M, Ragaller J, Leisinger T, Kertesz MA (1998)
Regulation of the sulfate starvation response in Pseudomonas aeruginosa: role of cysteine
biosynthetic intermediates. Microbiology 144:1375-1386.
9.
Bentley R, Chasteen TG (2004) Environmental VOSCs--formation and degradation of
dimethyl sulfide, methanethiol and related materials. Chemosphere 55:291-317.
10.
Endoh T, Habe H, Yoshida T, Nojiri H, Omori T (2003) A CysB-regulated and sigma54-
dependent regulator, SfnR, is essential for dimethyl sulfone metabolism of Pseudomonas putida
strain DS1. Microbiology 149:991-1000.
11.
Endoh T, Kasuga K, Horinouchi M, Yoshida T, Habe H, Nojiri H, Omori T (2003)
Characterization and identification of genes essential for dimethyl sulfide utilization in
Pseudomonas putida strain DS1. Appl Microbiol Biotechnol 62:83-91.
12.
Endoh T, Habe H, Nojiri H, Yamane H, Omori T (2005) The sigma54-dependent
transcriptional activator SfnR regulates the expression of the Pseudomonas putida sfnFG operon
responsible for dimethyl sulphone utilization. Mol Microbiol 55:897-911.
13.
Habe H, Kouzuma A, Endoh T, Omori T, Yamane H, Nojiri H (2007) Transcriptional
regulation of the sulfate-starvation-induced gene sfnA by a sigma54-dependent activator of
Pseudomonas putida. Microbiology 153:3091-3098.
14.
Kouzuma A, Endoh T, Omori T, Nojiri H, Yamane H, Habe H (2008) Transcription
factors CysB and SfnR constitute the hierarchical regulatory system for the sulfate starvation
response in Pseudomonas putida. J Bacteriol 190:4521-4531.
15.
Wicht DK (2016) The reduced flavin-dependent monooxygenase SfnG converts
dimethylsulfone to methanesulfinate. Arch Biochem Biophys 604:159-166.
16.
Driggers CM, Dayal PV, Ellis HR, Karplus PA (2014) Crystal structure of Escherichia
coli SsuE: defining a general catalytic cycle for FMN reductases of the flavodoxin-like
superfamily. Biochemistry 53:3509-3519.
17.
Binter A, Staunig N, Jelesarov I, Lohner K, Palfey BA, Deller S, Gruber K, Macheroux P
(2009) A single intersubunit salt bridge affects oligomerization and catalytic activity in a
bacterial quinone reductase. FEBS J 276:5263-5274.
18.
Vorontsov II, Minasov G, Brunzelle JS, Shuvalova L, Kiryukhina O, Collart FR,
Anderson WF (2007) Crystal structure of an apo form of Shigella flexneri ArsH protein with an
NADPH-dependent FMN reductase activity. Protein Sci 16:2483-2490.
24
This article is protected by copyright. All rights reserved.

19.
Deller S, Sollner S, Trenker-El-Toukhy R, Jelesarov I, Gübitz GM, Macheroux P (2006)
Characterization of a thermostable NADPH:FMN oxidoreductase from the mesophilic bacterium
Bacillus subtilis. Biochemistry 45:7083-7091.
20.
Deller S, Macheroux P, Sollner S (2008) Flavin-dependent quinone reductases. Cell Mol
Life Sci 65:141-160.
21.
22.
Weaver TM (2000) The pi-helix translates structure into function. Protein Sci 9:201-206.
Cooley RB, Arp DJ, Karplus PA (2010) Evolutionary origin of a secondary structure: π-
helices as cryptic but widespread insertional variations of α-helices that enhance protein
functionality. J Mol Biol 404:232-246.
23.
Musila JM, Ellis HR (2016) Transformation of a flavin-free FMN reductase to a
canonical flavoprotein through modification of the π-helix. Biochemistry 55:6389-6394.
24.
Musila J, Forbes D, Ellis HR (2018) Functional evaluation of the π-helix in the
NAD(P)H:FMN reductase of the alkanesulfonate monooxygenase system. Biochemistry
57:4469-4477.
25.
Dayal PV, Singh H, Busenlehner LS, Ellis HR (2015) Exposing the alkanesulfonate
monooxygenase protein-protein interaction sites. Biochemistry 54:7531-7538.
26.
Eswaramoorthy S, Poulain S, Hienerwadel R, Bremond N, Sylvester MD, Zhang YB,
Berthomieu C, Van Der Lelie D, Matin A (2012) Crystal structure of ChrR--a quinone reductase
with the capacity to reduce chromate. PLoS One 7:e36017.
27.
McPhillips TM, McPhillips SE, Chiu HJ, Cohen AE, Deacon AM, Ellis PJ, Garman E,
Gonzalez A, Sauter NK, Phizackerley RP, Soltis SM, Kuhn P (2002) Blu-ice and the distributed
control system: software for data acquisition and instrument control at macromolecular
crystallography beamlines. J Synchrotron Radiat 9:401-406.
28.
29.
Kabsch W (2010) XDS. Acta Cryst D66:125-132.
Vonrhein C, Flensburg C, Keller P, Sharff A, Smart O, Paciorek W, Womack T,
Bricogne G (2011) Data processing and analysis with the autoPROC toolbox. Acta Cryst
D67:293-302.
30.
Emsley P, Cowtan K (2004) Coot: model-building tools for molecular graphics. Acta
Cryst D60:2126-2132.
31.
Adams PD, Grosse-Kunstleve RW, Hung LW, Ioerger TR, McCoy AJ, Moriarty NW,
Read RJ, Sacchettini JC, Sauter NK, Terwilliger TC (2002) PHENIX: building new software for
automated crystallographic structure determination. Acta Cryst D58:1948-1954.
25
This article is protected by copyright. All rights reserved.

32.
Krissinel E, Henrick K (2004) Secondary-structure matching (SSM), a new tool for fast
protein structure alignment in three dimensions. Acta Cryst D60:2256-2268.
33.
Chen VB, Arendall III, WB, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, Murray
LW, Richardson JS, Richardson DS (2010) MolProbity: all-atom structure validation for
macromolecular crystallography. Acta Cryst D66:12-21.
Figure Legends
Figure 1. Reactions of two-component systems involved in sulfur metabolism. Two-component
FMN-dependent monooxygenase reactions found in different bacterial organisms. A)
alkanesulfonate monooxygenase reaction (SsuE/SsuD) B. dimethysulfone monooxygenase
reaction (SfnF/SfnG) C. methanesulfinate monooxgenase reaction (MsuE/MsuC) D.
methanesulfonate monooxygenase reaction (MsuE/MsuD).
Figure 2. Structural scheme for the mechanism of the two-component alkanesulfonate
monooxygenase system. A) The tetramer of SsuE dissociates to dimer pairs (monomers for
dimers are shades of gray and blue) binds FMN (yellow carbons) and dissociates to a dimer. B)
FMN is reduced by NAD(P)H to FMNH2 (green carbons). C) Electrostatic surface views of SsuE
and SsuD (blue – positive charge; red – negative charge). FMNH2-bound SsuE associates with
SsuD and transfers the reduced flavin to the SsuD monooxygenase. The predicted SsuD active
site region is boxed, and has a charged surface complementary to the FMNH2 binding region of
the SsuE dimer. The apo, FMN-bound, and FMNH2 SsuE structures were rendered with PDB:
4PTY, 4PTZ, and 4PU0, respectively. The SsuD structure was rendered with PDB 1M41.16
Figure 3. Oligomeric structures of the wild-type and Y118 SsuE variants. A) Overlay of wild-
type SsuE tetramer (gray with residue Y118 in orange) with dimers of apo Y118A SsuE (green)
and ∆118 SsuE (blue) SsuE. The Y118A and ∆118 SsuE enzymes form the same homodimer as
seen in the wild-type structure, but not the tetramer. B) The position of the residues forming the
1160 Å2 dimer interface remain the same in wild-type, Y118A and ∆118 SsuE. The sidechains
of the residues that make up the dimer interface are shown as ball-and-stick to emphasize their
positional homology.
26
This article is protected by copyright. All rights reserved.

Figure 4. Comparison of π and α-helical structures in the NADPH:FMN reductase family. A)
Overlay of the apo structures of wild-type (helix 4 gray), Y118A (helix 4 green) and ∆Y118
(helix 4 blue) SsuE. B) The π-helix in SsuE spans residues 110-127. The Y118A substitution
results in the formation of a canonical α-helix, while the Y118 deletion prevents hydrogen bond
formation between the carbonyls and amines of the amino acid backbone for residues 115-119
breaking the helical structure. The homolog SfnF (orange) with an inserted histidine forms a π-
helix. In YdhA (purple) and ArsH (red) the tyrosine is absent and an α-helix is formed. SsuE
(PDB:4PTY), Y118A SsuE (PDB:6DQI), ∆Y118 SsuE (PDB:6DQP), SfnF (PDB:4C76), YdhA
(PDB:2GSW), and ArsH (PDB:2Q62).16-18
Figure 5. Disruption of the tetrameric interface in Y118A and ∆118 SsuE. A) The tetramerization
interface of the wild-type SsuE structure with monomers shown in grey and lavender. The Y118
residue is shown in in pink, and the residues that comprise one tetramerization interface are
shown in space-filling representation. Note that for the wild-type SsuE structure the interface
forms a complementary hydrophobic surface between two monomers. B) Y118A SsuE (green)
docked with a wild-type dimer to form a tetramer (lavender). The space-filling model shows that
the continuous α-helix of the variant changes the N-terminal pack compared to the π-helix,
causing steric clash (atoms occupying the same three dimensional space). C) ∆Y118 SsuE
variant (blue) docked with a wild-type dimer (lavender). The Y118 deletion disrupts the π-helix,
making a non-helical center section, which displaces the N-terminus causing an even greater
steric clash that prevents tetramerization.
Figure 6. Structure based alignment generated by PDBeFOLD. A) The helix 4 sequence is
shown for each protein, with PDB codes shown in parenthesis, if structure determined: P.
aeruginosa MsuE (used for kinetics work herein), presumed to be a π-helix; P. putida SfnF, π-
helix; E. coli SsuE, π-helix; B. subtilis YhdA, α-helix; S. meliloti ArsH, α-helix; E. coli ChrR, α-
helix. The insertional residue at the bulge in the π-helix or the residue at the homologous site in
the α-helix is shown in red. B) Overlay of wild-type SsuE π-helix (gray), with Y118A SsuE
(green) and ChrR (yellow) α-helices. The grey helix is not shown for simplicity because the
bulge obscures the other structures. Note that the tyrosine of ChrR is in the structurally
equivalent position to Y118 of SsuE; however, ChrR has an α-helix like Y118A SsuE and not a
π-helix like wild-type. The orientation of the tyrosine in ChrR prevents this residue from
participating in tetramerization at the interface.
27
This article is protected by copyright. All rights reserved.

28
This article is protected by copyright. All rights reserved.

29
This article is protected by copyright. All rights reserved.

30
This article is protected by copyright. All rights reserved.