Rice (Oryza sativa) tir1 and 5′adamantyl-iaa significantly improve the auxin-inducible degron system in schizosaccharomyces pombe

G C A T

T A C G

G C A T

genes

Article

Rice (Oryza sativa) TIR1 and 5⁰adamantyl-IAA Signiﬁcantly

Improve the Auxin-Inducible Degron System in

Schizosaccharomyces pombe

Adam T. Watson ¹, Storm Hassell-Hart ², John Spencer ²and Antony M. Carr ^1,

*

1

Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, Brighton BN1 9RQ, UK;

a.t.watson@sussex.ac.uk

Department of Chemistry, School of Life Sciences, University of Sussex, Brighton BN1 9QJ, UK;

S.Hassell-Hart@sussex.ac.uk (S.H.-H.); J.Spencer@sussex.ac.uk (J.S.)

Correspondence: a.m.carr@sussex.ac.uk

2

*

Abstract: The auxin-inducible degron (AID) system is a powerful tool to induce targeted degradation

of proteins in eukaryotic model organisms. The efﬁciency of the existing Schizosaccharomyces pombe

AID system is limited due to the fusion of the F-box protein TIR1 protein to the SCF component, Skp1

(Skp1-TIR1). Here, we report an improved AID system for S. pombe that uses the TIR1 from Oryza

sativa (OsTIR1) not fused to Skp1. Furthermore, we demonstrate that degradation efﬁciency can be

improved by pairing an OsTIR1 auxin-binding site mutant, OsTIR1^F74A, with an auxin analogue,

5⁰adamantyl-IAA (AID2). We provide evidence for the enhanced functionality of the OsTIR1 AID

and AID2 systems by application to the essential DNA replication factor Mcm4 and to a non-essential

recombination protein, Rad52. Unlike AID, no detectable auxin-independent depletion of AID-tagged

proteins was observed using AID2.

ꢀꢁꢂꢀꢃꢄꢅꢆꢇ

ꢀꢁꢂꢃꢄꢅꢆ

Citation: Watson, A.T.; Hassell-Hart,

S.; Spencer, J.; Carr, A.M. Rice (Oryza

sativa) TIR1 and 5⁰adamantyl-IAA

Signiﬁcantly Improve the

Keywords: AID; AID2; degron; auxin; ﬁssion yeast; protein degradation

Auxin-Inducible Degron System in

Schizosaccharomyces pombe. Genes 2021,

12, 882. https://doi.org/10.3390/

genes12060882

1. Introduction

The auxin-inducible degron (AID) is an effective method for the rapid depletion of

target proteins, allowing control of protein expression and the study of protein function

Academic Editors: Martin Kupiec

and Maciej Wnuk

in vivo

by mediating the interaction of the F-box protein transport inhibitor response 1 (TIR1) with

the auxin/indole-3-acetic acid (AUX/IAA) family of transcriptional regulators [ ]. TIR1 is

[1]. In plants, the physiological role of auxin is to regulate growth and development

Received: 6 May 2021

Accepted: 3 June 2021

Published: 8 June 2021

2

part of the E3 ubiquitin ligase SCF-TIR1 (Skp/Cullin/F-box) complex that recruits an E2

ubiquitin-conjugating enzyme and polyubiquitinates AUX/IAA proteins, targeting them

for degradation by the proteasome.

Publisher’s Note: MDPI stays neutral

with regard to jurisdictional claims in

published maps and institutional afﬁl-

iations.

This degradation pathway can be transferred to non-plant organisms by (1) exoge-

nously expressing the auxin receptor F-box protein, TIR1 and (2) the fusion of an AUX/IAA

auxin-inducible degron (AID) to the protein of interest. As the other components of the SCF

complex are highly conserved, these non-plant cells can be treated with auxin to induce

proteasomal degradation of the AID-tagged protein (Figure 1A). In current AID systems,

Oryza sativa TIR1 (OsTIR1) is the most commonly used auxin receptor F-box protein and

is used in combination with AID tags derived from the Arabidopsis thaliana IAA17 pro-

Copyright:

tein [1,3–9]. However, the ﬁssion yeast AID system developed by Kanke et al. [10] uses a

Licensee MDPI, Basel, Switzerland.

This article is an open access article

distributed under the terms and

conditions of the Creative Commons

Attribution (CC BY) license (https://

creativecommons.org/licenses/by/

4.0/).

fusion of the A. thaliana TIR1 (AtTIR1) to the F-box-interacting component of the SCF, Skp1

(Skp1-AtTIR1, system termed ‘i-AID’). Overexpression of the Skp1-AtTIR1 fusion using

the constitutive alcohol dehydrogenase adh1 promoter severely inhibited cell growth, so

expression levels were reduced using an attenuated version of the adh1 promoter, Padh15

(Padh15-skp1-AtTIR1) [11]. Despite i-AID causing severe replication defects and cell cycle

arrest in mcm4-AID cells, biologically signiﬁcant amounts of other target proteins were

Genes 2021, 12, 882. https://doi.org/10.3390/genes12060882

https://ww w .mdpi.com/journal/genes

Genes 2021, 12, 882

2 of 24

shown to remain after depletion. The system was improved by exogenous expression of

0

Padh15-skp1-AtTIR1 and Padh15-skp1-OsTIR1 (termed ‘double TIR1 ). Double TIR1 combined

with transcription repression of the target protein (termed ‘off-AID’) was used to effectively

deplete Pol1 and Cdc45 [10]. The off-AID system has been used to efﬁciently regulate

various other proteins including Mcm10 [12], Cdc20 [13], Cnd3 and Smc2 [14] and Bqt1 [15].

A common feature of AID systems is the chronic, auxin-independent proteasome-

mediated degradation of AID-tagged proteins in cells constitutively expressing TIR1. To

circumvent this basal degradation level and its inherent problems, expression of TIR1 is

often transcriptionally regulated. Alternatively, another component of the plants native

auxin signalling machinery, an auxin-response transcription factor (ARF), is co-expressed

as this has been shown to allow near-endogenous expression levels of the target protein in

the absence of auxin [16].

Through a bump-and-hole strategy, a synthetic auxin–receptor pair involving 5-(3-

methoxy-phenyl)-IAA and its complementary auxin-binding pocket mutant AtTIR1^F79Gwas

identified and shown to function orthogonally to endogenous auxin signalling [17 ]. A screen

of 5-substituted IAA analogues using a yeast two-hybrid system identified 5⁰adamantyl-

indole-3-acetic acid (5⁰adamantyl-IAA) which mediates interaction of AtTIR1^F79Gand IAA3

proteins at a 100-fold lower concentration compared to the natural auxin–TIR1 pair. Fol-

lowing a screen of binding pocket mutants other than glycine, AtTIR1^F79Awas shown to

interact with IAA3 proteins at picomolar concentrations of 5⁰adamantyl-IAA, 10,000-fold

lower than for the auxin–TIR1 pair [18]. The corresponding OsTIR1-binding site mu-

tant (OsTIR1^F74A) and 5⁰adamantyl-IAA have recently been shown to function in chicken

DT40 cells at 1,000-fold lower ligand concentration compared to conventional AID/IAA-

OsTIR1^WTand shown to function effectively in mammalian cell lines again at signiﬁcantly

lower ligand concentrations [19]. Using an equivalent bump-and-hole strategy, the syn-

thetic ligand–receptor pair OsTIR1^F74Gand auxin analogue 5-phenyl-indole-3-acetic acid

(5-Ph-IAA) were shown to interact at nanomolar concentrations and have been used to

rapidly and efﬁciently deplete mAID-fused proteins in budding yeast, mammalian cells

and mice. This modiﬁed system was termed AID version 2 (AID2) [6]. The kinetics of

protein depletion were quicker when compared to the original AID system and depletion

could be induced with several hundred-fold lower ligand concentration. Moreover, no

detectable basal degradation was observed using AID2.

In ﬁssion yeast, a mechanism for the selective removal of meiosis-speciﬁc mRNAs in

mitotic cells has been characterised. The removal involves the YTH domain-containing

protein Mmi1 [20], which binds meiosis-speciﬁc mRNAs containing Determinant of Se-

lective Removal (DSR) sequences, usually located at the 3⁰end of the transcript. Mmi1 is

only functional in mitotic, but not meiotic, cells and greatly increases transcript turnover

by directing DSR-containing transcripts to the nuclear exosomes for degradation [20,21].

By deletion analysis, the DSR elements of ssm4, rec8 and spo5 mRNAs were identiﬁed [20].

Further studies have identiﬁed a hexanucleotide motif, U(U/C)AAAC, that is highly en-

riched in the DSR elements and have shown that tandem repeats of this motif can function

as an artiﬁcial DSR in heterologous gene systems [22,23].

Genes 2021, 12, 882

3 of 24

Figure 1. AID/OsTIR1^WTand AID2/OsTIR1^F74Asystems in S. pombe. ( ) Schematic illustration showing AID/OsTIR1^WT

A

and AID2/OsTIR1^F74Asystems. AID: As the Skp1, Cullin and F-box protein complex (SCF) is highly conserved among

eukaryotes, exogenously expressed plant F-box protein OsTIR1 can form a functional SCF complex in S. pombe. The protein

of interest (POI) is fused to the AID degron (AID). The synthetic auxin 1-naphthaleneacetic acid (NAA) binds OsTIR1 and

Genes 2021, 12, 882

4 of 24

promotes interaction between OsTIR1 and the AID degron. SCF-OsTIR1 acts as an E3 ubiquitin ligase to recruit an E2

ubiquitin-conjugating enzyme, resulting in the poly-ubiquitination of the AID tag. Finally, the POI is degraded by the

proteasome. AID2: The process is analogous to AID, but pairs the OsTIR1 auxin-binding site mutant F74A and the

0

5’-substituted auxin analogue 5 adamantyl-indole-3-acetic acid (5 a-IAA). (

loci engineered to constitutively express OsTIR1^WTor OsTIR1^F74A(NLS: nuclear localisation signal). (

immunoblot on total protein extract from wild-type^WT(AW279), OsTIR1^WT(AW1762) and OsTIR1^F74A(AW1703) cells

detected using anti-OsTIR1 antibody. Anti-tubulin was used as a loading control. ( ) Representative growth curves of

B

) Schematic illustration showing the arg3-D4

C

) Representative

D

isogenic wild-type (WT—(AW279)), OsTIR1^WT(AW1762) and OsTIR1^F74A(AW1703) cells. Cells were grown in YE media at

30 ^◦C with constant shaking (180 rpm). Optical density (OD) was measured at 1h intervals for total 10 h. Timeseries of

log 2-transformed OD₆₀₀measurements are presented. Black lines represent linear regression models and are the mean of

two technical repeats. Slopes of linear regression models (k) and calculated doubling times are indicated. (E) Plasmids to

C-terminally AID-tag a protein of interest (linker: ﬂexible 10 amino acid linker (Gly-Gly-Ser-Gly-Gly-Ser-Gly-Ser-Gly-Ala),

spo5DSR: spo5 Determinant of Selective Removal element, eDSR: enhanced spo5DSR element, TAG: epitope tag, number in

parenthesis after plasmid name: Addgene ID). (

* Reading frame for tag is indicated. ( ) Isogenic strains with the indicated genotypes (mcm4+ (AW279), mcm4-AID (AW1893),

Skp1-AtTIR1 (AW1942), mcm4-AID Skp1-AtTIR1 (AW1949), OsTIR1^WT(AW1762), mcm4-AID, OsTIR1^WT(AW1923)) were

spotted onto YEA plates and plates containing 500 M NAA. Plates were grown at the indicated temperatures for 3 days.

The experiment was repeated and similar results were obtained.

F) Primer sequences to amplify aid-(TAG)-(DSR)-Turg1-kanMX6 construct.

G

µ

Here, we describe an improved AID system for ﬁssion yeast that overcomes the

drawbacks of the original Kanke et al. [10] approach. We constructed two sets of plasmid

vector for this study. One set was designed to stably integrate expression constructs at the

arg3-D4 locus [24]. These plasmids were used to insert and constitutively express a genomic

copy of the OsTIR1 receptor, OsTIR1^WT, or the AID2 variant, OsTIR1^F74A, using the full-

strength S. pombe alcohol dehydrogenase (adh1) promoter. The second set of plasmids

was designed to allow AID tagging of the protein of interest at the C-terminus. These

plasmids include a series of epitope tag sequences for detection of AID-tagged proteins

by commercially available antibodies including HA, Myc and V5. The spo5DSR element

and an improved engineered version of the spo5DSR element, termed ‘eDSR’, are also

included as an option that will act to constitutively reduce AID-tagged protein levels. The

addition of either the synthetic auxin 1-naphthaleneacetic acid (NAA) (OsTIR1^WT/AID)

or the 5-substituted auxin 5⁰adamantyl-IAA (OsTIR1^F74A/AID2), allowed the creation of

conditional loss of function mutants of the MCM complex component Mcm4 to be created

in cells grown at 30 ^◦C without fusing to Skp1. For AID2, we observed faster depletion

kinetics at lower ligand concentrations as compared to AID and no basal degradation

of AID-tagged Mcm4. However, for the non-essential recombination protein Rad52, a

complete conditional null phenotype was not obtained, despite the presence of DSR

sequences: we observed that very low levels of Rad52 activity remained.

2. Materials and Methods

2.1. Strains and Growth Conditions

Strains used in this work are listed in Table 1. All strains were grown at 30 ^◦C unless

stated otherwise. The media composition was as described by Moreno et al. [25]. For

selection of G418 and phleomycin-resistant cells, G418 disulphate (Formedium, Hunstan-

ton, UK) or phleomycin (Fisher BioReagents, Waltham, MA, USA) was added to YEA

plates at a ﬁnal concentration of 200 and 30 µg/mL, respectively. Synthetic plant auxin

1-naphthaleneacetic acid (NAA) (Sigma, St. Louis, MO, USA) powder was dissolved in

80% ethanol to the required concentration (0.5 M). The ﬁnal NAA concentration used

was 500 µM. NAA stock was prepared fresh prior to use and unused stock discarded.

5’adamantyl-IAA was dissolved in DMSO to the required concentration (1 mM) and

◦

aliquots stored at

−

20 C. Growth curve doubling times were calculated using the formula

DT = 1/k, where DT stands for doubling time and k represents the slope of linear regression

computed from a timeseries of log 2-transformed OD measurements [26].

Genes 2021, 12, 882

5 of 24

Table 1. Strains used in this study.

Genotype (h+/h- Denote Mating Type)

Name

AW279

h+

AW1502

AW1581

AW1655

AW1658

AW1660

AW1680

AW1681

AW1682

AW1683

AW1703

AW1762

AW1893

AW1899

AW1901

AW1907

AW1915

AW1921

AW1923

AW1925

AW1935

AW1937

AW1942

AW1949

AW1962

AW1968

AW1970

AW1976

AW1990

AW1996

AW2011

AW2017

AW2024

AW2026

arg3-D4 h+

rad52::kanMX6 h+

bleMX6-arg3-D4 h-

arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h-

arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h-

rad52-HA-AID-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h-

rad52-HA-AID-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1, h+

rad52-HA-AID-spo5DSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1, h+

rad52-HA-AID-spo5DSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1, h-

arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h+

mcm4-AID-Turg1:kanMX6, h+

mcm4-AID-V5-Turg1:kanMX6, h+

rad52-AID-Turg1:kanMX6, h+

rad52-AID-V5-Turg1:kanMX6, h+

rad52-AID-spo5DSR-Turg1:kanMX6 h+

rad52-AID-V5-spo5DSR-Turg1:kanMX6 h+

mcm4-AID-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h+

mcm4-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

mcm4-AID-V5-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h+

mcm4-AID-V5-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

ade6::ade6+-Padh15-skp1-AtTIR1-2NLS-9myc h+

mcm4-AID-Turg1:kanMX6, ade6::ade6+-Padh15-skp1-AtTIR1-2NLS-9myc h+

rad52-AID-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

rad52-AID-V5-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

rad52-AID-spo5DSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

rad52-AID-V5-spo5DSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

rad52-AID-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h+

rad52-AID-V5-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^WT-TADH1 h+

rad52-AID-eDSR-Turg1:kanMX6 h+

rad52-AID-V5-eDSR-Turg1:kanMX6 h+

rad52-AID-eDSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

rad52-AID-V5-eDSR-Turg1:kanMX6, arg3::bleMX6-arg3+-Padh1-OsTIR1^F74A-TADH1 h+

2.2. Cloning and Plasmid Construction

Q5 High-Fidelity 2X Master Mix was used for all PCR reactions in accordance to the

manufacturer’s instructions. For all cloning procedures, NEBuilder HiFi DNA Assembly

Master Mix was used in accordance to the manufacturer’s instructions. Escherichia coli strain

DH5α was used for transformations and plasmid isolation. Synthesised gene fragments and

custom oligonucleotide primers (Table 2 ) were ordered from Integrated DNA Technologies.

Genes 2021, 12, 882

6 of 24

Table 2. Sequences of oligonucleotide primers used in this study.

0

Name

P1

Sequence (5 to 3 )

AGAAATCTATAGAAAAAAAGCTAGCGTGACGCAGACA

P2

CTCCCGGGAGTGCATGCCAGCATATGTATGTGGTTAGAAAAAAGAAAAGACTTAAAAG

AGAAATCTATAGAAAAAAAGCTAGCGTGACGCAGACATTCGAATGGCATGCCC

P3

CTCCCGGGAGTGCATGCCAGCATATGTATGTGGTTAGAAAAAAGAAAAGACTT

AAAAGTTTGTGATAGTCAAGACAATGGAATTCTCTTGCTTAAAGAAAAGCGAAGGCA

P4

P5

P6

GAGAGCTCCGTCTGCAGCGAGTCGACACTTCTAAATAAGCGAATTTCTTATGATTTATGA

ACACTCTACTTGCCCAGATCACTAGTATATTACCCTGTTATCCCTAGCG

P7

CATACATTATACGAAGTTATGCATGCTCGGTGGGTCAGGTGGAAGTGGATCTGGTGCTATGATGGGCAGTGTCGA

AAATTCGCTTATTTAGAAGTGCTAGCTCAAGCTCTGCTCTTGCACTTC

P8

P9

AGTGCAAGAGCAGAGCTTGAGCTAGCAGTCCCGGGGCTTGCCCATCTGTTTTAGACGT

GGGGACGAGGCAAGCTAAACAGATCTCGAGAAGAAGGCCCCGCTG

P10

P11

P12

P13

P14

P15

P16

P17

P18

AGTGCAAGAGCAGAGCTTGAGCTAGCACTACGCCATATCATGCCCA

TCTAAAACAGATGGGCAAGCCCCGGGGCTTTGTCTAACAGGTTTTATGTTGGTTTAAGT

AGAAGTGCAAGAGCAGAGCTGGTGCTGGAGCAGGCGCCTACCCATACGATGTTCCTGACTATGCG

GATGGGCAAGCCCCGGGACTGCTAGCGGCGCGCCTCAGCACTGAGC

TGGGCATGATATGGCGTAGTGCTAGCGGCGCGCCTCAGCACTGAGC

AGAAGTGCAAGAGCAGAGCTGGAGCAGGCGCCGGTGAACAAAAGTTGATTTCTGAAG

GATGGGCAAGCCCCGGGACTGCTAGCGGCGCGCCTTACAAGTCTTCCTC

TGGGCATGATATGGCGTAGTGCTAGCGGCGCGCCTTACAAGTCTTCCTC

TATACATTATTTAATACTAGTCCTAACTGACACAGTACAATATTCATT

ATTTCTATGCAAGCCAGTTCAATATCTTGATTGTTTAGCTTGCCTCGTCCCC

P19

P20

P21

P22

P23

P24

TCATCAGGGTCATTGGGACTATTCAACGCGAAATCAAATAGAAAACA

AAATATTGTTTCAAAAGAATGCTTTCATGTATAGGATGGCGGCGTTAGTATCG

GTGCTTTGGAAAGGCGAGGACGTATTAAGGTTATTACCAGTGCT

GGACATCGCATTGTACGTTCAATTGCACAGACTGATGGTGGGTCAGGTGGAAGTG

ATTATGCTCTGTAGTCTTTGATTTTCAACAACGACCTATGGTTTATGG

CTCATGAATAATACCAGCTTATTCGCTAAAAAAGGATGGCGGCGTTAGTATC

GAACAAATTCTGATCCTCAGTCGGCAATGAGGTCGCGAGAAAACTAC

GATGCTACGGTGGATAAGAAAGCCAAAAAAGGAGGTGGGTCAGGTGGAAGTG

AGATCTACCGTTTAAACAAATCATTAGTCATAAAACAGAAAATACTTGGTAA

AAAACAAGTTGCCAATCATCACATTTTGCCTCATTACTTGGATGGCGGCGTTAGTATC

2.3. S. pombe arg3-D4 Integration Expression Vectors

An NdeI site contained within the pUC19 backbone was removed by restriction with

NdeI, blunting the overhangs using Mung Bean Nuclease (New England Biolabs, Ipswich,

MA, USA) and religation using T4 DNA ligase (New England Biolabs). The resulting plas-

mid was termed pUC19*, where * denotes removal of the NdeI recognition site from plasmid

backbone (CATATG converted to CATG). The S. pombe arg3-D4 locus was sequenced and

the deleted genomic fragment identiﬁed. The deleted fragment and approximately 500 bp

each side of the deletion site were gene synthesised. Gene synthesis allowed for the re-

moval of unwanted restriction enzymes sites, insertion of a multiple clone site (MCS -

NheI-NdeI-SphI-XmaI-SacI-PstI-SalI-SpeI) and insertion NotI restriction enzyme sites for the

removal of the linear arg3 construct. The gene fragment was cloned into EcoRI/HindIII

restricted pUC19* to create MCS- Sp.arg3+/pUC19*. The 820 bp of the S. pombe adh1

promoter sequence (TATA box = TATAAATA) was ampliﬁed from total genomic DNA

using primers P1 and P2 and the resulting fragment cloned into NheI/NdeI restricted

Genes 2021, 12, 882

7 of 24

MCS-Sp.arg3+/pUC19* to create P_adh1-MCS-Sp.arg3+/pUC19*. Approximately 820 bp

of the S. pombe adh15 (TATA box = TAAATATA) and adh81 (TATA box = AT) promoter

sequences were ampliﬁed from pKM104 and pKM105 [10] using primers P3 and P4 and

the resulting fragment cloned into NheI/NdeI restricted MCS-Sp.arg3+/pUC19* to cre-

ate P_adh15-MCS-Sp.arg3+/pUC19* and P_adh81-MCS-Sp.arg3+/pUC19*, respectively. Then,

159 bp of the Saccharomyces cerevisiae ADH1 terminator was ampliﬁed from pAW8_TAP [27

]

using primers P5 and P6 and the fragment cloned into SalI/SpeI restricted P_adh1-MCS-

Sp.arg3+/pUC19*, P_adh15-MCS-Sp.arg3+/pUC19* and P_adh81-MCS-Sp.arg3+/pUC19* to cre-

ate P_adh1-MCS-T_ADH1-Sp.arg3+/pUC19*, P_adh15-MCS-T_ADH1-Sp.arg3+/pUC19* and P_adh81

-

MCS-T_ADH1-Sp.arg3+/pUC19*, respectively (MCS = NdeI-XmaI-SacI-PstI-SalI) (Figure S1).

2.4. AID-Tagging Constructs

The IAA17 degron tag sequence was ampliﬁed from the plasmid template pMK43 [1]

using primers P7 and P8 and the fragment cloned into SphI/AscI restricted pAW8_TAP [27],

replacing the TAP tag sequence, to create pAW8-aid. Primer P7 encodes a ten amino acid

ﬂexible linker sequence (Gly-Gly-Ser-Gly-Gly-Ser-Gly-Ser-Gly-Ala). Primer P8 replaces re-

striction enzyme site AscI with NheI. To help identify the presence of the kanMX6 antibiotic

selection marker, the plasmid was renamed pAW8-aid:kanMX6. 533 bp of the S. pombe urg1

terminator sequence was ampliﬁed from total S. pombe genomic DNA using primers P9

and P10 and the product cloned into the NheI/BglII restricted pAW8-aid:kanMX6, replacing

the S. cerevisiae ADH1 terminator sequence, to create pAW8-aid-Turg1:kanMX6. Primer P10

inserted the restriction enzyme recognition site XmaI adjacent to the NheI site. The 157 bp

DSR element of the S. pombe spo5 gene as identiﬁed by Harigaya et al. [20] was ampli-

ﬁed from pAW8ENdeI-spo5DSR [23] using primers P11 and P12 the product cloned into

NheI/XmaI restricted pAW8-aid-Turg1:kanMX6 to create pAW8-aid-spo5DSR-Turg1:kanMX6.

Three copies of the human inﬂuenza hemagglutinin (HA) protein tag sequence were ampli-

ﬁed from plasmid pAW8_3HA [28] using primers P13 and P14 or P13 and P15 the products

cloned into NheI-restricted pAW8-aid-Turg1:kanMX6 and NheI-restricted pAW8-aid-spo5DSR-

Turg1:kanMX6, respectively, to create pAW8-aid-3HA-Turg1:kanMX6 and pAW8-aid-3HA-

spo5DSR-Turg1:kanMX6. The forward primer P13 removed the AID-tag stop codon and

inserted a small ﬂexible six amino acid linker (Gly-Ala-Gly-Ala-Gly-Ala) between the AID

and 3HA tags. Five copies of the human c-myc (Myc) epitope were ampliﬁed from plasmid

pAW8_13Myc [27] using primers P16 and P17 or P16 and P18 and the resulting fragments

cloned into NheI-restricted pAW8-aid-Turg1:kanMX6 and NheI-restricted pAW8-aid-spo5DSR-

Turg1:kanMX6, respectively, to create pAW8-aid-5Myc-Turg1:kanMX6 and pAW8-aid-5Myc-

spo5DSR-Turg1:kanMX6. The forward primer P16 removed the AID-tag stop codon and

inserted a small ﬂexible six amino acid linker (Gly-Ala-Gly-Ala-Gly-Ala) between the

AID and 5Myc tags. A sequence encoding a single copy of the simian virus 5-derived V5

tag was human codon optimised and gene synthesised and cloned into NheI-restricted

pAW8-aid-Turg1:kanMX6 to create pAW8-aid-V5-Turg1:kanMX6. A second sequence was

synthesised allowing cloning into NheI-restricted pAW8-aid-spo5DSR-Turg1:kanMX6 to cre-

ate pAW8-aid-V5-spo5DSR-Turg1:kanMX6. The synthesised sequences removed the AID-tag

stop codon and inserted a small ﬂexible six amino acid linker (Gly-Ala-Gly-Ala-Gly-Ala)

between the AID and V5 tags.

A mutated version of spo5DSR element was designed to contain two additional DSR

core motifs and was termed ‘eDSR’ (Figure S2). A series of eDSR fragments compatible

for cloning into plasmids pAW8-aid-Turg1:kanMX6, pAW8-aid-3HA-Turg1:kanMX6, pAW8-

aid-5Myc-Turg1:kanMX6 and pAW8-aid-V5-Turg1:kanMX6 were synthesised and cloned

into their respective NheI-restricted plasmids to create pAW8-aid-eDSR-Turg1:kanMX6,

pAW8-aid-3HA-eDSR-Turg1:kanMX6, pAW8-aid-5Myc-eDSR-Turg1:kanMX6 and pAW8-aid-

V5-eDSR-Turg1:kanMX6.

All plasmid constructs were conﬁrmed by sequencing. All plasmid constructs and

sequences are available from Addgene (see Figure 1E for Addgene ID numbers).

Genes 2021, 12, 882

8 of 24

2.5. Yeast Transformations

All yeast transformations were performed using a lithium acetate method [28]. For

insertion of the phleomycin/bleomycin resistance cassette adjacent to the arg3-D4 locus,

a linear PCR fragment generated using primers P19 and P20 and the plasmid template

pFA6a-bleMX6 [29] was used to transform strain arg3-D4 (AW1502). After selection on

YEA plates supplemented with 30 mg/mL phleomycin, transformants were conﬁrmed by

genomic PCR and sequencing. This created strain AW1655 (bleMX6-arg3-D4) (Figure S1).

To fuse the AID-tag at the C-terminus of Mcm4 and Rad52, primers P21 and P22 (Mcm4) or

primers P23 and P24 (Rad52) were used to generate linear PCR fragments from the relevant

pAW8-aid-Turg1:kanMX6 plasmid described above and used to transform strain AW279

(WT h+). Transformants were selected on YEA plates supplemented with 200 mg/mL G418

and conﬁrmed using genomic PCR and sequencing.

2.6. Spot Tests

Cell cultures grown in YE media 30 ^◦C in YE medium were adjusted to a density of

1

×

10⁷cells/mL. A series of 10-fold dilutions in sterile water was performed for each

strain and 7 µL drops were spotted onto YEA medium plates with or without supplements.

2.7. Preparation of Total Cell Extract and Western Blot Analysis

Preparation of cell extracts for SDS-PAGE and Western blotting was performed as

previously described [30] except NaN₃was added to the cell culture sample to a ﬁnal

concentration of 0.1% prior to centrifugation. For protein detection, the following commer-

cially available antibodies were used. Primary antibodies: anti-V5 (Bio-Rad, # MCA1360)

(diluted 1:5,000), anti-OsTIR1 (MBL, #PD048) (diluted 1:1,000) and anti-α tubulin (Sigma,

#T5168) (diluted 1:10,000). Secondary antibodies: anti-mouse IgG HRP (Dako, #P0260) and

anti-rabbit IgG HRP (Dako, #P0217), both diluted 1:5,000. All antibodies were incubated in

phosphate-buffered saline, 0.1% v/v Tween 20 detergent (PBST) containing 3% skimmed

milk powder except anti-OsTIR1, which was incubated in PBST containing 5% skimmed

milk powder. For quantiﬁcation of protein levels, Amersham ImageQuant LAS4000 West-

ern blot imaging system was used and resulting images analysed using ImageQuant TL

software (version 1.2) ( GE Healthcare, Chicago, IL, USA).

2.8. Synthesis of 2-[5-(adamantan-1-yl)-1H-indol-3-yl]Acetic Acid (5⁰-adamantyl-IAA)

5⁰Adamantyl-IAA was synthesised essentially as described previously [18]. Solvents

were used as received, including deuterated solvents for NMR spectroscopy. NMR spec-

tra were recorded on a Varian NMR 400 (¹H 399.5 MHz; ¹³C{¹H} 100.5 MHz or 500 (¹H

499.9 MHz; 13C{¹H} 125.7 MHz). Chemical shifts are reported in ppm. Spectra are refer-

enced to the corresponding protic solvent (¹H) or signals of the solvent (¹³C). Reactions

were monitored by TLC on commercially available glass silica gel plates (60 Å, F254). The

mobile phase was usually a solvent mixture and the visualisation was undertaken using

UV light. Chromatographic puriﬁcations were carried out on an ISCO Combi Flash RF 75

or a 150 PSI puriﬁcation unit. Gel columns. LC–MS purity analyses were undertaken using

a 5

µm C18 110 Å column. Percentage purities were performed using a 30 min method

in water/acetonitrile with 0.1% formic acid (5 min at 5%, 5

95%) with the UV set to 254 nm. High-resolution mass spectrometry was carried out at the

University of Sussex.

−

95% over 20 min, 5 min at

2.8.1. N-(4-(adamantan-1-yl)phenyl)acetamide

Genes 2021, 12, 882

9 of 24

To a mixture of acetanilide (5.07 g, 37.50 mmol), 1-bromoadamantane (8.87 g, 41.25 mmol)

and 1,1,2,2-tetrachloroethane (50 mL) was added zinc chloride (10.22 g, 75.00 mmol) and

◦

the resulting mixture heated to 80 C and stirred for 72 h under an argon atmosphere. The

reaction was cooled to ambient temperature and to the mixture was added 1 M aqueous

HCl (150 mL) and dichloromethane (DCM) (100 mL). The resulting biphasic mixture was

separated, and the aqueous phase extracted with DCM (2

×

100 mL). The combined organic

extracts were dried over anhydrous MgSO₄, ﬁltered, and concentrated under reduced

pressure. The resulting residue was puriﬁed by automated column chromatography (n-

hexane/EtOAc, 100:0–30:70, 100 g SiO₂). The appropriate fractions were combined and

concentrated under reduced pressure to give N-(4-(adamantan-1-yl)phenyl)acetamide as

a white solid (5.14 g, 51%). LCMS (UV, ESI) R_t= 23.52 min, [M-H]⁺m/z = 270.1, 88%

1

purity. H NMR (600 MHz, d₆-DMSO):

δ

= 9.82 (1H, s), 7.50–7.46 (2H, m), 7.27–7.23 (2H,

m), 2.06–2.02 (3H, m), 2.01 (3H, s), 1.84–1.80 (6H, m), 1.76–1.68 (6H, m).

2.8.2. N-(4-(adamantan-1-yl)-2-iodophenyl)acetamide

To a mixture of N-(4-(adamantan-1-yl)phenyl)acetamide (1.82 g, 6.76 mmol), TsOH.H₂O

(128 mg, 0.66 mmol), and MeCN (100 mL) was added NIS (1.67 g, 7.43 mmol) and the

resulting mixture was stirred under an argon atmosphere for 24 h at ambient temperature.

The mixture was concentrated under reduced pressure and to the residue EtOAc (50 mL)

was added and saturated aqueous NaHCO₃(50 mL). The resulting biphasic mixture was

separated, and the aqueous phase extracted with EtOAc (3

×

50 mL). The combined

organic extracts were washed with brine, dried over anhydrous MgSO₄, ﬁltered, and

concentrated under reduced pressure to give a brown solid (2.7 g). The solid was puriﬁed

by automated ﬂash column chromatography (n-hexane/EtOAc, 100:0–50:50, 30 g SiO₂).

The appropriate fractions were combined and concentrated under reduced pressure to give

N-(4-(adamantan-1-yl)-2-iodophenyl)acetamide as a light orange solid (2.62 g, 98%). LCMS

1

(UV, ESI) R_t= 25.59 min, [M-H]⁺m/z = 396.0, 93% purity. H NMR (600 MHz, d₆-DMSO):

δ

= 9.36 (1H, s), 7.75 (1H, d, J = 2.2 Hz), 7.36 (1H, dd, J = 8.4, 2.2 Hz), 7.30 (1H, d, J = 8.4 Hz),

2.07–2.02 (3H, m), 2.03 (3H, s), 1.85–1.82 (6H, m), 1.76–1.69 (6H, m).

2.8.3. N-(4-(adamantan-1-yl)-2-((trimethylsilyl)ethynyl)phenyl)acetamide

To N-(4-(adamantan-1-yl)-2-iodophenyl)acetamide (1.00 g, 2.53 mmol), Pd(PPh₃)₂Cl₂

(44 mg, 0.063 mmol), and CuI (24 mg, 0.127 mmol) was added THF:NEt₃(1:1) (25 mL)

followed by trimethylsilyacetylene (456 µL, 3.29 mmol). The resulting mixture was stirred

under argon for 16 h at ambient temperature. The reaction was concentrated under reduced

pressure and puriﬁed by automated ﬂash column chromatography (n-hexane/EtOAc, 100:0–

60:40, 40 g SiO₂). The appropriate fractions were combined and concentrated under reduced

pressure to give N-(4-(adamantan-1-yl)-2-((trimethylsilyl)ethynyl)phenyl)acetamide as a

brown solid (740 mg, 80%). LCMS (UV, ESI) R_t= 29.64 min, [M-H]⁺m/z = did not ionise,

94% purity. ¹H NMR (600 MHz, d₆-DMSO):

δ

= 9.13 (1H, s), 7.60 (1H, d, J = 8.8 Hz),

7.39–7.34 (2H, m), 2.08–2.03 (6H, m), 1.85–1.81 (6H, m), 1.74–1.70 (6H, m), 0.25 (9H, s).

Genes 2021, 12, 882

10 of 24

2.8.4. 5-(Adamantan-1-yl)-1H-indole

To a mixture of N-(4-(adamantan-1-yl)-2-((trimethylsilyl)ethynyl)phenyl)acetamide

(630 mg, 1.72 mmol) and anhydrous THF (16 mL) was added tetrabutylammonium ﬂuoride

(TBAF) (1 M in THF) (2.50 mL). The resulting mixture was heated to 80 ^◦C and stirred for

16 h under an argon atmosphere. The reaction was cooled to ambient temperature and to

the mixture was added EtOAc (15 mL) and water (15 mL). The resulting biphasic mixture

was separated, and the aqueous phase extracted with EtOAc (3

×

15 mL). The combined

organic extracts were washed with brine (25 mL), dried over anhydrous MgSO₄, ﬁltered,

and concentrated under reduced pressure to give a brown oil (500 mg). The resulting

residue was puriﬁed by automated ﬂash column chromatography (n-hexane/EtOAc, 100:0–

70:30, 24 g SiO₂). The appropriate fractions were combined and concentrated under reduced

pressure to give 5-(adamantan-1-yl)-1H-indole as a pale yellow solid (330 mg, 76%). LCMS

1

(UV, ESI) R_t= 27.19 min, [M-H]⁺m/z = 252.1, 91% purity. H NMR (600 MHz, d₆-DMSO):

δ

= 10.88 (1H, s), 7.44 (1H, s), 7.30 (1H, d, J = 8.8 Hz), 7.26 (1H, m), 7.14 (1H, dd, J = 8.8,

1.8 Hz), 6.35 (1H, m), 2.09–2.05 (3H, m), 1.92–1.89 (6H, m), 1.78–1.72 (6H, m).

2.8.5. Methyl 2-(5-(adamantan-1-yl)-1H-indol-3-yl)-2-oxoacetate

To a mixture of 5-(adamantan-1-yl)-1H-indole (294 mg, 1.17 mmol) and anhydrous

Et₂O (10 mL) was added oxalyl chloride (148 µL, 1.75 mmol) and the resulting mixture

stirred for 16 h at ambient temperature under argon. To the mixture was added MeOH

(10 mL) and the resulting mixture stirred for 15 min. The resulting mixture was concen-

trated under reduced pressure to give a yellow solid of sufﬁcient purity to be utilised in

the subsequent reaction without further manipulation.

2.8.6. 2-[5-(Adamantan-1-yl)-1H-indol-3-yl]Acetic Acid

To a mixture of crude methyl 2-(5-(adamantan-1-yl)-1H-indol-3-yl)-2-oxoacetate

(395 mg, 1.17 mmol), NaH₂PO₂.H₂O (1.24 g, 11.70 mmol), and H₂O/1,4-dioxane (1:5)

(10 mL_◦) was added Pd/C (10%) (128 mg, 0.12 mmol). The resulting mixture was heated

to 100 C and stirred for 72 h under an argon atmosphere. The reaction was cooled to

ambient temperature and ﬁltered through Celite^®, washing with EtOAc (25 mL). To the

mixture was added 2M aqueous HCl (25 mL) and the resulting biphasic mixture separated.

The organic phase was washed with brine (25 mL), dried over anhydrous MgSO₄, ﬁltered,

and concentrated under reduced pressure to give a light red gum (550 mg). The result-

ing residue was puriﬁed by automated ﬂash column chromatography (n-hexane/EtOAc,

100:0–70:30, 24 g SiO₂). The appropriate fractions were combined and concentrated under

reduced pressure to give 2-(5-(adamantan-1-yl)-1H-indol-3-yl)acetic acid as a white solid

(129 mg, 36% over 2 steps). LCMS (UV, ESI) R_t= 22.49 min, [M-H]⁺m/z = 310.0, 96% purity.

¹H NMR (600 MHz, d₆-DMSO):

δ = 12.11 (1H, s), 10.73 (1H, s), 7.42 (1H, m), 7.27 (1H, d,

Genes 2021, 12, 882

11 of 24

J = 8.8 Hz), 7.18–7.13 (2H, m), 3.62 (2H, s), 2.10–2.05 (3H, m), 1.93–1.89 (6H, m), 1.78–1.72

(6H, m). ¹³C NMR (151 MHz, d₆

110.8, 107.7, 43.4, 36.4, 35.5, 31.0, 28.5. HRMS (ESI-[+Na]) m/z: Calcd for C₂₀H₂₃NNaO₂

−

DMSO): δ = 173.2, 141.1, 134.3, 126.9, 123.8, 118.5, 113.7,

332.1626; Found 332.1615.

3. Results

3.1. Integration of OsTIR1^WTand OsTIR1^F74AExpression Constructs at the arg3-D4 Locus

OsTIR1 is the most commonly used AID system auxin receptor F-box protein. More-

over, in budding yeast, OsTIR1 has been shown to work at high temperatures and expres-

sion of OsTIR1 from the constitutive alcohol dehydrogenase gene (ADH1) promoter does

not affect cell growth [1]. We therefore wished to test OsTIR1 not fused to Skp1 in a new

ﬁssion yeast AID system.

We developed a set of plasmids to integrate the OsTIR1^WTand OsTIR1^F74Aexpression

constructs at the S. pombe arg3-D4 locus. We sequenced the arg3-D4 locus [24] (Figure S1

to determine the region deleted and synthesised this sequence and approximately 500bp

ﬂanking the deletion site. These ﬂanking sequences allow integration of the deleted

arg3 gene fragment at the arg3-D4 locus and transformants can be screened for arginine

prototrophy. Synthesis of this fragment allowed for insertion of an MCS (NheI-NdeI-SphI-

XmaI-SacI-PstI-SalI-SpeI) and the removal of restriction enzyme recognition sites from the

arg3 gene sequence which may hinder subsequent cloning events. The synthesised gene

fragment was cloned into pUC19* (where * denotes the removal of the NdeI restriction

enzyme recognition site from the plasmid backbone) to create MCS-Sp.arg3+/pUC19*.

Expression cassettes consisting of an MCS site ﬂanked by approximately 820bp of

the S. pombe adh1 promoter and 160bp of the S. cerevisiae ADH1 terminator sequences

were constructed. Three individual constructs were created each containing different

adh1 promoter strengths. The strongest promoter strength was the wild-type adh1 pro-

moter sequence (P_adh1) followed by adh15 promoter (P_adh15), a weak derivative of the

adh1 promoter [11] and ﬁnally the adh81 promoter (P_adh81) a much weaker derivative of

)

P_adh1[31]. These three expression constructs were cloned into MCS-Sp.arg3+/pUC19*

to create P_adh1-MCS-T_ADH1-Sp.arg3+/pUC19*, P_adh15-MCS-T_ADH1-Sp.arg3+/pUC19* and

P_adh81-MCS-T_ADH1-Sp.arg3+/pUC19*, respectively (MCS = NdeI-XmaI-SacI-PstI-SalI).

For the new AID system, human-codon optimised OsTIR1^WT-NLS (NLS: nuclear local-

isation signal) was gene synthesised and cloned into P_adh1-MCS-T_ADH1-Sp.arg3+/pUC19* to

create P_adh1-OsTIR1^WT-NLS-T_ADH1-Sp.arg3+/pUC19*. For AID version 2 (AID2), human-

codon optimised OsTIR1^F74A-NLS was gene synthesised and cloned into P_adh1-MCS-

T_ADH1-Sp.arg3+/pUC19* to create P_adh1-OsTIR1^F74A-NLS-T_ADH1-Sp.arg3+/pUC19*. The

OsTIR1^F74Amutation corresponds to the AtTIR1 auxin-binding site mutation F79A identi-

ﬁed by Yamada et al. [18] and used by Nishimura et al. [19] (see also Figure S3). The NLS

directs the system to speciﬁcally deplete nuclear proteins. The plasmids P_adh1-OsTIR1^WT

-

NLS-T_ADH1-arg3+/pUC19* and P_adh1-OsTIR1^F74A-NLS-T_ADH1-Sp.arg3+/pUC19* were re-

stricted with NotI restriction enzyme and the linear fragments used to transform AW1655

(bleMX6-arg3-D4). Transformants were screened for arginine prototrophy and successful

integrants conﬁrmed by genomic PCR and sequencing (Figure 1B). This created strains

Padh1-OsTIR1^WT(AW1762) and Padh1-OsTIR1^F74A(AW1703). Expression of OsTIR1^WTand

OsTIR1^F74Awas conﬁrmed by immunoblot analysis and, as shown previously [17], the

F74A substitution does not signiﬁcantly affect stability of the TIR1 protein (Figure 1C).

Expression of OsTIR1^WTor OsTIR1^F74Afrom the strong constitutive adh1 promoter does

not affect cell growth rate, with doubling times of Padh1-OsTIR1^WTand Padh1-OsTIR1^F74A

cells comparable to wild-type cells (Figure 1D). As cellular levels of TIR1 have been shown

to be a limiting factor for auxin response [10,32,33], we predict that increasing the TIR1

expression level will increase AID efﬁciency.

Genes 2021, 12, 882

12 of 24

3.2. Plasmids for C-Terminal AID Tagging

To allow the C-terminal tagging of proteins of interest, we developed a set of plasmids

containing the full-length A. thaliana auxin-responsive AUX/IAA protein IAA17 gene

sequence. The tagging constructs also include a sequence encoding a ﬂexible 10-amino-acid

linker (Gly-Gly-Ser-Gly-Gly-Ser-Gly-Ser-Gly-Ala) that will be inserted between the protein

of interest and the AID-tag. This was included to help minimise loss of either target protein

or AID-tag function. The plasmids also included approximately 530 bp of S. pombe urg1

downstream sequence to act as a transcription terminator and the antibiotic resistance

cassette, kanMX6, which allows selection of G418-resistant cells (Figure 1E).

To detect AID-tagged proteins by immunoblotting using commercial antibodies, a

series of additional short epitope tag sequences were fused to the C-terminus of the AID

tag. These tags included three copies of the inﬂuenza virus hemagglutinin (HA) epitope

tag (3HA), ﬁve copies of the human c-myc (Myc) epitope (5Myc) and a single copy of the

V5 tag derived from the P and V protein of the simian virus 5 (SV5, a paramyxovirus). The

AID and epitope tags were separated by a short 6-amino-acid ﬂexible linker (Gly-Ala-Gly-

Ala-Gly-Ala) (Figure 1E).

To provide an option to constitutively reduce AID-tagged protein expression levels

from the constructs outlined above, we inserted the 157 bp DSR element derived from

the S. pombe spo5 gene directly downstream of the tag stop codon (Figure 1E). Levels of

yEGFP expressed from the uracil-inducible urg1 locus are reduced approximately 25-fold

by the spo5DSR element compared to the no DSR control [23]. The spo5DSR element

contains 5 copies of the hexanucleotide motif U(U/C)AAAC shown to be highly enriched

in DSR elements [22]. To increase the efﬁciency of the spo5DSR element and further reduce

AID-tagged protein levels, two sequences similar to the core motif were mutated to match

the hexanucleotide DSR motif (Figure S2). This new DSR element, termed ‘eDSR’, was

introduced into the AID-plasmids, replacing spo5DSR. The full set of plasmids are shown

in Figure 1E.

The AID-tagging constructs were cloned into the Cre-expression plasmid pAW8,

allowing for rapid and efﬁcient C-terminal fusion of the AID-tag using Cre-mediated

cassette exchange [27]. These tagging construct plasmids are also compatible with PCR-

based genomic strategies with the primer sequences required to amplify the series of AID

constructs shown in Figure 1F.

3.3. Testing the New S. pombe AID/OsTIR1(WT) System

As a target of degradation, we used Mcm4, a component of the DNA replication MCM

complex to test the new AID/OsTIR1 system. Mcm4 is an essential protein and mcm4

∆

cells are inviable. The i-AID system (Padh15-Skp1-AtTIR1) was used previously to deplete

Mcm4 [10] and allows direct comparison of the efﬁciency of the two systems. Mcm4 was

successfully C-terminally AID-tagged using a PCR-mediated approach using the plasmids

outlined in Figure 1E. The mcm4-AID strain was then crossed to strains expressing Padh15-

skp1-AtTIR1 or Padh1-OsTIR1^WTand the resulting strains were spotted onto a YEA plate or

YEA plates containing the synthetic auxin NAA at 500 µM and the plates were incubated

at 25 ^◦C, 30 ^◦C or 36 ^◦C for 3 days (Figure 1G). Unlike Skp1-AtTIR1 expressing i-AID cells,

expression of OsTIR1 from the strong adh1 constitutive promoter showed no inhibition

in cell growth, as has previously been observed for budding yeast [

1

]. Although mcm4-

◦

AID skp1-AtTIR1 cell growth was severely inhibited at 25 C by the presence of auxin,

increasing the temperature to 30 ^◦C reduced this inhibition and growth rates were more

similar to WT (Figure 1G). However, mcm4-aid OsTIR1 ^WTcells showed complete loss of

cell viability when grown in the presence of auxin at 25 ^◦C and, more importantly, also at

30 ^◦C (Figure 1G). The relative thermostability of OsTIR1 compared to AtTIR1 has been

previously reported [1] and explains the improved performance observed for our new AID

system with respect to temperature. Overall, these data clearly demonstrate the signiﬁcant

improvement in degradation efﬁciency when using Padh1-OsTIR1 as opposed to systems

involving Padh15-skp1-AtTIR1.

Genes 2021, 12, 882

13 of 24

3.4. Further Characterisation of the S. pombe AID/OsTIR1^WTSystem

To determine the rate and percentage reduction in AID-tagged protein levels following

addition of auxin, we created the strains mcm4-AID-5myc and mcm4-AID-V5 using the

plasmids outlined in Figure 1E (we were unable to create mcm4-AID-3HA). As we found the

signal-to-noise ratio of the anti-V5 antibody was signiﬁcantly higher than that for anti-Myc,

mcm4-AID-V5 cells were used to study protein levels. Complete inviability in the presence

of NAA of mcm4-AID-V5 OsTIR1^WTcells demonstrate that the V5 epitope tag does not

compromise AID degron function (Figure 2A).

mcm4-AID-V5 OsTIR1^WTcells were grown to mid-log phase, synthetic auxin NAA was

added to a ﬁnal concentration of 500 µM and total protein extracted at various timepoints.

Total protein was also extracted from mcm4⁺(untagged Mcm4) and mcm4-AID-V5 cells

with no OsTIR1. Following immunoblotting using anti-V5 antibodies and, as a loading

control, anti-tubulin, the degradation kinetics were determined (Figure 2B). Quantiﬁcation

of AID-tagged protein levels reveal a 14% reduction in Mcm4-AID-V5 protein levels in cells

exogenously expressing OsTIR1 in the absence of NAA. The chronic auxin-independent

depletion of AID-tagged proteins by TIR1 has been extensively reported [34–36]. After

addition of NAA a rapid depletion of cellular levels of Mcm4-AID-V5 was observed with a

90% reduction after 15 min. However, detectable levels of Mcm4-AID-V5 were observed

3 h after addition of NAA with approximately 5% of protein remaining (Figure 2C).

Using Mcm4 to assess the efﬁciency of the OsTIR1 auxin-inducible degron system

is limited because Mcm4 is an essential protein and a reduction in protein level by ap-

proximately 95% leads to complete cell inviability (Figure 2A,C). Therefore, we chose to

also study the DNA repair protein Rad52 because, unlike Mcm4, Rad52 is a non-essential

protein and rad52

∆ cells are viable. Depletion of Rad52 can be monitored phenotypically as

rad52 cells display a slow-growth phenotype and are hyper sensitive to DNA damaging

∆

agents such as hydroxyurea (HU) [37].

We successfully AID-tagged Rad52 via a PCR-based approach using the plasmids

outlined in Figure 1E as PCR templates. Spot test analysis shows that rad52-AID and rad52-

AID-V5 cells grow at WT rates and show WT levels of resistance to the genotoxic agent HU,

meaning that the AID and AID-V5 tags do not adversely affect Rad52 function (Figure 2D)

.

This is in contrast to rad52 cells that are both slow growing and are hypersensitive to HU

∆

treatment with signiﬁcant levels of cell death observed at low HU concentrations (2 mM).

In the presence of NAA, however, rad52-AID OsTIR1^WTand rad52-AID-V5 OsTIR1^WT

cells exhibit increased sensitivity to HU when compared to untagged Rad52 control cells,

but only at higher HU concentrations (4 mM). This indicates that signiﬁcant levels of

Rad52-AID protein remain when NAA is present (Figure 2D).

We used rad52-AID-V5 cells to monitor protein levels. rad52-AID-V5 OsTIR1^WTcells

were grown to mid-log phase, NAA was added to a ﬁnal concentration of 500 µM and total

protein extracted at various timepoints. As with mcm4-AID-V5 OsTIR1^WTcells, chronic

auxin-independent depletion of Rad52-AID-V5 by OsTIR1 was observed with protein

levels reduced by approximately 14% compared to rad52-AID-V5 cells (Figure 2F). As

with Mcm4, the addition of NAA induced a rapid depletion of Rad52-AID-V5, with levels

reduced by 78% within 15 min but Rad52-AID-V5 protein levels were detectable even after

overnight treatment (18 h). Residual levels of Rad52-AID-V5 in cells expressing OsTIR1 in

the presence of NAA are comparable to those seen for Mcm4—approximately 4% relative

to no TIR1 (Figure 2F).

Genes 2021, 12, 882

14 of 24

Figure 2. Regulation of Mcm4 and Rad52 activity using AID/OsTIR1^WT. (

(mcm4+ (AW279), mcm4-AID (AW1893), mcm4-AID-V5 (AW1899), OsTIR1^WT(AW1762), mcm4-AID OsTIR1^WT(AW1923),

A) Isogenic strains with indicated genotypes

Genes 2021, 12, 882

15 of 24

mcm4-AID-V5 OsTIR1^WT(AW1935)) were spotted onto YEA plates and plates containing 500

µ

M NAA. Plates were grown

) Representative immunoblot on total

protein extract from mcm4+ (AW279), mcm4-AID-V5 (AW1899) and mcm4-AID-V5 OsTIR1^WT(AW1935) cells treated with

500 M NAA and sampled at indicated time points and detected using anti-V5 antibody. Anti-tubulin was used as a loading

control. ( ) Graph of quantiﬁed anti-V5 signal normalised against anti-tubulin signal for ( ) (data represented as the mean

values +/ SD of three independent experiments). ( ) Isogenic strains with indicated genotypes (rad52+ (AW279), rad52-

AID (AW1901), rad52-AID-V5 (AW1907), OsTIR1^WT(AW1762), rad52-AID OsTIR1^WT(AW1990), rad52-AID-V5 OsTIR1^WT

◦

at 30 C for 3 days. The experiment was repeated and similar results were obtained. (

B

µ

C

B

−

D

(AW1996), rad52

∆

(AW1581)) were spotted onto YEA plates and plates c_◦ontaining 500

µM NAA and/or genotoxic agent

hydroxyurea (HU) at indicated concentrations. Plates were grown at 30 C for 3 days. The experiment was repeated and

similar results were obtained. (

(AW1907) and rad52-AID-V5 OsTIR1^WT(AW1996) cells treated with 500

and detected using anti-V5 antibody. Anti-tubulin was used as a loading control. (

E

) Representative immunoblot on total protein extract from rad52+ (AW279), rad52-AID-V5

M NAA and sampled at the indicated time points

) Graph of quantiﬁed anti-V5 signal

µ

F

normalised against anti-tubulin signal (data represented as the mean values +/− SD of three independent experiments).

Overall, these data demonstrate the effectiveness of the AID/OsTIR1^WTsystem. AID-

tagged proteins are rapidly degraded in the presence of NAA with overall levels reduced

approximately 20-fold. However, detectable levels of AID-tagged protein remain. For

an essential protein such as Mcm4, this residuary level is low enough to render the cell

inviable and thus a conditional null-mutant phenotype was obtained. However, for a

non-essential gene, such as Rad52, this residual level did not manifest a conditional null

phenotype: NAA-treated cells only showed sensitivity to HU at concentrations that were

higher than those required to kill rad52-deleted cells. Moreover, the effectiveness of the

AID/OsTIR1^WTsystem is potentially compromised by the NAA-independent association

of AID-tagged proteins with OsTIR1, resulting in levels being reduced by approximately

14% relative to no TIR1 controls.

3.5. Using the AID2/OsTIR1^F74ASystem in S. pombe

Recent AID systems have made use of synthetic auxin–TIR1 pairs that function or-

thogonally to the natural auxin signalling pathway. The systems involve an auxin-binding

site mutant and a 5-substituted synthetic auxin and overcome problems associated with

the original AID system, namely, the requirement for a high dose of auxin and the auxin-

independent degradation of AID-tagged target proteins. The new AID systems (termed

AID version 2 or ‘AID2⁰) have been characterised for use in chicken DT40 cells, budding

yeast, mammalian cells and mice and have been shown to require a markedly lower ligand

concentration for the association of TIR1 with the AID-tag and no detectable basal degra-

dation of AID-tagged proteins was observed [6,19]. The rate of degradation has been also

shown to be even quicker in AID2 compared to AID [6].

To test an AID2 in fission yeast, we construct a system analogous to that described by

0

Yamada et al. [18 ]. We synthesised the 5-substituted auxin 5 adamantyl-IAA (Figure 3 A) and

created a strain that endogenously expresses the high-affinity-binding partner OsTIR1^F74A

corresponding to AtTIR1^F79A, using the arg3-D4 integration expression vector system we

have developed (Figure 1B). Growth analysis showed that overexpression of OsTIR1^F74A

using the strong constitutive adh1 promoter does not affect cell growth (Figure 1D). We

crossed the OsTIR1^F74Astrain to the mcm4-AID and mcm4-AID-V5 strains and, using

spot test analysis, tested a range of concentrations of the AID2 inducer 5⁰adamantyl-IAA

(100 nM, 10 nM and 1 nM). We found that a 5⁰adamantyl-IAA concentration of 1 nM

was sufﬁcient to generate a lethal phenotype and that 10 nM was, upon microscopic

examination, able to completely inhibit cell growth (Figure S5A and Figure 3B). The 10 nM

represents a 5,000-fold reduction in ligand concentration compared to OsTIR1^WT/NAA.

Interestingly, the AID2/OsTIR1^F74Asystem also functions better at the higher growth

temperature of 36 ^◦C (Figure 3B; compare with Figure 1G). This clearly demonstrates that

the AID2 OsTIR1^F74A/5⁰adamantyl-IAA system is fully functional in ﬁssion yeast and,

with respect to Mcm4, requires a signiﬁcantly lower ligand concentration compared to

AID/OsTIR1^WT/NAA.

,

Genes 2021, 12, 882

16 of 24

Figure 3. Regulation of Mcm4 and Rad52 activity using AID2/OsTIR1^F74A. (

[5-(adamantan-1-yl)-1H-indol-3-yl]acetic acid (5 adamantyl-IAA). (1) 1-Bromoadamantane, ZnCl₂, 1,1,2,2-tetrachloroethane,

A

) Schematic illustration showing synthesis of 2-

0

Genes 2021, 12, 882

17 of 24

◦

80 C, 72 h, 51%; (2) NIS, TsOH.H₂O, MeCN, rt, 24 h, 98%; (3) trimethylsilyacetylene, Pd(PPh₃)₂Cl₂, CuI, THF:NEt₃(1:1),

◦

80%; (4) TBAF, THF, 80 C, 16 h, 76%; (5) oxalyl chloride, Et₂O, rt, 16 h; (6) NaH₂PO₂.H₂O, Pd/C, H₂O/1,4-dioxane (1:5),

◦

100 C, 72 h, 36% over two steps. (

B

) Isogenic strains with the indicated genotypes (mcm4+ (AW279), mcm4-AID (AW1893),

mcm4-AID-V5 (AW1899), OsTIR1^F74A(AW1703), mcm4-AID OsTIR1^F74A(AW1925), mcm4-AID-V5 OsTIR1^F74A(AW1937))

were spotted onto YEA plates and plates containing 10 nM 5⁰adamantyl-IAA (5⁰a-IAA). Plates were grown at indicated

temperatures for 3 days. The experiment was repeated and similar results were obtained. (C) Representative immunoblot on

total protein extract from mcm4+ (AW279), mcm4-AID-V5 (AW1899) and mcm4-AID-V5 OsTIR1^F74A(AW1937) cells treated

with 10 nM 5⁰adamantyl-IAA (5⁰a-IAA) and sampled at the indicated time points and detected using anti-V5 antibody.

Anti-tubulin was used as a loading control. (

for (C) (data represented as the mean values +/

indicated genotypes (rad52+ (AW279), rad52-AID (AW1901), rad52-AID-V5 (AW1907) OsTIR1^F74A(AW1703), rad52-AID

OsTIR1^F74A(AW1962), rad52-AID-V5 OsTIR1^F74A(AW1968), rad52

(AW1581)) were spotted onto YEA plates and plates

D) Graph of quantiﬁed anti-V5 signal normalised against anti-tubulin signal

−

SD of three independent experiments). ( ) Isogenic strains with the

E

∆

0

containing 100 nM 5 adamantyl-IAA (5 a-IAA) and/or genotoxic agent hydroxyurea (HU) at the indicated concentrations.

◦

Plates were grown at 30 C for 3 days. The experiment was repeated and similar results were obtained. (

F) Representative

immunoblot on total protein extract from rad52+ (AW279), rad52-AID-V5 (AW1907) and rad52-AID-V5 OsTIR1^F74A(AW1968)

cells treated with 100 nM 5⁰adamantyl-IAA (5⁰a-IAA) and sampled at indicated time points and detected using anti-V5

antibody. Anti-tubulin was used as a loading control. (

G) Graph of quantiﬁed anti-V5 signal normalised against anti-tubulin

signal for (F) (data represented as the mean values +/− SD of three independent experiments).

Immunoblot analysis shows no auxin-independent depletion of Mcm4-AID-V5 in

cells expressing OsTIR1^F74A(Figure 3C,D) in contrast to mcm4-AID-V5 OsTIR1^WTcells

(Figure 2B,C). Furthermore, Figure 3C,D show that the kinetics of depletion are faster

in mcm4-AID-V5 OsTIR1^F74Acells after the addition of 5⁰adamantyl-IAA (94% reduction

after 15 min) when compared to mcm4-AID-V5 OsTIR1^WTcells treated with NAA (see

Figure 2B,C) (90% reduction after 15 min). These faster kinetics may be due to the higher

afﬁnity of the 5⁰adamantyl-IAA-induced OsTIR1^F74Ainteraction when compared to the

NAA-induced OsTIR1^WTinteraction [18]. Surprisingly, steady-state proteins levels after

0

addition of 5 adamantyl-IAA to mcm4-AID-V5 OsTIR1^F74Acells are similar to those seen for

mcm4-AID-V5 OsTIR1^WTcells after NAA addition (approximately 4% of no TIR1 levels).

To test AID2 using Rad52, rad52-AID OsTIR1^F74Aand rad52-AID-V5 OsTIR1^F74Acells

were created. We tested a range of 5⁰adamantyl-IAA concentrations (1,000 nM, 100 nM

and 10 nM) using spot test analysis of rad52-AID OsTIR1^F74Acells (Figure S5B) and deter-

0

mined that a concentration of 100 nM 5 adamantyl-IAA was required to maximally induce

the rad52 phenotype—a 500-fold lower concentration as compared to NAA. The Rad52-

AID/OsTIR1^F74Asystem is also clearly more efﬁcient than the Rad52-AID/OsTIR1^WT

system. Growth rates of rad52-AID OsTIR1^F74Acells were reduced in the presence of

5⁰adamantyl-IAA compared to rad52-AID cells (Figure 3E), whereas rad52-AID OsTIR1^WT

cells treated with NAA do not show reduced growth rate (Figure 2D). Furthermore, rad52-

AID OsTIR1^F74Acells treated with 5⁰adamantyl-IAA show a marked reduction in cell

viability when grown in the presence of HU (Figure 3E) when compared to rad52-AID

OsTIR1^WTcells treated with NAA (Figure 2 D). However, despite improved efﬁciency of

Rad52 degradation by AID2, rad52-AID/OsTIR1^F74Acells treated with 5⁰adamantyl-IAA

are not as slow growing nor as sensitive to HU as rad52∆ cells, implying residuary Rad52

activity remains in these cells.

As seen for Mcm4-AID-V5, immunoblot analysis shows no auxin-independent deple-

tion of Rad52-AID-V5 in cells expressing OsTIR1^F74A(Figure 3F,G). Furthermore, Figure 3G

shows that the kinetics of depletion are faster in rad52-AID-V5 OsTIR1^F74Acells after the

addition of 5⁰adamantyl-IAA (94% reduction after 15 min) when compared to rad52-AID-

V5 OsTIR1^WTcells treated with NAA (Figure 2B,C) (77% reduction after 15 min). The

steady-state protein levels after addition of 5⁰adamantyl-IAA to rad52-AID-V5 OsTIR1^F74A

cells are signiﬁcantly lower than those seen for rad52-AID-V5 OsTIR1^WTcells treated with

NAA (1.6% and 3.6%, respectively), which explains the slower growth rates and increased

HU sensitivity described above.

Genes 2021, 12, 882

18 of 24

As recently shown by others [

6

], the AID2 (OsTIR1^F74A/5⁰adamantyl-IAA) system

is clearly an improvement on the AID (OsTIR1^WT/NAA) system with faster degradation

kinetics, much lower ligand concentrations and no auxin-independent depletion of AID-

tagged proteins. However, despite this increase in functionality, observable levels of

AID-tagged proteins remain.

3.6. Use of DSR Elements Allows Generation of Stricter S. pombe Mutants

Despite signiﬁcantly improving the ﬁssion yeast auxin-dependent degron system,

the reduction in protein levels was insufﬁcient to obtain a conditional rad52-null mutant

phenotype. To achieve such a phenotype, other levels of regulation are therefore required.

The regulation of transcription is an effective and well-deﬁned option but requires ad-

ditional genome editing with the insertion of a regulatable promoter sequence and the

manipulation of the growth media in order to downregulate transcription. Determinant of

Selective Removal (DSR) elements have previously been shown to effectively modulate

0

protein levels [23]. As DSR elements are usually located at the 3 end of the transcript they

can easily be incorporated into the AID-plasmid sequence (Figure 1 E) and therefore require

no extra steps. The use of DSRs does, however, have the disadvantage that protein levels

are constitutively lowered.

Using the DSR containing AID-plasmids outlined in Figure 1E, we C-terminally

tagged the rad52 locus with AID-spo5DSR, AID-eDSR, AID-V5-spo5DSR and AID-V5-

eDSR. To determine the relative effectiveness of the spo5DSR and eDSR on Rad52-AID-

V5 levels, Western blot analysis was performed. Immunoblot of total protein extracted

from logarithmically growing rad52-AID (NO DSR), rad52-AID-spo5DSR and rad52-AID-

eDSR cells shows the effect of DSR elements on constitutively reducing protein levels

(Figure 4A). The previously untested eDSR element—a mutant form of spo5DSR engineered

to contain two additional copies of the DSRcore element—is more effective at reducing

levels than spo5DSR. Quantiﬁcation of Rad52-AID-V5 proteins levels revealed that the

spo5DSR element reduces the level on average by 84% and the eDSR element by 98%

(Figure 4B). As above, addition of 5⁰adamantyl-IAA to rad52-AID-spo5DSR and rad52-

AID-eDSR cells exogenously expressing OsTIR1^F74Acaused rapid depletion of Rad52-AID-

tagged proteins (Figure 4C,D, respectively). Interestingly, in rad52-AID-V5-spo5DSR cells

treated with 5⁰adamantyl-IAA, steady-state protein levels were still detectable despite a

reduction in initial protein levels by 84% (Figure 4B,C). This suggests that as the AID-

tagged protein level is reduced, the efﬁciency of degradation is also reduced. However, in

rad52-AID-V5-eDSR cells treated with 5⁰adamantyl-IAA, where initial levels are reduced

by 98%, steady-state protein levels were un-detectable (Figure 4D).

The effects of the reduction in Rad52-AID protein levels due to the DSR elements

are revealed by spot test analysis (Figure 4E). Predictably, as levels of Rad52 decrease in

rad52-AID (NO DSR), rad52-AID-spo5DSR and rad52-AID-eDSR cells, sensitivity to 4 mM

HU increases. Interestingly, HU sensitivity was slightly increased when a V5 tag for

each of these strains was also present, implying that the V5 tag reduces Rad52 activity

(

Figure 4E). In the presence of 100 nM 5⁰adamantyl-IAA, rad52-AID-spo5DSR OsTIR1^F74A

cells exhibit a slow growth phenotype that is signiﬁcantly more pronounced as seen for

rad52-AID/OsTIR1^F74Acells, but not as slow growing as rad52

∆ cells (Figure 4 E). This

pattern is repeated for plates supplemented with HU. rad52-AID-spo5DSR OsTIR1^F74Acells

exhibit sensitivity to HU that is signiﬁcantly more severe than that seen for rad52-AID

OsTIR1^F74Acells but not as sensitive as rad52

∆ cells. Unexpectedly, when grown in the

presence of 5⁰adamantyl-IAA, rad52-AID-eDSR OsTIR1^F74Acells are as slow growing and

as sensitive to HU as rad52-AID-spo5DSR OsTIR1^F74Acells. This was surprising as the

level of Rad52-AID-V5 protein is clearly lower when associated with eDSR than that of

Rad52-AID-V5 associated with spo5DSR (Figure 4C,D, respectively). This may reﬂect the

sensitivity limit of the spot test assay.

Genes 2021, 12, 882

19 of 24

Figure 4. DSR elements improve AID2/OsTIR1^F74A. (

(AW279), rad52-AID-V5 (NO DSR) (AW1907), rad52-AID-V5-spo5DSR (spo5DSR) (AW1921) and rad52-AID-V5-eDSR (eDSR)

(AW2017) cells detected using anti-V5 antibody. Anti-tubulin was used as a loading control. ( ) Histogram of quantiﬁed anti-

V5 signal normalised against anti-tubulin signal for ( ) (data represented as the mean values +/ SD of three independent

experiments). (

) Representative immunoblot on total protein extract from control and rad52-AID-V5-spo5DSR OsTIR1^F74A

(AW1976) cells treated with 100 nM 5 adamantyl-IAA (5 a-IAA) and sampled at indicated time points and detected using

anti-V5 antibody. Anti-tubulin was used as a loading control. ( ) Representative immunoblot on total protein extract from

control and rad52-AID-V5-eDSR OsTIR1^F74A(AW2026) cells treated with 100 nM 5 adamantyl-IAA (5 a-IAA) and sampled

at the indicated time points and detected using anti-V5 antibody. Anti-tubulin was used as a loading control. ( ) Isogenic

A) Representative immunoblot on total protein extract from rad52+

B

A

−

C

0

D

0

E

strains with indicated genotypes (rad52+ (AW279), rad52-AID-spo5DSR (AW1915), rad52-AID-V5-spo5DSR (AW1921), rad52-

AID-eDSR (AW2011), rad52-AID-V5-eDSR (AW2017), OsTIR1^F74A(AW1703), rad52-AID-spo5DSR) OsTIR1^F74A(AW1970),

rad52-AID-V5-spo5DSR OsTIR1^F74A(AW1976), rad52-AID-eDSR OsTIR1^F74A(AW2024), rad52-AID-V5-eDSR OsTIR1^F74A

0

(AW2026), rad52

∆

(AW1581)) were spotted onto YEA plates and plates containing 100 nM 5 adamantyl-IAA (5 a-IAA) and/or

◦

genotoxic agent hydroxyurea (HU) at the indicated concentrations. Plates were grown at 30 C for 3 days. Experiment was

repeated and similar results obtained.

Genes 2021, 12, 882

20 of 24

The use of DSR elements clearly reduces AID-target protein levels leading to a more

penetrative phenotype. Frustratingly, despite the higher efﬁciency of the eDSR element

compared to spo5DSR, rad52-AID-eDSR OsTIR1^F74Aand rad52-AID-spo5DSR OsTIR1^F74A

are as equally sensitive to HU when 5⁰adamantyl-IAA is present (Figure 4E) and neither

are as sensitive as rad52∆ cells. However, the residual level of Rad52 is very low.

4. Discussion

Here, we describe the construction of a powerful protein-depletion system in S. pombe

based upon the auxin-inducible degron (AID) system. We created two sets of plasmid

vectors for this study. The ﬁrst is a series of stable integration expression vectors that target

the S. pombe arg3-D4 locus (Figure S1). The vectors include the arg3 gene sequence that is

deleted at the arg3-D4 locus, a range of S. pombe adh1 gene promoter sequences of varying

strengths and, to clone the gene to be expressed, an MCS. The plasmid vectors are designed

to integrate a single stable copy at the arg3-D4 locus restoring arginine prototrophy.

The second set of plasmids are to fuse the AID tag to the C-terminus of the target

protein (Figure 1E). The AID constructs include a ﬂexible ten amino acid linker, the full-

length A. thaliana IAA17 AID tag (a 229-amino-acid peptide) and, for the detection of AID-

tagged proteins by immunoblot, a series of common epitope tags for which commercial

antibodies are available. Also included is the option of one of two ‘Determinants of

Selective Removal’ (DSR) elements: one derived from the S. pombe spo5 gene and an

improved, mutated version of the spo5DSR termed eDSR. DSR elements usually prevent

the accumulation of meiosis-speciﬁc mRNAs during the mitotic cell cycle in ﬁssion yeast

by targeting them for destruction by nuclear exosomes. Here, they result in the constitutive

reduction in AID-tagged protein levels. The AID constructs can be inserted into the

genome using Cre recombinase-mediated cassette exchange [27] or by using a standard

PCR-mediated tagging procedure commonly used for ﬁssion yeast.

Using the integration vectors, we successfully inserted at the arg3-D4 locus sequences

to express the auxin receptor TIR1 protein from O. sativa (OsTIR1^WT) and an auxin-binding

site mutant of OsTIR1, OsTIR1^F74A. Importantly, both forms of OsTIR1 were not fused

to Skp1. Overexpression of either OsTIR1^WTor OsTIR1^F74Afrom the strong constitutive

adh1 promoter had no observable effect on cell growth. OsTIR1^F74Abinds the auxin analog

0

5 adamantyl-IAA with a higher afﬁnity than OsTIR1 and natural auxin [18]. This synthetic

pairing forms the basis of AID version 2 (AID2) the equivalent of which has recently been

shown to perform better than AID in chicken DT40 cells, budding yeast, mammalian cells

and mice [6,19].

◦

Both AID and AID2 produced a conditional Mcm4 null phenotype at 30 C. However,

as predicted, AID2 required much lower ligand concentration (5,000-fold less), showed

slightly faster degradation kinetics and no auxin-independent proteolysis of Mcm4 or

Rad52 as compared with AID. The effective concentration of 5-adamaltyl-IAA was higher

for Rad52 (100 nM) than for Mcm4 (10 nM). This was surprising considering quantitative

analysis of the ﬁssion yeast proteomes has shown that in vegetatively growing cells there

are approximately 3-fold more Mcm4 protein molecules than Rad52 protein molecules [38

]

a₀nd Nishimura et al. [19] have demonstrated that depletion of AID-tagged CENP-H by

5 -adamantyl-IAA is dose dependent. The AID system may therefore be intrinsically better

suited to regulating essential proteins: below a critical threshold level, the cell becomes

inviable and a null phenotype achieved. Despite the higher ligand concentration, a lower

steady-state protein level and the use of highly effective DSR elements, residual Rad52

activity remains after depletion (Figure 4 C) (due possibly to TIR1 being limiting). Tandem

arrays of functional truncated forms of the AID tag have been used to dramatically increase

the efﬁciency of previous AID systems (termed ‘3XminiAID’; [39,40]). Use of a 3Xmini-

AID-style tag may be sufﬁcient to achieve a conditional-null Rad52 phenotype and we are

currently testing this. However, anecdotal evidence from our lab suggests that fusion of

the 3Xmini-AID tag to the target protein either partially or completely removes protein

function more often than with full-length AID.

Genes 2021, 12, 882

21 of 24

Despite no conditional null phenotype for Rad52 being achieved using either AID

system, AID2 performed better than AID. The use of DSR elements successfully improved

the severity of the conditional mutant phenotype, but a very low level of Rad52 activity

remains. Despite the eDSR reducing initial protein levels by 94% and spo5DSR by 74% and

immunoblots showing less Rad52-AID in rad52-AID-eDSR cells treated with 5⁰adamantyl-

IAA than rad52-AID-spo5DSR cells treated with 5⁰adamantyl-IAA, rad52-AID-eDSR and

rad52-AID-spo5DSR cells surprisingly exhibited the same level of HU sensitivity.

A detailed protocol for the synthesis of 5⁰adamantyl-IAA is provided in the materi-

als and methods section. In addition, 5⁰adamantyl-IAA is now commercially available

(https://ww w .tcichemicals.com/GB/en/p/A3390 (accessed on 6 June 2021)). We found

5⁰adamantyl-IAA to be more chemically stable than NAA. We incubated an aliquot of

5⁰adamantyl-IAA at room temperature for 7 days and, when tested, we observed no

loss in activity (Figure S4). In our hands, NAA was found to be chemically labile with

freeze/thawing of frozen stocks reducing activity. Only freshly prepared NAA stocks

were used.

5. Conclusions

Overall, we have signiﬁcantly improved the utility of the auxin-inducible degron

system in S. pombe and this should enhance the study of gene function in vivo by more

effectively reducing the levels of gene product. As auxin response has been shown to be

intrinsically linked to cellular TIR1 concentration [10

,32,33], the increase in TIR1 expression

level is the probable reason for the concomitant increase in AID efﬁciency. The relative

thermostability of OsTIR1 compared to AtTIR1 [1] also means that our new system works

also more efﬁciently at the higher temperatures of 30 and 36 ^◦C.

The OsTIR system was further enhanced by introducing the synthetic pairing of

the binding-site mutant OsTIR1^F74Awith the auxin analogue 5⁰adamantyl-IAA (AID2).

Because neither the AID or AID2 systems abolish AID-tagged protein levels completely,

we also introduced the ability to regulate the initial protein levels by introducing a DSR

sequence that restricts the mRNA level and thus reduces the starting protein level. This

may be particularly helpful when it is desirable to reduce gene function as much as possible

to approach a null phenotype. While both the AID and AID2 systems are highly effective

for regulating essential proteins to achieve a null-like phenotype, as seen for Mcm4, we

note that residual activity remains when assessing a non-essential gene for function, even

when combining AID2 with DSR elements.

Supplementary Materials: The following are available online at https://ww w .mdpi.com/article/10

.3390/genes12060882/s1, Figure S1: Overview of the arg3-D4 integration expression vector system.

(a) Sequence of the arg3-D4 locus [24]. Underlined capital letters: pBR322 plasmid sequence; sequence

highlighted in yellow: arg3-D4 homology used in construction of arg3+ expression vectors (see b).

(b) Schematic illustration showing arg3-D4 integration expression vectors. HOM: the two homology

sequences used to insert the linear expression construct at the arg3-D4 locus (see a); MCS: multiple

clone site; number in parenthesis after plasmid name: Addgene ID. (c) Schematic illustration showing

integration of P_adh1-OsTIR1^WT-NLS-T_ADH1and P_adh1-OsTIR1^F74A-NLS-T_ADH1expression constructs

at arg3-D4 locus using arg3-D4 integration expression vector system; cmb1: gene neighbouring arg3.

Figure S2: The spo5DSR and eDSR elements. (a) The 157bp DSR element from the S. pombe spo5 gene

downstream region as identiﬁed by Harigaya et al. [20]. Sequences identical to core hexanucleotide

U(U/C)AAAC motifs are highlighted. Boxed sequences are those identiﬁed as similar to the core

motif. (b) The 158 bp eDSR sequence derived from the spo5DSR element. Underlined sequences are

additional core TTAAAC motifs (mutated bases shown in lower case). Figure S3: Alignment of Oryza

sativa transport inhibitor response protein 1 (OsTIR1) and Arabidopsis thaliana transport inhibitor

response protein 1 (AtTIR1) proteins. AtTIR1 (GeneID 825473) and OsTIR1 (GeneID 4335696) were

aligned using the ClustalW software. Black and grey boxes indicate identical and similar amino

acids, respectively. Position F79 of AtTIR1 and the corresponding F74 of OsTIR1 are arrowed.

Figure S4: 5’adamantyl-IAA is chemically stable. Isogenic strains with indicated genotypes (rad52+

(AW279), rad52-HA-AID, OsTIR1^F74A(AW1680), rad52-HA-AID OsTIR1^F74A(AW1681), rad52-HA-AID-

Genes 2021, 12, 882

22 of 24

spo5DSR OsTIR1^F74A(AW1682), rad52-HA-AID-spo5DSR OsTIR1^F74A(AW1683), rad52

∆

(AW1581))

were spotted onto YEA plates and plates containing 100 nM 5’adamantyl-IAA (5’a-IAA) and/or

genotoxic agent hydroxyurea (HU) at the indicated concentrations. 5’adamantyl-IAA added to plates

◦

from frozen stock (

−

20 C stock) or from an aliquot incubated at room temperature for 7 days (7d RT).

◦

Plates were grown at 30 C for 3 days, Figure S5: Titration of 5’adamantyl-IAA to determine effective

ligand concentration. (a) Mcm4-AID. Isogenic strains with indicated genotypes (mcm4+ (AW279),

mcm4-AID (AW1893), OsTIR1^F74A(AW1703), mcm4-AID OsTIR1^F74A(AW1925)) were spotted onto

YEA plates and plates containing 100 nM 5’adamantyl-IAA (5’a-IAA), 10 nM 5’adamantyl-IAA

(5’a-IAA) and 1 nM 5’adamantyl-IAA (5’a-IAA). Plates were grown at 30 ^◦C for 3 days. (b) Rad52-

AID. Isogenic strains with indicated genotypes (rad52+ (AW279), rad52-AID (AW1901), OsTIR1^F74A

(AW1703), rad52-AID OsTIR1^F74A(AW1962), rad52

∆ (AW1581)) were spotted onto YEA plates and

plates containing 1000 nM 5’adamantyl-IAA (5’a-IAA), 100 nM 5’adamantyl-IAA (5’a-IAA) and 10

◦

nM 5’adamantyl-IAA (5’a-IAA). Plates were grown at 30 C for 3 days. Note: each panel in (b) is a

composite of two images (both taken of the same plate) excising irrelevant strains between rad52-AID

and rad52-delete.

Author Contributions: Conceptualisation, A.M.C. and A.T.W.; methodology, A.T.W. and S.H.-H.;

validation, A.T.W. and S.H.-H.; formal analysis, A.M.C., A.T.W., S.H.-H. and J.S.; investigation,

A.T.W. and S.H.-H.; data curation, A.T.W. and S.H.-H.; writing—original draft preparation, A.T.W.;

writing—review and editing, A.M.C., A.T.W., S.H.-H. and J.S.; funding acquisition, A.M.C. and J.S.

All authors have read and agreed to the published version of the manuscript.

Funding: This research was funded in part by the Wellcome Trust [110047/Z/15/Z]. S.H-H. and J.S.

were funded by EPSRC grant number EP/P026990/1. For the purpose of Open Access, the author

has applied a CC BY public copyright licence to any Author Accepted Manuscript version arising

from this submission.

Data Availability Statement: Primary data are available from the authors on request.

0

Acknowledgments: We thank Li-Lin Du for kindly supplying an initial aliquot of 5 adamantyl-IAA.

Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design

of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or

in the decision to publish the results.

References

1.

2.

3.

4.

Nishimura, K.; Fukagawa, T.; Takisawa, H.; Kakimoto, T.; Kanemaki, M. An auxin-based degron system for the rapid depletion of

proteins in nonplant cells. Nat. Methods 2009, 6, 917–922. [CrossRef]

Teale, W.D.; Paponov, I.A.; Palme, K. Auxin in action: Signalling, transport and the control of plant growth and development.

Nat. Rev. Mol. Cell Biol. 2006, 7, 847–859. [CrossRef]

Costa, E.A.; Subramanian, K.; Nunnari, J.; Weissman, J.S. Deﬁning the physiological role of SRP in protein-targeting efﬁciency

and speciﬁcity. Science 2018, 359, 689–692. [CrossRef]

Nora, E.P.; Goloborodko, A.; Valton, A.L.; Gibcus, J.H.; Uebersohn, A.; Abdennur, N.; Dekker, J.; Mirny, L.A.; Bruneau, B.G.

Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell

2017, 169, 930–944. [CrossRef]

5.

6.

Muhar, M.; Ebert, A.; Neumann, T.; Umkehrer, C.; Jude, J.; Wieshofer, C.; Rescheneder, P.; Lipp, J.J.; Herzog, V.A.; Reichholf, B.;

et al. SLAM-seq deﬁnes direct gene-regulatory functions of the BRD4-MYC axis. Science 2018, 360, 800–805. [CrossRef] [PubMed]

Yesbolatova, A.; Saito, Y.; Kitamoto, N.; Makino-Itou, H.; Ajima, R.; Nakano, R.; Nakaoka, H.; Fukui, K.; Gamo, K.; Tominari, Y.;

et al. The auxin-inducible degron 2 technology provides sharp degradation control in yeast, mammalian cells, and mice. Nat.

Commun. 2020, 11, 5701. [CrossRef] [PubMed]

7.

8.

Zhang, L.; Ward, J.D.; Cheng, Z.; Dernburg, A.F. The auxin-inducible degradation (AID) system enables versatile conditional

protein depletion in C. elegans. Development 2015, 142, 4374–4384. [CrossRef] [PubMed]

Bence, M.; Jankovics, F.; Lukácsovich, T.; Erdélyi, M. Combining the auxin-inducible degradation system with CRISPR/Cas9-

based genome editing for the conditional depletion of endogenous Drosophila melanogaster proteins. FEBS J. 2017, 284, 1056–1069.

[CrossRef] [PubMed]

9.

Kleinjan, D.A.; Wardrope, C.; Nga Sou, S.; Rosser, S.J. Drug-tunable multidimensional synthetic gene control using inducible

degron-tagged dCas9 effectors. Nat. Commun. 2017, 8, 1191. [CrossRef]

10. Kanke, M.; Nishimura, K.; Kanemaki, M.; Kakimoto, T.; Takahashi, T.S.; Nakagawa, T.; Masukata, H. Auxin-inducible protein

depletion system in ﬁssion yeast. BMC Cell Biol. 2011, 12, 1–6. [CrossRef]

11. Yamagishi, Y.; Sakuno, T.; Shimura, M.; Watanabe, Y. Heterochromatin links to centromeric protection by recruiting shugoshin.

Nature 2008, 455, 251–255. [CrossRef]

Genes 2021, 12, 882

23 of 24

12. Kanke, M.; Kodama, Y.; Takahashi, T.S.; Nakagawa, T.; Masukata, H. Mcm10 plays an essential role in origin DNA unwinding

after loading of the CMG components. EMBO J. 2012, 31, 2182–2194. [CrossRef] [PubMed]

13. Handa, T.; Kanke, M.; Takahashi, T.S.; Nakagawa, T.; Masukata, H. DNA polymerization-independent functions of DNA

polymerase epsilon in assembly and progression of the replisome in ﬁssion yeast. Mol. Biol. Cell 2012, 23, 3240–3253. [CrossRef]

14. Kakui, Y.; Rabinowitz, A.; Barry, D.J.; Uhlmann, F. Condensin-mediated remodeling of the mitotic chromatin landscape in ﬁssion

yeast. Nat. Genet. 2017, 49, 1553–1557. [CrossRef] [PubMed]

15. Moiseeva, V.; Amelina, H.; Collopy, L.C.; Armstrong, C.A.; Pearson, S.R.; Tomita, K. The telomere bouquet facilitates meiotic

prophase progression and exit in ﬁssion yeast. Cell Discov. 2017, 3, 17041. [CrossRef] [PubMed]

16. Sathyan, K.M.; McKenna, B.D.; Anderson, W.D.; Duarte, F.M.; Core, L.; Guertin, M.J. An improved auxin-inducible degron system

preserves native protein levels and enables rapid and specific protein depletion. Genes Dev. 2019, 33, 1441–1455. [CrossRef ] [PubMed ]

17. Uchida, N.; Takahashi, K.; Iwasaki, R.; Yamada, R.; Yoshimura, M.; Endo, T.A.; Kimura, S.; Zhang, H.; Nomoto, M.; Tada, Y.; et al.

Chemical hijacking of auxin signaling with an engineered auxin-TIR1 pair. Nat. Chem. Biol. 2018, 14, 299–305. [CrossRef]

18. Yamada, R.; Murai, K.; Uchida, N.; Takahashi, K.; Iwasaki, R.; Tada, Y.; Kinoshita, T.; Itami, K.; Torii, K.U.; Hagihara, S. A Super

Strong Engineered Auxin-TIR1 Pair. Plant Cell Physiol. 2018, 59, 1538–1544. [CrossRef]

19. Nishimura, K.; Yamada, R.; Hagihara, S.; Iwasaki, R.; Uchida, N.; Kamura, T.; Takahashi, K.; Torii, K.U.; Fukagawa, T. A super-sensitive

auxin-inducible degron system with an engineered auxin-TIR1 pair. Nucleic Acids Res. 2020, 48, e108. [CrossRef ] [PubMed ]

20. Harigaya, Y.; Tanaka, H.; Yamanaka, S.; Tanaka, K.; Watanabe, Y.; Tsutsumi, C.; Chikashige, Y.; Hiraoka, Y.; Yamashita, A.; Yamamoto,

M. Selective elimination of messenger RNA prevents an incidence of untimely meiosis. Nature 2006, 442, 45–50. [CrossRef ]

21. Yamanaka, S.; Yamashita, A.; Harigaya, Y.; Iwata, R.; Yamamoto, M. Importance of polyadenylation in the selective elimination of

meiotic mRNAs in growing S. pombe cells. EMBO J. 2010, 29, 2173–2181. [CrossRef]

22. Yamashita, A.; Shichino, Y.; Tanaka, H.; Hiriart, E.; Touat-Todeschini, L.; Vavasseur, A.; Ding, D.Q.; Hiraoka, Y.; Verdel, A.;

Yamamoto, M. Hexanucleotide motifs mediate recruitment of the RNA elimination machinery to silent meiotic genes. Open Biol.

2012, 2, 120014. [CrossRef]

23. Watson, A.T.; Daigaku, Y.; Mohebi, S.; Etheridge, T.J.; Chahwan, C.; Murray, J.M.; Carr, A.M. Optimisation of the Schizosaccha-

romyces pombe urg1 expression system. PLoS ONE 2013, 8, e83800. [CrossRef]

24. Waddell, S.; Jenkins, J.R. arg3+, a new selection marker system for Schizosaccharomyces pombe: Application of ura4+ as a

removable integration marker. Nucleic Acids Res. 1995, 23, 1836–1837. [CrossRef] [PubMed]

25. Moreno, S.; Klar, A.; Nurse, P. Molecular Genetic Analysis of Fission Yeast Schizosaccharomyces Pombe; Guide to Yeast Genetics and

Molecular Biology, Methods in Enzymology; Elsevier: Amsterdam, Netherlands, 1991; pp. 795–823.

26. Zach, R.; Carr, A.M. Increased expression of Polδ does not alter the canonical replication program in vivo. Wellcome Open Res.

2021, 6, 44. [CrossRef]

27. Watson, A.T.; Garcia, V.; Bone, N.; Carr, A.M.; Armstrong, J. Gene tagging and gene replacement using recombinase-mediated

cassette exchange in Schizosaccharomyces pombe. Gene 2008, 407, 63–74. [CrossRef] [PubMed]

28. Bähler, J.; Wu, J.Q.; Longtine, M.S.; Shah, N.G.; McKenzie, A.; Steever, A.B.; Wach, A.; Philippsen, P.; Pringle, J.R. Heterologous

modules for efﬁcient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 1998, 14, 943–951. [CrossRef]

29. Hentges, P.; Van Driessche, B.; Tafforeau, L.; Vandenhaute, J.; Carr, A.M. Three novel antibiotic marker cassettes for gene

disruption and marker switching in Schizosaccharomyces pombe. Yeast 2005, 22, 1013–1019. [CrossRef]

30. Watson, A.T.; Werler, P.; Carr, A.M. Regulation of gene expression at the ﬁssion yeast Schizosaccharomyces pombe urg1 locus.

Gene 2011, 484, 75–85. [CrossRef] [PubMed]

31. Yokobayashi, S.; Watanabe, Y. The kinetochore protein Moa1 enables cohesion-mediated monopolar attachment at meiosis I. Cell

2005, 123, 803–817. [CrossRef]

32. Gray, W.M.; del Pozo, J.C.; Walker, L.; Hobbie, L.; Risseeuw, E.; Banks, T.; Crosby, W.L.; Yang, M.; Ma, H.; Estelle, M. Identiﬁcation

of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev. 1999, 13, 1678–1691. [CrossRef]

[PubMed]

33. Maraschin, F.S.; Memelink, J.; Offringa, R. Auxin-induced, SCF(TIR1)-mediated poly-ubiquitination marks AUX/IAA proteins

for degradation. Plant J. 2009, 59, 100–109. [CrossRef] [PubMed]

34. Morawska, M.; Ulrich, H.D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast 2013, 30, 341–351.

[CrossRef] [PubMed]

35. Nishimura, K.; Fukagawa, T. An efﬁcient method to generate conditional knockout cell lines for essential genes by combination

of auxin-inducible degron tag and CRISPR/Cas9. Chromosome Res. 2017, 25, 253–260. [CrossRef]

36. Zasadzin´ska, E.; Huang, J.; Bailey, A.O.; Guo, L.Y.; Lee, N.S.; Srivastava, S.; Wong, K.A.; French, B.T.; Black, B.E.; Foltz, D.R.

Inheritance of CENP-A Nucleosomes during DNA Replication Requires HJURP. Dev. Cell 2018, 47, 348–362.e7. [CrossRef]

37. Doe, C.L.; Osman, F.; Dixon, J.; Whitby, M.C. DNA repair by a Rad22-Mus81-dependent pathway that is independent of Rhp51.

Nucleic Acids Res. 2004, 32, 5570–5581. [CrossRef]

38. Marguerat, S.; Schmidt, A.; Codlin, S.; Chen, W.; Aebersold, R.; Bähler, J. Quantitative analysis of ﬁssion yeast transcriptomes and

proteomes in proliferating and quiescent cells. Cell 2012, 151, 671–683. [CrossRef]

39. Kubota, T.; Nishimura, K.; Kanemaki, M.T.; Donaldson, A.D. The Elg1 replication factor C-like complex functions in PCNA

unloading during DNA replication. Mol. Cell 2013, 50, 273–280. [CrossRef]

Genes 2021, 12, 882

24 of 24

40. Tanaka, S.; Miyazawa-Onami, M.; Iida, T.; Araki, H. iAID: An improved auxin-inducible degron system for the construction of a

‘tight’ conditional mutant in the budding yeast Saccharomyces cerevisiae. Yeast 2015, 32, 567–581. [CrossRef]

Article Doi

Rice (Oryza sativa) tir1 and 5′adamantyl-iaa significantly improve the auxin-inducible degron system in schizosaccharomyces pombe

DOI: 10.3390/genes12060882

Source and publish data:

Authors:

Article abstract of DOI:10.3390/genes12060882

Full text of DOI:10.3390/genes12060882

Products guided by the article

R&D Labs maybe for 1459-50-3

Relevant to this article

Hot Product