Structural and kinetic characterization of 4-hydroxy-4-methyl-2- oxoglutarate/4-carboxy-4-hydroxy-2-oxoadipate aldolase, a protocatechuate degradation enzyme evolutionarily convergent with the HpaI and DmpG pyruvate aldolases

Article abstract of DOI:10.1074/jbc.M110.159509

4-Hydroxy-4-methyl-2-oxoglutarate/4-carboxy-4-hydroxy-2-oxoadipate (HMG/CHA) aldolase from Pseudomonas putida F1 catalyzes the last step of the bacterial protocatechuate 4,5-cleavage pathway. The preferred substrates of the enzyme are 2-keto-4-hydroxy acids with a 4-carboxylate substitution. The enzyme also exhibits oxaloacetate decarboxylation and pyruvate α-proton exchange activity. Sodium oxalate is a competitive inhibitor of the aldolase reaction. The pH dependence of k_cat/K_m and k_cat for the enzyme is consistent with a single deprotonation with pK_a values of 8.0 ± 0.1 and 7.0 ± 0.1 for free enzyme and enzyme substrate complex, respectively. The 1.8 A x-ray structure shows a four-layered α-β-β-α sandwich structure with the active site at the interface of two adjacent subunits of a hexamer; this fold resembles the RNase E inhibitor, RraA, but is novel for an aldolase. The catalytic site contains a magnesium ion ligated by Asp-124 as well as three water molecules bound by Asp-102 and Glu-199′. A pyruvate molecule binds the magnesium ion through both carboxylate and keto oxygen atoms, completing the octahedral geometry. The carbonyl oxygen also forms hydrogen bonds with the guanadinium group of Arg-123, which site-directed mutagenesis confirms is essential for catalysis. A mechanism for HMG/CHA aldolase is proposed on the basis of the structure, kinetics, and previously established features of other aldolase mechanisms.

Full text of DOI:10.1074/jbc.M110.159509

Enzymology:
Structural and Kinetic Characterization of
4
-Hydroxy-4-methyl-2-oxoglutarate/4-Carb
oxy-4-hydroxy-2-oxoadipate Aldolase, a
Protocatechuate Degradation Enzyme
Evolutionarily Convergent with the HpaI
and DmpG Pyruvate Aldolases
Weijun Wang, Scott Mazurkewich, Matthew
S. Kimber and Stephen Y. K. Seah
J. Biol. Chem. 2010, 285:36608-36615.
doi: 10.1074/jbc.M110.159509 originally published online September 15, 2010
Access the most updated version of this article at doi: 10.1074/jbc.M110.159509
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
•
•
When this article is cited
When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2010/09/15/M110.159509.DC1.html
This article cites 41 references, 11 of which can be accessed free at
http://www.jbc.org/content/285/47/36608.full.html#ref-list-1

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 47, pp. 36608–36615, November 19, 2010
2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
©
Structural and Kinetic Characterization of 4-Hydroxy-4-
methyl-2-oxoglutarate/4-Carboxy-4-hydroxy-2-oxoadipate
Aldolase, a Protocatechuate Degradation Enzyme
Evolutionarily Convergent with the HpaI and DmpG Pyruvate
□
S
*
Aldolases
Received for publication, June 29, 2010, and in revised form, September 3, 2010 Published, JBC Papers in Press, September 15, 2010, DOI 10.1074/jbc.M110.159509
1
2
Weijun Wang, Scott Mazurkewich, Matthew S. Kimber , and Stephen Y. K. Seah
From the Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario N1G 2W1, Canada
4
-Hydroxy-4-methyl-2-oxoglutarate/4-carboxy-4-hydroxy- xenobiotics such as phthalate isomers found in plastics and
2
-oxoadipate (HMG/CHA) aldolase from Pseudomonas putida pesticides (1, 3). The aromatic ring cleavage of protocatechuate
F1 catalyzes the last step of the bacterial protocatechuate 4,5- in the microbial 4,5-cleavage pathway leads to formation of
cleavage pathway. The preferred substrates of the enzyme are 4-carboxy-2-hydroxymuconate-6-semialdehyde. Depending
2
-keto-4-hydroxy acids with a 4-carboxylate substitution. The on the bacteria strain, this intermediate can be converted to
3
enzyme also exhibits oxaloacetate decarboxylation and pyruvate 4-hydroxy-4-methyl-2-oxoglutarate (HMG) in the hydrolytic
␣
-proton exchange activity. Sodium oxalate is a competitive in- branch of the pathway or 4-carboxy-4-hydroxy-2-oxoadipate
hibitor of the aldolase reaction. The pH dependence of k /K
(CHA) in the oxidative branch (4). Carbon-carbon bond cleav-
cat
m
and k for the enzyme is consistent with a single deprotonation age catalyzed by a common aldolase (HMG/CHA aldolase; EC
cat
with pK values of 8.0 ؎ 0.1 and 7.0 ؎ 0.1 for free enzyme and 4.1.3.17) leads to formation of two molecules of pyruvate in the
a
˚
enzyme substrate complex, respectively. The 1.8 A x-ray struc- former case and a molecule of pyruvate and oxaloacetate in the
ture shows a four-layered ␣-␤-␤-␣ sandwich structure with the latter (Fig. 1), which can then be channeled to the TCA cycle (5).
active site at the interface of two adjacent subunits of a hexamer;
Aldolases are an evolutionarily diverse class of enzymes that
this fold resembles the RNase E inhibitor, RraA, but is novel for are typically divided into two groups based on their catalytic
an aldolase. The catalytic site contains a magnesium ion ligated mechanism. The Class I aldolases utilize a Schiff base mecha-
by Asp-124 as well as three water molecules bound by Asp-102 nism to stabilize a carbanion intermediate, whereas the Class II
and Glu-199ꢀ. A pyruvate molecule binds the magnesium ion enzymes utilize divalent metal ions to stabilize an enolate inter-
through both carboxylate and keto oxygen atoms, completing mediate. Within each mechanistic class of aldolases, further
the octahedral geometry. The carbonyl oxygen also forms diversity exists with respect to the sequence, structure, and sub-
hydrogen bonds with the guanadinium group of Arg-123, which strate specificities. HMG/CHA aldolases have previously been
site-directed mutagenesis confirms is essential for catalysis. A purified from Pseudomonas putida and Pseudomonas ochra-
mechanism for HMG/CHA aldolase is proposed on the basis of ceae and found to be divalent metal ion-dependent Class II
the structure, kinetics, and previously established features of aldolases (5, 6). However, the amino acid sequence of the P.
other aldolase mechanisms.
orchraceae enzyme (7) showed no sequence similarity to other
well studied Class II pyruvate aldolases, including HpaI (8)
and DmpG (9) from the bacterial degradation pathways of
Protocatechuate is a key intermediate in the microbial deg- 4-hydroxyphenylacetate and phenol, respectively. Therefore,
radation of diverse aromatic compounds, including low molec- HMG/CHA aldolases have been proposed to be distinct mem-
ular weight products derived from lignin degradation, such as bers of Class II pyruvate aldolases in aromatic degradation
vanillate and syringate (1), pollutants from fossil fuels and coal pathways (COG0684 for HMG/CHA aldolases, COG3836 for
derivatives such as fluorene and its analogs (2), and man-made HpaI, and COG0119 for DmpG). Intriguingly, the HMG/CHA
aldolases are distantly related in sequence to RraA (regulator
*
This work was supported by National Science and Engineering Research of ribonuclease activity A) proteins (sequence identities of
Council of Canada Discovery Grants 238284 (to S. Y. K. S.) and 327280 (to 25–33% over the central ϳ115 residues and ϳ15% over entire
M. S. K.).
S
sequence), which associate within the RNA degradosome and
□
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Tables S1 and S2 and Figs. S1–S5.
Theatomiccoordinatesandstructurefactors(code3NOJ)havebeendepositedin
the Protein Data Bank, Research Collaboratory for Structural Bioinformatics,
Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
inhibit RNase E activity in Escherichia coli (10), and a yeast
3
The abbreviations used are: HMG, 4-hydroxy-4-methyl-2-oxoglutarate or
1
To whom correspondence may be addressed: Dept. of Molecular and Cellu-
lar Biology, University of Guelph, Guelph, ON N1G 2W1, Canada. Tel.: 519-
2-hydroxy-2-methyl-4-oxopentanedioic acid; CHA, 4-carboxy-4-hydroxy-
2-oxoadipic acid or 2-hydroxy-4-oxobutane-1,2,4-tricarboxylic; KHG, ␣-ke-
to-␥-hydroxyglutarate or 2-hydroxy-4-oxopentanedioic acid; HOPA,
4-hydroxy-2-oxopentanoate; LDH, L-lactate dehydrogenase; MDH, malic
dehydrogenase;MOPS, 3-(N-morpholino)propanesulfonicacid;MES, 2-(N-
morpholine)ethanesulfonic acid; OAA, oxaloacetate.
8
24-4120; Fax: 519-837-1802; E-mail: mkimber@uoguelph.ca.
2
To whom correspondence may be addressed: Dept. of Molecular and Cellu-
lar Biology, University of Guelph, Guelph, ON N1G 2W1, Canada. Tel.: 519-
8
24-4120; Fax: 519-837-1802; E-mail: sseah@uoguelph.ca.
3
6608 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 47•NOVEMBER 19, 2010

Structure and Kinetic Characterization of HMG/CHA Aldolase
¨
Chromatography was performed on an AKTA Explorer 100
(
Amersham Biosciences). Buffer containing 20 mM sodium
HEPES, pH 7.5, was used throughout the purification proce-
dure unless indicated otherwise.
FIGURE 1. Scheme showing the aldol cleavage reaction catalyzed by
HMG/CHA aldolase. R is CH for HMG and CH COOH for CHA.
The cell pellet (4.1 g of wet weight) was resuspended in buffer
and disrupted by a French press. The cell debris was removed by
3
2
centrifugation (17,500 ϫ g, 10 min). The clear supernatant was
TM
protein (YER010c) of known structure but unknown function filtered through a 0.45-␮m filter and loaded onto a Source
(
11).
15Q (Amersham Biosciences) anion exchange column (2 ϫ 13
In addition to their importance in aromatic compounds and cm). The column was washed with 2 column volumes of the
carbohydrate metabolism, the ability of aldolases to catalyze the buffer containing 0.15 M NaCl followed by a linear gradient of
formation of carbon-carbon bond linkages has resulted in them NaCl from 0.15 to 0.50 M over 12 column volumes. The aldolase
also being exploited as biocatalysts to synthesize natural prod- was eluted with ϳ0.35 M NaCl. Active fractions were pooled,
ucts and bioactive molecules (12). Here, we kinetically charac- concentrated by ultrafiltration with a YM10 filter (Millipore,
TM
terize HMG/CHA aldolase from P. putida F1 (56% sequence Nepean, Canada), and loaded onto a phenyl-Sepharose
identity to the P. orchracea enzyme), show that its structure is hydrophobic interaction chromatography column (1 ϫ 18.5
characterized by an RraA-like fold previously unseen in aldola- cm) and purified with a 5-column volume linear gradient of
ses, and find conserved features in common with distantly ammonium sulfate from 0.4 to 0 M. The enzyme was eluted at
related and poorly characterized homologs. Our results provide ϳ0.2 M ammonium sulfate. Active fractions were concentrated
significant new insights into the active site organization and the to ϳ4 ml by ultrafiltration, loaded onto a HiLoad 26/60 Super-
potential catalytic mechanism of this enzyme, which should dex 200 prep gel filtration column (Amersham Biosciences),
facilitate efforts to engineer aldolases to enhance aromatic pol- and then eluted with buffer containing 0.15 M NaCl. The puri-
lutant degradation and for use as a biocatalyst.
fied enzyme was concentrated to 20 mg of protein/ml as before,
aliquoted, and stored at Ϫ80 °C in 20 mM sodium HEPES buffer,
pH 7.5. The enzyme remained stable for 2 months under this
EXPERIMENTAL PROCEDURES
Chemicals—Sodium pyruvate, sodium oxalate, oxaloacetate, storage condition.
L-lactate dehydrogenase (LDH, rabbit muscle), malate dehy-
Determination of Protein Concentration, Purity, and Molec-
drogenase (MDH, porcine heart), and Dowexꢁ 1X8-200 ion ular Mass—Protein concentrations were determined by the
exchange resin were from Sigma-Aldrich. Restriction enzymes, Bradford assay (15) using bovine serum albumin as standards.
T4 DNA ligase, and Pfx polymerase were from Invitrogen or SDS-PAGE was performed and stained with Coomassie Blue
New England Biolabs (Pickering, Canada). All other chemicals according to established procedures (15). The molecular
were analytical grade and were obtained from Sigma-Aldrich or weight of holoenzyme was determined by gel filtration using a
Fisher.
DNA Manipulation—DNA was purified, digested, and
HiLoad 26/60 Superdex 200 prep column.
Crystallization and Structure Determination—HMG/CHA
ligated using standard protocols (13). The HMG/CHA aldolase aldolase crystals were grown using the hanging drop method at
gene (pput1361) was amplified from genomic DNA of P. putida 25 °C, with 2 ␮l of reservoir solution containing 10% PEG 4000,
F1 by PCR using the primers with the sequences GCGGCAT- 0.2 M ammonium acetate, 0.1 M sodium acetate, pH 4.6, 10 mM
ATGAACACTCTGATCGGTAAAAC and CCGCAAGCTT- MgCl , 5 mM sodium pyruvate, and 2 ␮l of 21 mg/ml HMG/
2
AACCCTCCAAGTCTTCG. Introduced NdeI and PstI restric- CHA aldolase. The crystals were flash frozen in a 100 K liquid
tion sites are underlined. The amplified fragment was ligated to nitrogen stream using paratone-N oil as a cryoprotectant. The
the vector pT7-7 (14). Site-specific mutagenesis was carried out data were collected to 1.82 Å at the Canadian Macromolecular
TM
according to a modified QuikChange
(Stratagene) method. Crystallography Facility (08ID-1) and processed in HKL2000
The sequence of the sense oligonucleotides used to construct (16). Crystals were of the trigonal space group R32, with cell
the R123A and R123K mutants are GGAGTCGCGGACAC- dimensions a ϭ b ϭ 111.18 Å and c ϭ 139.57 Å. The structure
CCAGACGTTACGCGACATGGGGTTC and GGAGTCAA- was determined using Phaser (17), searching with residues
GGACACCCAGACGTTACGCGACATGGGGTTC, respec- 2–157 of one protomer from the Mycobacterium tuberculosis
tively (the altered codons are underlined). All of the constructs RraA (MenG) structure (Protein Data Bank code 1NXJ); this
were checked by sequencing at the Guelph Molecular Super- solution was weak (LLG 41.4) but proved sufficient for struc-
center of the University of Guelph.
ture refinement. The structure was rebuilt in Coot (18), and
Purification of Wild-type and Mutant HMG/CHA Aldolase— refinement was performed using Refmac in CCP4 (19). For the
Recombinant E. coli BL21(␭DE3) harboring the gene encoding final stages of refinement, TLS refinement with five residue
HMG/CHA aldolase was propagated in 1 liter of Luria-Bertani groups was added (20). The crystal contains a single protomer
medium supplemented with 0.6 M D-sorbitol, 2.5 mM glycine in the asymmetric unit, with residues 1 and 237–238 missing
betaine, and 100 ␮g/ml ampicillin at 37 °C until a density of 0.6 from the final model. Supplemental Table S1 lists data collec-
was reached at 600-nm wavelength, after which 0.5 mM isopro- tion and final model refinement statistics. Structure figures
pyl ␤-D-thiogalactopyranoside was added to induce protein were prepared using PyMol (21).
expression. The culture was incubated at 15 °C overnight and
Preparation of Enzyme Substrates—HMG and CHA were
then harvested by centrifugation at 5000 ϫ g for 10 min.
synthesized chemically using published methods with some
NOVEMBER 19, 2010•VOLUME 285•NUMBER 47
JOURNAL OF BIOLOGICAL CHEMISTRY 36609

Structure and Kinetic Characterization of HMG/CHA Aldolase
modifications (22). Racemic KHG and HOPA were synthesized TABLE 1
HMG aldolase data collection and refinement statistics
The numbers in parentheses indicate the highest resolution shell (1.85 to 1.82).
enzymatically using HpaI according to previous methods (23).
All of the products were purified using Dowex Chloride 1X8
anion exchange resin with a linear gradient of HCl from 0.0 to
Data collection
Space group
R32
0
.1 M. Fractions containing specified products were collected
Unit cell dimensions
a ϭ b (Å)
111.18
139.27
and neutralized by 2.0 M NaOH, lyophilized, and stored at
c (Å)
Ϫ20 °C. The concentration of each product was determined
Wavelength (Å)
Resolution limits (Å)
1.541
50–1.82
0.099 (0.273)
180,118
27,093
with HMG/CHA aldolase (using 1.0 mM CoCl as cofactor) by
2
R
sym
Total observations
Unique observations
Data completeness (%)
Redundancy
coupling pyruvate or oxaloacetate formation to NADH oxida-
tion using LDH or MDH (for CHA), respectively.
90.8 (89.4)
6.7 (2.8)
12.0 (4.4)
28.5
Metal Substitution—Metal-free apoenzyme was prepared by
adding 0.5 g of Chelex 100 (Sigma) to 10 mg of purified enzyme
in 10 ml of 20 mM sodium HEPES, pH 7.5. After gentle stirring
for 20 min, Chelex 100 was removed by a 20-␮m filter. The
apoenzyme has less than 1.0% of the activity observed in the
I/␴I
Mean B (Wilson plot)
Model refinement
R
0.158
0.169
cryst
R
free
Root mean square deviations
Bond lengths (Å)
Bond angles (°)
0.009
1.20
presence of 1.0 mM MgCl . The apoenzyme was preincubated
2
with the stated metal ions prior to use in the kinetic assay.
Enzyme Assays—All of the kinetics assays were performed at
least in duplicate at 25 °C using a Varian Cary 3 spectrophotom-
eter equipped with a thermojacketed cuvette holder. HMG
aldol cleavage and OAA decarboxylase activity were observed
by coupling pyruvate formation to NADH oxidation using
LDH. Analogously, formation of acetaldehyde by HOPA cleav- RESULTS
Residues modeled
Water molecules
Mean B: protein
Water
2–236
125
34.4
46.8
2
ϩ
Mg
24.4
Pyruvate
PEG
26.1
73.5
age was monitored using alcohol dehydrogenase, and forma-
Expression and Purification—The HMG/CHA aldolase of P.
tion of oxaloacetate by CHA cleavage was monitored using putida F1 was overexpressed in E. coli BL21(␭DE3) and purified
MDH. NADH oxidation was monitored at 340 nm, and the to homogeneity with a typical yield of 19 mg of purified protein/
Ϫ1
extinction coefficient of NADH was taken to be 6200 M
liter of bacterial culture (supplemental Fig. S1 and supplemen-
Ϫ1
cm . A standard aldolase cleavage activity assay contained 2.0 tal Table S1). The subunit molecular mass of the enzyme as
mM of substrate, 0.4 mM NADH, 1.0 mM divalent metal ion, and determined by SDS-PAGE is 26 kDa, consistent with the pre-
3
0 units of either LDH, alcohol dehydrogenase, or MDH in 100 dicted molecular mass (25,448 Da).
mM HEPES buffer, pH 8.0. For KHG aldol cleavage activity,
glyoxylate formation was determined using phenylhydrazine
hydrochloride according to the continuous spectrophotomet-
ric method (24). Assay solutions contained 4.0 mM phenylhydr-
azine hydrochloride, 1 mM divalent metal ion, and varying con-
centrations of KHG in 100 mM HEPES buffer, pH 8.0, with a
total volume of 1.0 ml. Enzyme was added to initiate the reac-
tion, and the absorbance increase at 324 nm was monitored for
Overall Structure—The structure of HMG/CHA aldolase
was determined at 1.82 Å by molecular replacement using the
structure of RraA (Protein Data Bank code 1NXJ) as a search
model (Table 1). The protomer forms a four-layered ␣-␤-␤-␣
sandwich (Fig. 2A). One layer is a continuous seven-stranded
sheet comprised of ␤11Ј, ␤1, ␤6, ␤2, ␤3, ␤4, and ␤5 (where the
underlined strands are antiparallel to others, and ␤11Ј is con-
tributed by an adjacent protomer in the trimer). The other
␤
␤
-strand layer is comprised of ␤2, ␤9, and ␤10 and, separately,
7 and ␤8. ␣C, ␣D, and ␣E pack against the exposed face of the
5
min.
All of the kinetic data fitting was performed using nonlinear
first sheet, whereas ␣A, ␣B, and the N-terminal portion of ␣F
pack against the exposed face of the second sheet. The C-ter-
minal-most 40 residues form an extended “tail” that wraps
around an adjacent protomer of the trimer, with ␣F, ␣G, and
regression in the program Leonora (25). All of the data were
fitted to the Michaelis-Menten equation, except for the OAA
decarboxylation reaction, which was fitted to the substrate
inhibition equation. For inhibition assays, the concentration of
␣
H packing against the symmetry related copies of ␣C and ␣D
sodium oxalate was varied from 0.5 to 10 ϫ K , and data were
i
and ␤11Ј hydrogen bonding with ␤1. The short 3 I helix, found
1
0
fitted to a competitive inhibition equation.
at the very C terminus of the chain, is formed by residues that
The pH dependence of the kinetics was determined using
HMG as the substrate, with pH varying between pH 6.0 and
exist only in the P. putida protein.
Oligomeric State—The crystal packs with a single molecule
per asymmetric unit. This protomer is associated into a highly
1
0.5 in a three-component constant ionic strength buffer con-
taining 0.1 M Tris, 0.05 M acetic acid, and 0.05 M MES. The data
were fitted by nonlinear regression in Leonora.
2
stabilized trimer, where each protomer buries 1724 Å with the
adjacent protomer; much of this interface is due to the C-ter-
minal extension. PISA calculates that this trimer is the most
Pyruvate ␣-proton exchange was determined by measuring
the loss of pyruvate methyl protons signal in deuterated buffer stable conformation (26). However, there is also a second can-
1
by H NMR (8). Proton exchange assays were performed using didate oligomeric interface where two trimeric rings interact,
2
6
00 ␮l of assay solution containing 30 mM of pyruvate, 1.0 mM with a combined 760 Å buried per protomer with two pro-
MgCl in 20 mM deutered MOPS buffer, pD 8.0.
tomers from the opposite ring (Fig. 2, B and C). Despite this
VOLUME 285•NUMBER 47•NOVEMBER 19, 2010
2
3
6610 JOURNAL OF BIOLOGICAL CHEMISTRY

Structure and Kinetic Characterization of HMG/CHA Aldolase
well defined inter-ring hydrophobic
patch in the vicinity of Ile-158, and
the residues buried at the interface
are far more conserved than those
on exposed surfaces of the pro-
tomer. This proposed hexamer is
consistent with a 146-kDa molecu-
lar mass determined experimentally
by gel filtration.
Active Site Organization—The
catalytic site is found in the cleft
between adjacent protomers of the
trimer and is comprised of residues
contributed by helices ␣D, ␣E, the
␤
4–␣E and ␤5–␤6 loops from one
protomer, and ␣B and ␣F of the
other. The electron density map
shows a well ordered magnesium
ion and pyruvate molecule bound in
the active site (Fig. 2D). The magne-
sium ion displays skewed octahedral
coordination geometry. Unusually,
the metal ion has only a single direct
protein ligand: Asp-124. Two addi-
tional coordination sites are occu-
pied by pyruvate, and the remaining
three sites are occupied by water
molecules. These water molecules
are tightly bound, however; one
forms a hydrogen bond to Asp-124
carboxylate, one forms a hydrogen
bond to the carboxylate groups of
Asp-102 and Glu-199Ј, and the
third forms a hydrogen bond to Glu-
1
99Ј alone, which is contributed by
F from an adjacent protomer that
␣
covers the catalytic site. This helix is
stabilized at its N- and C-terminal
ends by hydrophobic interactions,
but the central two turns are sus-
pended over the catalytic site and
solvent-exposed on all sides.
FIGURE 2. Overall structure of HMG/CHA aldolase. A, organization of the protomer. A single protomer is
colored blue to red, N terminus to C terminus. The magnesium ion is shown as a magenta sphere, along with its
ligands. Secondary structure elements are labeled. B, view of the hexamer, seen down the 3-fold axis. One
protomer is colored as in A, and the others are in white. The C-terminal motif comprising ␣F, ␣G, ␣H, ␤11, and
The pyruvate group coordinates
the magnesium ion through its keto
and one carboxylate oxygen atoms.
310
I wrap around the adjacent protomer, forming extensive interactions. C, the hexamer looking down the
2
-fold symmetry axis. D, active site of HMG/CHA aldolase. One protomer is colored white, and the other is beige. The pyruvyl carboxylate group also
Electron density for magnesium, pyruvate, and four functionally relevant waters are shown as blue mesh at 1.5
forms a pair of hydrogen bonds with
␴. E, model of CHA in the HMG/CHA aldolase binding in the substrate binding pocket (semitransparent white
surface). The pyruvate moiety is superposed closely on the experimental pyruvate site. The OH group makes a the main chain amide nitrogen
pair of hydrogen bonds with Wat-1 (the proposed catalytic base) and Arg-123. The carboxylate groups make
one direct hydrogen bond each to the protein, with good geometry, as well as to structured water molecules
atoms of Leu-103 and Leu-104,
located at the N-terminal end of ␣D,
(not shown). F, overlay of HMG/CHA aldolase with its homologs. HMG/CHA aldolase is in red, 3K4I is in blue,
2
C5Q is in yellow, and RraA (2PCN) is in green. Note that HMG/CHA aldolase has N- and C-terminal extensions whose helix dipole points into the
relative to the other proteins, and 2C5Q has a topological inversion relative to the other structures. G, overlay
of the catalytic site of HMG/CHA aldolase with its homologs. Structures are colored as in Fig. 2F, residues are
labeled by their HMG/CHA aldolase convention. Note that the core catalytic machinery associated with pyru-
vate binding and activation appears conserved across this whole family.
catalytic site. The carbonyl oxygen
of pyruvate forms an additional
hydrogen bond with the N⑀ guana-
dinium nitrogen of Arg-123. Arg-
limited buried surface, there are additional lines of evidence 123, in turn, makes a salt bridge with Glu-36. The flat face of the
indicating that the hexamer is the true, in vivo state. The ring- pyruvate stacks against the main chain atoms of Phe-100 and
ring interaction shows good shape complementarity, there is a Gly-101. An additional well ordered water molecule (Wat-4)
NOVEMBER 19, 2010•VOLUME 285•NUMBER 47
JOURNAL OF BIOLOGICAL CHEMISTRY 36611

Structure and Kinetic Characterization of HMG/CHA Aldolase
makes a hydrogen bond (2.8 Å) with the pyruvate methyl group. thermophilus (Protein Data Bank code 1J3L) (28), and Vibrio
The ability of the methyl group to act as a hydrogen bond donor cholerae (Protein Data Bank code 1VI4). These RraA homologs
reflects the strongly electronegative nature of this methyl car- omit the first 30 and last 40 amino acids (the C-terminal tail) of
2ϩ
bon atom in the context of the pyruvateꢂMg complex.
HMG/CHA aldolase and are therefore noticeably smaller. The
Substrate Modeling—Superposing the pyruvyl moiety of HMG/CHA aldolase structure is also distantly related to His
CHA on the experimentally observed pyruvate-binding site domain of enzyme I for bacterial P-enolpyruvate-dependent
allows the rest of the CHA to be modeled by adjusting primarily carbohydrate:phosphotransferase systems (Protein Data Bank
three torsion angles (Fig. 2E). In our model, the C4-OH inter- codes 1ZYM and 2HWG) (29, 30) and the phosphotransfer
acts with Arg-123N␩2 and the metal ligating water molecule, domain of pyruvate phosphate dikinase (Protein Data Bank
Wat-1, which in turn hydrogen bonds with Glu-199Ј. The code 1DIK) (31).
C4-carboxylate hydrogen bonds with Thr-145O␥. These inter-
Metal Ion and Substrate Specificity of HMG/CHA Aldolase—
actions would all be expected to be recapitulated in the HMG The specific activities of purified apoenzyme with different
complex. The C6-carboxylate specific to CHA makes a hydro- metal ions were determined using HMG as substrate. Optimum
2
ϩ
2ϩ
gen bond with Asn-71N␦ and could potentially also hydrogen activity was obtained with Mg and Mn ions, and other
bond with Lys-147 N␨, although this would require a slight divalent cations activate the enzyme in the following order of
2
ϩ
2ϩ
2ϩ
2ϩ
reorientation of this residue. All of the amino acid residues effectiveness: Co Ͼ Zn Ͼ Ni Ͼ Cd . No detectable
2
ϩ
2ϩ
modeled as contacting the substrate are conserved in all homol- activity was observed for Cu and Ca (Table 2).
2
ϩ
2ϩ
ogous HMG/CHA aldolases (supplemental Fig. S3).
Using Mg or Mn as cofactors, the substrate specificity of
Structurally Related Proteins—Searching the Protein Data HMG/CHA aldolase toward different 4-hydroxy-2-ketoacids
Bank with DALI-lite reveals a number of related structures (Fig. was determined (Table 3). The enzyme has the highest speci-
2
, F and G, and supplemental Table S2). There are two relatively ficity constant (k /K ) for CHA and HMG. The specificity
cat
m
close structural homologs to HMG/CHA aldolase that are func- constant for HOPA, a substrate analog that lacks the 4-carbox-
4
tionally uncharacterized: PSPTO_3204 (Protein Data Bank ylate group, is decreased by a factor of ϳ10 -fold relative to the
code 3K4I) from Pseudomonas syringae pv. tomato DC3000 physiological substrate, HMG. The enzyme also exhibits oxalo-
and YER010c (Protein Data Bank code 2C5Q) from Saccharo- acetate decarboxylase activity, which also involves C–C bond
myces cerevisiae (11). The closest related protein with an estab- cleavage, leading to formation of pyruvate and carbon dioxide.
lished function is the RNaseE inhibitor RraA from E. coli (Pro- The kinetic data for all substrates obey classic Michaelis-Men-
tein Data Bank code 1Q5X) (10), along with its homologs from ten kinetics except for OAA, which follows a substrate inhibi-
M. tuberculosis (Protein Data Bank code 1NXJ) (27), Pseudo- tion model.
monas aeruginosa (Protein Data Bank code 3C8O), Thermus
Pyruvate Proton Exchange and Aldolase pH Rate Profile—
The enzyme is able to catalyze the exchange of pyruvate ␣-pro-
Ϫ1
1
TABLE 2
ton with a rate of 2.98 Ϯ 0.18 s as determined by H NMR in
Relative activity of HMG/CHA aldolase with various metal ions
deuterated buffer. Furthermore, sodium oxalate is a strong
Ϫ1
Ϫ1
Activity obtained with MgCl (0.11 mmolꢂmg ꢂmin ) is taken as 100%. Assays,
2
competitive inhibitor of the HMG aldolase activity with a K
2
ϩ
2ϩ
i
with the exception of Zn and Cu , were performed with 2.2 ␮g of aldolase, 10
mM HMG, 1.0 mM of the respective metal chloride salts, 0.3 mM NADH, 30 units
of LDH, and 100 mM sodium HEPES buffer, pH 8.0, in a total volume of 1 ml.
value of 5.0 Ϯ 0.3 ␮M using 1.0 mM MgCl as a cofactor (sup-
2
plemental Fig. S2A) and 1.7 Ϯ 0.1 ␮M using 1.0 mM MnCl as a
2
ϩ
2ϩ
2
Activity with Zn and Cu was determined by the discontinuous method (8).
2
ϩ
For assays with Zn , a high spontaneous aldol cleavage rate in the presence of
.0 mM ZnCl necessitates that 0.1 mM ZnCl be used instead. ND, no activity
cofactor (supplemental Fig. S2B).
1
2
2
A pH activity profile for HMG cleavage was determined
using constant ionic strength buffers from pH of 6.0 to 10.5,
Ϫ1
Ϫ1
was detected above the detection limit of 10 nmolꢂmin ꢂmg protein.
Metal ion
Relative activity
with 1.0 mM MgCl as cofactor (supplemental Fig. S4). Kinetic
2
%
2
2
ϩ
parameters were not determined above pH 10.5 because of the
Mg
Mn
100.0 Ϯ 2.8
90.3 Ϯ 5.7
64.7 Ϯ 3.6
28.2 Ϯ 3.4
5.0 Ϯ 0.2
49.6 Ϯ 2.7
ND
ϩ
instability of substrate at high pH. The k /K and k data for
cat
m
cat
2
ϩ
Co
2
ϩ
the enzyme is consistent with a single deprotonation with pK
Ni
a
2
ϩ
Cd
values of 8.0 Ϯ 0.1 and 7.0 Ϯ 0.1 for free enzyme and enzyme
2
ϩ
Zn
Cu
2
ϩ
substrate complex, respectively.
2
ϩ
Ca
ND
Characterization of the R123A and R123K Variants—Arg-
EDTA
ND
1
23 was separately replaced with alanine and lysine by site-
TABLE 3
Steady state kinetic parameters of HMG/CHA aldolase with different substrates
Ksi is the substrate inhibition constant.
.0 mM Mg2
؉
1.0 mM Mn2؉
Ksi
1
Ksi
mM
Substrate
Km
k
kcat/K
M
Km
mM
k
kcat/K
cat
sϪ1
m
Ϫ1
cat
sϪ1
m
Ϫ1
mM
Ϫ1ꢂs
mM
M
Ϫ1ꢂs
3
4
5
2
4
5
5
3
OAA
HMG
CHA
KHG
HOPA
0.30 Ϯ 0.03
0.26 Ϯ 0.02
0.066 Ϯ 0.008
0.15 Ϯ 0.02
25.0 Ϯ 2.2
0.37 Ϯ 0.04
1.85 Ϯ 0.18
6.2 ϫ 10
7.4 ϫ 10
2.2 ϫ 10
3.8 ϫ 10
1.9
0.036 Ϯ 0.004
0.022 Ϯ 0.001
0.030 Ϯ 0.005
0.071 Ϯ 0.003
8.8 Ϯ 0.7
0.25 Ϯ 0.03
1.52 Ϯ 0.09
13.7 Ϯ 0.2
7.5 Ϯ 0.3
4.2 ϫ 10
6.2 ϫ 10
2.5 ϫ 10
3.5 ϫ 10
a
a
19.3 Ϯ 0.9
a
a
a
a
a
a
14.4 Ϯ 0.5
0.058 Ϯ 0.002
0.048 Ϯ 0.003
0.25 Ϯ 0.003
0.19 Ϯ 0.01
2.2 ϫ 101
a
Substrate inhibition was not observed.
3
6612 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 47•NOVEMBER 19, 2010

Structure and Kinetic Characterization of HMG/CHA Aldolase
1
24, and indirectly by Asp-102 and
Glu-199Ј (from a different pro-
tomer), which together position
three water molecules that directly
bind the metal cofactor. This
arrangement most strongly resem-
bles HpaI, where the magnesium
ion is bound directly by the acidic
residues Glu-149 and Asp-175,
whereas Glu-44 is an indirect ligand
(
Fig. 3B) (33). Coordinating this
FIGURE3. StructuralconvergenceintheactivesitesofthreenonhomologousClassIIpyruvatealdolases.
A, HMG/CHA aldolase. B, HpaI (Protein Data Bank code 2V5K). C, DmpG (Protein Data Bank code 1NVM). All
metal ion via the C1-carboxyl and
three structures are presented from the same perspective, taking the metal ion and pyruvate analog as refer- C2-carbonyl groups is
a well
ence. The residues are labeled. For HpaI, the condensing aldehyde will approach from the distal side of the
pyruvate, forDmpGandCHA/HMGaldolasefromtheproximalside. NotethatArg-123–Glu-36Јpairhasadirect
ordered pyruvate molecule with
analog in both HpaI (Arg-70 to Asp-42) and DmpG (Arg-17 to Glu-48), although the nitrogen atom used to similar arrangements observed in
hydrogen bond to the keto oxygen is different in each case. HpaI, like HMG/CHA aldolase, uses a magnesium
ion coordinated by acidic groups. The similarities with HpaI extend to the ␣H region, which acts similarly to ␣D
in HMG/CHA aldolase, providing a pair of hydrogen bonds to the oxamate carboxylate group, as well as a metal
ligand (here Asp-175). The peptide bond of Gly-172 to Pro-173 acts similarly to the Phe-100 to Gly-101 peptide
bond in HMG/CHA aldolase, packing against the side of pyruvate, albeit against the opposite face. The corre-
spondence with DmpG, which uses a manganese ion, is less apparent. The oxalate carboxylate is coordinated
by Ser-171 OH instead of using backbone atoms, and Phe-139 packs against the oxalate rather than the
backbone immediately N-terminal to the ␣-helix.
other pyruvate aldolases containing
bound pyruvate analogs (32, 33).
We have shown here that HMG/
CHA aldolase catalyzes two reac-
tions: pyruvate C3-proton exchange
and oxaloacetate decarboxylation,
in addition to HMG and CHA cleav-
directed mutagenesis. The R123A mutant proved unable to cat- age. All of these reactions require the formation of a pyruvate
alyze pyruvate C3-proton exchange, OAA decarboxylation, and enolate intermediate. Both HpaI and BphI (56% sequence iden-
the HMG or CHA aldol cleavage reactions. The R123K variant, tity to DmpG) also exhibit pyruvate C3-proton exchange and
on the other hand, retains some HMG aldol cleavage activity secondary decarboxylase activity (8, 40), supporting the exist-
Ϫ1
(
K
value of 5.5 Ϯ 0.4 mM, k value of 0.099 Ϯ 0.001 s ), ence of a common pyruvate enolate intermediate in all three
m
cat
although its catalytic efficiency (k /K ) toward HMG is aldolases (5, 7). The presence of this intermediate in these reac-
cat
m
decreased by 4000-fold. This is mainly due to a 200-fold tions is further supported by oxalate, a pyruvate enolate analog,
decrease in k . Pyruvate proton exchange rate was also being a strong competitive inhibitor.
cat
Ϫ1
reduced by ϳ200-fold in the R123K variant (0.015 Ϯ 0.003 s ).
In addition to the pyruvate coordinating metal ion (which
characterizes all Class II aldolases), Arg-123 appears to be a
functionally critical group. In the pyruvate complex structure it
DISCUSSION
Bacterial aromatic meta-cleavage pathways follow a general forms a strong hydrogen bond with the pyruvate keto group,
schema wherein a series of steps following aromatic ring cleav- and the 200-fold reduction in the ␣-proton exchange rate in the
age culminates in the formation of a 4-hydroxy-2-ketoacid; this R123K mutant argues that precise positioning of this hydrogen
molecule is then cleaved by an aldolase into pyruvate and an bond is critical for stabilizing the enolate intermediate. Model-
aldehyde or ketoacid that is suitable for entry into central ing of the full substrate suggests that this residue also hydrogen
metabolism. The HMG/CHA pyruvate aldolase, in particular, bonds to the C4-OH group (Fig. 2E). In the C4-OH deprotona-
catalyzes the last step of protocatechuate 4,5-cleavage pathway. tion step, Arg-123 is therefore predicted to stabilize the nega-
Ϫ
The enzyme adopts a four-layered ␣-␤-␤-␣ sandwich structure tive charge that develops on the C4-O , thus promoting proton
with the active site in the interface of two adjacent subunits of abstraction.
the hexamer; this fold has not been previously reported for an
Both the k /K and k data indicate a single deprotonation
cat
m
cat
aldolase. Two other Class II pyruvate aldolases (HpaI and event with pK values of 8.0 Ϯ 0.1 and 7.0 Ϯ 0.1 for free enzyme
a
DmpG) in aromatic meta-cleavage pathway (32, 33), along with and enzyme substrate complex, respectively. These pK values
a
fructose 1,6-bisphosphate aldolases (34), dihydropteroate syn- are consistent with a base catalyzed deprotonation of the
thetases (35), and 3-deoxy-D-manno-octulosonate 8-phos- C4-OH of the substrate leading to the aldol cleavage reaction.
phate synthase (36) all adopt TIM barrel folds. In addition, The base in this proton abstraction is almost certainly the
three-layered ␣-␤-␣ sandwich structures are reported for metal-bound water, Wat-1 (Fig. 4A). This group is well posi-
L-fuculose-1-phosphate aldolase (37) and rhamnulose-1-phos- tioned to hydrogen bond with C4-OH (2.9 Å), while also inter-
phate aldolase (38).
acting with the magnesium ion (which can act as a Lewis acid,
In canonical Class II aldolases, the mechanism proceeds via stabilizing the hydroxyl ion) and Glu-199Ј (which could possi-
the base-catalyzed abstraction of a proton from the hydroxyl bly act in concert with Wat-1 in a proton relay). During the
group at the C4 position, cleavage of the carbon-carbon bond, subsequent cleavage of the C3–C4 bond, and the concomitant
and formation of an enolate intermediate stabilized by a diva- formation of the enolate intermediate, the hydrogen bond
lent metal ion (39). Protonation of this intermediate forms between Arg-123 and the C2 keto oxygen would stabilize the
pyruvate, completing the reaction. The magnesium ion in the development of a negative charge on this atom (Fig. 4B). This
HMG/CHA aldolase structure is coordinated directly by Asp- critical dual role for Arg-123 is supported by the finding that
NOVEMBER 19, 2010•VOLUME 285•NUMBER 47
JOURNAL OF BIOLOGICAL CHEMISTRY 36613

Structure and Kinetic Characterization of HMG/CHA Aldolase
tal, pyruvate-bound structure rep-
resents the product of this reaction,
and Wat-4 (which forms a 2.8 Å
hydrogen bond with the methyl
hydrogen) is the only observed
nearby group capable of proton
donation (Fig. 2D). Although this
water is likely a relatively poor acid
(
there are no nearby charged resi-
dues to stabilize a hydroxide or
hydronium ion), the relatively slow
nature of this step means that it
should still suffice to explain the
observed catalytic rate.
Despite the acidic metal ion-
binding pocket, the presence of the
magnesium ion and multiple cati-
onic residues (Arg-40, Arg-123,
Arg-195, Arg-203, Lys-147, and
Lys-202) result in the active site
being generally electropositive. This
likely contributes to the specificity
of the enzyme toward substrates
with 4-carboxylate substitutions,
such as HMG and CHA. Additional
interactions of the substrate with
conserved residues including Thr-
1
45, Asn-71, and Lys-147 are prob-
ably important for the C4–C6
moiety of CHA binding and cor-
rectly positioning the substrate.
FIGURE 4. Proposed catalytic mechanism of HMG/CHA aldolase. A, the catalytic cycle starts with substrate
binding. A deprotonated metal bound water (Wat-1) abstracts a proton from C4-OH of the substrate. B, C–C This area may also be a second posi-
bond cleavage occurs, pyruvate enolate is formed, and one keto acid product is released. C, Wat-4 binds and
donates a proton to pyruvate enolate. D, pyruvate is formed and can then exchange with a substrate molecule
to initiate the next catalytic cycle.
tion for nonproductive OAA bind-
ing, accounting for the substrate
inhibition kinetics for OAA decar-
replacement with Lys results in an enzyme with greatly reduced boxylation activity (Table 3). In general, substrate recognition
activity (indicating that both H-bond-donating groups are does not appear to involve tight interactions, resulting in the
likely needed), whereas replacement with Ala results in a pro- relative broad substrate specificity of the enzyme.
tein that is wholly inactive. The disruption of the pyruvate C3
The structural and mechanistic insight afforded by this study
deuterium exchange and the OAA decarboxylation reactions in also sheds light on several related proteins whose functions are
addition to HMG cleavage supports the idea that Arg-123 is poorly understood. For example, the structure of YER010c,
especially important for stabilizing the enolate anion. Intrigu- from S. cerevisiae was reported, but whereas the hypothesis of it
ingly, in the active sites of both HpaI and DmpG, an arginine being a methyltransferase was discounted (11), a more plausible
residue is positioned to present a pair of guanylate nitrogen function has not been demonstrated. Even more closely related
atoms in nearly identical (relative to pyruvate) positions (Fig. 3). is PSPTO_3204 (Protein Data Bank code 3K4I) from P. syringae
In HpaI, replacement of Arg-70 with an alanine residue also pv. tomato DC3000, which was recently deposited at the Pro-
abolishes aldolase activity. Together, these common features in tein Data Bank but without an ascribed function. Most of the
HMG/CHA, HpaI, and DmpG aldolases point toward the con- key catalytic machinery identified in HMG/CHA aldolase,
vergent evolution of a common catalytic mechanism. Other including the metal ligands Asp-102 (although not in
enzymes that also proceed through a metal ion-assisted 2-keto- YER010c), Asp-124, and Glu-199Ј, the keto binding Arg-123
acid enolization reaction step, such as oxaloacetate decarboxy- along with Glu-36, as well as the residues contributed by ␣D,
lase (PA4872) (41) and 5,10-methylenetetrahydrofolate:3- have direct correlates in YER010c and PSPTO_3204 (Fig. 2G
methyl-2-oxobutanoate hydroxymethyl transferase (42), also and supplemental Fig. S5). Interestingly, a magnesium ion in
have arginine residues (Arg-159 for PA4872 and Arg-228 for the PSPTO_3204 structure is ligated directly to Asp-102 and
KPHMT from M. tuberculosis) interacting with the equivalent Glu-200 and indirectly to Asp-124. This position is shifted ϳ3
substrate keto group in their active sites.
Å relative to HMG/CHA aldolase and appears incompatible
The final step of the cleavage reaction is protonation of the with productive pyruvate binding. In both of these enzymes, a
pyruvate enolate, forming pyruvate (Fig. 4C). The experimen- deep binding pocket is present, but loop rearrangements and
3
6614 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 47•NOVEMBER 19, 2010

Structure and Kinetic Characterization of HMG/CHA Aldolase
residue replacements result in the binding sites being quite dif- 11. Leulliot, N., Quevillon-Cheruel, S., Graille, M., Schiltz, M., Blondeau, K.,
Janin, J., and Van Tilbeurgh, H. (2005) Protein Sci. 14, 2751–2758
ferent, suggesting the recognition of quite different substrates.
1
2. Clap e´ s, P., Fessner, W. D., Sprenger, G. A., and Samland, A. K. (2010) Curr.
Opin. Chem. Biol. 14, 154–167
Nevertheless, the strong conservation of the magnesium and
pyruvate-binding sites in these two proteins argues that they
too are highly likely to be aldolases.
1
3. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,
New York
The similarity between HMG/CHA aldolase and RraA is less
strong. RraA from E. coli is proposed to bind the C-terminal 14. Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Sci. U.S.A. 82,
1
074–1078
domain of RNase E, blocking binding of accessory proteins
involved in the RNA degradosome function (43, 44). RraA is
also trimeric but, relative to HMG/CHA aldolase, lacks several
motifs (supplemental Fig. S5), including the ␣F helix that con-
tributes the metal ligand Glu-199Ј. The equivalent of Arg-123 is
conserved across all RraA homologs, whereas Asp-102 and
1
1
1
5. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254
6. Otwinowski, Z., and Minor, W. (1997) Methods Enzymol. 276, 307–326
7. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Sto-
roni, L. C., and Read, R. J. (2007) J. Appl. Crystallogr. 40, 658–674
8. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Acta Crys-
tallogr. D Biol. Crystallogr. 66, 486–501
1
Asp-124 are also largely conserved, although one or both are 19. Collaborative Computational Project (1994) Acta Crystallogr. D Biol.
Crystallogr. 50, 760–763
missing in some homologs, including E. coli and T. thermophi-
2
0. Winn, M. D., Isupov, M. N., and Murshudov, G. N. (2001) Acta Crystal-
logr. D Biol. Crystallogr. 57, 122–133
lus. Interestingly, the proposed substrate-binding residues
Asn-71 and Lys-147 are conserved, despite RraA being rela-
tively distantly related to HMG/CHA aldolase. The pyruvate-
2
1. Delano, W. L. (2002) The PyMOL Molecular Graphics System, DeLano
Scientific, San Carlos, CA
binding site is occupied by small anions in several of these 22. Helaine, V., Rossi, J., Gefflaut, T., Alaux, S., and Bolte, J. (2001) Adv. Synth.
structures, including tartaric acid (Protein Data Bank code
Catalysis 343, 692–697
2
2
3. Wang, W., Baker, P., and Seah, S. Y. (2010) Biochemistry 49, 3774–3782
4. Chell, R. M., Sundaram, T. K., and Wilkinson, A. E. (1978) Biochem. J. 173,
1
NXJ) and acetate (Protein Data Bank code 2PCN). RraA is
present in organisms such as T. thermophilus (28) where RNase
E is absent, suggesting that the inhibitory function of RraA may
have been secondarily acquired, and some homologs may have
a catalytic function in addition to, or instead of, the RNase E
1
65–177
2
5. Cornish-Bowden, A. (1995) Analysis of Enzyme Kinetic Data, Oxford Uni-
versity Press, New York
2
6. Krissinel, E., and Henrick, K. (2007) J. Mol. Biol. 372, 774–797
inhibitory function. The similarities with the active site of 27. Johnston, J. M., Arcus, V. L., Morton, C. J., Parker, M. W., and Baker, E. N.
(
2003) J. Bacteriol. 185, 4057–4065
HMG/CHA aldolase suggests that the RraA family is derived
from a common ancestor with class II aldolase activity, and at
least some homologs seem likely to have retained this activity.
In addition, HMG/CHA aldolase is also distantly related to the
His domain of Enzyme I and phosphohistidine domain of PPDK
in terms of the three-dimensional structure. Intriguingly, the
histidine residues responsible for phosphate transfer (His-189
for enzyme I and His-455 for PPDK) were replaced by arginine
2
2
3
8. Rehse, P. H., Kuroishi, C., and Tahirov, T. H. (2004) Acta Crystallogr. D
Biol. Crystallogr. 60, 1997–2002
9. Liao, D. I., Silverton, E., Seok, Y. J., Lee, B. R., Peterkofsky, A., and Davies,
D. R. (1996) Structure 4, 861–872
0. Teplyakov, A., Lim, K., Zhu, P. P., Kapadia, G., Chen, C. C., Schwartz, J.,
Howard, A., Reddy, P. T., Peterkofsky, A., and Herzberg, O. (2006) Proc.
Natl. Acad. Sci. U.S.A. 103, 16218–16223
3
3
1. Herzberg, O., Chen, C. C., Kapadia, G., McGuire, M., Carroll, L. J., Noh,
S. J., and Dunaway-Mariano, D. (1996) Proc. Natl. Acad. Sci. U.S.A. 93,
(
Arg-123) in HMG/CHA aldolase, which is essential for catal-
2
652–2657
ysis. Future work on these proteins may provide deeper insights
into how these divergent functions evolved from a common
ancestor.
2. Manjasetty, B. A., Powlowski, J., and Vrielink, A. (2003) Proc. Natl. Acad.
Sci. U.S.A. 100, 6992–6997
33. Rea, D., F u¨ l o¨ p, V., Bugg, T. D., and Roper, D. I. (2007) J. Mol. Biol. 373,
8
66–876
Acknowledgment—We thank Pawel Grochulski for collecting the 34. Blom, N. S., T e´ treault, S., Coulombe, R., and Sygusch, J. (1996) Nat. Struct.
HMG/CHA aldolase dataset at the Canadian Macromolecular Crys-
tallography Facility.
Biol. 3, 856–862
3
5. Hampele, I. C., D’Arcy, A., Dale, G. E., Kostrewa, D., Nielsen, J., Oefner, C.,
Page, M. G., Sch o¨ nfeld, H. J., St u¨ ber, D., and Then, R. L. (1997) J. Mol. Biol.
2
68, 21–30
REFERENCES
36. Radaev, S., Dastidar, P., Patel, M., Woodard, R. W., and Gatti, D. L. (2000)
J. Biol. Chem. 275, 9476–9484
1
2
3
. Masai, E., Katayama, Y., and Fukuda, M. (2007) Biosci. Biotechnol. Bio-
3
3
7. Dreyer, M. K., and Schulz, G. E. (1993) J. Mol. Biol. 231, 549–553
chem. 71, 1–15
8. Kroemer, M., Merkel, I., and Schulz, G. E. (2003) Biochemistry 42,
. Seo, J. S., Keum, Y. S., and Li, Q. X. (2009) Int. J. Environ. Res. Public Health
1
0560–10568
6, 278–309
3
9. Horecker, B. L., Tsolas, O., and Lai, C. Y. (1972) in The Enzymes (Boyer,
. Keyser, P., Pujar, B. G., Eaton, R. W., and Ribbons, D. W. (1976) Environ.
Health Perspect. 18, 159–166
P. D., ed) 3rd Ed., Vol. 7, pp. 213–258, Academic Press, New York
4
5
. Dennis, D. A., Chapman, P. J., and Dagley, S. (1973) J. Bacteriol. 113, 521–523 40. Baker, P., Pan, D., Carere, J., Rossi, A., Wang, W., and Seah, S. Y. (2009)
. Tack, B. F., Chapman, P. J., and Dagley, S. (1972) J. Biol. Chem. 247,
444–6449
. Maruyama, K. (1990) J. Biochem. 108, 327–333
Biochemistry 48, 6551–6558
6
41. Narayanan, B. C., Niu, W., Han, Y., Zou, J., Mariano, P. S., Dunaway-
Mariano, D., and Herzberg, O. (2008) Biochemistry 47, 167–182
6
7
. Maruyama, K., Miwa, M., Tsujii, N., Nagai, T., Tomita, N., Harada, T., Soba- 42. Chaudhuri, B. N., Sawaya, M. R., Kim, C. Y., Waldo, G. S., Park, M. S.,
jima, H., and Sugisaki, H. (2001) Biosci. Biotechnol. Biochem. 65, 2701–2709
. Wang, W., and Seah, S. Y. (2005) Biochemistry 44, 9447–9455
Terwilliger, T. C., and Yeates, T. O. (2003) Structure 11, 753–764
43. G o´ rna, M. W., Pietras, Z., Tsai, Y. C., Callaghan, A. J., Hern a´ ndez, H.,
Robinson, C. V., and Luisi, B. F. (2010) RNA 16, 553–562
8
9
. Powlowski, J., Sahlman, L., and Shingler, V. (1993) J. Bacteriol. 175, 377–385
1
0. Monzingo, A. F., Gao, J., Qiu, J., Georgiou, G., and Robertus, J. D. (2003) J. 44. Lee, K., Zhan, X., Gao, J., Qiu, J., Feng, Y., Meganathan, R., Cohen, S. N.,
Mol. Biol. 332, 1015–1024
and Georgiou, G. (2003) Cell 114, 623–634
NOVEMBER 19, 2010•VOLUME 285•NUMBER 47
JOURNAL OF BIOLOGICAL CHEMISTRY 36615