Biochemical and functional characterization of anthocyanidin reductase (ANR) from Mangifera indica L.

Article abstract of DOI:10.3390/molecules23112876

Mango (Mangifera indica L.) is abundant in proanthocyanidins (PAs) that are important for human health and plant response to abiotic stresses. However, the molecular mechanisms involved in PA biosynthesis still need to be elucidated. Anthocyanidin reductase (ANR) catalyzes a key step in PA biosynthesis. In this study, three ANR cDNAs (MiANR1-1,1-2,1-3) were isolated from mango, and expressed in Escherichia coli. In vitro enzyme assay showed MiANR proteins convert cyanidin to their corresponding flavan-3-ols, such as (—)-catechin and (—)-epicatechin. Despite high amino acid similarity, the recombinant ANR proteins exhibited differences in enzyme kinetics and cosubstrate preference. MiANR1-2 and MiANR1-3 have the same optimum pH of 4.0 in citrate buffer, while the optimum pH for MiANR1-1 is pH 3.0 in phosphate buffer. MiANR1-1 does not use either NADPH or NADH as co-substrate while MiANR1-2/1-3 use only NADPH as co-substrate. MiANR1-2 has the highest Km and Vmax for cyanidin, followed by MiANR1-3 and MiANR1-1. The overexpression of MiANRs in ban mutant reconstructed the biosynthetic pathway of PAs in the seed coat. These data demonstrate MiANRs can form the ANR pathway, leading to the formation of two types of isomeric flavan-3-ols and PAs in mango.

Full text of DOI:10.3390/molecules23112876

molecules
Article
Biochemical and Functional Characterization
of Anthocyanidin Reductase (ANR) from
Mangifera indica L.
Lin Tan 1,
*
, Mei Wang 2 , Youfa Kang 3, Farrukh Azeem 1,4, Zhaoxi Zhou 1, Decai Tuo 5,
Lina María Preciado Rojo 6, Ikhlas A. Khan 2 and Zhiqiang Pan 7
1
Haikou Experimental Station, Chinese Academy of Tropical Agricultural Sciences (CATAS)—Hainan Key
Laboratory of Banana Genetic Improvement, Haikou 570102, Hainan Province, China;
farrukh@gcuf.edu.pk (F.A.); zhzx81@163.com (Z.Z.)
National Center for Natural Products Research, Thad Cochran Research Center, School of Pharmacy,
2
University of Mississippi, University, MS 38677, USA; meiwang@olemiss.edu (M.W.);
ikhan@olemiss.edu (I.A.K.)
Department of Basic Education in Liberal Arts, Hainan University, Haikou 571101, Hainan Province, China;
3
kangyoufa@126.com
Department of Bioinformatics and Biotechnology, Government College University,
4
Faisalabad 38000, Pakistan
Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural
5
Sciences (CATAS), Haikou 571101, Hainan Province, China; tuodecai123@163.com
Programa Ofidismo-Escorpionismo, Facultad de Ciencias Farmacéuticas y Alimentarias,
6
Universidad de Antioquia, Medellín 1226, Colombia; linampr@gmail.com
United States Department of Agriculture, Agricultural Research Service, Natural Products Utilization
7
Research Unit (USDA-ARS-NPURU), P.O. Box 1848, University, MS 38677-1848, USA;
zhiqiang.pan@ars.usda.gov
*
Correspondence: tanlin7402@126.com; Tel.: +86-156-0764-9988; Fax: +86-898-6670-5612
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 30 September 2018; Accepted: 30 October 2018; Published: 5 November 2018
Abstract: Mango (Mangifera indica L.) is abundant in proanthocyanidins (PAs) that are important for
human health and plant response to abiotic stresses. However, the molecular mechanisms involved
in PA biosynthesis still need to be elucidated. Anthocyanidin reductase (ANR) catalyzes a key step
in PA biosynthesis. In this study, three ANR cDNAs (MiANR1-1,1-2,1-3) were isolated from mango,
and expressed in Escherichia coli. In vitro enzyme assay showed MiANR proteins convert cyanidin to
their corresponding flavan-3-ols, such as (
−
)-catechin and ( )-epicatechin. Despite high amino acid
−
similarity, the recombinant ANR proteins exhibited differences in enzyme kinetics and cosubstrate
preference. MiANR1-2 and MiANR1-3 have the same optimum pH of 4.0 in citrate buffer, while the
optimum pH for MiANR1-1 is pH 3.0 in phosphate buffer. MiANR1-1 does not use either NADPH or
NADH as co-substrate while MiANR1-2/1-3 use only NADPH as co-substrate. MiANR1-2 has the
highest Km and Vmax for cyanidin, followed by MiANR1-3 and MiANR1-1. The overexpression of
MiANRs in ban mutant reconstructed the biosynthetic pathway of PAs in the seed coat. These data
demonstrate MiANRs can form the ANR pathway, leading to the formation of two types of isomeric
flavan-3-ols and PAs in mango.
Keywords: anthocyanidin reductase; (
indica L.
−
)-epicatechin; (
−
)-catechin; proanthocyanidins; Mangifera
Molecules 2018, 23, 2876; doi:10.3390/molecules23112876
www.mdpi.com/journal/molecules

Molecules 2018, 23, 2876
2 of 20
1. Introduction
Proanthocyanidins or PAs (also known as condensed tannin) belong to a subclass of plant
metabolites called flavonoids. When incorporated into the diet, PAs can improve human health
via their anticancer, anti-oxidant, cardiovascular protection and immunomodulatory effects [
These metabolites are widely distributed in stems, flowers, roots, tea-leaves, seed coats and fruits [
PAs play an important role in plant response to biotic/abiotic stresses like herbivore damage, fungal
infection, mechanical wounding and ultraviolet irradiation [15 16]. Moreover, PAs can also affect
plant traits of commercial interest, including skin color [17 18]. Therefore, it seems plausible to design
1–
7].
8–
14].
,
,
strategies for increasing the levels of PAs in the fruits and vegetables of daily use.
The biosynthetic pathways leading to the formation of the monomeric units of PAs or
falvan-3-ols (catechin and epicatechin) have been well studied in model plant species like maize [19
]
and Arabidopsis [20]. Flavan-3-ol monomers are synthesized via two distinct branches of the
general flavonoid pathway, which share the same upstream biosynthetic pathway to leucocyanidin.
The downstream pathway to PAs involves leucoanthocyanidin reductase (LAR) converting
leucocyanidin into (+)-flavan-3-ols such as (+)-catechin [21] and anthocyanidin reductase (ANR),
encoded by the BANYLUS gene in Arabidopsis [22], converting cyanidin into (
such as (−)-epicatechin (Figure 1).
−
)-(epi)-flavan-3-ols,
Figure 1. Scheme of the proanthocyanidin synthesis pathway.
The genes encoding ANR and LAR enzymes have been cloned and characterized in plants
including poplar [23], buckwheat [10], lotus [24] and fruits such as grapevine [25], strawberry [26],
persimmon [27] and apple [28]. The expression pattern of both genes is highly correlated with PA
accumulation [26–30]. In apple, the transcript levels of LAR1 and ANR2 genes were significantly
correlated with the contents of catechin and epicatechin [14]. In grape, during flowering, at the initial
stage of berry growth and during colour-change in skins, the expression of LAR and ANR genes
coincide with total tannin, catechin and epicatechin concentrations. It indicates potential involvement
of ANR and LAR in PA synthesis [31].

Molecules 2018, 23, 2876
3 of 20
Mango (Mangifera indica L.) is considered among the five most important fruit commodities
traded worldwide, along with bananas, apples, grapes and oranges. It is very popular due
to its excellent eating quality (bright color, sweet taste, luscious flavor), nutritional composition
(vitamin, minerals) [32], fiber [33,34], and other phytochemical compounds including terpenoid [35],
mangiferin [36] and flavonoids [37]. PAs (catechin and epicatechin) are one of important flavnoids in
mango [34], and are major contributors to the total antioxidant capacity in mango fruit [38], which
confer beneficial effect on human health. Besides, the antioxidant and antifungal properties of mango
peel were associated with high levels of proanthocyanidins [39]. Therefore, it is very important to
investigate the PA biosynthesis pathway in mango to improve its fruit quality.
The molecular mechanism underlying anthocyanin accumulation has recently been extensively
studied in many fruits [40–43]. There are some studies which also reported the cloning of UFGT [44],
F30H [45] and DFR [46] genes related to anthocyanin synthesis from mango and their expression in
red and green mango [47]. A mango fruit peel transcriptome in response to hot water treatment, also
revealed anthocyanin biosynthesis-related genes [48]. However, there is little information available for
genetic basis of PA biosynthesis pathway genes in mango.
In this report, we isolated three homolog cDNA sequences encoding ANR from mango. After
the recombinant expression of these cDNAs in E. coli BL21, enzymatic activity was assayed in vitro
Moreover, enzymatic kinetics were also analyzed and compared. By over-expression in Arabidopsis ban
mutant (ANR deficient) plants, the three ANR cDNAs were studied for potential complementation of
ANR pathway leading to PA synthesis. This is the first report about the biochemical and transgenic
characterization of ANR in mango, which lays a foundation for further investigations of the PA
biosynthesis pathway in mango.
.
2. Results
2.1. Molecular Cloning of ANR Homolog from Hongguifei Mango
In the current study, 16 clones were obtained and sequenced, and after alignment analysis, three
clones (that differed slightly in DNA sequence and amino acid sequence) were identified and named
as MiANR1-1 (1289 bp), MiANR1-2 (1286 bp) and MiANR1-3 (1411 bp). Moreover, sequences were
submitted to NCBI GenBank under the following accession numbers MG322128, MG322129, and
MG322130, respectively. The ORFs encode 335 amino acids with a molecular weight (MW) of 36195 Da
(pI: 5.91), 36339 Da (pI:5.46), 36304 Da (pI: 5.69), respectively.
An amino acid sequence alignment of 17 ANR homologs from 15 various plants was done by using
Constraint-based Multiple Alignment Tool (COBALT, https://www.ncbi.nlm.nih.gov/tools/cobalt/
cobalt.cgi? LINK_LOC=BlastHomeLink) (Figure 2). Results showed 98.81% amino acid sequence
identity between MiANR1-1/1-2, 99.10% between MiANR1-2/1-3 and 97.91% between MiANR1-1
and 1-3. These three sequences exhibit differences at seven different amino acid residues. At three
positions MiANR1-1/1-2 have same AA, while at four positions MiANR1-2/1-3 have identical AAs
(Figure 2). Except for the AtANR sequence from A. thaliana, all the other ANR homologs shared highly
conserved properties. Ser130, Tyr167 and Lys171 constitutes the putative enzymatic activity triad
in all homologs [25,49]. Besides, a high conservation was also found at the glycine-rich Rossmann
dinucleotide (NADPH/NADH)-binding domain (G-G-X-G-X-X-A) in these 17 homologs (Figure 2).
In this domain sequence, GGTGFVA is conserved in all the ANRs from fruits, while it is variable
among gymnosperms, monocotyledons and dicotyledon (Figure 3).

Molecules 2018, 23, 2876
4 of 20
Figure 2. A sequence alignment of MiANR1-1,1-2 and 1-3 with ANR homologs from plants generated
using Constraint-based Multiple Alignment Tool. Mangifera represents mango Iwin, indicates the
same amino acid in all 17 sequences. shows semi-conservative amino acid in the 17 sequences. 43, 46,
110, 169, 184, 280, 306 indicates amino acid difference among MiANR1-1, 1-2 and 1-3.
*
.

Molecules 2018, 23, 2876
5 of 20
A phylogenetic analysis was conducted by amino acid sequences of ANR homologs from
gymnosperms, monocotyledons and dicotyledons (Figure 3). The phylogenetic analysis showed
that plant ANRs could be grouped into two main clades. One clade included the dicotyledon group,
and the other included the gymnosperm group and the monocotyledon group, which suggested that
monocotyledon ANRs were evolutionarily closer to gymnosperm ANRs than to dicotyledon ANRs.
Among the three MiANRS, MiANR1-2 and MiANR1-3 fell into the same clade, indicating MiANR1-2
is evolutionarily closer to MiANR1-3 than MiANR1-1.
Figure 3. An unrooted phylogenetic tree with amino acid sequences of ANR homologs.
Protein Alignment was performed by using ClustalW. The phylogenetic tree was constructed
using neighbor-joining method with 1000 bootstrap iterations in Mega VII. GbANR (Q5XLY0.1,
Ginkgo biloba); PsANR (ABR18365.1, Picea sitchensis); ZmANR (PWZ46070.1, Zea mays); OsANR
(XP_015637099.1, Oryza sativa); HvANR (BAJ96327.1, Hordeum vulgare); TuANR (EMS66907.1,
Triticum Urartu); BdANR (XP_003580614.1, Brachypodium distachyon); VbANR (AFG28175.1,
Vitis bellula); PeANR (XP_011003389.1, Populus euphratica); GhANR (ABM64802.1, Gossypium hirsutum);
PcANR (AKV89239.1, Prunus cerasifera); GaANR (NP_001316937.1, Gossypium arboretum); TcANR
(ADD51354.1, Theobroma cacao); MdANR (AEL79860.1, Malus domestica); HbANR (XP_021671256.1,
Hevea brasiliensis); PnANR (ART94427.1, Populus nigra); VvANR (NP_001267885.1, Vitis vinifera);
CsANR (ADF43751.1, Camellia sinensis); PcoANR (AGL81352.1, Pyrus communis); MrANR (AIX02996.1,
Morella rubra); VaANR (BAM42668.1, Vaccinium ashei); DkANR (BAF56654.1, Diospyros kaki); MaANR
(ANR02605.1, Morus alba var. multicaulis); FaANR (ABG76842.1, Fragaria x ananassa); FtANR
(AHA14497.1, Fagopyrum tataricum); RiANR (AMP19723.1, Rubus idaeus); MiANR (Mangifera indica);
AtANR (Q9SEV0.2, Arabidopsis thaliana); GmANR1 (NP_001241913.2, Glycine max); GmANR2
(NP_001243072.1, Glycine max); MtANR (XP_013457149.1, Medicago truncatula).
2.2. Functional Expression in E. coli and In Vitro Biochemical Characterization
The ORFs of ANR cDNAs were cloned into pET28b vector and the recombinant E. coli Bl21
clones were treated with ITTG (50 µ
M) at 30 ◦C, resulting in high production of soluble recombinant

Molecules 2018, 23, 2876
6 of 20
protein. With a 6-His tag fusion to the C-terminal, the recombinant proteins were purified on Ni-NTA
resin column from the Lysate. The size of recombinant MiANR1-1, MiANR1-2 and MiANR1-3 were
identified as approximately 37 kD by using SDS-PAGE (Figure 4a,b). This expression system allowed
for the production of 10–15 mg ANR protein per liter of culture.
Figure 4. Cont.

Molecules 2018, 23, 2876
7 of 20
Figure 4. Recombinant expression of three MiANRs and their catalytic activity analysis. (a) SDS–PAGE
(12%) gel electrophoresis of recombinant MiANR1-1 and MiANR1-2 proteins stained with Commassie
brilliant blue G250. lane1: prestained protein mass markers (New England Biolabs), lane 2: 10 µg crude
extract from E. coli BL21 harboring pET28b, lane 3:10
pET28bMiANR1-1, lane 4:10 g crude extract from induced E. coli BL21 harboring pET28bMiANR1-1,
lane 5:10 g purified MiANR1-1, lane 6:10 g crude extract from uninduced E. coli BL21 harboring
pET28bMiANR1-2, lane 7:10 g crude extract from induced E. coli BL21 harboring pET28bMiANR1-2,
lane 7: 20 µg purified MiANR1-2; (b) lane 1: prestained protein mass markers(New England Biolabs);
lane 2: 10 g crude extract from E. coli BL21 harboring pET28b, lane 3:10 g crude extract from
uninduced BL21 harboring pET28bMiANR1-3, lane 4: 10 g crude extract from induced E. coli BL21
harboring pET28b MiANR1-3, lane 5:10 g purified MiANR1-3; ( ) UPLC-MS profiles show authentic
standard of catechin, epcatechin, gallocatecin, epigallocatechin; ( ) UPLC-MS profiles show epicatechin
and catechin formed from the incubation of MiANR1-1 and cyaniding (d-1) but not from that of
denatured MiANR1-1 (control) and cyanidin (d-2); ( ) UPLC-MS profiles show epicatechin and catechin
formed from the incubation of MiANR1-2 and cyanidin (e-1) but not from that of denatured MiANR1-2
(control) and cyanidin (e-2); ( ) UPLC-MS profiles show epicatechin and catechin formed from the
incubation of MiANR1-3 and cyaniding (f-1) but not from that of denatured MiANR1-3 (control) and
cyanidin (f-2); ( ) UPLC-MS profiles shows nothing formed from the incubation of MiANR1-1 with
µg crude extract from uninduced BL21 harboring
µ
µ
µ
µ
µ
µ
µ
µ
c
d
e
f
g
delphinidin (g-1) and boiled MiANR1-1 with delphinidin (g-2). Data is not shown for MiANR1-2 and
MiANR1-3; h UPLC-MS profiles show a peak formed from the incubation of MiANR1-2 or MiANR1-3
and perlargonidin (h-1) but not from that of denatured MiANR1-2 (control) with perlargonidin(h-2),
however, it was not (
(−)-epi- afzelechin or (−)-afzelechin.
−
)-epi- afzelechin or ( )-afzelechin, as its MW is not the same as the MW of
−
To determine the enzymatic catalysis of MiANRs, three substrates (cyanidin, delphinidin and
pelargonidin) were studied in the presence of either NADPH or NADH. All the three MiANR enzymes
converted cyanidin into catechin and epicatechin with NADPH as coenzyme (Figure 4c–f). However,
MiANRs were unable to use delphinidin and perlargonidin as a substrate (Figure 4g,h). In a reaction
with NADH as coenzyme, MiANR1-2 and MiANR1-3 converted cyanidin into catechin and epicatechin
(Figure S1b), while ANR1-2 converted cyanidin only into epicatechin (Figure S1c). All of them did not
employ delphinidin and perlargonidin as substrate. In the control experiments with boiled enzyme for
the reaction, no flavan-3-ols were produced from these three substrates.

Molecules 2018, 23, 2876
8 of 20
2.3. Effects of Temperature, pH, and NaCl on ANR Activities
Based on the UHPLC results, a standard curve and corresponding equation (Figure S2) were
established to calculate the production of enzymatic products for optimizing of pH and temperature
values and characterization of kinetics.
All these three enzymes exhibit their utmost efficiency in converting cyanidin to its corresponding
◦
flavan-3-ols at 30 C (Figure S3). Variations were observed in pH dependence. All these three enzymes
showed maximum activity at acidic pH. Both MiANR1-2 and 1-3 displayed the highest catalytic activity
in citrate buffer at pH 4.0 but ANR1-1 gave the highest catalytic activity in phosphate buffer at pH
3.0 (Figure 5a–c). High sodium concentrations used in the buffers reportedly inhibited VbANR and
MtANR [25,50]. NaCl (concentration ranging from 0–600 mM) did not cause any inhibition effect on
the activity of MiANR1-1, 1-2 and 1-3, which is consistent with NaCl effect on the AtANR [51].
Figure 5. Effects of pH values on MiANR1-1, 1-2 and 1-3 activity. (
tested by using Tris–HCl buffer, MES buffer, phosphate buffer and citrate buffer. (
MiANR 1-2 activity tested by using Tris–HCl buffer, MES buffer, phosphate buffer and citrate buffer.
) pH effect on MiANR1-3 activity tested by using Tris–HCl buffer, MES buffer, phosphate buffer
a) pH effect on MiANR 1-1 activity
b) pH effect on
(
c
and citrate buffer. The total production includes all enzymatic products composed of epicatechin
and catechin.
2.4. Kinetics of MiANRs with Coenzymes, Anthocyanidins and Perlargonidins
The production of enzymatic products exhibited a hyperbolic curve growth from 0 to 20 min
but no significant increase at 30, 40 and 50 min. Hence, the 20 min was chosen as reaction time to
investigate kinetics to coenzyme and substrates.
Significant variations were found among MiANR1-1, 1-2 and 1-3 for co-substrate requirements.
All the three enzymes did not use NADH as co-substrate. MiANR1-2 and 1-3 used NADPH as
co-substrate, while MiANR1-1 did not use NADPH as co-substrate. Plots of the velocity (V) versus
concentrations [NADPH] for MiANR1-2 and MiANR1-3 showed similar trend. At low concentration
of NADPH (0–1 mM), their progress curves were almost linear (Figure 6a). From 1.25 to 3.75 mM,

Molecules 2018, 23, 2876
9 of 20
the velocity mildly decreased, indicating substrate inhibition. Double reciprocal plot of 1/V versus
1/NADPH for ANR1-2 and 1-3 were established by using initial velocity values to estimate Km
and Vmax (Figure 6b). Results showed that MiANR1-2 has lower Km for NADPH (Table 1) than
MiANR1-3 and higher Vmax than MiANR1-3, suggesting MiANR1-2 had a higher affinity to NADPH
than MiANR1-3.
Table 1. Kinetic properties of Mi ANR1-1, 1-2and 1-3.
Substrates
Cyanidin
Cofactors
NADPH
Enzyme
Vmax (nmol/min mg)
Km (µM)
9.11 ± 0.15
48.32 ± 3.45
958
NR
-
-
-
MiANR1-1
MiANR1-2
MiANR1-3
−1
Kcat (min
Kcat/Km (M
)
S
−1 −1
)
3.3 × 105
Vmax (nmol/min mg)
24.15 ± 0.92
116.4 ± 4.42
2542
22.68 ± 0.18
Km (µM)
18.14 ± 1.4
−1
-
-
Kcat (min
Kcat/Km (M
)
S
−1 −1
)
3.63 × 105
Vmax (nmol/min mg)
18.42 ± 1.38
80.43 ± 5.85
1938
18.98 ± 0.1
Km (µM)
18.98 ± 1.18
−1
-
-
Kcat (min
Kcat/Km (M
)
S
−1 −1
)
4.01 × 105
NR: No reaction.
Figure 6. Kinetics of MiANR1-2, and 1-3 to NADPH. The initial velocity was expressed with nanomolar
products produced from cyanidin per minute by per milligram of MiANR1-2/1-3 at varying NADPH
concentrations. A plot of initial velocity versus [NADPH] for MiANR1-2/1-3 (a) and a double-reciprocal
plot of 1/V versus 1/[NADPH]for MiANR1-2/1-3 (b).
Variations were detected among properties of MiANR1-1, 1-2 and 1-3 towards anthocyanidin
substrates. All the MiANRs showed much higher enzyme activity than VbANR [25], AtANR and
MtANR [50]. They also exhibited classic Michaelis-Menten kinetics with cyanidin like VbANR and
MtANR (Figure 7a). The double reciprocal plots indicated MiANR1-2 has the highest Vmax for
cyanidin, followed by ANR1-3 and then ANR 1-1 (Figure 7b). This is consistent with UPLC-MS
profiles showing the epicatechin and catechin formed from the incubation of MiANR1-2, MiANR1-3,
MiANR1-1 and cyanidin.

Molecules 2018, 23, 2876
10 of 20
Figure 7. Kinetics of MiANR1-1, 1-2 and 1-3 with cyanidin. The initial velocity was expressed with
nanomolar products produced from substrates per min by per milligram of ANR in the presence
of NADPH (1 mM). Plots of initial velocity (V) versus cyanidin for MiANR1-1,1-2 and 1-3 ( ) and
). Products of cyanidin were
a
double-reciprocal plots of 1/V versus 1/(cyanidin) for MiANRs (
b
calculated as (−)-epicatechin by using an (−)-epicatechin standard.
2.5. Over-Expression of MiANR1-1, 1-2 and 1-3 in AtANR Mutant (Banyuls) Plants
A. tumefaciens EHA105 containing the pCB408 MiANR1-1, 1-2 or 1-3 was used to transform ANR
mutant Arabidopsis thaliana plants (Figure S4). After transformation by the flower dip method, T0 seeds
were obtained. To obtain T1 plants, plant selection was performed twice against the herbicide barstar
resulting in herbicide resistant T1 plants which were further screened by PCR. PCR positive plants
were transferred to pots to be cultivated. About six weeks later, the immature seeds were collected
from transgenic, control ban and wild-type plants. Seeds were observed under microscope directly
or after staining. Results showed that the immature seeds of wild type plants were lightly greenish.
In contrast, the immature seeds from ban plants were reddish or pinkish due to the accumulation of
anthocyanin in the endothelial layer of the seed coat (Figure 8c). It is because the mutated ANR [51,52]
in the ban plants cannot convert anthocyanidin to proanthocyanidn. Surprisingly, the seeds from
MiANR 1-1,1-2 and 1-3 transgenic plant were also reddish or pinkish (Figure 8e,g,i). Further analysis
by 0.1% DMACA staining indicated a bluish coloration of seed coats of wild type plants as DMACA
can specifically react with proanthocyanidins. The stained seeds from ban plants showed deepened
red color. Some of the stained seeds of MiANR 1-1,1-2 and 1-3 transgenic ban showed bluish coloration,
which suggested anthocyanidins converted into PAs by MiANR 1-1,1-2 and 1-3 (Figure 8f,h,j). Due to
gene segregation, some of the stained seeds of MiANR 1-1,1-2 and 1-3 transgenic ban showed deepened
reddish color like the ban seeds (Figure 8d) which is caused by the intensification effects of the 3 M
HCl used in the DMACA solution. These results demonstrated that the over expression of MiANR1-1,
1-2 or 1-3 can reconstruct the ANR pathway to PAs.

Molecules 2018, 23, 2876
11 of 20
Figure 8. Genetic complementation of MiANR1-1, 1-2 and 1-3 expression in the ban mutant. Phenotypes
of immature wild-type seeds ( ), ban ( ) and MiANR1-1, 1-2 and 1-3 transgenic ban ( ) plants;
), ban ( ), and
a
c
e,g,i
staining with 0.1% DMACA to reveal the phenotypes of immature seeds from wild (
b
d
MiANR1-1, 1-2 and 1-3 transgenic ban (f,h,j) plants, respectively.
3. Discussion
In this study, three cDNA clones encoding anthocyanidin reductase (MiANR1-1, MiANR1-2,
and MiANR1-3) were isolated from Mangifera indica. All the clones were functionally expressed in
E. coli, showing they encode active proteins and providing a way to investigate co-substrate/substrate
specificity of the proteins in vitro. The protein sequence derived from the three clones contained

Molecules 2018, 23, 2876
12 of 20
the conserved Rossmann dinucleotide-binding domain amino-termini (G-G-X-G-X-X-A), which is
responsible for binding nucleotide cofactors [53]. The amino acid of this domain of the three MiANRs
is G-G-T-G-V-A, which is also shared by grape VbANR and legume MtANR. However, the three
ANRs from mango exhibited different NADH/NADPH co-substrate specificity from VbANR and
MtANR i.e., instead of using both NADH and NADPH as co-substrate, MiANRs use only NADPH
as co-substrate. This is probably due to a mutation of Ser 2 to Ala in recombinant MiANRs caused
by introduction of restriction enzyme site (CCATGG) to keep the integrity of open reading frame.
Single amino acid change can alter cofactor binding specificity, for instance, mutation of Gln to
Thr in Rattus norvegicus NADH dependent Cytochorome b5 reductase altered its cofactor specificity
from NADH to NADPH [54]. Similarly, a mutation of Trp677 to Ala in rat NADPH-dependent
cytochrome-P450 makes it into an enzyme with good NADH turn over [55]. However, it cannot be
ruled out that other factors may also contribute to the NADH/NADPH preference like the hydrogen
0
bond formation between the enzyme and 2 - phosphate of NADPH [56]. We used molecular docking to
analyze the interaction between MiANR1-1, 1-2, 1-3 and NADH/NADPH (Figure S5). It was observed
that there were more hydrogen bond formation between MiANR1-2 or MiANR1-3 and NADPH than
their interaction with NADH. In addition, the binding free energy for the complex MiANR1-2 or
MiANR1-3 with NADPH was higher compared to the complex with NADH. Besides, the conformation
of NAD (P) H ligand may also affect the binding [57].
Unlike other ANRs (MtANR, AtANR, VbANR, CsANR, MdANR), which use cyanidin,
perlargonidin and delphinidin as substrate, the MiANRs did not use delphinidin and perlargonidin
as substrate. It indicates that MiANRs have unique substrate specificity. Similarly, dihydroflavonol
4-reductase (DFR) from different organisms exhibited different substrate specificity [58] and DFR
homologs from the same organism (strawberry fruits) also revealed a high variability in substrate
specificity [59]. This is the first report that an ANR has unique substrate specificity.
The three MiANRs also differed from those of individual ANRs from other plants in relative
substrate preferences. For example, in Medicago, ANR shows preference for anthocyanidin substrates
in the order of cyanidin > pelargonidin > delphinidin [58]. ANR in grape also exhibited the substrate
preference in the order of cyanidin > pelargonidin > delphinidin [25], while ANR in Arabidopsis
displays the reverse preference [58]. Compared to the above mentioned ANRs, both MiANR 1-2 and
MiANR 1-3 showed substrate preference in the order of cyanidin > perlargonidin/delphinidin.
Similar to recombinant ANRs from legume [58], grape [25] and tea [11], all the three
ANRs from mango convert cyanidin into (
It suggests that cyanidin may be the major in vivo substrates, consistent with the red colored mango
cultivars characterized with higher anthocyanins with cyanidin-3-O-monoglucosides as the major
−
)-epicatechin and ( )-catechin with similar Kcat/km.
−
anthocyanins [60]. In contrast to other ANR proteins converting perlargonidin into (
and/or ( )-afzelechin, MiANRs does not use perlargonidin as substrate. It supports the fact that PA
in mango is mainly composed of catechin and epicatechin [34,61].
−
)-epi-afzelechin
−
In vitro enzyme assay showed that the three MiANRs shared similar biochemical properties.
All of them have the same temperature and time length optima in the enzyme reaction and
substrate/cosubstrate preference. While there are higher similarities between MiANR1-2 and
MiANR1-3 than MiANR1-1 and MiANR1-3. For example, MiANR1-2 and 1-3 have the same optimum
pH of 4.0 in citrate buffer. In contrast, the optimum pH for MiANR1-1 is 3.0 in phosphate buffer.
MiANR1-2 and 1-3 also shared similar Km/kcat with cyanidin and have the same NADH/NADPH
co-substrate preference. Based on the amino acid sequence alignment, despite these three MiANRs
shared very high identity, MiANR1-2 exhibit higher amino acid sequence identity (99.1%) to MiANR1-3
than to MiANR1-1 (98.81%). That is probably why MiANR1-2 and MiANR1-3 revealed more similar
biochemical properties than MiANR1-1 and 1-3.
Numerous investigations indicated that stereochemistry contributes a lot to the biochemical
properties of flavan-3-ol. For example, (
weed Centarea maculosa Lam function as a broad-spectrum phyto-toxin. Unlike (
−
)-catechin secreted from the roots of a destructive invasive
)-catechin, the
−

Molecules 2018, 23, 2876
13 of 20
(+)-catechin showed antibacterial activity against root-infesting pathogens. When consumed in
diet, stereochemical configuration of epicatechin and catechin exhibited a profound influence on
their uptake and metabolism in humans. Consequently, affect their beneficial effects on human
health [62]. In this study, we did not use a chiral column to separate the enzymatic reaction products,
but we can believe that the peaks from cyanidin and pelargonidin substrates were (–)-epicatechin,
(
(
−
)-catechin, respectively. This is based on the investigations of Xie [22] who purified (–)-epicatechin,
)-epiafzelechin, ( )-catechin, and ( )-afzelechin from a 500–1000 mL volume of ANR and substrate
−
−
−
reactions at pH 7.0 by HPLC separation and identified their structure and configurations by NMR and
CD spectrum analysis. Similar enzymatic assays were also conducted at the same pH 7.0 as described
by Xie [22].
In this study, the seed coat from transgenic plants were pinkish like banyuls mutant seeds. It is
due to the low level of production of proanthocyanidin in transgenic seeds, which turned bluish
after staining with DMACA. It suggested that the expression of MiANR1-1,1-2 and 1-3 in the seed
is low. The formation of bluish color of the seed coat revealed the conversion of anthocyanidin
into proanthocyanidin by MiANR1-1, 1-2 and 1-3 enzymes. It confirms that MiANR1-1, 1-2 and
1-3 complemented the PA deficiency pathway. This is consistent with VbANR [25], TcANR [63] and
GhANR [64] whose over-expression reconstructed the ANR pathway in banuyls mutant. Up to date,
except mango ANR, only grape and apple fruit ANR has been transgenically characterized, although
ANR cDNA homologs have been cloned or identified from a number of fruits like plum [64], pear [65],
persimmion [27] and strawberry [25].
4. Materials and Methods
4.1. Plant Materials and Treatments
Hongguifei mango at the developmental stage (immature fruit) was collected from a mango farm
located in Basuo Town, Dongfang County, Hainan Province, China. The pulp of Hongguifei mango
was removed and quickly frozen in liquid nitrogen and then stored at −80 ◦C.
4.2. cDNA Cloning of ANR from Pulp of Hongguifei Mango by RACE
Fifty milligrams of frozen Hongguifei mango pulp at the developmental stage were ground into a
fine powder in a mortar in liquid nitrogen. Total RNA samples free of genomic DNA were extracted
from pulp powder using RNAprep Pure Plant Kit (Polysaccharide & Polyphenolics-rich) from Tiangen
(Beijing, China). Degenerated primers (Table S1) of ANR gene were used for the amplification and
cloning of a fragment of the mango ANR homolog. Then total RNA from Hongguifei mango pulp
was used to synthesize the first strand cDNA as the protocol of the SMARTer® RACE 50/30 Kit 50and
0
0
3 cDNA suggested. The 5 end of ANR gene was amplified in two rounds of PCR with the gene-specific
primers (Table S1) designed according to the above obtained fragments with the special sequence to
the 50end to facilitate infusion cloning. The 30end of ANR gene was amplified in one round of PCR
with the gene-specific primers (Table S1) designed according to the above obtained fragments with the
special sequence to the 50end to facilitate infusion cloning. After the 50end and 30end were sequenced,
the synthesized 30cDNA was used to clone the full length cDNA with the primers (Table S1) based on
the sequenced 50end and 30end.
4.3. Expression of Recombinant MiANR cDNAs in E. coli
The selected the cDNA sequences were cloned into the MCS of pET28b without affecting the
0
0
integrity of ORF. The forward primer (5 -CATGCCATGGCGGCCCAGCAAACGGCAA-3 ) for cloning
MiANR 1-1 included NcoI restriction site (underlined) with a mutation of T4 changed to G (bold face).
The forward primer (CATGCCATGGCGGCCCAACAAACGGCAA) for cloning ANR 1-2 and 1-3 also
included NcoI (underlined) with a mutation of T4 changed to G (bold face). The three clones share
the same reverse primer (50-CCGCTCGAGCACTCCCTTAGCCTTGAAG-30) with XhoI restriction

Molecules 2018, 23, 2876
14 of 20
site (underlined). Then PCR was carried out to amplify respective ORFs and the products were
digested with restriction enzyme NcoI and XhoI, followed by purification with the DNA fragment
Purification Kit (QIA quick ®PCR pufication kit). The purified cDNA were then ligated into the
pET28b (Novagen, San Diego, CA, USA) vector that had already been digested by NcoI and XhoI.
This ligation led to the fusion of cDNA to the C-terminal containing a His-tag-coding sequence in the
vector, which is necessary for Ni-NIA affinity purification. Ligation products were introduced into
TOP 10 competent bacteria. Positive colonies on an agar-solidified LB medium were selected to isolate
and confirm the recombinant construct by double enzyme digestion and sequencing, and then named
pET28bMiANR1-1, 1-2, 1-3 respectively.
To study protein expression, the recombinant vectors pET28bMiANR1-1, 1-2, 1-3,
pET28bMiANR1-1, 1-2, 1-3 and an empty vector pET28b(+) (control) were introduced into
ultra-competent cells of the Bl21 (De3) plysS (Invitrogen, Carlsbad, CA, USA) strain, respectively.
◦
A single positive colony was inoculated into 5 mL LB and grown overnight at 37 C. The cultures were
then diluted 1:100 and grown at 37 ◦C until the OD600 reached 0.6 (grown for 3 h). Then IPTG was
added to a final concentration of 0.5 mm and further cultured at 30 ◦C and 220
×
g rpm overnight.
The cells were harvested by centrifuge at 5000
×
g rpm at 4 ◦C for 15 min. Pellets were either used
directly for enzyme extraction or stored at −80 ◦C.
4.4. Purification of Recombinant MiANRs
The purification was performed according to Qiagen ExpressionistTM (pp. 79, 81) with minor
modifications. The harvested cells from 100 mL culture were suspended in 4 mL lysis buffer. Lysozyme
was added as 2 mg/L, followed by incubation on ice for 30 min, sonication for 10 min and centrifugation
at 10,000
×
g for 30 min at 4 ◦C to pellet the cellular debris. Then, 1200
µL of 50% Ni-NTA slurry was
added to the clear lysate and mixed gently by shaking at 4 ◦C for 60 min. The lysate-Ni-NTA mixture
was loaded into a column (10 mL) with the bottom outlet capped. The bottom cap was removed to
collect the column flow-through, column was washed three times with 4 mL wash buffer, the protein
was eluted 4 times with 0.5 mL elution buffer. At the end, the lysate, flow through, wash fraction, and
eluted protein were collected for SDS-PAGE analysis.
4.5. Enzymatic Assay
Enzyme assays were initiated by mixing 140
(final concentration: 1 mM), 20 L of substrate (cyanidin, delphinidin, and perlargonidin, respectively,
final concentration: 100 M), 20 L (20 ug) of purified recombinant MiANRs in a 200 L reaction
volume (with boiled purifed recombinant enzyme as control). The reactions were incubated at 37 ◦C
for 45 min. All reactions were started by adding enzyme, and were stopped by adding 600 L of
ethyl acetate with 2 min of vigorous vortexing, and then centrifuged for 1 min at 12,000 g rpm.
The ethyl acetate supernatant phase (500 L) was transferred to a new Eppendorf tube, repeated the
extraction step and pooled the two ethyl acetate extractions (1000 L), which was dried by using a
L HPLC grade methanol for
µL Tris–HCl buffer (100 mM, pH7.0), 20 µL NADPH
µ
µ
µ
µ
µ
×
µ
µ
speedy vacuum at room temperature. Residues were dissolved in 60
UHPLC-UV-MS analysis.
µ
4.6. Determination of Kinetic Parameters for Recombinant MiANRs
The following experimental steps were specified for obtaining an appropriate reaction time,
the optimization of pH value and temperature, the kinetic characterization of substrates and
NADPH/NADH, and NaCl effect on MiANR activity. All enzymatic reactions were stopped and
extracted by adding ethyl acetate as described above. Extraction steps and sample preparation for UV
spectrometry analysis were described below.
First, several different buffer systems including citrate buffer (pH 3.0–6.5 100 mM), phosphate
buffer (pH 3.0–7.5 100 mM), Tris–HCl buffer (pH 7.0–9.0 100 mM) and 50 mM MES (5.0–7.0) buffer
were tested to get the optimal pH value. Each single enzymatic reaction consisted of 70 µL of buffer,

Molecules 2018, 23, 2876
15 of 20
10
and 10
All reactions were conducted at 40 ◦C for 45 min.
µ
L of cyanidin chloride (final concentration: 100
µ
M), 10
µ
L of NADPH (final concentration: 1 mM),
µL of MiANR protein (final amount: 10 µg). Control reactions were performed using BSA.
The temperature profiles for MiANRs were determined at their respective optimal pH value of
phosphate buffer 3.0 (ANR1-1), citrate 4.0 (ANR1-2), citrate 4.0(ANR1-3) with 45 min incubations in a
final volume of 100
µL containing 70
µL buffer, 10
µL of cyanidin chloride (final concentration: 100
µM),
10 L of NADPH (final concentration: 1 mM), and 10
µ
µ
L of MiANR protein (final amount: 10
µ
g).
The tested reaction temperatures included 30, 34.6, 39.5, 45.3, 49.6 and 55 ◦C, which are performed by
gradient PCR.
The optima reaction time was determined at the respective pH optima and temperature optima
in total volume of 100 containing 70
µL buffer, 10
µL of cyanidin chloride (final concentration:
100 M), 10 L of NADPH (final concentration: 1 mM), and 10 µ
µ
µ
L of MiANR1-1, 1-2 and 1-3 protein
(final amount: 10 µg). The tested times included 2, 5, 8, 10, 20, 30, 40, and 50 m.
The kinetics of recombinant MiANRs with NADPH were characterized at the respective pH,
temperature and time optima in total volume of 100
chloride (final concentration: 100 M), 10 L of NADPH (different concentrations), and 10
protein (final amount: 10 g). The tested concentrations of NADPH include 0 (control), 0.05, 0.1, 0.5, 1,
1.25, 2.5, 3.125, and 3.75 mM. The kinetic properties of recombinant MiANRs were likewise determined
in total volume of 100 L containing 70 L buffer (100 mM), 10 L of cyanidin chloride (0, 6.25, 12.5, 25,
L NADPH (final concentration: 1 mM), ANR1-1,
µL containing 70
µL of buffer, 10
µL of cyanidin
µ
µ
µL of ANR
µ
µ
µ
µ
50, 100, 150, 200, 300, 400, 500 and 600 mM), and 10
µ
1-2, 1-3 protein (final amount: 10 µg).
To determine the effects of NaCl concentrations, enzyme assays were carried out at the respective
pH, temperature, time optima in total volume of 100 L consisting of 60 L of buffer, 10 L of cyanidin
chloride (final concentration: 100 M), 10 L of 1 mM NADPH, 10 L of ANR protein and 10 L of
µ
µ
µ
µ
µ
µ
µ
NaCl (0–500 mM). All the control reactions were performed using BSA.
4.7. UHPLC-UV-MS and Ultraviolet–Visible Spectrometry Analyses
An UHPLC-MS method was developed for the simultaneous analysis of the four compounds, viz.
catechin [ ], epigallocatechin [ ], epicatechin [10], and gallocatechin [11]. The analyses were performed
8
9
on an Agilent 1290 Infinity series LC (Agilent, Santa Clara, CA, USA) that included a binary solvent
manager, sampler manager, thermostatted column compartment, diode array (DAD) detector. The LC
instrument was coupled to an Agilent 6120 quadrupole mass spectrometer with a dual APCI and
ESI interface. The column was an Agilent ZORBAX Eclipse Plus C18 (2.1
×
100 mm, 1.8 µm) column.
The column temperature was maintained at 30 ◦C. The eluent consisted of water with 0.05% formic
acid (A) and acetonitrile in 0.05% formic acid (B). Analysis was performed using the following gradient
elution at a flow rate of 0.25 mL/min: 0–10 min, 5% B to 30% B; 10–15 min, 30% B to 60% B; and
increasing B to 100% in next 3 min. The analysis was followed by a 7 min washing procedure with
100% B and re-equilibration period of 6 min. All solutions were filtered through 0.45 µm PTFE filters
and the injection volume was 5 µL.
Both ESI and APCI sources were evaluated in the positive and negative modes to scan a mass
range of 100–800. Mass spectrometer conditions were optimized to obtain maximal sensitivity.
The fragmentor voltage was 100 V, and the capillary voltage was 4000 V. The drying gas flow rate was
10.0 L/min, the nebulizer pressure was 30 psi, and the drying gas temperature was 300 ◦C. Signals
in negative modes at m/z 289 [M
[M
H]− (ESI) were used to detections of compounds gallocatechin, epigallocatechin, catechin and
epicatechin, respectively.
−
H]− (APCI), 289 [M
−
H]− (ESI), 305 [M
−
H]− (ESI) and 305
−
An ultraviolet–visible (UV) spectrometry analysis was employed to quantify the enzymatic
reaction products. This method is based on dimethylaminocinnamaldehyde (DMACA) reacts with
flavan-3-ols producing deep bluish compounds, which have a maximum absorption at 640 nm [66
–68].
First, the standard curves and equations were developed to calculate flavan-3-ols from enzymatic

Molecules 2018, 23, 2876
16 of 20
reactions as described by [25]. Then 30
µL of crude methanol extract from each enzymatic reaction
was mixed with 30 µL of 0.1% DMACA in a 96 well plate, which was then kept in room temperature
for 10 min, followed by absorbance measurement at 640 nm (BioTek Microplate Reader ELX808,
Winooski, VT, USA). The blank with BSA in place of recombinant MiANR1-1, 1-2, 1-3 was likewise
assayed. This UV spectrometry method was used for optimizing the pH and temperature values,
analyzing the kinetics and the effects of sodium chloride. Each experiment was repeated at least three
times. The plots of the initial reaction velocities versus the substrate concentrations were established by
using the data from UV spectrometric analyses. All Km, Vmax, and Kcat values related to substrates
and NADPH/NA DH were obtained by using values from the UV spectrometry measurement.
4.8. Over-Expression of MiANR in the Banuyls Mutant of Arabidopsis thaliana
A pair of primers (Forward primer: 50-CCGGAATTCAAATCAACCATGTCGGCCCA-30
including an EcoRI restriction site, Reverse primer: CCGCTCGAGTCATTAGAGCACTCCCTTA
GCCTTG including an XhoI restriction site) were designed to amplify the ORFs of MiANR cDNA,
which were recovered using the recovery kit and ligated to the double digested pub vector
(constructed by Zhiqiang Pan) to produce pub MiANR. Then pubMiANR and plant expression
vector pCB408 were digested with SfiI respectively. The fragments containing the ORF were recovered
and cloned into pCB408 vector. The recombinant binary vectors, named pCB408MiANR1-1, 1-2, 1-3
were obtained and then introduced into Agrobacterium tumefaciens strain EHA105 by using a modified
protocol of the freeze-thaw method [69]. The positive colonies were selected by colony PCR and then
used to transform the banuyls (ban) mutant line.
Mutant plants (250C and 474C) were cultivated in a growth chamber with a 12/12 photoperiod
at 22 ◦C. Leaves were collected to extract DNA to perform PCR to indentify the genetic purity of the
mutant. When the floral stems were about 10 cm high, the floral dipping transformation was done
according to the protocol described by Logemann [70]. Transformed plants were kept in the plant
growth chamber with Columbia wild-type and ban mutants (not transformed) grown in the same
condition as control. Seeds were obtained upon full maturation and germinated on soil. One week
after germination, 0.1% BASTA herbicide was sprayed to screening the transgenic plants in the plant
growth chamber and repeated twice at seven days intervals. Transgenic plants were identified if they
continued to grow and stayed green. In contrast, the untransformed plants kept small, went white and
died two weeks after selection. Simultaneously, PCR was also used to confirm the transgenic plants.
Green siliques were collected from wild, transformed and non-transformed control plants. Immature
seeds were removed from the siliques to be observed under microscope and photographed, and then
stained with 0.1% DMACA as described by Xie [22]. After 20 min of staining, they were observed
under dissecting microscope and photographed for their coloration.
5. Conclusions
We have cloned and functionally characterized three ANR cDNAs genes from Hongguifei mango
in vitro and in vivo. All of them have the ability to reduce anthocyanidin into proanthocyanidins,
while they differ from ANRs of other plants like Arabidopsis and vitis vibro, in co-substrate/substrate
specificity and enzyme kinetics. This study has laid a foundation for further investigating the regulation
of PAs biosynthesis in mango.
Supplementary Materials: The following are available online. Table S1. And Figures S1–S5.
Author Contributions: Conceptualization, Z.P.; Data curation, Y.K.; Formal analysis, F.A.; Investigation, M.W.,
D.T. and L.M.P.R.; Resources, Z.Z. and I.K.; Writing—original draft, L.T.
Funding: This work is supported by China Scholarship Council (201503260002) and Central Public-interest
Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences
(No. 1630092018007; No. 1630032014047).
Acknowledgments: We thank Marilyn Ruscoe for excellent technical assistance.

Molecules 2018, 23, 2876
17 of 20
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the
study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to
publish the results.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Ulusoy, S.; Ozkan, G.; Yucesan, F.B.; Ersöz, S¸.; Orem, A.; Alkanat, M.; Yulug˘, E.; Kaynar, K.; Al, S.
Anti-apoptotic and anti-oxidant effects of grape seed proanthocyanidin extract in preventing cyclosporine
A-induced nephropathy. Nephrology 2012, 17, 372–379. [CrossRef] [PubMed]
Sobeh, M.; Mahmoud, M.F.; Abdelfattah, M.A.O.; Cheng, H.; El-Shazly, A.M.; Wink, M. A proanthocyanidin-rich
extract from Cassia abbreviata exhibits antioxidant and hepatoprotective activities in vivo. J. Ethnopharmacol.
2018, 213, 38–47. [CrossRef] [PubMed]
Yu, R.-J.; Liu, H.-B.; Yu, Y.; Liang, L.; Xu, R.; Liang, C.; Tang, J.-S.; Yao, X.-S. Anticancer activities of
proanthocyanidins from the plant Urceola huaitingii and their synergistic effects in combination with
chemotherapeutics. Fitoterapia 2016, 112, 175–182. [CrossRef] [PubMed]
Padumadasa, C.; Dharmadana, D.; Abeysekera, A.; Thammitiyagodage, M. In vitro antioxidant,
anti-inflammatory and anticancer activities of ethyl acetate soluble proanthocyanidins of the inflorescence of
Cocos nucifera L. BMC Complement. Altern. Med. 2016, 16, 345. [CrossRef] [PubMed]
Rasmussen, S.E.; Frederiksen, H.; Struntze Krogholm, K.; Poulsen, L. Dietary proanthocyanidins: Occurrence,
dietary intake, bioavailability, and protection against cardiovascular disease. Mol. Nutr. Food Res. 2005, 49,
159–174. [CrossRef] [PubMed]
Vaid, M.; Singh, T.; Prasad, R.; Elmets, C.A.; Xu, H.; Katiyar, S.K. Bioactive grape proanthocyanidins
enhance immune reactivity in UV-irradiated skin through functional activation of dendritic cells in mice.
Cancer Prev. Res. 2013, 6, 242–252. [CrossRef] [PubMed]
Dinh, J.; Angeloni, J.T.; Pederson, D.B.; Wang, X.; Cao, M.; Dong, Y. Cranberry extract standardized for
proanthocyanidins promotes the immune response of Caenorhabditis elegans to Vibrio cholerae through the p38
MAPK pathway and HSF-1. PLoS ONE 2014, 9, e103290. [CrossRef] [PubMed]
Yoshida, K.; Ma, D.; Constabel, C.P. The MYB182 Protein Down-Regulates Proanthocyanidin and
Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes.
Plant Physiol. 2015, 167, 693–710. [CrossRef] [PubMed]
Abeynayake, S.W.; Panter, S.; Chapman, R.; Webster, T.; Rochfort, S.; Mouradov, A.; Spangenberg, G.
Biosynthesis of Proanthocyanidins in White Clover Flowers: Cross Talk within the Flavonoid Pathway.
Plant Physiol. 2012, 158, 666–678. [CrossRef] [PubMed]
10. Matsui, K.; Hisano, T.; Yasui, Y.; Mori, M.; Walker, A.R.; Morishita, T.; Katsu, K. Isolation and characterization
of genes encoding leucoanthocyanidin reductase (FeLAR) and anthocyanidin reductase (FeANR) in
buckwheat (Fagopyrum esculentum). J. Plant Physiol. 2016, 205, 41–47. [CrossRef] [PubMed]
11. Pang, Y.; Abeysinghe, I.S.B.; He, J.; He, X.; Huhman, D.; Mewan, K.M.; Sumner, L.W.; Yun, J.; Dixon, R.A.
Functional characterization of proanthocyanidin pathway enzymes from tea and their application for
metabolic engineering. Plant Physiol. 2013, 161, 1103–1116. [CrossRef] [PubMed]
12. Kovinich, N.; Saleem, A.; Arnason, J.T.; Miki, B. Identification of Two Anthocyanidin Reductase Genes and
Three Red-Brown Soybean Accessions with Reduced Anthocyanidin Reductase 1 mRNA, Activity, and Seed
Coat Proanthocyanidin Amounts. J. Agric. Food Chem. 2012, 60, 574–584. [CrossRef] [PubMed]
13. Zhou, H.; Lin-Wang, K.; Liao, L.; Gu, C.; Lu, Z.; Allan, A.C.; Han, Y. Peach MYB7 activates transcription
of the proanthocyanidin pathway gene encoding leucoanthocyanidin reductase, but not anthocyanidin
reductase. Front. Plant Sci. 2015. [CrossRef] [PubMed]
14. Liao, L.; Vimolmangkang, S.; Wei, G.; Zhou, H.; Korban, S.S.; Han, Y. Molecular characterization of genes
encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple. Front. Plant Sci.
2015, 6, 243. [CrossRef] [PubMed]
15. Ayres, M.; Clausen, T.; MacLean, S.; Redman, A.; Relchardt, P. Diversity of structure and antiherbivore
activity in condensed tannins. Ecology 1997, 78, 1696–1712. [CrossRef]
16. Mellway, R.D.; Tran, L.T.; Prouse, M.B.; Campbell, M.M.; Constabel, C.P. The Wound-, Pathogen-, and
Ultraviolet B-Responsive MYB134 Gene Encodes an R2R3 MYB Transcription Factor That Regulates
Proanthocyanidin Synthesis in Poplar. Plant Physiol. 2009, 150, 924–941. [CrossRef] [PubMed]

Molecules 2018, 23, 2876
18 of 20
17. Jaakola, L. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 2013, 18,
477–483. [CrossRef] [PubMed]
18. Yang, Y.; Yao, G.; Yue, W.; Zhang, S.; Wu, J. Transcriptome profiling reveals differential gene expression in
proanthocyanidin biosynthesis associated with red/green skin color mutant of pear (Pyrus communis L.).
Front. Plant Sci. 2015, 6, 795. [CrossRef] [PubMed]
19. Tohge, T.; de Souza, L.P.; Fernie, A.R. Current understanding of the pathways of flavonoid biosynthesis in
model and crop plants. J. Exp. Bot. 2017, 68, 4013–4028. [CrossRef] [PubMed]
20. Saito, K.; Yonekura-Sakakibara, K.; Nakabayashi, R.; Higashi, Y.; Yamazaki, M.; Tohge, T.; Fernie, A.R.
The flavonoid biosynthetic pathway in Arabidopsis: Structural and genetic diversity. Plant Physiol.
Biochem. PPB 2013, 72, 21–34. [CrossRef] [PubMed]
21. Tanner, G.J.; Francki, K.T.; Abrahams, S.; Watson, J.M.; Larkin, P.J.; Ashton, A.R. Proanthocyanidin
biosynthesis in plants. Purification of legume leucoanthocyanidin reductase and molecular cloning of
its cDNA. J. Biol. Chem. 2003, 278, 31647–31656. [CrossRef] [PubMed]
22. Xie, D.-Y.; Sharma, S.B.; Paiva, N.L.; Ferreira, D.; Dixon, R.A. Role of anthocyanidin reductase, encoded by
BANYULS in plant flavonoid biosynthesis. Science 2003, 299, 396–399. [CrossRef] [PubMed]
23. Wang, L.; Jiang, Y.; Yuan, L.; Lu, W.; Yang, L.; Karim, A.; Luo, K. Isolation and characterization of cDNAs
encoding leucoanthocyanidin reductase and anthocyanidin reductase from Populus trichocarpa. PLoS ONE
2013, 8, e64664. [CrossRef] [PubMed]
24. Paolocci, F.; Robbins, M.P.; Madeo, L.; Arcioni, S.; Martens, S.; Damiani, F. Ectopic Expression of a Basic
Helix-Loop-Helix Gene Transactivates Parallel Pathways of Proanthocyanidin Biosynthesis. Structure,
Expression Analysis, and Genetic Control of Leucoanthocyanidin 4-Reductase and Anthocyanidin Reductase
Genes in Lotus cornicu. Plant Physiol. 2006, 143, 504–516. [CrossRef] [PubMed]
25. Zhu, Y.; Peng, Q.-Z.; Li, K.-G.; Xie, D.-Y. Molecular cloning and functional characterization of the
anthocyanidin reductase gene from Vitis bellula. Planta 2014, 240, 381–398. [CrossRef] [PubMed]
26. Mandave, P.C.; Kuvalekar, A.A.; Mantri, N.L.; Autal Islam, M.; Ranjekar, P.K. Cloning, expression and
molecular modeling of the anthocyanidin reductase (FaANR) gene during strawberry fruit development.
Fruits 2017, 72, 139–147. [CrossRef]
27. Ikegami, A.; Eguchi, S.; Kitajima, A.; Inoue, K.; Yonemori, K. Identification of genes involved in
proanthocyanidin biosynthesis of persimmon (Diospyros kaki) fruit. Plant Sci. 2007, 172, 1037–1047. [CrossRef]
28. Han, Y.; Vimolmangkang, S.; Soria-Guerra, R.E.; Korban, S.S. Introduction of apple ANR genes into tobacco
inhibits expression of both CHI and DFR genes in flowers, leading to loss of anthocyanin. J. Exp. Bot. 2012
63, 2437–2447. [CrossRef] [PubMed]
,
29. Bogs, J.; Downey, M.O.; Harvey, J.S.; Ashton, A.R.; Tanner, G.J.; Robinson, S.P. Proanthocyanidin synthesis
and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing
grape berries and grapevine leaves. Plant Physiol. 2005, 139, 652–663. [CrossRef] [PubMed]
30. Gesell, A.; Yoshida, K.; Tran, L.T.; Constabel, C.P. Characterization of an apple TT2-type R2R3 MYB
transcription factor functionally similar to the poplar proanthocyanidin regulator PtMYB134. Planta 2014
240, 497–511. [CrossRef] [PubMed]
,
31. Gagné, S.; Lacampagne, S.; Claisse, O.; Gény, L. Leucoanthocyanidin reductase and anthocyanidin reductase
gene expression and activity in flowers, young berries and skins of Vitis vinifera L. cv. Cabernet-Sauvignon
during development. Plant Physiol. Biochem. 2009, 47, 282–290. [CrossRef] [PubMed]
32. Dutta, P. Effect of potassium nutrition on mineral composition of mango leaf and ripe fruit. Indian J. Hortic.
1999, 56, 238–241.
33. Vergara-Valencia, N.; Granados-Pérez, E.; Agama-Acevedo, E.; Tovar, J.; Ruales, J.; Bello-Pérez, L.A.
Fibre concentrate from mango fruit: Characterization, associated antioxidant capacity and application
as a bakery product ingredient. LWT Food Sci. Technol. 2007. [CrossRef]
34. Sudha, M.L.; Indumathi, K.; Sumanth, M.S.; Rajarathnam, S.; Shashirekha, M.N. Mango pulp fibre waste:
Characterization and utilization as a bakery product ingredient. J. Food Meas. Charact. 2015. [CrossRef]
35. Sellamuthu, P.S.; Denoya, G.I.; Sivakumar, D.; Polenta, G.A.; Soundy, P. Comparison of the contents of
bioactive compounds and quality parameters in selected mango cultivars. J. Food Qual. 2013. [CrossRef]
36. Matkowski, A.; Kus, P.; Goralska, E.; Wozniak, D. Mangiferin—A bioactive xanthonoid, not only from mango
and not just antioxidant. Mini Rev. Med. Chem. 2013. [CrossRef]

Molecules 2018, 23, 2876
19 of 20
37. Das, S.; Alam, M.D.N.; Batuta, S.; Roy, N.; Begum, N.A. Exploring Comparative Antioxidant Activity of
Some Popular Cultivars of Mangifera indica L., National Fruit of India. Int. J. Fruit Sci. 2015. [CrossRef]
38. Ma, X.; Wu, H.; Liu, L.; Yao, Q.; Wang, S.; Zhan, R.; Xing, S.; Zhou, Y. Polyphenolic compounds and
antioxidant properties in mango fruits. Sci. Hortic. 2011. [CrossRef]
39. Dorta, E.; González, M.; Lobo, M.G.; Laich, F. Antifungal activity of mango peel and seed extracts against
clinically pathogenic and food spoilage yeasts. Nat. Prod. Res. 2016. [CrossRef] [PubMed]
40. Dare, A.P.; Tomes, S.; Jones, M.; McGhie, T.K.; Stevenson, D.E.; Johnson, R.A.; Greenwood, D.R.;
Hellens, R.P. Phenotypic changes associated with RNA interference silencing of chalcone synthase in
apple (Malus × domestica). Plant J. 2013. [CrossRef] [PubMed]
41. Massonnet, M.; Fasoli, M.; Tornielli, G.B.; Altieri, M.; Sandri, M.; Zuccolotto, P.; Paci, P.; Gardiman, M.;
Zenoni, S.; Pezzotti, M. Ripening Transcriptomic Program in Red and White Grapevine Varieties Correlates
with Berry Skin Anthocyanin Accumulation. Plant Physiol. 2017. [CrossRef] [PubMed]
42. Li, Y.; Fang, J.; Qi, X.; Lin, M.; Zhong, Y.; Sun, L. A key structural gene, AaLDOX, is involved in anthocyanin
biosynthesis in all red-fleshed kiwifruit (Actinidia arguta) based on transcriptome analysis. Gene 2018
.
[CrossRef] [PubMed]
43. Zhao, F.; Li, G.; Hu, P.; Zhao, X.; Li, L.; Wei, W.; Feng, J.; Zhou, H. Identification of basic/helix-loop-helix
transcription factors reveals candidate genes involved in anthocyanin biosynthesis from the strawberry
white-flesh mutant. Sci. Rep. 2018. [CrossRef] [PubMed]
44. Zhao, Z.; Zhang, B.; Gao, A.; Chen, Y.; Huang, J.; Dang, Z.; Luo, R. Cloning and Expression Analysis of
UFGT Gene from Mango (Mangifera indica). Jiangsu Agric. Sci. 2016, 44, 31–34.
45. Zhao, Z.; Gao, A.; Huang, J.; Dang, Z.; Luo, R.; Chen, Y. Cloning and Expression Analysis of F3’ H Gene
from Mango (Mangifera indica). Hans J. Comput. Biol. 2016, 6, 1–7. [CrossRef]
46. Zhang, B.; Zhao, Z.; Gao, A.; Luo, R. Cloning and Expression Analysis of DFR Gene from Mango
(Mangifera indica). Mol. Plant Breed. 2015, 4, 816–821.
47. Li, X.; Zhao, Z.; Gao, A.; Chen, Y.; Huang, J.; Dang, Z.; Luo, R. Cloning and Expression Analysis of ANR
Gene from Mango (Mangifera indica). Jiangsu Agric. Sci. 2017, 45, 22–25.
48. Luria, N.; Sela, N.; Yaari, M.; Feygenberg, O.; Kobiler, I.; Lers, A.; Prusky, D. De-novo assembly of mango
fruit peel transcriptome reveals mechanisms of mango response to hot water treatment. BMC Genom. 2014
15, 957. [CrossRef] [PubMed]
,
49. Gargouri, M.; Manigand, C.; Maugé, C.; Granier, T.; Langlois d’Estaintot, B.; Cala, O.; Pianet, I.; Bathany, K.;
Chaudière, J.; Gallois, B. Structure and epimerase activity of anthocyanidin reductase from Vitis vinifera.
Acta Crystallogr. Sect. D Biol. Crystallogr. 2009, 65, 989–1000. [CrossRef] [PubMed]
50. Xie, D.-Y.; Sharma, S.B.; Dixon, R.A. Anthocyanidin reductases from Medicago truncatula and Arabidopsis
thaliana. Arch. Biochem. Biophys. 2004, 422, 91–102. [CrossRef] [PubMed]
51. Albert, S.; Delseny, M.; Devic, M. BANYULS, a novel negative regulator of flavonoid biosynthesis in the
Arabidopsis seed coat. Plant J. 1997, 11, 289–299. [CrossRef] [PubMed]
52. Devic, M.; Guilleminot, J.; Debeaujon, I.; Bechtold, N.; Bensaude, E.; Koornneef, M.; Pelletier, G.; Delseny, M.
The BANYULS gene encodes a DFR-like protein and is a marker of early seed coat development. Plant J.
1999, 19, 387–398. [CrossRef] [PubMed]
53. Scrutton, N.S.; Berry, A.; Perham, R.N. Redesign of the coenzyme specificity of a dehydrogenase by protein
engineering. Nature 1990, 343, 38–43. [CrossRef] [PubMed]
54. Marohnic, C.C.; Bewley, M.C.; Barber, M.J. Engineering and characterization of a NADPH-utilizing
cytochrome b5 reductase. Biochemistry 2003, 42, 11170–11182. [CrossRef] [PubMed]
55. Hendricks, S.P.; Mathews, C.K. Allosteric regulation of vaccinia virus ribonucleotide reductase, analyzed by
simultaneous monitoring of its four activities. J. Biol. Chem. 1998, 273, 29512–29518. [CrossRef] [PubMed]
56. Cui, D.; Zhang, L.; Jiang, S.; Yao, Z.; Gao, B.; Lin, J.; Yuan, Y.A.; Wei, D. A computational strategy for altering
an enzyme in its cofactor preference to NAD(H) and/or NADP(H). FEBS J. 2015, 282, 2339–2351. [CrossRef]
[PubMed]
57. Kho, R.; Baker, B.L.; Newman, J.V.; Jack, R.M.; Sem, D.S.; Villar, H.O.; Hansen, M.R. A path from primary
protein sequence to ligand recognition. Proteins 2003, 50, 589–599. [CrossRef] [PubMed]
58. Xie, D.Y.; Jackson, L.A.; Cooper, J.D.; Ferreira, D.; Paiva, N.L. Molecular and biochemical analysis of
two cDNA clones encoding dihydroflavonol-4-reductase from Medicago truncatula. Plant Physiol. 2004
.
[CrossRef] [PubMed]

Molecules 2018, 23, 2876
20 of 20
59. Miosic, S.; Thill, J.; Milosevic, M.; Gosch, C.; Pober, S.; Molitor, C.; Ejaz, S.; Rompel, A.; Stich, K.;
Halbwirth, H. Dihydroflavonol 4-reductase genes encode enzymes with contrasting substrate specificity and
show divergent gene expression profiles in Fragaria species. PLoS ONE 2014. [CrossRef] [PubMed]
60. Karanjalker, G.R.; Ravishankar, K.V.; Shivashankara, K.S.; Dinesh, M.R.; Roy, T.K.; Sudhakar Rao, D.V.
A Study on the Expression of Genes Involved in Carotenoids and Anthocyanins During Ripening in Fruit
Peel of Green, Yellow, and Red Colored Mango Cultivars. Appl. Biochem. Biotechnol. 2018. [CrossRef]
[PubMed]
61. Rymbai, H.; Srivastav, M.; Sharma, R.R.; Patel, C.R.; Singh, A.K. Bio-active compounds in mango
(Mangifera indica L.) and their roles in human health and plant defence—A review. J. Hortic. Sci. Biotechnol.
2013, 88, 369–379. [CrossRef]
62. Ottaviani, J.I.; Momma, T.Y.; Heiss, C.; Kwik-Uribe, C.; Schroeter, H.; Keen, C.L. The stereochemical
configuration of flavanols influences the level and metabolism of flavanols in humans and their biological
activity in vivo. Free Radic. Biol. Med. 2011, 50, 237–244. [CrossRef] [PubMed]
63. Liu, Y.; Shi, Z.; Maximova, S.; Payne, M.J.; Guiltinan, M.J. Proanthocyanidin synthesis in Theobroma cacao:
Genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.
BMC Plant Biol. 2013, 13, 202. [CrossRef] [PubMed]
64. Gu, C.; Liao, L.; Zhou, H.; Wang, L.; Deng, X.; Han, Y. Constitutive activation of an anthocyanin regulatory
gene PcMYB10.6 is related to red coloration in purple-foliage plum. PLoS ONE 2015, 10, 1–16. [CrossRef]
[PubMed]
65. Fischer, T.C.; Gosch, C.; Pfeiffer, J.; Halbwirth, H.; Halle, C.; Stich, K.; Forkmann, G. Flavonoid genes of pear
(Pyrus communis). Trees 2007, 21, 521–529. [CrossRef]
66. Peel, G.; Dixon, R. Detection and quantification of engineered proanthocyanidins in transgenic plants.
Nat. Prod. Commun. 2007, 2, 1009–1014.
67. Thies, M.; Fischer, R. New color reaction for microchemical detection and quantitative determination of
catechins. Mikrochim. Acta 1971, 1, 9–13. [CrossRef]
68. Treutter, D. Chemical reaction detection of catechins and proanthocyanidins with
4-dimethylaminocinnamaldehyde. J. Chromatogr. A 1989. [CrossRef]
69. Hofgen, R.; Willmitzer, L. Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res. 1988
.
[CrossRef]
70. Logemann, E.; Birkenbihl, R.P.; Ülker, B.; Somssich, I.E. An improved method for preparing Agrobacterium
cells that simplifies the Arabidopsis transformation protocol. Plant Methods 2006, 2, 16. [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).