Synthesis and biological evaluation of novel coumarin derivatives in rhabdoviral clearance

Article abstract of DOI:10.1016/j.ejmech.2021.113739

Diseases caused by rhabdoviruses have had a huge impact on the productive lives of the entire human population. The main problem is the lack of drugs for the treatment of this family of viruses. Infectious hematopoietic necrosis virus (IHNV), the causative agent of IHN, is a typical rhabdovirus which has caused huge losses to the salmonid industry. Therefore, in this study, IHNV was studied as a model to evaluate the antiviral activity of 35 novel coumarin derivatives. Coumarin A9 was specifically selected for further validation studies upon comparing the half maximum inhibitory concentration (IC₅₀) of four screened candidate derivatives in epithelioma papulosum cyprinid (EPC) cells, as it exhibited an IC₅₀ value of 2.96 μM against IHNV. The data revealed that A9 treatment significantly suppressed the virus-induced cytopathic effect (CPE) in EPC cells. In addition, A9 showed IC₅₀ values of 1.68 and 2.12 μM for two other rhabdoviruses, spring viremia of carp virus and micropterus salmoides rhabdovirus, respectively. Furthermore, our results suggest that A9 exerts antiviral activity, but not by destroying the virus particles and interfering with the adsorption of IHNV. Moreover, we found that A9 had an inhibitory effect on IHNV-induced apoptosis in EPC cells, as reflected by the protection against cell swelling, formation of apoptotic bodies, and loss of cell morphology and nuclear division. There was a 19.05 % reduction in the number of apoptotic cells in the A9 treatment group compared with that in the IHNV group. In addition, enzyme activity assays proved that A9 suppressed the expression of caspase 3, 8 and 9. These results suggested that A9 inhibit viral replication, to some extent, by blocking IHNV-induced apoptosis. In an in vivo study, A9 exhibited an anti-rhabdovirus effect in virus-infected fish by substantially enhancing the survival rate. Consistent with the above results, A9 repressed IHNV gene expression in virus-sensitive tissues (brain, kidney and spleen) in the early stages of virus infection. Importantly, the data showed that horizontal transmission of IHNV was reduced by A9 in a static cohabitation challenge model, especially in fish that underwent bath treatment, suggesting that A9 might be a suitable therapeutic agent for IHNV in aquaculture. Therefore, coumarin derivatives can be developed as antiviral agents against rhabdoviruses.

Full text of DOI:10.1016/j.ejmech.2021.113739

European Journal of Medicinal Chemistry 223 (2021) 113739
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Synthesis and biological evaluation of novel coumarin derivatives in
rhabdoviral clearance
,
b
,
,
b
,
,
b
,
,
b
,
, b, c, *
Yang Hu a c, Lipeng Shan a c, Tianxiu Qiu a c, Lei Liu a c, Jiong Chen a
a State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Ningbo University, Ningbo, 315211, China
b Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Meishan Campus, Ningbo University, Ningbo, 315832, China
c Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Meishan Campus, Ningbo University, Ningbo, 315832, China
a r t i c l e i n f o
a b s t r a c t
Article history:
Diseases caused by rhabdoviruses have had a huge impact on the productive lives of the entire human
population. The main problem is the lack of drugs for the treatment of this family of viruses. Infectious
hematopoietic necrosis virus (IHNV), the causative agent of IHN, is a typical rhabdovirus which has
caused huge losses to the salmonid industry. Therefore, in this study, IHNV was studied as a model to
evaluate the antiviral activity of 35 novel coumarin derivatives. Coumarin A9 was specifically selected for
further validation studies upon comparing the half maximum inhibitory concentration (IC50) of four
screened candidate derivatives in epithelioma papulosum cyprinid (EPC) cells, as it exhibited an IC50
Received 11 March 2021
Received in revised form
31 July 2021
Accepted 1 August 2021
Keywords:
Rhabdovirus
Coumarin derivatives
Antiviral activity
value of 2.96
m
M against IHNV. The data revealed that A9 treatment significantly suppressed the virus-
M for
induced cytopathic effect (CPE) in EPC cells. In addition, A9 showed IC50 values of 1.68 and 2.12
m
two other rhabdoviruses, spring viremia of carp virus and micropterus salmoides rhabdovirus, respec-
tively. Furthermore, our results suggest that A9 exerts antiviral activity, but not by destroying the virus
particles and interfering with the adsorption of IHNV. Moreover, we found that A9 had an inhibitory
effect on IHNV-induced apoptosis in EPC cells, as reflected by the protection against cell swelling, for-
mation of apoptotic bodies, and loss of cell morphology and nuclear division. There was a 19.05 %
reduction in the number of apoptotic cells in the A9 treatment group compared with that in the IHNV
group. In addition, enzyme activity assays proved that A9 suppressed the expression of caspase 3, 8 and
9. These results suggested that A9 inhibit viral replication, to some extent, by blocking IHNV-induced
apoptosis. In an in vivo study, A9 exhibited an anti-rhabdovirus effect in virus-infected fish by sub-
stantially enhancing the survival rate. Consistent with the above results, A9 repressed IHNV gene
expression in virus-sensitive tissues (brain, kidney and spleen) in the early stages of virus infection.
Importantly, the data showed that horizontal transmission of IHNV was reduced by A9 in a static
cohabitation challenge model, especially in fish that underwent bath treatment, suggesting that A9
might be a suitable therapeutic agent for IHNV in aquaculture. Therefore, coumarin derivatives can be
developed as antiviral agents against rhabdoviruses.
© 2021 Elsevier Masson SAS. All rights reserved.
1. Introduction
Chandipura virus, caused an outbreak of acute childhood enceph-
alitis in a village near the city of Nagpur, India, with 329 cases and
Rhabdoviruses are a group of negative-stranded RNA viruses
that are bullet- or rod-shaped, and can infect a wide range of hosts.
The most well-known rhabdovirus is the rabies virus, which causes
rabies in humans or other warm-blooded animals and has an
almost 100 % mortality rate [1]. Another rhabdovirus, such as
183 deaths [2]. Rhabdoviruses can also cause a variety of acute
infectious diseases in livestock, as well as infectious diseases in fish
and various crops [3]. Currently, vaccination is the main way to
prevent diseases caused by rhabdoviruses. The human diploid cell
rabies vaccine (HDCV, Imovax Rabies, Sanofi Pasteur), was licensed
for use in the United States in 1980 [4]. Vaccines are very effective in
prevention; however, they do not solve the problem of disease
treatment [5]. Hence, drugs for the treatment of rhabdoviruses are
of urgent importance.
* Corresponding author. State Key Laboratory for Managing Biotic and Chemical
Threats to the Quality and Safety of Agro-products, Ningbo University, Ningbo,
315211, China.
E-mail address: jchen1975@163.com (J. Chen).
https://doi.org/10.1016/j.ejmech.2021.113739
0223-5234/© 2021 Elsevier Masson SAS. All rights reserved.

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Natural products are a valuable resource for new molecular
structural skeletons owing to their wide chemical and biological
diversity [6]. They are also lead compounds for a wide range of
clinical applications, including antiviral, antitumor and antibacte-
rial drugs [7e9]. Reports show that between 1981 and 2014, over
59 % of new FDA-approved drug were directly or indirectly derived
from natural products [10]. Coumarins, first isolated from Tonka
beans in 1820, are a family of naturally-occurring lactones. Over
1300 coumarins have been identified and reported to exhibit
multiple biological activities for treating diverse ailments [11].
Warfarin, a coumarin derivative, known as a traditional anticoag-
ulant, has been tested in an idiopathic pulmonary fibrosis (Anti-
coagulant Effectiveness in Idiopathic Pulmonary Fibrosis, ACE-IPF)
trial [12], because the prothrombotic state is 4 times more likely in
patients with IPF [13]. In addition, some investigators have focused
on the antiviral activity of coumarins [14e16]. Interestingly, pre-
vious studies have found that coumarineimidazole hybrid de-
rivatives show anthelmintic, antibacterial, and antiviral activity
[17e19]. Importantly, coumarineimidazole hybrid derivatives
exhibit antiviral activity against spring viremia of carp virus (SVCV)
and infectious hematopoietic necrosis virus (IHNV), which are
typical rhabdoviruses [20,21]. Hence, it is feasible to identify anti-
nucleoprotein (N), and a nonstructural protein nonvirion (NV))
[24].
In an attempt to address the urgent need for the development of
broad-spectrum anti-rhabdovirus agents, 35 novel coumarin de-
rivatives were designed and synthesised in this study. We identi-
fied these active compounds against IHNV using quantitative real-
time PCR (RT-qPCR) to detect the expression of IHNV. Among these
compounds,
7-((6-(1H-benzo[d]imidazole-1-yl)hexyl)oxy)-
coumarin (A9) exhibited the most remarkable anti-IHNV activity,
based on virus titration assays, cytopathic effect (CPE) analysis,
ultracentrifugation, binding assays, and apoptosis tests. Further-
more, to investigate the broad-spectrum anti-rhabdovirus potential
of A9, we tested the antiviral activity of A9 against two other
rhabdovirus strains, SVCV and micropterus salmoides rhabdovirus
(MSRV), in vitro and in vivo. The horizontal transmission results
suggest that A9 can be used as a potential agent against IHNV
infection in aquaculture. The antiviral activity results demonstrate
the potential of A9 as a broad-spectrum anti-rhabdovirus agent.
2. Results and discussion
2.1. Synthesis of coumarin derivatives
rhabdovirus
derivatives.
agents
among
coumarineimidazole
hybrid
The outlines for the synthesis of the starting and target com-
pounds are presented in Schemes 1 and 2. Firstly, six intermediates
(A1eA5, and A15) were prepared using a general scheme involving
the Williamson reaction. Compounds A6eA14 and A16eA20 were
synthesised in 40e75 % yield by treating the six intermediates with
the corresponding amines and anhydrous potassium carbonate in
acetonitrile at room temperature.
Synthesis of ether coumarin derivatives followed the general
pathway depicted in Scheme 2. In the initial research, ether de-
rivatives (A21-A35) bearing different ether side chains at the
phenolic hydroxyl positions were designed, and synthesised.
Moreover, ether derivatives were obtained by alkylation of
coumarin with different commercially available halohydrocarbons
in anhydrous acetone under reflux conditions.
In this study, IHNV was studied as a model to evaluate the
feasibility of development of broad-spectrum anti-rhabdovirus
drugs. IHNV, which is classified as a member of the Rhabdoviridae
family, is the causative agent of IHN [22]. The notable advantages of
employing IHNV as the model including the following: (1) safety:
aquatic animals constitute the narrow natural host range of IHNV,
and humans are nonsusceptible [23]; (2) widespread distribution
and easy accessibility: IHNV has been isolated from many marine
and freshwater species, such as rainbow trout and Salmo salar [23];
(3) simplicity: similar to other rhabdoviruses, IHNV is a single-
stranded, non-segmented, negative-sense RNA virus that encodes
five structural proteins (RNA-dependent RNA polymerase (L),
glycoprotein (G), matrix protein (M), phosphoprotein (P),
Scheme 1. Synthetic route of coumarin derivatives A1-A20. Reagents and conditions: (a) 1,6-dibromohexane, K2CO3, dry acetone, reflux, 20e24 h; (b) benzimidazole/triazole/3-
hydroxythiophenol/2-aminothiophenol/piperidine/imidazole/2-methylimidazole/4-methylimidazole, K2CO3, CH3CN, r.t., 20e24 h.
2

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Scheme 2. Synthetic route of coumarin derivatives A21-A35. Reagents and conditions: (c) bromomethane/1-bromopropane/1-bromobutane/allyl chloride/3-chloro-2-methyl-1-
propene, K2CO3, dry acetone, reflux, 20e24 h.
2.2. Screening of coumarin derivatives
exhibited an anti-IHNV activity of more than 95 % on the gene
expression of four viral genes (Fig. 2A). The results in Fig. 2 also
show that A9 was effective in reducing the infectivity of IHNV, and
could reduce viral titers and suppress virus-induced CPE in
epithelial papilloma (EPC) cells.
Thirty-five derivatives utilised in the screening study contained
four substructural units corresponding to the linker, terminal,
methyl, and O-biphenyl parts, as shown in Tables 1 and 2. The
derivatives could be classified into two families based on the dif-
ferences in these parts. RT-qPCR was used to detect the anti-IHNV
activity of all the compounds. Tables 1 and 2 provide an overview
of the antiviral activity for each derivative. Four compounds were
approved against IHNV infection, namely 7-((6-(1H-benzo[d]
imidazole-1-yl)hexyl)oxy)-2H-chromen-2-one (A9), 7-((6-(1H-
imidazole-1-yl)hexyl)oxy)-4-methyl-2H-chromen-2-one (A16), 4-
methyl-7-((6-(2-methyl-1H-imidazole-1-yl)hexyl)oxy)-2H-chro-
men-2-one (A17), and 7-((6-(1H-benzo[d]imidazole-1-yl)hexyl)
2.4. Anti-SVCV and anti-MSRV activity of A9 in vitro
To measure the anti-rhabdovirus effect of A9 in vitro, six-point
dose-response curves of RT-qPCR were matched with the expres-
sion of viral N genes which were highly conserved (Fig. 3A and D).
As shown in Fig. 3B and E, A9 was effective in inhibiting the three
rhabdovirus infections in vitro in a dose-dependent manner. The
IC50 of A9 for SVCV and MSRV were 1.68 and 2.12 mM based on
oxy)-4-methyl-2H-chromen-2-one
(A19)
(max
inhibitory
probit analysis, respectively. Moreover, these two rhabdoviruses
were dramatically inhibited after exposure to A9, with maximum
inhibitory rates of 97.86 % and 99.08%, respectively. The decrease
expression of N genes indicated that the replication of these two
rhabdoviruses was inhibited by A9 in vitro. It should be noted that
response: A9, (99.17 %); A16, (82.13 %); A17, (89.47 %); A19, (94.14 %).
To determine the optimal candidate agent, we compared the four
active compounds. We found that the rules reported in the litera-
ture were applicable to the results of the anti-IHNV activity of the
coumarin derivatives. Both the R1 and R2 substituents of the de-
rivatives have an important influence on their antiviral activity
[18,25,26]. The compounds showed the best antiviral effect when
the R1 substituent was a 6-methylene unit and the R2 substituent
was a benzimidazole. In addition, we found that methyl substitu-
tion at position 4 had little effect on the antiviral activity.
A9 at 25 mM had no significant toxicity toward EPC and grass carp
ovary (GCO) cells (Fig. 3B and E). In addition, we evaluated the titers
of the rhabdoviruses after A9 treatment. Consistent with the results
of RT-qPCR, significant inhibition of rhabdoviruses was observed in
A9-treated EPC and GCO cells by measuring the viral titers (Fig. 3C
and F). In accordance with the viral mRNA expression, CPE of
rhabdovirus-infected cells in the presence of A9 decreased signifi-
cantly (Fig. 3G and H). The results shown in Fig. 3 demonstrate that
A9 inhibit rhabdovirus replication in host cells with high efficiency.
We then tested the half-effective concentration (IC50) of the four
active derivatives against IHNV. The results are shown in Fig. 1. The
IC50 values for the four derivatives were 2.96
mM (A9), 7.63 mM
(A16), 6.34 M (A17), and 4.76 M (A19). These results suggest that
m
m
A9 exerts the best anti-IHNV activity among these derivatives.
Therefore, an in-depth study of the application of A9 in aquaculture
is necessary.
2.5. Compound A9 could not damage viral particles directly and did
not interfere with IHNV adsorption
We first co-incubated virus particles with A9, isolated the virus
by ultracentrifugation, and then re-infected the cells with it
(Fig. 4A). The results showed that co-incubation of the virus par-
ticles with the drug did not affect their infectivity, and their pro-
liferation in the cells was not significantly different from that of the
2.3. Anti-IHNV activity of A9 in vitro
First, we tested the inhibitory activity of A9 on the expression of
several genes in IHNV. In accordance with G gene expression, A9
3

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Table 1
The inhibition of IHNV glycoprotein of coumarin derivatives A1-A20.
Compound
A1
Substituent group
R1
Inhibition of IHNV glycoprotein (%)a
0.13 4.21
R2
Br
R3
H
e
A2
A3
A4
A5
-CH2-
-C2H4-
-C4H8-
ꢀ8.24 1.23
2.59 5.23
ꢀ11.24 2.13
-C6H12
-
-
ꢀ16.24 4.53
A6
H
H
5.58 1.59
e
A7
A8
A9
A10
-CH2-
-C2H4-
-C4H8-
-C6H12
27.19 3.89
35.06 1.27
99.17 0.09
46.07 0.90
A11
A12
-C4H8-
39.25 9.34
13.76 4.28
A13
A14
49.32 8.22
5.32 1.34
A15
A16
-C4H8-
-Br
CH3
ꢀ2.34 2.65
82.13 0.81
A17
89.47 1.12
A18
A19
65.14 1.73
94.14 0.44
A20
25.25 3.71
99.07 0.11
Ribavirin
e
e
e
a
Concentration at 25 mM.
untreated virus group (Fig. 4B). In addition, to investigate whether
the drug affects virus-cell recognition, a binding assay was per-
formed. The results shown in Fig. 4 indicate that the drug had no
effect on this phase of virus replication (Fig. 4C and D).
chromatin crinkling, and the appearance of apoptotic vesicles. The
white arrows point to the area where the apoptotic vesicles appear,
and it can be clearly observed that the nuclei in this area have
disappeared, an obvious apoptotic feature. After treatment with the
derivative A9, the morphology of the EPC cells was basically the
same as that of the normal control group, with normal staining of
the cells, normal size of the nuclei, and very few apoptotic vesicles.
The results in Fig. 6 show that 72 h after IHNV infection of EPC
cells, there was a 46.7 % apoptosis rate in the virus group of cell
samples. In contrast, when the derivative A9 was applied, the
2.6. Effects of compound A9 on IHNV-induced apoptosis
As shown in Fig. 5, IHNV-infected cells showed typical apoptotic
features after 72 h, including loss of cell morphology, diffuse nuclei,
blurred nuclear boundaries and a corresponding tendency to lysis,
4

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Table 2
The inhibition of IHNV glycoprotein of coumarin derivatives A21-A35.
Compound
Substituent group
Inhibition of IHNV glycoprotein (%)
R3
R4
A21
A22
A23
A24
A25
H
10.77 3.56
5.73 2.05
22.03 5.98
ꢀ5.86 4.36
14.04 3.74
H
H
H
H
A26
A27
A28
A29
A30
-CH3
-CH3
-CH3
-CH3
-CH3
2.13 4.53
ꢀ1.75 5.97
ꢀ4.37 4.29
ꢀ11.25 3.14
9.37 1.45
A31
A32
A33
A34
A35
H
H
H
H
H
19.46 1.52
9.48 2.38
14.47 3.03
2.46 3.32
9.47 8.76
Ribavirin
99.07 0.11
e
e
a
Concentration at 25 mM.
apoptosis rate was reduced by 40.7 % relative to the virus group,
and the number of normal cells was essentially the same as that in
the control group.
indicated that A9 played an antiviral role to block apoptosis, as well
as protect the host cells.
While the control cells had intact morphology such as nuclei
and chromatin, the EPC cells showed obvious apoptotic features
after IHNV infection (Fig. 7). Typical symptoms included a tendency
for the nucleus to lyse, severe vacuolisation of the cytoplasm and a
large amount of contents flowing out. It is also noteworthy that in
the IHNV-infected group, the number of mitochondria inside the
host EPC cells was significantly reduced. In contrast, the EPC cells
treated with the derivative A9 showed no significant difference
compared with the control cells, and the cell morphology was
maintained at a relatively good condition (Fig. 7A and B).
As shown in Fig. 8, caspase activities in the IHNV-infected cells
increased by 417e383 % (48e72 h) for caspase 3, 101e98 % for
caspase 8, and 73e50 % for caspase 9. A significant decrease in
2.7. Antiviral activity of A9 against SVCV, IHNV and MSRV in vivo
To demonstrate that A9 could be used in aquaculture, an in vivo
antiviral study of A9 was conducted (Figs. 9A, 10A and 10C). As
shown in Figs. 9 and 10, after treatment with A9, the mortality rate
of fish was greatly reduced relative to that of the virus group
(Figs. 9B, 10B and 10D). In accordance with the results of the sur-
vival rate, the titer of the virus decreased after treatment with
derivative A9 (Fig. 9C and D), which also inhibited the proliferation
of the virus in the main organs of the fish (brain, spleen, and
kidney).
2.8. Inhibition of horizontal transmission of IHNV by A9
caspase activity was obvious in response to 25 mM A9 versus the
IHNV treatments: 75e77 % (48e72 h) for caspase 3, 41e29 % for
caspase 8, and 43e32 % for caspase 9. Since caspase 3 is a key
downstream executor of apoptotic pathways [27], these data
Horizontal transmission is an important mode of virus trans-
mission and is one of the most direct causes of pathogen infection
in fish. To verify the potential application of A9, experiments on the
5

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 1. Confirmatory six-point dose-response curves for antiviral activities of four more than 80 % compounds in EPC cells. The percent cytotoxicity on the uninfected host cells was
shown in red, and the percent inhibition in the IHNV G expression assay was shown in blue, respectively. Error bars indicate the SD. Results were from a minimum of three
replicates.
effect of A9 on horizontal transmission of IHNV were conducted in
this study. The results in Fig. 11 show that the virus titer in donor
fish and fish infected with IHNV after A9 treatment were lower
than those in fish treated with IHNV alone (Fig. 11B). In addition,
the expression of the IHNV G gene in the spleen and kidney was
significantly downregulated after immersion of rainbow trout in A9
(Fig. 11C and D). These results suggest that IHNV infection during
horizontal transmission is blocked by A9 to some extent.
both apoptotic pathways, with the death receptor pathway being
mediated by caspase 8 and the mitochondrial pathway being
mediated by caspase 9. Activation of caspases occurs in a hierar-
chical and cascading manner until downstream executors such as
caspase 3 are activated, leading to the onset of apoptosis [36]. The
results of the tests in this study show that the enzymatic activities
of caspases 3, 8, and 9 all increase significantly after IHNV infection,
suggesting that both exogenous and endogenous pathways play a
role in the induction of apoptosis by IHNV. In contrast, derivative A9
restores the expression and enzymatic activity of apoptosis-related
proteins and thus protects cells from apoptosis.
Apoptosis is a genetically controlled process of active cell death
that is induced when the body is stimulated by internal and
external signals. It is an important mechanism by which the body
maintains the homeostasis of its own internal environment and
regulates the function of the immune system and the development
of the body [28,29]. There is a complex relationship between virus
infection and apoptosis. After infecting host cells, the viruses often
need to use the internal material and energy systems of the host
cells to complete their own proliferation and replication; in this
process, the viruses will trigger severe apoptosis and induce a
typical CPE. For example, infection of host cells by transmissible
gastroenteritis coronavirus leads to fragmentation of nucleic acid
material and changes in cell surface structure [30]; Rana grylio virus
infection of fathead minnow cells leads to intracellular chromo-
some abnormalities, DNA fragmentation, and mitochondrial
cleavage [31]. Previous studies have shown that IHNV causes
apoptosis in EPC cells [26]. In contrast, many studies have reported
that coumarin analogues can inhibit apoptosis caused by viruses
[32,33]. For example, coumarin derivatives were able to inhibit
apoptosis caused by SVCV in EPC cells [34]. Therefore, we hypoth-
esised that the antiviral mechanism of derivative A9 is the inhibi-
tion of apoptosis. This speculation was supported by the
observation of apoptotic vesicles and the results of experiments
involving electron microscopy and flow cytometry.
Owing to the
p-p conjugation system contained in their
chemical structure, coumarins can bind to different active sites in
living organisms through a variety of non-covalent modes of action,
and thus a wide range of biological activities, such as anti-tumor
[37], anti-bacterial [38], and antiviral activity [39]. In particularly,
previous studies have indicated that coumarin derivatives exhibit
favorable activity against SVCV in vitro and in vivo [40,41]. These
findings suggest that coumarins are worth developing and can be
put to good use as broad-spectrum antiviral agents.
Hitherto, use of antiviral drugs has been an effective therapeutic
method for the prevention and treatment of viral diseases. Our
previous studies indicated that it was feasible to find anti-
rhabdovirus agents among coumarin derivatives containing an
imidazole skeleton [20,21]. Based on the results, a new derivative
(A9) with six-carbon-atom linker was synthesised in the present
study, to improve drug potency against rhabdovirus infections.
Owing to their susceptibility to IHNV, SVCV, and MSRV, EPC and
GCO cells were used as research models to evaluate the antiviral
activity of A9 in vitro [42e44]. To further investigate the anti-
rhabdovirus activity of A9, its antiviral effects against IHNV, SVCV,
and MSRV were also evaluated in vivo. A9 showed highly efficient
inhibition of IHNV, SVCV, and MSRV replication in host fish. Based
on these results, A9 can be considered an effective antiviral agent
against rhabdoviruses.
The classical apoptotic pathways include the death receptor-
mediated exogenous pathway and the endogenous pathway
mediated by intracellular signalling [35]. The caspase family, a class
of aspartate-dependent cysteine proteases, plays a crucial role in
6

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 2. The anti-IHNV activity of A9 in vitro. (A) The percent inhibition of A9 in the IHNV of N, P, M and L expression assay was shown in olive, blue, red and orange, respectively. (B)
A9 reduced the titers of IHNV in EPC cells. Viral titers were determined by TCID50 at 72 h. (C) A9 reduced the titers of IHNV in EPC cells. Viral titers were determined by TCID50 at
96 h. (D) Morphological effect of A9 are tested on IHNV infection in EPC cells. Each value is represented as the mean SD normalized to values for no treatment. Results were from a
minimum of three replicates. **p < 0.01; *p < 0.05.
3. Conclusion
methyl-7-hydroxycoumarin as the initial compounds (Schemes 1
and 2). All compounds were identified using HRMS, 1H NMR, and
13C NMR. The details are presented in the supplemental materials
and are available online.
In summary, 35 coumarin derivatives were synthesised and
their anti-IHNV activity was evaluated. Derivative A9 was the most
promising compound against IHNV, SVCV, and MSRV in vitro and
in vivo. Mechanistically, A9 blocked IHNV-induced apoptosis to
inhibit virion replication. Importantly, A9 can be a useful thera-
peutic against horizontal transmission of IHNV under static-water
conditions. These results suggest coumarin compounds are worth
developing as broad-spectrum anti-rhabdovirus agents, which will
provide new ideas for the development of green fishing medicines
and new solutions to address the misuse of antivirals.
4.2. Cells, viruses and fish
The EPC and GCO cell lines were kindly provided by Prof. Ling-
Bing Zeng (Yangtze River Fisheries Research Institute, Wuhan,
Hubei, China) and Zhejiang Institute of Freshwater Research (Zhe-
jiang, China), respectively. Cells were cultured in Medium 199
(M199, Hyclone, USA) supplemented with 10 % fetal bovine serum
(FBS; Every Green, China) (M199-10), penicillin (100 IU/mL) and
streptomycin (0.1 mg/mL), and maintained at 25 ꢁC under 5 % CO2.
SVCV (strain 0504) and IHNV (strain Sn-1203) were propagated in
EPC cells until a CPE was observed, and the cells in the culture
medium were harvested and stored at ꢀ80 ꢁC for further use
[43,45]. MSRV (kindly provided by Zhejiang Institute of Freshwater
Research) was propagated in GCO cells at 28 ꢁC [46]. Rainbow trout,
4. Materials and methods
4.1. Synthesis of coumarin derivatives
Based on a previous study [18], 35 coumarin derivatives were
synthesised using 7-hydroxycoumarin, 4-hydroxycoumarin and 4-
7

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 3. The anti-SVCV and MSRV activity of A9 in vitro. (A) Workflow of the experimental design followed in (B). (B) Confirmatory six-point dose-response curves for antiviral
activities of A9 in EPC cells. The percent cytotoxicity on the uninfected host cells was shown in red, and the percent inhibition in the SVCV N expression assay was shown in blue,
respectively. (C) A9 reduced the titers of SVCV in EPC cells. (D) Workflow of the experimental design followed in (E). (E) Confirmatory six-point dose-response curves for antiviral
activities of A9 in GCO cells. The percent cytotoxicity on the uninfected host cells was shown in red, and the percent inhibition in the MSRV N expression assay was shown in blue,
respectively. (F) A9 reduced the titers of MSRV in GCO cells. (G) Morphological effect of A9 are tested on SVCV infection in EPC cells. (H) Morphological effect of A9 are tested on
MSRV infection in GCO cells. Each value is represented as the mean SD normalized to values for no treatment. Results were from a minimum of three replicates. **p < 0.01;
*p < 0.05.
common carp, and largemouth bass farming conditions have been
described in the literature [47,48]. The details are presented in the
supplemental materials and are available online.
materials and are available online. The primer pair sequences are
listed in Table 3 [46e49]. Relative mRNA expression was calculated
using the 2-△△Ct method [50].
4.3. Anti-IHNV, SVCV and MSRV activity assay of A9 in vitro and
in vivo
4.4. Ultracentrifugation assay
IHNV particles (1 ꢂ 103 median tissue culture infective dose
The antiviral activity assay was performed as previously
described [46e48]. The details are presented in the supplemental
(TCID50)) were treated with A9 (25 mM) for 1, 2, and 4 h at
25
0.5 ꢁC. Subsequently, samples were ultracentrifuged at
8

Fig. 4. (A) Workflow of the experimental design followed in (B). (B) qRT-PCR analysis of G encoding gene. Data were shown as mean SEM of three replicate samples of three
independent experiments. (C) Workflow of the experimental design followed in (D). (D) RT-qPCR analysis of the IHNV gene. Data were shown as mean SEM of three replicate
samples of three independent experiments.
Fig. 5. Fluorescence microscopy images of nucleus damage in EPC cells. EPC cells in 12-well plate were treated in the presence or absence of A9 with IHNV infection. The cells were
dyed after 72 h post infection and apoptosis body was detected as arrows indicating.
9

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 6. Compound A9 inhibited apoptosis induced by IHNV in EPC cells. The percentage of viable, early apoptosis and late apoptosis/necrosis cells was assessed by Annexin V/PI
staining at 72 h post-infection. Flow cytometric analysis of apoptosis used Annexin V/PI staining of EPC cells.
Fig. 7. A9 protects the integrity of cells and mitochondria. (A) Scanning electron microscopy image showed the morphological effect of IHNV infection and antivirus activity of A9.
(B) Ultrastructural changes of EPC cells and mitochondria treated with A9.
33000 g for 1.5 h at 4 ꢁC and the pellets were resuspended in
maintenance medium. EPC cells were infected with the treated
virus, and the infectivity was detected 72 h after infection, using RT-
qPCR.
10

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 8. Induction of caspase-3, -8, -9 activities in the EPC cells after exposure to IHNV and A9 for 48 and 72 h. Data were shown as mean SEM of three replicate samples of three
independent experiments. **p < 0.01; *p < 0.05.
Fig. 9. Antiviral activity of A9 against IHNV in rainbow trout. (A) Workflow of the experimental design followed in (BeD). (B) Cumulative survivorship curves of fish intraperi-
toneally injected with IHNV and A9. (C) IHNV infectivity titer in rainbow trout which were infected with IHNV and treated with A9. (D) Expression of IHNV G in brain, kidney and
spleen after injection. Each value was represented as mean SEM. **p < 0.01; *p < 0.05.
4.5. Virus binding assay
4.7. Cohabitation analysis
Briefly, cells were treated with cell media containing 5 % FBS,
Donor fish were infected with 1 ꢂ 105 TCID50/mL IHNV or
treated with M199 alone (mock). Twelve hours after infection,
three donor fish were transferred to each challenge vessel (quiet
UV-sterilized water). Recipient fish were subsequently bathed in
and exposed to IHNV (1 ꢂ 103 TCID50
)
25 mM compound A9 for
30 min at 4 ꢁC to allow virus adhesion but not virus internalization
and replication. After 30 min, the cells were washed and harvested
for RT-qPCR analysis of IHNV expression.
each challenge vessel with 25 mM A9 treatment (vehicle control
was 0.05 % DMSO). After 72 h of co-habitation (holding infected fish
alongside un-infected fish), sampled fish were euthanized in the
laboratory using a washrag soaked with MS-222, and frozen
at ꢀ80 ꢁC. This process was carried out twice. In addition, the
kidneys and spleens were removed from the recipient fish and
immediately frozen in liquid nitrogen for RNA isolation.
4.6. Cellular apoptosis assays
To observe the protective effect of A9 on EPC cells, cellular
apoptosis assays, including fluorescence assay, ultrastructural
analysis, flow cytometry assay and caspase activity assay, were
conducted. The details are presented in the supplemental materials
and are available online.
11

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Fig. 10. Antiviral activity of A9 against SVCV and MSRV in vivo. (A) Workflow of the experimental design followed in (B). (B) Cumulative survivorship curves of common carp
intraperitoneally injected with SVCV and A9. (C) Workflow of the experimental design followed in (D). (D) Cumulative survivorship curves of largemouth bass intraperitoneally
injected with MSRV and A9. **p < 0.01; *p < 0.05.
Fig. 11. Inhibition of A9 on horizontal transmission of IHNV. (A) Workflow of the experimental design. (B) A9 reduced the titers of IHNV. (C and D) Down-regulation of IHNV G gene
expression in recipient fish with A9 treatments. Values represent the mean SD of three replicate samples. **p < 0.01; *p < 0.05.
12

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
Table 3
References
Sequences of primer pairs used for the analysis of gene expression by real-time PCR.
[1] J. Megid, C.M. Appolinario, A.M. Mazzini, M.F. Almeida, Evaluation of cytokines
concentration and percentage of survival of rabies virus-infected mice sub-
mitted to anti-rabies vero-cell propagated vaccine and p. acnes, Vet. Immunol.
Immunopathol. 114 (2006) 192e196.
[2] B. Rao, A. Basu, N.S. Wairagkar, M.M. Gore, V.A. Arankalle, J.P. Thakare,
R.S. Jadi, K. Rao, A. Mishra, A large outbreak of acute encephalitis with high
fatality rate in children in Andhra Pradesh, India, in 2003, associated with
Chandipura virus, Lancet 364 (2004) 869e874.
Genes
Primer sequences (from 50 to 30)
IHNV glycoprotein (G)
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
GCACAAAGGCTCCATCTATC
TGTACTGGGCGACGTATT
IHNV nucleoprotein (N)
IHNV phosphoprotein (P)
IHNV matrix protein (M)
IHNV polymerase (L)
TTAACTTCAACGCCAACAGG
TCGGACAGGTTGATGAGAATG
AATTGCTATTCGGTCCAACC
ATACCCAATTCCGAATCCAAG
ACTCTATGAATCTGGCGGCT
GTTGACCTTTTCTTGGGTGC
CTTCCCATTGTCATCCTCCT
AGCATTTCCACATGGTCACAGG
GCGATACAAGAACAAGGTGG
AGATCAGTGCGTTGACGACA
AACAGCGCGTCTTACATGC
CTAAGGCGTAAGCCATCAGC
GCCCACATCGCATCATTCAC
GTGGCAGAGTAAGGGGACAC
GCTATGTGGCTCTTGACTTCGA
CCGTCAGGCAGCTCATAGCT
GATGATGAAATTGCCGCACTG
ACCGACCATGACGCCCTGATGT
ATGGAAGGTGAAATCGCC
TGCCAGATCTTCTCCATG
[3] I.V. Kuzmin, I.S. Novella, R.G. Dietzgen, A. Padhi, C.E. Rupprecht, The rhabdo-
viruses: biodiversity, phylogenetics, and evolution, Infect. Genet. Evol.
9
(2009) 541e553.
[4] P.L. Moro, E.J. Woo, W. Paul, P. Lewis, B.W. Petersen, M. Cano, Post-marketing
surveillance of human rabies diploid cell vaccine (Imovax) in the vaccine
adverse event reporting system (VAERS) in the United States, 1990‒2015,
PLoS Neglected Trop. Dis. 10 (2016), e0004846.
[5] M. Gotesman, H. Soliman, R. Besch, M. El-Matbouli, Inhibition of spring vir-
aemia of carp virus replication in an E pithelioma papulosum cyprini cell line
by RNA i, J. Fish. Dis. 38 (2015) 197e207.
IHNV non-virion protein (NV)
SVCV nucleoprotein (N)
MSRV nucleoprotein (N)
[6] F.E. Koehn, G.T. Carter, The evolving role of natural products in drug discovery,
Nat. Rev. Drug Discov. 4 (2005) 206e220.
EPC cells
GCO cells
b
-actin
-actin
[7] S.-N. Si-Ahmed, P. Pradat, R. Zoutendijk, M. Buti, V. Mallet, C. Cruiziat,
K. Deterding, J. Dumortier, F. Bailly, R. Esteban, Efficacy and tolerance of a
combination of tenofovir disoproxil fumarate plus emtricitabine in patients
with chronic hepatitis B: a European multicenter study, Antivir. Res. 92 (2011)
90e95.
[8] Y. Luo, X. Ji, J. Liu, Z. Li, W. Wang, W. Chen, J. Wang, Q. Liu, X. Zhang, Moderate
intensity static magnetic fields affect mitotic spindles and increase the anti-
tumor efficacy of 5-FU and Taxol, Bioelectrochemistry 109 (2016) 31e40.
[9] N.K. Chaudhary, P. Mishra, Metal complexes of a novel Schiff base based on
penicillin: characterization, molecular modeling, and antibacterial activity
study, Bioinorgan. Chem. Appl. 4 (2017) 6927675.
b
Rainbow trout
common carp
b
-actin
-actin
-actin
b
GATGATGAAATTGCCGCACTG
ACCAACCATGACACCCTGATGT
CCACCACAGCCGAGAGGGAA
TCATGGTGGATGGGGCCAGG
Largemouth bass
b
[10] D.J. Newman, G.M. Cragg, Natural products as sources of new drugs from 1981
to 2014, J. Nat. Prod. 79 (2016) 629e661.
4.8. Statistical analysis
[11] D. Egan, R. O'kennedy, E. Moran, D. Cox, E. Prosser, R.D. Thornes, The phar-
macology, metabolism, analysis, and applications of coumarin and coumarin-
related compounds, Drug Metab. Rev. 22 (1990) 503e529.
[12] I. Noth, K.J. Anstrom, S.B. Calvert, J. De Andrade, K.R. Flaherty, C. Glazer,
R.J. Kaner, M.A. Olman, A placebo-controlled randomized trial of warfarin in
idiopathic pulmonary fibrosis, Am. J. Respir. Crit. Care Med. 186 (2012) 88e95.
[13] V. Navaratnam, A.W. Fogarty, T. McKeever, N. Thompson, G. Jenkins,
S.R. Johnson, G. Dolan, M. Kumaran, K. Pointon, R.B. Hubbard, Presence of a
The drug response curves followed a logistic sigmoidal function
with a maximal effect level (Amax), and a Hill coefficient indicated
the sigmoidal transition, which was plotted using Origin 8.5. The
data were analyzed by probit analysis, which was used to calculate
the IC50 of the compound at the 95 % confidence interval, using
SPSS 23.0 for Windows (SPSS Inc, an IBM Company, USA). Values
prothrombotic state in people with idiopathic pulmonary fibrosis:
population-based case-control study, Thorax 69 (2014) 207e215.
a
were expressed as means
standard deviations (SD) or
[14] M. Zhu, L. Ma, J. Wen, B. Dong, Y. Wang, Z. Wang, J. Zhou, G. Zhang, J. Wang,
Y. Guo, Rational design and Structure-Activity relationship of coumarin de-
rivatives effective on HIV-1 protease and partially on HIV-1 reverse tran-
scriptase, Eur. J. Med. Chem. 186 (2020) 111900.
[15] Y. Gao, H. Cheng, S. Khan, G. Xiao, L. Rong, C. Bai, Development of coumarine
derivatives as potent anti-filovirus entry inhibitors targeting viral glycopro-
tein, Eur. J. Med. Chem. 204 (2020) 112595.
means standard errors (SEM), and statistical analysis was per-
formed with SPSS 23.0 software (SPSS Inc.), using one-way ANOVA
after normalization to determine significance. Statistical signifi-
cance was set at p < 0.05 (**p < 0.01; *p < 0.05).
[16] J. Neyts, E.D. Clercq, R. Singha, Y.H. Chang, A.R. Das, S.K. Chakraborty,
S.C. Hong, S.C. Tsay, M.H. Hsu, J.R. Hwu, Structure-activity relationship of new
Declaration of competing interest
anti-Hepatitis
Chem. 52 (2009) 1486e1490.
[17] Y. Hu, L. Liu, G.L. Liu, Synthesis and anthelmintic activity of arctigenin de-
rivatives against Dactylogyrus intermedius in goldfish, Bioorg. Med. Chem.
Lett 27 (2017) 3310e3316.
C virus agents: heterobicycle-coumarin conjugates, J. Med.
The authors declare that they have no known competing
financial interests or personal relationships that could have
appeared to influence the work reported in this paper.
[18] Y. Hu, Y. Shen, X. Wu, X. Tu, G.X. Wang, Synthesis and biological evaluation of
coumarin derivatives containing imidazole skeleton as potential antibacterial
agents, Eur. J. Med. Chem. 143 (2018) 958e969.
Acknowledgment
[19] L. Liu, D.W. Song, G.L. Liu, L.P. Shan, T.X. Qiu, J. Chen, Hydroxycoumarin effi-
ciently inhibits spring viraemia of carp virus infection in vitro and in vivo, Zool.
Res. 41 (2020) 395e409.
[20] L. Liu, Y. Hu, J. Lu, G. Wang, An imidazole coumarin derivative enhances the
antiviral response to spring viremia of carp virus infection in zebrafish, Virus
Res. 263 (2019) 112e118.
[21] Y. Hu, W. Chen, Y. Shen, B. Zhu, G.X. Wang, Synthesis and antiviral activity of
coumarin derivatives against infectious hematopoietic necrosis virus, Bioorg.
Med. Chem. Lett 29 (2019) 1749e1755.
[22] A. Ammayappan, S.E. LaPatra, V.N. Vakharia, Molecular characterization of the
virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90, Virol. J.
7 (2010) 1e11.
[23] P. Dixon, R. Paley, R. Alegria-Moran, B. Oidtmann, Epidemiological charac-
teristics of infectious hematopoietic necrosis virus (IHNV): a review, Vet. Res.
47 (2016) 1e26.
[24] A. Ammayappan, V.N. Vakharia, Nonvirion protein of novirhabdovirus sup-
presses apoptosis at the early stage of virus infection, J. Virol. 85 (2011)
8393e8402.
[25] Y. Hu, L. Liu, G.-L. Liu, X. Tu, G.-X. Wang, F. Ling, Synthesis and anthelmintic
activity of arctigenin derivatives against Dactylogyrus intermedius in goldfish,
Bioorg. Med.l chem. Lett. 27 (2017) 3310e3316.
This work was supported by the Agriculture Ministry Key Lab-
oratory of Healthy Freshwater Aquaculture, Key Laboratory of Fish
Health and Nutrition of Zhejiang Province of the Zhejiang Institute
of Freshwater Fisheries (ZJK202105), the General Scientific
Research Project of Education of Zhejiang Province (Y202044089),
the Starting Research Fund of Ningbo University (422011912), the
Natural Science Foundation of China (31902410), the Natural Sci-
ence Foundation of Zhejiang Province (LY21C190002), the Program
of State Key Laboratory for Managing Biotic and Chemical Threats to
the Quality and Safety of Agro-products (KF20200106), the Scien-
tific Innovation Team Project of Ningbo(2015C110018), and the
Foundation of Ningbo City of China (202003N4120).
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.ejmech.2021.113739.
[26] Y. Hu, L. Liu, B. Li, Y. Shen, G.-X. Wang, B. Zhu, Synthesis of arctigenin
13

Y. Hu, L. Shan, T. Qiu et al.
European Journal of Medicinal Chemistry 223 (2021) 113739
derivatives against infectious hematopoietic necrosis virus, Eur. J. Med. Chem.
163 (2019) 183e194.
antitumor activity evaluation, and DNA-binding study of coumarin-based
agents, Arch. Pharm. 351 (2018) 1700199.
[27] G.M. Cohen, Caspases: the executioners of apoptosis, Biochem. J. 326 (1997)
1e16.
[28] S.L. Fink, B.T. Cookson, Apoptosis, pyroptosis, and necrosis: mechanistic
description of dead and dying eukaryotic cells, Infect. Immun. 73 (2005)
1907e1916.
[40] T.X. Qiu, D.W. Song, L.P. Shan, G.L. Liu, L. Liu, Potential prospect of a thera-
peutic agent against spring viraemia of carp virus in aquaculture, Aquaculture
515 (2020) 734558.
[41] D.W. Song, L. Liu, L.P. Shan, T.X. Qiu, J. Chen, J.P. Chen, Rhabdoviral clearance
effect of a phenylpropanoid medicine against spring viremia of carp virus
infection in vitro and in vivo, Aquaculture 526 (2020) 735412.
[42] L. Liu, Y.F. Shen, Y. Hu, J.F. Lu, Antiviral effect of 7-(4-benzimidazole-butoxy)-
[29] A. Wyllie, J.R. Kerr, A. Currie, Cell death: the significance of apoptosis, Int. Rev.
Cytol. 68 (1980) 251e306.
[30] L. Ding, X. Xu, Y. Huang, Z. Li, K. Zhang, G. Chen, G. Yu, Z. Wang, W. Li, D. Tong,
Transmissible gastroenteritis virus infection induces apoptosis through FasL-
and mitochondria-mediated pathways, Vet. Microbiol. 158 (2012) 12e22.
[31] Y.H. Huang, X.H. Huang, J.F. Gui, Q.Y. Zhang, Mitochondrion-mediated
apoptosis induced by Rana grylio virus infection in fish cells, Apoptosis 12
(2007) 1569e1577.
coumarin on rhabdoviral clearance via nrf-2 activation regulated by pkca/b
phosphorylation, Fish Shellfish Immunol. 83 (2018) 386e396.
[43] Y. Hu, Y. Shen, B. Li, G.X. Wang, B. Zhu, Evaluation on the antiviral activity of
ribavirin against infectious hematopoietic necrosis virus in epithelioma pap-
ulosum cyprini cells, Virus Res. 263 (2019) 73e79.
[44] S.J. Lyu, X.M. Yuan, H.Q. Zhang, W.D. Shi, X.Y. Hang, L. Liu, Y.L. Wu, Isolation
[32] L. Liu, T.X. Qiu, D.W. Song, L.P. Shan, J. Chen, Inhibition of a novel coumarin on
an aquatic rhabdovirus by targeting the early stage of viral infection dem-
onstrates potential application in aquaculture, Antivir. Res. 174 (2020)
104672.
[33] L. Liu, Y. Hu, Y.-F. Shen, G.-X. Wang, B. Zhu, Evaluation on antiviral activity of
coumarin derivatives against spring viraemia of carp virus in epithelioma
papulosum cyprini cells, Antivir. Res. 144 (2017) 173e185.
[34] D.W. Song, L. Liu, L.P. Shan, T.-X. Qiu, J. Chen, J.P. Chen, Therapeutic potential
of phenylpropanoid-based small molecules as anti-SVCV agents in aquacul-
ture, Aquaculture 526 (2020) 735349.
and characterization of a novel strain (YH01) of Micropterus salmoides
rhabdovirus and expression of its glycoprotein by the baculovirus expression
system, J. Zhejiang. Uni. Sci. B. 20 (2019) 728e739.
[45] H. Wang, T.X. Qiu, L. Liu, J. Chen, Potential aquatic environmental risks of
trifloxystrobin: enhancement of virus susceptibility in zebrafish through
initiation of autophagy, Zool. Res. 42 (2021) 339e349.
[46] Y.F. Shen, Y.H. Liu, B.Y. Li, T.Q. Liu, G.X. Wang, Evaluation on antiviral activity
of a novel arctigenin derivative against multiple rhabdoviruses in aquaculture,
Virus Res. 285 (2020) 198019.
[47] D.W. Song, L. Liu, Y. Hu, J. Chen, Immune responses and protective efficacy on
4-(2-methoxyphenyl)-3,4-dihydro-2h-chromeno[4,3-d] pyrimidine-2,5 (1h)-
dione against spring viremia of carp virus in vivo, Aquaculture 540 (2021)
736694.
[35] S.E. Tran, A. Meinander, J.E. Eriksson, Instant decisions: transcription-
independent control of death-receptor-mediated apoptosis, Trends Biochem.
Sci. 29 (2004) 601e608.
[36] X. Chen, K. Hao, X. Yu, A. Huang, B. Zhu, G.-x. Wang, F. Ling, Magnolol protects
Ctenopharyngodon idella kidney cells from apoptosis induced by grass carp
reovirus, Fish Shellfish Immunol. 74 (2018) 426e435.
[48] B.Y. Li, Y. Hu, J. Li, S. Kai, B. Zhu, G.X. Wang, Ursolic acid from prunella vulgaris
l. efficiently inhibits IHNV infection in vitro and in vivo, Virus Res. 273 (2019)
197741.
[37] M.A. Salem, M.I. Marzouk, A.M. El-Kazak, Synthesis and characterization of
some new coumarins with in vitro antitumor and antioxidant activity and
high protective effects against DNA damage, Molecules 21 (2016) 249.
[38] D. Dastan, P. Salehi, A. Aliahmadi, A.R. Gohari, H. Maroofi, A. Ardalan, New
coumarin derivatives from Ferula pseudalliacea with antibacterial activity,
Nat. Prod. Res. 30 (2016) 2747e2753.
[49] B. Omkar, C.W. Chen, P.C. Wang, T. Mingan, S.C. Chen, De novo transcriptome
analysis of differential functional gene expression in largemouth bass
(micropterus salmoides) after challenge with nocardia seriolae, Int. J. Mol. Sci.
17 (2016) 1315.
[50] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
DDCT
realtime quantitative PCR and the 2-
method, Methods 25 (2001)
[39] K.M. Amin, A.M. Taha, R.F. George, N.M. Mohamed, F.F. Elsenduny, Synthesis,
402e408.
14