Two structurally analogous ruthenium complexes as naked-eye and reversible molecular "light switch" for G-quadruplex DNA

Article abstract of DOI:10.1016/j.jinorgbio.2014.07.003

A pair of symmetrical furyl based ruthenium(II) complexes ([Ru(phen) ₂dpq-df]^{2 +} (1) and [Ru(bpy)₂dpq-df] ^{2 +} (2) (phen = 1,10-phenanthroline, bpy = 2,2′-bipyridine, dpq-df = dipyrido (3,2-a:2′,3′-c) quinoxaline-difuran) have been prepared and characterized. The binding properties of both complexes toward G-quadruplex DNA have been investigated by fluorescence spectroscopy, UV-Vis spectroscopy, circular dichroism (CD), fluorescence resonance energy transfer (FRET) melting assays and molecular docking studies. The experimental results indicated that both Ru-complexes exhibited a remarkable "light switch" effect in the presence of hybrid G-quadruplex DNA. Interestingly, the "light switch" can be repeated off and on through the successive addition of Cu^{2 +} ions and EDTA, and all these behaviors can be observed even by the naked eyes. Moreover, FRET melting assay revealed that both complexes could be potential stabilizers for G-quadruplex architectures. The computational studies not only confirmed that the two complex molecules bound to one G-quadruplex DNA molecule, but also explained the "light switch" effect.

Full text of DOI:10.1016/j.jinorgbio.2014.07.003

Journal of Inorganic Biochemistry 140 (2014) 64–71
Contents lists available at ScienceDirect
Journal of Inorganic Biochemistry
journal homepage: www.elsevier.com/locate/jinorgbio
Two structurally analogous ruthenium complexes as naked-eye and
reversible molecular “light switch” for G-quadruplex DNA
Xiao-Hui Lu, Shuo Shi ⁎, Jun-Liang Yao, Xing Gao, Hai-Liang Huang, Tian-Ming Yao ⁎
Department of Chemistry, Tongji University, Shanghai 200092, PR China
a r t i c l e i n f o
a b s t r a c t
A pair of symmetrical furyl based ruthenium(II) complexes ([Ru(phen) dpq-df]2+ (1) and [Ru(bpy) dpq-df]
(
2+
Article history:
2
2
Received 25 February 2014
Received in revised form 7 July 2014
Accepted 7 July 2014
2) (phen = 1,10-phenanthroline, bpy = 2,2′-bipyridine, dpq-df = dipyrido (3,2-a:2′,3′-c) quinoxaline-difuran)
have been prepared and characterized. The binding properties of both complexes toward G-quadruplex DNA
have been investigated by fluorescence spectroscopy, UV–Vis spectroscopy, circular dichroism (CD), fluorescence
resonance energy transfer (FRET) melting assays and molecular docking studies. The experimental results indicated
that both Ru-complexes exhibited a remarkable “light switch” effect in the presence of hybrid G-quadruplex DNA.
Interestingly, the “light switch” can be repeated off and on through the successive addition of Cu ions and
EDTA, and all these behaviors can be observed even by the naked eyes. Moreover, FRET melting assay revealed
that both complexes could be potential stabilizers for G-quadruplex architectures. The computational studies not
only confirmed that the two complex molecules bound to one G-quadruplex DNA molecule, but also explained
the “light switch” effect.
Available online 15 July 2014
Keywords:
2
+
Ruthenium complexes
G-quadruplex DNA
Light switch
Naked-eye and reversible
Molecular docking
©
2014 Elsevier Inc. All rights reserved.
1
. Introduction
induces antiparallel quadruplex folding in the human telomeric 22AG
DNA, while K induces a hybrid-type mixed parallel/antiparallel
+
For several decades, G-quadruplex motifs have attracted intense
quadruplex structure in solution condition [18–20]. What's more,
+
research attention with respect to their biological and medical
applications, since they are abundant in functional genomic regions
and involved in the regulation of several key biological processes,
even closely associated with various cancers [1]. For example,
G-quadruplex can form readily from a single strand at the 3′ end
of telomeric DNA 5′-AGGGTTAGGGTTAGGGTTAGGG-3′ (22AG)
and can effectively inhibit telomerase activity by disrupting the
interaction between telomerase and its substrate in 80–85% tumor
cells [2–6]. In addition, the formation of G-quadruplexes in promoter
regions of certain oncogenes such as c-myc and c-kit has been
proposed to regulate the corresponding oncogenes' transcription
it also has been found that quadruplex structure in the presence of K
+
is more stable than that formed in the presence of Na [21].
Polypyridyl-based transition–metal complexes that interact with
DNA have been widely studied, as this class of molecules has potential
as DNA-conformational probes, anticancer drugs, cellular imaging, or
initiators for electron-transfer studies on DNA [22–35]. Among them,
Ru(II) complexes have attracted particular attention due to their
prominent DNA-binding properties and predominant “light switch”
effects for DNA [22–25,28–31]. Since Murphy and Barton reported a
+
classical Ru(II) complex, [Ru(L)
2
(dppz)]2 (L = 2,2′-bipyridine
or 1,10-phenanthroline, dppz = dipyrido[3,2-a:2′,3′-c]phenazine),
which appears to “switch on” in the presence of duplex DNA [36,37],
many researchers have focused on the design of molecular “light
switch” complexes, some have developed a few ways to make the
molecular “light switch” reversible by controlling photoregulation,
temperature or metal ions coupled EDTA treatment [24,28–35]. Those
reversible DNA “light switches” are very appealing in many applications,
such as DNA sensing, the detection of DNA mismatches, molecular-scale
logic gates and the signaling of DNA–protein binding. Recently, our
laboratory has reported several Ru(II) complexes, which could serve
as a prominent molecular “light switch” for G-quadruplex DNA
[28–31,38]. Furthermore, we have developed the first example of a
new G-quadruplex DNA “light switch”, which can be repeatedly cycled
[
7–11]. Moreover, transcribed single-stranded G-rich noncoding
RNA sequences, particularly within mRNA, could readily form
more stable G-quadruplexes in vitro than DNA, and these RNA
quadruplexes could provide the basis for a rational approach toward
translational control of gene expression [12–15]. G-quadruplex DNA
is the resultant of the folding of guanine-rich nucleic acid sequences
into four-base-paired planar unique secondary DNA structures
through Hoogsteen hydrogen bonds among guanines [1–11]. They
are highly dynamic and polymorphic DNA structures [16–21]. It has
been demonstrated that the stability and the folding topology
+
of a quadruplex are dependent on monocations. For instance, Na
4
−
on and off through the addition of [Fe(CN)
6
]
ions and G-quadruplex
⁎
Corresponding authors. Tel: +86 21 6598 3292; fax: +86 21 6598 2287.
E-mail addresses: shishuo@tongji.edu.cn (S. Shi), tmyao@tongji.edu.cn (T.-M. Yao).
DNA [31], and also presented the first example of a pH-controlled
http://dx.doi.org/10.1016/j.jinorgbio.2014.07.003
162-0134/© 2014 Elsevier Inc. All rights reserved.
0

X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
65
reversible visual light switch established on a conformational switch
of G-quadruplex DNA [29]. However, the reversible light switch toward
G-quadruplex DNA which can be observed by the naked eyes is
very limited.
of these oligomer samples were determined by measuring the absor-
bance at 260 nm. Single-strand extinction coefficients were calculated
from mononucleotide data using a nearest-neighbor approximation.
The formation of intramolecular G-quadruplexes was carried out as
follows: the oligonucleotide samples, dissolved in K buffer, were
heated to 90 °C for 5 min, gently cooled to room temperature, and
then incubated at 4 °C overnight.
+
Herein, we report two new ruthenium complexes (Scheme 1)
2
+
2+
[
Ru(phen)
2
dpq-df]
(1) and [Ru(bpy)
2
dpq-df]
(2) (phen =
1
,10-phenanthroline, bpy = 2,2′-bipyridine, dpq-df = dipyrido
(
3,2-a:2′,3′-c) quinoxaline-difuran), as the naked-eye and reversible
molecular “light switch” toward G-quadruplex DNA (22AG).
Symmetrical furyls were introduced to Ru-complexes and dramati-
cally enhanced the emission for G-quadruplex DNA visible detection.
Besides, the light switch effect of G-quadruplex DNA induced by
complex 1 was compared with complex 2. The interactions between
2.2. Synthesis and characterization of [Ru(L)
2 6 2
(dpq-df)](PF )
2.2.1. Furil [39]
1
Firstly, 6.67 mmol (2.00 g) of vitamin B , 4.0 mL of distilled water and
16.0 mL of ethanol were mixed in a flask and cooled to 0 °C. Then, 4.0 mL
of NaOH solution (2 M) and 8.2 mL of furural (freshly concentrated) were
introduced into the mixture and stirred for 24 h at room temperature, and
6.80 g of furoin was collected. Furoin was then oxidized to furil using
+
complexes and G-quadruplex structure in K solution, which is
considered to be biologically more relevant due to its higher intracel-
lular concentration, are extensively investigated in this article.
DNA-binding affinities of these two complexes and the “light switch”
effect are also reasonably explained by density functional theory
CuSO
(16.00 g) of CuSO
4
–C
5
H
5
N as oxidant. The mixture of 9.0 mL water, 64.00 mmol
·5H O and 22.0 mL pyridine was prepared in advance.
4
2
(
DFT) / time-dependent (TD) − DFT calculations.
Afterward, 30.20 mmol (5.80 g) of furoin was added into the reaction
mixture and the solution was refluxed at 74 °C. Two hours later,
100.0 mL of cold water was poured into the flask. Yellow needle-like
crystals were obtained through filtering and washing with water and
methanol, respectively. Yield: 5.30 g, 92%.
2
. Experimental
2
.1. Materials
Furural, vitamin B
1
, aluminum trioxide (200–300 mesh) and
2.2.2. dpq-df
ruthenium trichloride hydrate were obtained from commercial
sources and could be used without further purification unless other-
wise noted. DNA oligomer 5′-AGGGTTAGGGTTAGGGTTAGGG-3′
5,6-Diamino-1,10-phenanthroline was synthesized according to the
literature [40]. 5,6-diamino-1,10-phenanthroline (1.20 mmol, 0.25 g)
and furoin (1.20 mmol, 0.23 g) were dissolved in 20.0 mL of dimethyl
formamide. The mixture was refluxed for 2 days under the atmosphere
of nitrogen. dpq-df was collected via filtration and recrystalliza-
(
22AG), 5′-FAM-[22AG]-TAMRA-3′ (FAM = (5-[[(2-aminoethyl)
amino]carbonyl]-2-(3,6-dihydroxy-9H-xanthen-9-yl)), TAMRA =
6-carboxytetramethylrhodamine)) and 5′-CCCTAACCCTAACCCTAA
(
tion by DMF. Yield: 0.25 g, 57%. 1H NMR [(CD
3 2
) SO]: δ 9.43 (2H, d,
CCCT-3′ (22CT) were purchased from Sangon (Shanghai, China). Calf
thymus DNA (CT-DNA) was obtained from Sigma. The concentrations
J = 8.3 Hz), 9.25 (2H, d, J = 4.8 Hz), 7.98 (4H, m, J = 18.3 Hz),
7.11 (2H, d, J = 3.2 Hz), 6.82 (2H, d, J = 4.7 Hz). Anal. data for
22 4 12 2
C N H O : calc. (%): C, 72.52; H, 3.32; N, 15.38. found (%): C, 72.56;
H, 3.31; N, 15.43.
2
.2.3. [Ru(phen)
Cis-Ru(phen)
according to literature methods [40,41]. Cis-[Ru(phen)
2
(dpq-df)](PF
6 2
) (1)
2
Cl ·2H O and Cis-Ru(bpy)
2
2
2
Cl
2
·2H
2
O were synthesized
Cl ]·2H
0.40 mmol, 0.23 g) and dpq-df (0.60 mmol, 0.22 g) were mixed in
2
2
2
O
(
40.0 mL ethylene glycol/water (7:1, v/v). The reagents were refluxed for
6
h. Upon cooling, the reaction mixture was diluted with 40.0 mL water
and filtered to remove solid impurities. Then, 12.27 mmol (2.00 g)
NH PF was added to the filtrate and the precipitate of crude product
4
6
was dried and collected. The complex was then purified by alumina
chromatography, using toluene/methyl cyanide (3:1, v/v) as eluent
and further recrystallized from acetone/diethyl ether (1:5, v/v).
Yield: 0.30 g, 67%. 1H NMR [(CD
)
SO]: δ 9.49 (2H, d, J = 9.4 Hz),
3
2
8
8
2
.80 (4H, dd, J = 15.3 Hz), 8.41 (4H, s), 8.21 (4H, dd, J = 20.5 Hz),
.07 (4H, t, J = 13.9 Hz), 7.89 (2H, dd, J = 13.6 Hz), 7.79 (4H, m, J =
4.1 Hz), 7.22 (2H, d, J = 4.0 Hz), 6.85 (2H, dd, J = 5.2 Hz). 13C NMR
[
DMSO]: δ 163.46, 154.28, 153.66, 153.19, 150.46, 149.98, 147.68,
1
1
47.66, 146.39, 142.21, 137.43, 137.27, 133.30, 130.99, 130.97, 129.44,
29.35, 128.54, 127.72, 126.82, 126.71, 115.15, 113.17. Anal. data
for C46
H
28
F
12
N
8
O
2
P
2
Ru: calc. (%): C, 49.52; H, 2.53; N, 10.04. found
(
8
%): C, 49.56; H, 2.51; N, 10.17. MALDI-MS for C46 Ru: calc.
25.8 [M] , found 826.1 [M] .
28 8 2
H N O
+
+
2
.2.4. [Ru(bpy)
With 0.40 mmol (0.21 g) Cis-[Ru(bpy)
Cis-[Ru(phen) Cl ]·2H O, this complex was obtained by a procedure
similar to that described for 1. Yield: 0.32 g, 75%. H NMR [(CD
2 6 2
(dpq-df)](PF ) (2)
2
2 2
Cl ]·2H O in place of
2
2
2
1
3 2
) SO]:
δ 9.52 (2H, d, J = 8.3 Hz), 8.88 (4H, dd), 8.26 (4H, m), 8.14 (2H, t,
J = 17.1 Hz), 8.06 (2H, s), 8.01 (2H, dd, J = 16.1 Hz), 7.84 (2H, d, J =
5
.0 Hz), 7.72 (2H, d, J = 5.6 Hz), 7.61 (2H, t, J = 14.2 Hz), 7.38 (2H, t,
1
3
Scheme 1. Synthetic routes for the preparation of complexes 1 and 2.
J = 14.3 Hz), 7.23 (2H, d, J = 4.1 Hz), 6.85 (2H, dd, J = 5.2 Hz).
C

66
X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
NMR [DMSO]: δ 157.30, 157.00, 153.80, 152.40, 152.00, 150.60,
2.3.4. Circular dichroism measurements
1
1
49.70, 146.50, 142.30, 138.56, 138.44, 137.40, 133.50, 129.7,
28.50, 128.23, 127.96, 124.98, 124.88, 115.18, 113.18. Anal. data
Circular dichroism (CD) spectra were performed on a Jasco J-810
spectropolarimeter at room temperature. The 22AG DNA samples at a
concentration of 5 μM were dissolved in K buffer solution (2000 μL)
+
for C42
H
28
F
12
N
8
O
2
P
2
Ru: calc. (%): C, 47.25; H, 2.64; N, 10.49. found
(
%): C, 47.16; H, 2.55; N, 10.52. MALDI-MS for C42 Ru: calc.
H
28
N
8
O
2
in this study. The titration processes were similar to that of fluorescence
titrations. Adding aliquot (5 μL) of Ru complex solution into the DNA
samples respectively until there is no change in spectra. For each
sample, the sample was equilibrated for 5 min and at least three
spectrum scans were accumulated over the wavelength range of
220–400 nm in a 1.0 cm path length cell. The scan of the buffer
alone was subtracted from the average scan for each sample.
+
+
7
77.8 [M] , found 777.0 [M]
The NMR spectra of 1 and 2 have been given in the supplementary
information (Fig. S1).
.
2
.3. Physical measurement
Elemental analyses (C, H and N) were performed on a Perkin-
1
13
Elmer 240C elemental analyzer. H NMR and C NMR spectra of
2.3.5. Thermal DNA denaturation experiments
2
+
[
Ru(L)
2
dpq-df] were recorded on a Bruker DRX-400 NMR spectrom-
SO as solvent and SiMe as an internal standard. Matrix
assisted laser desorption ionization mass spectra (MALDI-MS) were
measured on an Ion Spec HiResMALDI spectrometer.
Fluorescence resonance energy transfer (FRET) melting assays were
carried out on ABI-7500 Real-Time PCR Apparatus. 0.25 μM Double-
tagging 22AG DNA (5′-FAM-[AGGGTTAGGGTTAGGGTTAGGG]-
TAMRA-3′) was incubated in the presence of complex 1 or 2 at different
concentrations for 1 h. Then, tubes were put into a PCR apparatus, and
denaturation of oligonucleotides was performed using the following
protocol: keeping 25 °C for 2 min, and then increasing the temperature
to 95 °C in 0.5 °C increments, and the recording is performed after a 30 s
eter with (CD
)
3 2
4
2
.3.1. Fluorescence titrations and the stoichiometry interactions
Fluorescence spectra titrations were carried out on a Hitachi F-7000
Fluorescence Spectrophotometer at room temperature. Luminescence
titrations of Ru(II) complexes were measured by using fixed ruthenium
concentration (5 μM) with increasing G-quadruplex DNA. The first spec-
trum was taken after 5 min to allow the sample (2000 μL) to equilibrate.
Then, 5 μL of a 100 μM DNA solution was added to the sample cell with
thorough mixing. After 5 min, the spectrum was recorded again. The
titration processes were repeated until there was no apparent change
in the spectra for at least three titrations, indicating the achievement
of the binding saturation. The changes in the sample concentration
were negligible due to dilution at the end of each titration. Besides,
the luminescence behaviors of 1 or 2 with different DNA structures
included human telomeric 22AG DNA (forming an anti-parallel
m
stabilization. T value was calculated by Origin Software.
2.3.6. Computational studies
1 or 2 consists of one Ru(II) ion, one main ligand (dpq-df), and two
ancillary ligands. Geometry optimizations were performed at the
ground state of the complexes in their singlet states. Electronic
structures and vertical singlet/triplet transition energies were
obtained in water using DFT and TD-DFT, respectively. All the
calculations were carried out employing Becke's three parameter
hybrid functional with the Lee–Yang–Parr correlation functional
(B3LYP) method with the Gaussian 03 quantum chemistry program-
package. Ru(II) ion was treated using LANL2DZ basis set, whereas all
the other (C, H, N, O) atoms were treated with the 6-31G* basis set.
Lamarckian aenetic algorithm (LGA) within AutoDock 4.2 was applied
as the molecular docking strategy. When performing molecular
docking, we used the optimized structures directly while setting
the single bonds between dipyrido[3,2-a: 2′,3′-c] quinoxaline and
furan rings rotatable. A 26-mer mixed hybrid-type NMR G-quadruplex
structure (PDB: 2HY9) was used as the templates for the docking
studies. Two adenines located at the end of the initial model were
removed and slight modifications to increase the separation between
loop base pairs and the G-quartet were performed [29,38,42]. The
results were further analyzed using Accelrys Discovery Studio 2.5,
which provided more information on the binding interactions between
the Ru-complex and G-quadruplex DNA.
+
structure in the Na system, whereas a hybrid motif in the presence
of K ), CT-DNA, i-motif (22CT), were investigated by fluorescence
titration. The excitation wavelength was 460 nm and emission spectra
+
were recorded in the region of 500–800 nm.
The stoichiometry interactions between [Ru(L)
2
dpq-df]2+ and
G-quadruplex DNA were obtained by utilizing the method of continu-
ous variation analysis (Job plot). The total concentrations of the two
reactants were held constant at 5 μM, while the mole fraction of the
Ru(II) complex varied from 0 to 1 in 0.1 increments. Job plots for
complexes 1 and 2 were obtained by collecting the emission data at
6
04 nm and 609 nm, respectively.
2
.3.2. The reversibility of the molecular light switch
The final concentrations of the 22AG DNA in K+ solutions and
complexes were adjusted to 2 μM and 3 μM, respectively. The spectra
were measured and color of the samples were recorded by a digital
camera under UV light (Vilber Lourmat, Bio-Print, VL) at 365 nm. Then
3. Results and discussion
2
2
00 μM of copper chloride (CuCl ) was added into the mixed solution
3.1. Fluorescent and binding stoichiometry studies
with thorough mixing. The spectra and color of the reaction mixtures
were taken 10 min later. Next, 400 μM EDTA was added into the
above samples, emission spectra and the color were recorded again.
The fluorescence behaviors of 1 and 2 with G-quadruplex DNA were
investigated. The variations of the emission spectra with successive
additions of 22AG DNA into Ru-complexes are depicted in Fig. 1. The
fluorescence intensity of complexes 1 and 2 manifests 20 and 10-fold
enhancements upon addition of DNA, respectively, behaving like DNA
molecular “light switches”. The emission changes of Ru(II) complexes
due to the addition of the DNA clearly demonstrate that they are
bound to G-quadruplex DNA, and complex 1 reveals a stronger binding
affinity compared to complex 2. Since the octahedral complexes bind to
DNA in three dimensions, the structure changes in the ancillary ligands
of complexes may result in different orientations of the ancillary ligands,
which can play an important role in governing the DNA binding.
Planarity, aromaticity, hydrophobicity and steric hindrance of ancillary
ligands would distinctly affect DNA binding [43–45]. The main ligands
(dpq-df) of complexes 1 and 2 are the same, so their differential
Other eleven metal salts (BaCl
CoCl , FeCl , Cd(NO , SnCl and CaCl
responses with complexes 1 and 2 too.
2
, MgCl
2
, AgNO
3 2 3 2 2
, NiCl , Pb(NO ) , ZnCl ,
2
2
3
)
2
2
2
) were tested for luminescent
2
.3.3. Absorption spectra titrations
To determine the binding affinity between the DNA and complexes,
absorption spectra titrations were carried out by adding aliquot (5 μL) of
buffered DNA solution into the samples containing 1000 μL of a 5 μM Ru
complexes or blank buffer, respectively. The first spectrum was taken in
the range of 200–600 nm after being mixed by repeated inversions
for 5 min. The titration processes were repeated until there was no
apparent change in the spectra for at least four cycles, signifying the
achievement of binding saturation.

X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
67
Fig. 1. Changes in the emission spectra (λex = 460 nm) of 2.5 μM 1 (a) and 2 (b) with increasing concentrations of 22AG DNA (0–4.0 μM) in 10 mM Tris–HCl, 100 mM KCl, pH 7.4. Insets:
plots of [DNA] and the corresponding peak values.
DNA-binding affinities must be attributed to the different ancillary
ligands [46,47]. From the ancillary ligand phen to bpy, planarity,
aromaticity and hydrophobicity of the ancillary ligand phen of complex
different levels of emission quenching, as depicted in Fig. S2. Most
of them could quench the fluorescence more or less, which may be
caused by coordinating with difuryl [48]. Among all tested metal ions,
2
+
1
are greater than those of complex 2, which are advantageous to
the greatest spectral change is observed for Cu . Apparently, upon
addition of Cu2 (200 μM) into the solution, the increased fluorescence
intensity is quenched completely. Given the structure of ligand dpq-df
(dpq-df is a multidentate ligand, besides the nitrogen atoms of
1,10-phenanthroline, there are two free bidentate coordination site,
one oxygen atom of the furyl ring and one nitrogen atom of
pyrazinyl ring), Cu2 ion could coordinate with dpq-df, which provides
a pathway for nonradiative deactivation of the excited state of com-
plexes 1 and 2 [49]. Upon addition of EDTA (ethelenediaminetetraacetic
acid, 400 μM), Cu2 ion could be released from complex 1 or 2 due to
the stronger coordination ability of EDTA than dpq-df, thus, the
quenched luminescence could be recovered [49]. As shown in Fig. 4,
the reversibility of the switch was achieved by the addition of Cu2
and EDTA successively and this dramatic “light switch” effect could
easily be observed by the naked eyes under UV light.
+
G-quadruplex DNA-binding of complex 1. Considering these factors,
the difference of G-quadruplex DNA-binding affinity between com-
plexes 1 and 2 could be well understood. In addition, the selectivity
of the complexes toward G-quadruplex DNA was also studied by
fluorescence measurements and the results were shown in Fig. 2.
We could see that both complexes displayed specificity toward
+
+
G-quadruplex DNA in a K solution, especially for complex 2, indicating
a potential application in the visual detection of a hybrid-type
G-quadruplex DNA.
+
The method of continuous variation analysis was used to determine
the binding stoichiometry between the complexes and G-quadruplex
DNA. The total concentrations of DNA and Ru-complexes were held
constant, while the relative molar ratios changed for each sample,
from 0: 1 (all DNA) to 1: 0 (all complex). The emission data at 604 nm
and 609 nm were used to generate Job plots for complexes 1 and 2,
respectively. The results are displayed in Fig. 3. It is evident that two
complex molecules bind to one molecule of G-quadruplex DNA.
+
3.3. Absorption spectra titrations
The application of electronic absorption spectroscopy in DNA-
binding studies is one of the most useful techniques. The high-energy
band around 264 nm for 1 and 284 nm for 2 are attributed to phen-
centered π → π* transitions and bpy-centered π → π* transitions in
3
.2. The reversibility of the molecular light switch
The strong enhancement of the intrinsic fluorescence of
2
+
2+
2+
[
Ru(L)
2
dpq-df]
when bound to DNA provides a possibility for
comparison with [Ru(phen)
3
]
and [Ru(bpy)
3
]
, respectively.
the visual detection of G-quadruplex DNA. Fluorescence quenching of
The low-energy band at 414 nm for complex 1 is assigned to the
overlap of Ru(dπ) → dpq-df (π*) and Ru(dπ) → phen (π*), while
424 nm for 2 is assigned to the overlap of Ru(dπ) → dpq-df (π*)
and Ru(dπ) → bpy (π*). Here binding affinity of complexes to
22AG DNA was determined by absorption spectra titrations. The
2
+
2+
2+
the above solution using transition metal cations (Cu , Pb , Zn
Ag , Co , Ni , Fe , Mg , Sn , Ba , Ca
,
+
2+
2+
2+
2+
2+
2+
2+
and Cd2+) has also
been examined by detecting the variation of its luminescence intensity
in the presence or absence of them. Addition of metal cations induces
Fig. 2. Specific luminescent recognition of complex 1 (a) or 2 (b) toward G-quadruplex DNA. The concentration of the Ru complexes was 2 μM and the concentration of DNAs was 1 μM.

68
X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
values also indicate that complex 1 bound to G-quadruplex DNA more
tightly than complex 2 did. Compared with the reported similar com-
plexes, both binding constants and binding sizes are comparable to
those of [Ru(phen)
smaller than those of [Ru(L
2
(bppp)](PF
6
)
2
and [Ru(phen)
2
(pppp)](PF
)(dppz)
6
)
2
[17],
)
6 4
1
)(dppz)
2
](PF and [Ru(L
)
6 4
2
2
](PF
(
L
1
= 5,5′-di(1-(trimethylammonio) methyl)-2,2′-dipyridyl cation,
L
2
= 5,5′-di(1-(triethylammonio)methyl)-2,2′-dipyridyl cation,
dppz = dipyrido [3,2-a:2′,3′-c] phenazine) [54]. The results obtained
by absorption spectra titrations are comparable to those obtained by
fluorescence titrations.
3.4. CD measurements
CD spectroscopy was employed to determine the solution confor-
mation of G-quadruplex DNA in the absence or presence of Ru(II)
complexes in 100 mM K buffers. As is shown in Fig. 6, in the absence
Fig. 3. Job plots constructed from mixing the Ru-complexes and 22AG together in variable
ratios but a constant total concentration (2.5 μM) in a K+ buffer (10 mM Tris–HCl, 100 mM
+
KCl, pH 7.4). The peak values of the emission are plotted versus the fraction of complex 1
of Ru(II) complexes, the CD spectrum contains a strong positive peak
at 295 nm with a shoulder peak around 270 nm and a smaller negative
peak at 235 nm, which suggests that 22AG in K solutions existed as a
(black square) and 2 (red diamond). (For interpretation of the references to color in this
figure legend, the reader is referred to the web version of this article.)
+
hybrid-type of quadruplex DNA containing parallel and antiparallel
structures [55,56]. Upon successive additions of the complexes,
no apparent spectral changes were observed in the CD spectrum
(Fig. 6), which implied that the conformation of G-quadruplex was
stabilized by K , and either 1 or 2 could hardly change the conformation
of G-quadruplex at high ionic strength.
extent of the hypochromism and red shift is commonly parallel to
the DNA binding strength [17,45,50]. As shown in Fig. 5, when
2
2AG DNA was added into the complex solutions, a notable red
+
shift and hypochromism in the ligand absorption region, as well
as metal-to-ligand charge transfer (MLCT) band, were observed.
Furthermore, a bigger hypochromism was observed for complex 1
upon addition of the mixed-hybrid quadruplex DNA than that for
complex 2 under the same condition. Addition of 22AG DNA to com-
plex 1 solution leads to a 16 nm red shift and 27.7% hypochromism of
the band at 414 nm, however addition of 22AG DNA to solution 2
leads to a 12 nm red shift and 11.3% hypochromism of the band at
3.5. FRET melting assay
FRET melting assay was used to evaluate the stabilization ability of
the complexes to DNA [57]. The emission of fluorescence is normalized
between 0 and 1, and the T1/2 is defined as the temperature for which
the normalized emission is 0.5. As shown in Fig. 7, the T1/2 of the
4
24 nm. These spectral changes (hypochromism) indicate strong
+
interactions between the DNA bases and the complexes.
In order to further evaluate quantitatively the DNA-binding affinities
of the two complexes, the intrinsic binding constant K is obtained using
the following Eqs. [51–53].
monovalent ion K which induced an intramolecular G-quartet struc-
ture of 22AG DNA sequence was 64 °C. With different concentrations
of complexes added into the 22AG solutions, the T1/2 values increase
notably (Fig. S3). As the ratio of Ru(II) complexes to 22AG equals to
1
0, the good stabilization of G-quadruplex was observed. 1 and 2 induce
ꢂ
ꢃ
+
ꢀ
ꢁ ꢀ
ꢁ
ꢀ
ꢁ
positive T1/2 shifts of +14 and +13 °C in K buffer, respectively. The
results therefore indicate that both complexes 1 and 2 are excellent
stabilizers of G-quadruplex DNA.
1=2
2
2
εa–ε = ε –ε
¼
b– b –2K C ½DNAꢀ=s
=2KCt
ðaÞ
f
b
f
t
b ¼ 1 þ KC þ K½DNAꢀ=2s
ðbÞ
t
3.6. Molecular “light switch” mechanism
where [DNA] is the concentration of DNA in base pair, ε
a
is the
The DFT calculations with B3LYP method are shown to be very
absorption coefficient observed for the absorption band at a given
DNA concentration, ε is the absorption coefficient for free complex
without DNA, ε is the absorption coefficient for the complex in a fully
bound form, K is the equilibrium binding constant in M , C
effective for the biomolecular interactions such as DNA–small molecule
interaction [58–60]. The structures of two Ru complexes were
f
b
optimized applying DFT/B3LYP with the basis set 6-31G* for C, N, O, H
−
1
2+
t
is the
and LanL2DZ for Ru
on Gaussian 03 (Figs. 8 and S4) [61,62]. We
total metal complex concentration and s is the binding site size. The bind-
ing constant K of 1 and 2 toward hybrid-type G-quadruplex DNA is calcu-
lated to be 4.1 × 10 (s = 0.9) and 2.6 × 10 (s = 1.4), respectively. These
could see that the two furan rings preferred not to share plane with
the dpq section.
5
5
To gain insight into the electronic transitions responsible for the
absorption spectra of complexes 1 and 2, first six vertical singlet transi-
tions for both complexes were obtained in water and in vacuum using
TD-DFT with the LanL2DZ/6-31G** basis sets. The corresponding
energies, oscillator strengths, transition contributions, and weighting
factors of calculated lowest-lying excited singlet states of 1 and 2 in
an aqueous solution and vacuum are shown in Tables S1–S4. In vacuum,
1
the largest oscillator strengths (f) for 1 is ES6 (481.28 nm, f = 0.0909,
1
Table S1), while in water, ES4 (436.11 nm, f = 0.4496, Table S2) has
the largest oscillator strengths; in vacuum, the transition is red shifted
compared to those in water, in accordance with the absorption
spectra titration experiments (Fig. 5a), with the addition of 22AG
DNA to complex 1 solution which leads to a 16 nm red shift and the
hypochromism is about 27.7%. While for complex 2, the calculated
1
strongest absorption is ES4 (485.33 nm, f = 0.0888, Table S3)
Fig. 4. Images of the reversible “light switch” behavior of 2 μM 1 and 2 for DNA (1 μM)
under UV light at 365 nm in 10 mM Tris–HCl, 100 mM KCl, pH 7.4.
and 1ES4 (436.99 nm, f = 0.4342, Table S4) in vacuum and water,

X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
69
Fig. 5. Absorption spectra of complex 1 (a) or 2 (b) in the presence of 22AG in K+ (100 mM KCl, 10 mM Tris–HCl, pH 7.4) ([Ru] = 10 μM, [DNA] = 0–10 μM). Insets: plots of (ε
vs. [DNA] for the titration of the Ru(II) complexes.
− ε
)/(ε
a
f
b
f
− ε )
Fig. 6. CD titration of 22AG DNA by adding complex 1 or 2 in K+ buffer (100 mM KCl, 10 mM Tris–HCl, pH 7.4) at 25 °C. CD spectra of (a) 22AG + 1 in K+ buffer; (b) 22AG + 2 in K+ buffer.
respectively, which is also in accordance with the experimental
results (Fig. 5b). To further understand the nature and relative
energies of the frontier orbitals in this system, a cyclic voltammetry
experiment was also carried out, the electrochemical potentials
and energy levels for both complexes were listed in Table S5. The
band gap of 1 was a little larger than 2, and the data obtained from
the calculation was close to experiment.
It has been proposed that the MLCT transition from the Ru(II) to
the distal phz part of the dppz ligand results in a non-emissive state,
whereas the emissive state arises from a charge transfer from the
(determined from the weighing factors), and bright states contained
100% emissive transitions, states that did not fit these criteria were
3
labeled mixed [29]. For complex 1, the first six MLCT transitions
3
3
3
3
3
3
have two BSs ( ES4 and ES6), ES2 was DS; and ES1, ES3 and ES5
were appointed as MSs (Table S6). In aqueous, 3ES3 and 3ES4 of
complex 1 were MSs, the others were DSs (Table S7). However, the
3
3
3
first six MLCT transitions of complex 2 in vacuum, ES6 was BS, ES2
3
was DS, and 3ES1, 3ES3, 3ES4 and ES5 were MSs (Table S8). While
3
3
dissolved in water, the first six MLCT transitions of complex 2 all
belonged to DSs (Table S9), which was caused by the quenching effect
Ru(II) center to the proximal bpy of dppz ligand or the ancillary ligands
3
[
63–65]. Similarly, states with MLCT transitions from the metal center
to the distal portion of the quinoxaline or the two rotatable furan
rings of the main ligand dpq-df in complexes 1 and 2 are expected to
be nonemissive or weakly emissive, whereas states with transitions to
the two ancillary ligands (phen for complex 1 and bpy for complex 2)
or the bpy portion of dpq-df are expected to be emissive. As shown
in Fig. 8, for complex 1 (in vacuum) the LUMO (lowest unoccupied
molecular orbital), LUMO + 1, LUMO + 2, LUMO + 3 and LUMO + 4
were mainly contributed by π*(phen), d* of Ru and π* of bpy part of
the dpq-df ligand, no quinoxaline or furan rings was involved in these
molecular orbitals, while LUMO + 5 and LUMO + 6 were found to be
admixture of π*(dpq-df) and π*(phen). In vacuum, LUMO, LUMO + 1,
LUMO + 2 and LUMO + 6 of 2 were likely to be hybridized orbitals of
π*(bpy), d* of Ru. LUMO + 3, LUMO + 4 and LUMO + 5 of 2 were the
admixture of π*(dpq-df) and π*(bpy).
Fig. 7. Normalized melting curves of G-quadruplex DNA (0.25 μM) measured by Real-time
Several criteria are abided to determine whether states are emissive
PCR system in a K+ buffer (10 mM KH
PO
the Ru(II) complex (black squares), in the presence of 2.5 μM 1 (green triangles) and 2
pink circles), respectively. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of this article.)
2
4 2 4
/K HPO , 100 mM KCl, pH 7.4) in the absence of
(
bright state, BS), nonemissive (dark state, DS), or to possess a mixed
emissive character (mixed state, MS); it should be noted that dark
states possessed N75% of transitions expected to be nonemissive
(

70
X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
Fig. 8. Contour plots of some selected frontier molecular orbitals of 1.
of water. The calculated results showed that both complexes 1 and 2
had BSs in the absence of water, while no BSs in the presence of
water. Complex 1 has a higher intensity than 2, which may be due to
the two BSs for 1 while one BS for 2.
results indicated that both complexes could act as reversible “light
switches” for hybrid-type quadruplex DNA upon the successive
addition of Cu2 and EDTA. The color variation of the switch with
the exchange of on and off states could be clearly discerned by the
naked eye under the radiation of UV light. The results also show that
the “light switch” effect of complex 1 is superior to complex 2, whereas,
complex 2 has a better selectivity toward hybrid G-quadruplex. Both
the luminescence and absorption spectra titrations prove that complex
1 exhibits a better DNA-binding affinity than complex 2, probably
because the auxiliary ligand of 1 (phen) has a stronger hydrophobicity
and larger square π-aromatic surface than 2 (bpy). All the results
suggest that the ancillary ligands could cause interesting differences in
the spectral properties and G-quadruplex DNA-binding behavior of
the corresponding Ru(II) complexes. We hope that our present work
could be valuable for designing new reversible molecular probes,
as well as be helpful for systematic investigations of the interaction
between G-quadruplexes and metal complexes.
+
3
.7. Molecular docking
A 26-mer mixed hybrid-type NMR G-quadruplex structure (PDB:
HY9) was used as the template for the docking studies. Two extra
2
adenines were removed from each terminal of the 26-mer mixed
hybrid-type G-quadruplex before docking, according to literature
[
59,60]. As shown in Figs. 9 and S5, the docking study confirms
that each intramolecular G-quadruplex molecule binds to two
2
+
[
Ru(L)
2
(dpq-df)]
molecules, which verified the Job plot results in
Fig. 3. It has been previously shown that G-quadruplex binders can
stack on the surface of both terminal G-quartet planes. Here, the molec-
+
ular docking suggested that [Ru(L)
2
(dpq-df)]2 bound to the hybrid-
type G-quadruplex structure at both termini (5′ and 3′ terminus) with
potential π–π stacking interactions and hydrogen bonds. The interac-
tion between G-quadruplex and Ru-complex removed water molecules
away from the surface of main ligand (dpq-df), which may cause the
fluorescence emission of the complexes.
Abbreviations
phen
bpy
1,10-phenanthroline
2,2′-bipyridine
dpq-df dipyrido (3,2-a:2′,3′-c) quinoxaline-difuran
dppz
22AG
dipyrido[3,2-a:2′,3′-c]phenazine
5′-AGGGTTAGGGTTAGGGTTAGGG-3′
5′-CCCTAACCCTAACCCTAACCCT-3′
metal to ligand charge transfer
4
. Conclusions
22CT
In summary, two new complexes, [Ru(phen)
2
dpq-df]2+ (1) and
MLCT
FRET
2
+
[
Ru(bpy)
2
dpq-df]
(2), have been synthesized and characterized.
fluorescence resonance energy transfer
Multiple analytical methods were carried out to investigate the
interactions between the complexes and G-quadruplex DNA. The
UV–Vis UV–visible
CD circular dichroism
Fig. 9. The calculated model of 1 binding to the hybrid-type G-quadruplex DNA. (a) G-quartets are displayed in a stick mode; (b) G-quadruplex is rendered with a solvent surface.

X.-H. Lu et al. / Journal of Inorganic Biochemistry 140 (2014) 64–71
71
[
[
[
[
30] S. Shi, J. Zhao, X.T. Geng, T.M. Yao, H.L. Huang, T.L. Liu, L.F. Zheng, Z.H. Li, D. Yang, L.N.
DFT
TD-DFT time-dependent density functional theory
LGA Lamarckian aenetic algorithm
density functional theory
Ji, Dalton Trans. 39 (2010) 2490–2493.
31] S. Shi, J. Zhao, X. Gao, C.Y. Lv, L. Yang, H.L. Huang, J.L. Yao, W.L. Sun, T.M. Yao, L.N. Ji,
Dalton Trans. 41 (2012) 5789–5793.
32] S. Shi, C.Y. Lv, X. Gao, J. Zhao, J.L. Yao, W.L. Sun, H.L. Huang, T.M. Yao, L.N. Ji, Inorg.
Chem. Commun. 24 (2012) 212–215.
33] P. Wu, D.L. Ma, C.H. Leung, S.C. Yan, N. Zhu, Chem. Eur. J. 15 (2009) 13008–13021.
Acknowledgements
[34] S. Shi, S. Gao, T. Cao, J. liu, X. Gao, J. Hao, C. Lv, H. Huang, J. Xu, T. Yao, PLoS ONE 8
2013) e84419.
(
[
35] J. Zhang, F. Zhang, H. Li, C. Liu, J. Xia, L. Ma, W. Chu, Z. Zhang, C. Chen, S. Li, S. Wang,
This work was supported by the National Natural Science
Foundation of China (20901060, 31170776 and 81171646) and the
Fundamental Research Funds for the Central Universities.
Curr. Med. Chem. 19 (2012) 2957–2975.
[36] A.E. Friedman, J.C. Chambron, J.P. Sauvage, N.J. Turro, J.K. Barton, J. Am. Chem. Soc.
12 (1990) 4960–4962.
37] Y. Jenkins, A.E. Friedman, N.J. Turro, J.K. Barton, Biochemistry 31 (1992)
0809–10816.
[38] J.L. Yao, X. Gao, W.L. Sun, S. Shi, T.M. Yao, Dalton Trans. 42 (2013) 5661–5672.
1
[
1
Appendix A. Supplementary data
[
[
[
39] W.W. Hartman, J.B. Dickey, J. Am. Chem. Soc. 55 (1933) 1228–1229.
40] J. Bolger, A. Gourdon, E. Ishow, Inorg. Chem. 35 (1996) 2937–2944.
41] B.P. Sullivan, D.J. Salmon, T.J. Meyer, Inorg. Chem. 17 (1978) 3334–3341.
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.jinorgbio.2014.07.003.
[42] T.N. Hasan, L. Grace B, T.A. Masoodi, G. Shafi, A.A. Alshatwi, P. Sivashanmugham,
Adv. Appl. Bioinforma. Chem. 4 (2011) 29–36.
[
43] A.M. Pyle, J.P. Rehmann, R. Meshoyrer, C.V. Kumar, N.J. Turro, J.K. Barton, J. Am.
References
Chem. Soc. 111 (1989) 3051–3058.
[
[
44] C. Moucheron, A.K.D. Mesmaeker, J. Phys. Org. Chem. 11 (1998) 577–583.
45] S. Shi, J. Liu, J. Li, K.C. Zheng, X.M. Huang, C.P. Tan, L.M. Chen, L.N. Ji, J. Inorg. Biochem.
[
1] J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, J. Am. Chem. Soc. 135
(2013) 367–376.
100 (2006) 385–395.
[
[
2] A.K. Todd, M. Johnston, S. Neidle, Nucleic Acids Res. 33 (2005) 2901–2907.
3] S. Rankin, A.P. Reszka, J. Huppert, M. Zloh, G.N. Parkinson, A.K. Todd, S. Ladame, S.
Balasubramanian, S. Neidle, J. Am. Chem. Soc. 127 (2005) 10584–10589.
[
[
46] J.G. Liu, Q.L. Zhang, X.F. Shi, L.N. Ji, Inorg. Chem. 40 (2001) 5045–5050.
47] A.W. McKinley, J. Andersson, P. Lincoln, E.M. Tuite, Chem. Eur. J. 18 (2012)
15142–15150.
[
[
[
4] G. Biffi, D. Tannahill, J. McCafferty, S. Balasubramanian, Nat. Chem. 5 (2013)
[
[
48] G.M. Bounet, Transit. Met. Chem. 14 (1989) 356–360.
49] P.Y. Zhang, L.M. Pei, Y. Chen, W.C. Xu, Q.T. Lin, J.Q. Wang, J.H. Wu, Y. Shen, L.G. Ji, H.
Chao, Chem. Eur. J. 19 (2013) 15494–15503.
182–186.
5] E. Izbicka, R.T. Wheelhouse, E. Raymond, K.K. Davidson, R.A. Lawrence, D.Y. Sun, B.E.
Windle, L.H. Hurley, D.D. Von Hoff, Cancer Res. 59 (1999) 639–644.
6] R.V. Brown, F.L. Danford, V. Gokhale, L.H. Hurley, T.A. Brooks, J. Biol. Chem. 286
[
50] S. Shi, T.M. Yao, X.T. Geng, L.L. Jiang, J. Liu, Q.Y. Yang, L.N. Ji, Chirality 21 (2009)
2
76–283.
51] S.R. Smith, G.A. Neyhart, W.A. Kalsbeck, H.H. Thorp, New J. Chem. 18 (1994)
97–406.
(2011) 41018–41027.
[
[
[
[
7] S. Neidle, G.N. Parkinson, Curr. Opin. Struct. Biol. 13 (2003) 275–283.
8] T.R. Cech, Angew. Chem. Int. Ed. 112 (2000) 34–43.
9] A. Siddiqui-Jain, C.L. Grand, D.J. Bearss, L.H. Hurley, Proc. Natl. Acad. Sci. U. S. A. 99
3
[52] R.B. Nair, E.S. Teng, S.L. Kirkland, C.J. Murphy, Inorg. Chem. 37 (1998) 139–141.
[53] M.T. Carter, M. Rodriguez, A.J. Bard, J. Am. Chem. Soc. 111 (1989) 8901–8911.
[54] J. Sun, Y. An, L. Zhang, H.Y. Chen, Y. Han, Y.J. Wang, Z.W. Mao, L.N. Ji, J. Inorg.
Biochem. 105 (2011) 149–154.
(2002) 11593–11598.
[
[
[
10] J. Dai, T.S. Dexheimer, D. Chen, M. Carver, A. Ambrus, R.A. Jones, D. Yang, J. Am.
Chem. Soc. 128 (2006) 1096–1098.
11] S. Balasubramanian, L.H. Hurley, S. Neidle, Nat. Rev. Drug Discov. 10 (2011)
61–275.
12] S. Kumari, A. Bugaut, J.L. Huppert, S. Balasubramanian, Nat. Chem. Biol. 3 (2007)
18–221.
13] Y. Xu, K. Kaminaga, M. Komiyama, J. Am. Chem. Soc. 130 (2008) 11179–11184.
14] G. Biffi, M.D. Antonio, D. Tannahill, S. Balasubramanian, Nat. Chem. 6 (2014) 75–80.
15] G.W. Collie, G.N. Parkinson, Chem. Soc. Rev. 40 (2011) 5867–5892.
[
55] Y. Xu, Y. Noguchi, H. Sugiyama, Bioorg. Med. Chem. 14 (2006) 5584–5591.
56] V. Dapic, V. Abdomerovic, R. Marrington, J. Peberdy, A. Rodger, J.O. Trent, P.J. Bates,
Nucleic Acids Res. 31 (2003) 2097–2107.
[
2
[
57] C. Allain, D. Monchaud, M.P. Teulade-Fichou, J. Am. Chem. Soc. 128 (2006)
2
1
1890–11893.
58] S. Shi, J. Liu, J. Li, K.C. Zheng, C.P. Tan, L.M. Chen, L.N. Ji, Dalton Trans. 11 (2005)
038–2046.
[
[
[
[
[
2
[59] S. Agrawal, R.P. Ojha, S. Maiti, J. Phys. Chem. B 112 (2008) 6828–6836.
[60] L.C. Xu, S. Shi, J. Li, S.Y. Liao, K.C. Zheng, L.N. Ji, Dalton Trans. 2 (2008) 291–301.
[61] A. Rajendran, C. Zhao, B. Rajendar, V. Thiagarajan, Y. Sato, S. Nishizawa, N. Teramae,
Biochim. Biophys. Acta, Gen. Subj. 1800 (2010) 599–610.
16] S. Shi, J. Liu, T.M. Yao, X.T. Geng, L.F. Jiang, Q.Y. Yang, L. Cheng, L.N. Ji, Inorg. Chem. 47
(2008) 2910–2912.
[
17] S. Shi, H.L. Huang, G. Xing, J.L. Yao, C.Y. Lv, J. Zhao, W.L. Sun, T.M. Yao, L.N. Ji, J. Inorg.
Biochem. 121 (2013) 19–27.
[
62] M.J. Frisch, G.W. Trucks, H.B. Schlegel, G.E. Scuseria, M.A. Robb, J.R. Cheeseman, J.A.
Montgomery Jr., T. Vreven, K.N. Kudin, J.C. Burant, J.M. Millam, S.S. Iyengar, J.
Tomasi, V. Barone, B. Mennucci, M. Cossi, G. Scalmani, N. Rega, G.A. Petersson, H.
Nakatsuji, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M. Ishida, T.
Nakajima, Y. Honda, O. Kitao, H. Nakai, M. Klene, X. Li, J.E. Knox, H.P. Hratchian, J.
B. Cross, V. Bakken, C. Adamo, J. Jaramillo, R. Gomperts, R.E. Stratmann, O. Yazyev,
A.J. Austin, R. Cammi, C. Pomelli, J.W. Ochterski, P.Y. Ayala, K. Morokuma, G.A.
Voth, P. Salvador, J.J. Dannenberg, V.G. Zakrzewski, S. Dapprich, A.D. Daniels, M.C.
Strain, O. Farkas, D.K. Malick, A.D. Rabuck, K. Raghavachari, J.B. Foresman, J.V.
Ortiz, Q. Cui, A.G. Baboul, S. Clifford, J. Cioslowski, B.B. Stefanov, G. Liu, A. Liashenko,
P. Piskorz, I. Komaromi, R.L. Martin, D.J. Fox, T. Keith, M.A. Al-Laham, C.Y. Peng, A.
Nanayakkara, M. Challacombe, P.M.W. Gill, B. Johnson, W. Chen, M.W. Wong, C.
Gonzalez, J.A. Pople, Gaussian 03, Gaussian, Inc., Wallingford CT, 2004.
[
[
18] Y. Wang, D.J. Patel, Structure 1 (1993) 263–282.
19] A. Ambrus, D. Chen, J. Dai, T. Bialis, R.A. Jones, D. Yang, Nucleic Acids Res. 34 (2006)
2
723–2735.
20] K.N. Luu, A.T. Phan, V. Kuryavyi, L. Lacroix, D.J. Patel, J. Am. Chem. Soc. 128 (2006)
963–9970.
21] P.L. Tran, J.L. Mergny, P. Alberti, Nucleic Acids Res. 39 (2011) 3282–3294.
22] K.E. Erkkila, D.T. Odom, J.K. Barton, Chem. Rev. 99 (1999) 2777–2796.
23] C. Metcalfe, J.A. Thomas, Chem. Soc. Rev. 32 (2003) 215–224.
24] S.P. Foxon, T. Phillips, M.R. Gill, M. Towrie, A.W. Parker, M. Webb, J.A. Thomas,
Angew. Chem. Int. Ed. 46 (2007) 3686–3688.
[
9
[
[
[
[
[
[
[
[
25] J.K. Barton, E.D. Olmon, P.A. Sontz, Coord. Chem. Rev. 255 (2011) 619–634.
26] H.K. Liu, P.J. Sadler, Acc. Chem. Res. 44 (2011) 349–359.
27] A.C. Komor, J.K. Barton, Chem. Commun. 49 (2013) 3617–3630.
28] S. Shi, X.T. Geng, J. Zhao, T.M. Yao, C.R. Wang, D.J. Yang, L.F. Zheng, L.N. Ji, Biochimie
2 (2010) 370–377.
29] J.L. Yao, X. Gao, W.L. Sun, X.Z. Fan, S. Shi, T.M. Yao, Inorg. Chem. 51 (2012)
2591–12593.
[
[
63] A.G. Zhang, Y.Z. Zhang, Z.M. Duan, K.Z. Wang, Inorg. Chem. 50 (2011) 6425–6436.
64] G. Pourtois, D. Beljonne, C. Moucheron, S. Schumm, A.K.D. Mesmaeker, R. Lazzaroni,
J.L. Bredas, J. Am. Chem. Soc. 126 (2004) 683–692.
9
[
[
65] E.R. Batista, R.L. Martin, J. Phys. Chem. A 109 (2005) 3128–3133.
1