Chlorzoxazone metabolism by porcine cytochrome P450 enzymes and the effect of cytochrome b5

Article abstract of DOI:10.1124/dmd.109.030528

Chlorzoxazone (CLZ) is a commonly used nontoxic in vivo and in vitro probe for the assessment of CYP2E1 activity. Human CYP1A1 and CYP3A4 have also been shown to contribute to CLZ metabolism. For pigs to be a potential model system for humans, it is necessary that human and pig cytochromes P450 (P450) have similar metabolizing capabilities. Therefore, CLZ metabolizing capabilities and specificities of porcine P450s were investigated. In this study, the complete coding regions of six porcine P450s were amplified from liver cDNA and cloned into pcDNA3.1/V5-His TOPO vector. Expression vectors for the individual P450s and microsomal cytochrome b₅ (CYB5A) were expressed in the human embryonic kidney HEK-293FT cell line to investigate their role in CLZ metabolism. As with the human enzymes, porcine CYP2E1 (K_m = 290.3 μM and Vmax = 4980 pmol/h/mg total protein) and CYP1A1 (Km = 159.5 μM and V_max = 1650 pmol/h/mg total protein) both contribute to CLZ metabolism. In addition, porcine CYP2A19 and CYP2C33v4 also metabolize the substrate, with K_m = 212.1 μM and V_max = 6680 pmol/h/mg total protein and K_m = 126.3 μM and V_max = 2100 pmol/h/mg total protein, respectively, whereas CYP3A does not. CYB5A augmented CYP2E1 and CYP2C33v4 activity in the pig, with a significant increase in activity of 85 and 73% compared with control, respectively. Thus, CLZ should be used with caution as a probe for CYP2E1 activity in the pig. However, further information regarding the abundance of different P450 isoforms is needed to fully understand their contribution in microsomal, hepatocyte, and in vivo systems in the pig. Copyright

Full text of DOI:10.1124/dmd.109.030528

0
090-9556/10/3805-857–862$20.00
DRUG METABOLISM AND DISPOSITION
Copyright © 2010 by The American Society for Pharmacology and Experimental Therapeutics
DMD 38:857–862, 2010
Vol. 38, No. 5
30528/3582028
Printed in U.S.A.
Chlorzoxazone Metabolism by Porcine Cytochrome P450 Enzymes
and the Effect of Cytochrome b5
P. Wiercinska and E. J. Squires
Department of Animal and Poultry Science, University of Guelph, Guelph, Ontario, Canada
Received September 28, 2009; accepted February 17, 2010
ABSTRACT:
Chlorzoxazone (CLZ) is a commonly used nontoxic in vivo and pmol/h/mg total protein) and CYP1A1 (Km ؍ 159.5 ␮M and
in vitro probe for the assessment of CYP2E1 activity. Human Vmax ؍ 1650 pmol/h/mg total protein) both contribute to CLZ
CYP1A1 and CYP3A4 have also been shown to contribute to CLZ metabolism. In addition, porcine CYP2A19 and CYP2C33v4 also
metabolism. For pigs to be a potential model system for humans, it
metabolize the substrate, with Km ؍ 212.1 ␮M and Vmax ؍ 6680
is necessary that human and pig cytochromes P450 (P450) have pmol/h/mg total protein and Km ؍ 126.3 ␮M and Vmax ؍ 2100
similar metabolizing capabilities. Therefore, CLZ metabolizing pmol/h/mg total protein, respectively, whereas CYP3A does not.
capabilities and specificities of porcine P450s were investi-
gated. In this study, the complete coding regions of six porcine
P450s were amplified from liver cDNA and cloned into
CYB5A augmented CYP2E1 and CYP2C33v4 activity in the pig,
with a significant increase in activity of 85 and 73% compared
with control, respectively. Thus, CLZ should be used with cau-
pcDNA3.1/V5-His TOPO vector. Expression vectors for the indi- tion as a probe for CYP2E1 activity in the pig. However, further
vidual P450s and microsomal cytochrome b5 (CYB5A) were ex- information regarding the abundance of different P450 isoforms
pressed in the human embryonic kidney HEK-293FT cell line to is needed to fully understand their contribution in microsomal,
investigate their role in CLZ metabolism. As with the human
hepatocyte, and in vivo systems in the pig.
enzymes, porcine CYP2E1 (Km ؍ 290.3 ␮M and Vmax ؍ 4980
The CYP2E1 gene is the most highly conserved of all P450s and is muscle relaxant, was first shown to be metabolized by human
found in numerous species including human, mouse, rat, pig, dog, CYP2E1 by Peter et al. (1990) and has since been used as a specific
cow, rabbit, monkey, and even fungi (Overton et al., 2008). This probe substrate in both in vitro and in vivo studies. One of the
enzyme shows broad substrate specificity with more than 80 sub- challenges of choosing probe substrates, apart from sensitivity and
strates identified, most of them being small, hydrophobic compounds, specificity, is that they must be relatively nontoxic to be suitable for
including anesthetics (Lieber, 1997; Ingelman-Sundberg, 2004). use in in vivo studies; CLZ meets this criterion (Court et al., 1997;
There is much interest in exploring the metabolic capabilities of
human CYP2E1, because it contributes to the metabolism of many
compounds ranging from therapeutic agents to procarcinogens and
carcinogens (Raucy et al., 1993; Lieber, 1997). In addition, CYP2E1
expression can be altered by growth hormone, cytokines, ethanol,
thyroid hormone, and insulin (Waxman et al., 1989; Abdel-Razzak
et al., 1993; Lieber, 1997; Peng and Coon, 1998; Emery et al., 2003).
Because of differences in CYP2E1 expression, individuals with dia-
betes, endocrine disorders, or alcoholism may exhibit alterations in
drug metabolism and efficacy (Overton et al., 2008).
Ernstgård et al., 2004). However, the specificity of CLZ as a probe
substrate for human CYP2E1 has been questioned, because other
human P450s contribute to its metabolism (Carriere et al., 1993;
Gorski et al., 1997). Just as in the human, porcine CYP2E1 has been
shown to metabolize CLZ to its major metabolite, 6-OH-CLZ (An-
zenbacherov a´ et al., 2005; Baranov a´ et al., 2005).
Pigs are often explored as potential human models in pharmaceu-
tical studies because of their wide availability and physiological,
dietary, and anatomical similarity to humans (Balk, 1987; Monshou-
wer et al., 1998; Tsiaoussis et al., 2001). Drug development is a
complex process requiring multiple steps before clinical trial testing.
Individual porcine P450 enzymes have been studied to determine how
metabolic capabilities correlate with those found in humans and in
veterinary pharmacology (Juskevich, 1987). Studies have demon-
strated that porcine hepatocytes and microsomal systems are capable
of metabolizing a wide range of human indicator substrates (Bogaards
et al., 2000; Myers et al., 2001; Szot a´ kov a´ et al., 2004). CLZ has also
been used as a probe for porcine CYP2E1activity in pharmaceutical
and agricultural studies (Friis, 1995; Lejus et al., 2002), but as is the
Characterization of the metabolic capabilities of an enzyme usually
involves the use of specific inhibitors and probe substrates as indica-
tors of enzymatic activity. Chlorzoxazone (CLZ), a centrally acting
This work was supported by the Natural Sciences and Engineering Research
Council [Discovery Grant 400066]; and the Ontario Ministry of Agriculture and
Food [Grant 026398] (to E.J.S.).
Article, publication date, and citation information can be found at
http://dmd.aspetjournals.org.
doi:10.1124/dmd.109.030528.
ABBREVIATIONS: P450, cytochrome P450; CLZ, chlorzoxazone; 6-OH-CLZ, 6-hydroxy-chlorzoxazone; HEK293FT, human embryonic kidney cell
line; POR, P450-oxidoreductase/P450 NADPH reductase; CYB5R3, cytochrome b reductase; CYB5A, microsomal cytochrome b ; h, human; Cint,
5
5
intrinsic clearance.
857

8
58
WIERCINSKA AND SQUIRES
case in humans, it is highly likely that other porcine P450 enzymes introduction of the V5-His tag has been shown to not interfere with enzymatic
activity (Handley-Gearhart et al., 1994; Billen and Squires, 2009). The identity
contribute to CLZ hydroxylation. It is important to determine which
of all clones was confirmed by sequencing. The amplified sequence of porcine
porcine enzymes may have a significant contribution to CLZ metab-
CYP3A did not match the sequence of porcine CYP3A29, differing by two
olism if the pig is to be an effective human model. If CLZ is used as
amino acids: Asn4233His and Lys4583Arg. To ensure that this was not a
a marker for CYP2E1 activity, the potency of CYP2E1 inhibitors may
cloning artifact, the sequence of CYP3A was confirmed by identifying its
be underestimated in pharmacological studies if other P450s contrib-
presence in liver cDNA prepared from three different breeds of pigs (York-
ute to CLZ hydroxylation. Commonly used anesthetics are metabo-
lized by CYP2E1 and some, such as propofol, are inhibitors of
shire, Large White, and Sireline).
Cell Culture. HEK-293FT cells (Invitrogen) were cultured in 75-cm flasks
CYP2E1 (Lejus et al., 2002). In addition, the microsomal hemoprotein (Sarstedt, Montreal, QC, Canada) under conditions described previously
6
cytochrome b (CYB5A) has been shown to augment human CYP2E1 (Billen and Squires, 2009). Cells were plated at 10 cells/well in six-well plates
5
activity toward CLZ hydroxylation by apparently acting as an electron (BD Biosciences, Mississauga, ON, Canada). Confluent cells were transfected
donor (Yamazaki et al., 1996, 2002).
with Lipofectamine 2000 (Invitrogen) 24 h after plating. Each transfection
contained 2.35 ␮g of individual P450 expression plasmid along with 0.40 ␮g
of POR, 0.25 ␮g of CYPB5R3, and 1 ␮g of CYB5A. When plasmid amounts
were varied, empty pcDNA3.1/V5-His TOPO vector was used to bring the
total DNA amount up to 4.0 ␮g for each transfection. Twenty-four hours
later, transfected cells were subsequently incubated with various amounts
of CLZ (Sigma-Aldrich, St. Louis, MO) dissolved in dimethyl sulfoxide;
the concentration of organic solvent did not exceed 0.1% in culture.
Substrate was incubated for 24 h and a 1-ml aliquot of media was collected
Most studies use human probe substrates, inhibitors, or antibodies
to characterize P450 enzymes in other species, and this approach
assumes that these compounds are also specific to the particular
porcine isoforms of the human enzymes. However, this is often not
the case. Therefore, to definitively characterize the porcine P450
isoforms that may contribute to CLZ metabolism, we have cloned and
individually expressed various porcine P450s in a cell line system,
eliminating the need for inhibitors and antibodies to identify which for analysis; trials were performed in triplicate. Protein was precipitated
isoforms are present. In this study, we investigated the specificity of from the collected media by the addition of 1/10 volume of trichloroacetic
CLZ metabolism by individually expressing porcine CYP2E1, acid (40% v/v) and centrifuged for 15 min; 100 ␮l of supernatant was then
subjected to HPLC analysis. Cells were scraped into 300 ␮l of radioim-
munoprecipitation assay buffer containing 0.5% sodium deoxycholate, 1%
CYP1A1, CYP2A19, CYP2C33v4, CYP2C49, and CYP3A as well as
human CYP2E1 in human embryonic kidney (HEK-293FT) cells
SDS, and 1% Nonidet P-40 (Sigma-Aldrich) with a Complete protease
along with porcine P450-oxidoreductase. We measured the apparent
inhibitor tablet (Roche, Mississauga, ON, Canada), sonicated for 1 min,
clearance efficacy of CLZ by each enzyme in our model system. We
and then centrifuged to pellet cell debris. The protein concentration was
also investigated the effect of cotransfection with an expression vector
measured using the Bio-Rad protein assay (Bio-Rad Laboratories, Rich-
for CYB5A on the rate of CLZ hydroxylation, because little is known
about the effects of CYB5A on the activity of individual porcine
P450s.
mond, CA).
Western Blot. Western blot analysis was performed as described previously
(Billen and Squires, 2009) with the following modifications. Proteins were
separated on SDS-12% polyacrylamide gels and incubated with a 1:5000
dilution of primary mouse-anti-V5 antibody (Invitrogen) and a 1:24,000 dilu-
tion of secondary goat-anti-mouse-horseradish peroxidase antibody (Sigma-
Materials and Methods
Cloning. The expression vectors for porcine P450-oxidoreductase/P450
NADPH reductase (POR), cytochrome b reductase (CYB5R3), and CYB5A Aldrich). The blot was visualized as described previously (Billen and Squires,
5
were constructed as described previously (Billen and Squires, 2009). To 2009), and band densities were analyzed with Northern Eclipse software
generate expression vectors for the different porcine P450s, the entire coding
(Empix Imaging, Mississauga, ON, Canada). Because all proteins contained
regions of porcine CYP1A1, CYP2A19, CYP2E1, CYP2C33v4, CYP2C49, the V5-His tag, immunostaining with anti-V5 antibody allowed measurement
and CYP3A were amplified from porcine liver cDNA by polymerase chain
reaction using platinum Taq DNA Polymerase High Fidelity (Invitrogen,
Burlington, ON, Canada). The amplicons were then T/A cloned into
pcDNA3.1/V5-His TOPO (Invitrogen) according to the manufacturer’s in-
structions. PCR conditions included an initial denaturation step for 2 min at
of all expressed P450s in individual samples. To ensure that the activity in each
sample was based on equal protein expression across samples, the enzyme
activities were normalized to the protein content of the individually expressed
P450s based on immunoblot band densities.
HPLC Assays. A 100-␮l volume of sample was analyzed by HPLC on a
9
4°C, 30 s at 94°C, and annealing of primers for 15 s at 60.1°C with an C18 reverse-phase column (250 ϫ 4.6 mm, 5 ␮m). The solvent system
extension for 1 min 40 s at 68°C for 35 cycles. A final extension of 10 min was
carried out at 68°C. Primers were designed based on their respective sequences
consisted of buffer A (5% acetonitrile, 95% water, and 0.2% acetic acid) and
buffer B (100% acetonitrile) with a flow rate of 1 ml/min. The gradient used
available from National Center for Biotechnology Information; details are was as follows: 0 min at 80% A, 10 min at 10% A, 15 min r 10% A, 15.1 min
presented in Table 1. A plasmid containing human (h) CYP2E1 was obtained at 80% A, and 20 min at 80% A. CLZ and the 6-OH-CLZ metabolite were
from Origene (Rockville, MD), and the coding region was amplified and
monitored by absorbance at 295 nm; the retention times for 6-OH-CLZ and
cloned into pcDNA3.1/V5-His TOPO (Invitrogen). Expression vectors for CLZ were 6.4 and 9.45 min, respectively.
V5-His tagged proteins were generated so that the levels of the expressed
proteins could be estimated by Western blotting using anti-V5 antibody; the
Data Analysis. Statistical analysis was performed using SAS/STAT
(version 9.1; SAS Institute, Cary, NC). The CYB5A dose response was
TABLE 1
Summary of primers used for PCR amplification of CYP450 isoforms
Forward primers were modified by adding a Kozak sequence (GCC) immediately upstream of the start codon (underlined). Reverse primers were designed to eliminate the original stop
codon of the protein sequence allowing for the incorporation of the V5-His-tag.
Protein
Forward (5Ј-3Ј)
Reverse (5Ј-3Ј)
Plasmid Name
Reference Sequence
Human CYP2E1
Porcine CYP1A1
Porcine CYP2C33v4
Porcine CYP2C49
Porcine CYP2A19
Porcine CYP3A
GCCATGTCTGCCCTCGGAGTC
GCCATGTTCTCTGTGTTTGGA
GCCATGGAGCTGCTGGGAATC
GCCATGGATGGGGCTGTGGT
GCCATGCTGGCCTCAGGC
GCCATGGACCTGATCCCA
GCCATGACTGCCCTGGGC
TGAGCGGGGAATGACACAGAG
AGAGCGCACATGCATCTGGAC
TCTAGGGATGAGGCACAGCTT
TACAGGAATGAAGCGGAGCTG
GCGGGGCTGGAAGCTCATGGT
GGCTCCACTTACGGTCCCATC
CACTTGTGAGCGGGGAATGAC
hCYP2E1
CYP1A1
CYP2C33v4
CYP2C49
CYP2A19
CYP3A
NM_000773.3
NM_214412
NM_214414
NM_214420
NM_214417
NM_214423
AB052259
Porcine CYP2E1
CYP2E1

CHLORZOXAZONE METABOLISM BY PORCINE P450
859
analyzed using linear regression. All kinetic parameters were determined A 73, 85, and Ͼ300% increase in CLZ activity was seen with
using SigmaPlot 8.0 (Systat Software, Inc., San Jose, CA) with Kinetic
CYP2C33v4, CYP2E1, and hCYP2E1 at the highest level of CYB5A
Module software. The Km and Vmax parameters were determined from either
transfected, compared with the control without CYB5A. There was no
the Michaelis-Menten equation (eq. 1) or the Hill equation (eq. 2); exam-
significant response observed by cotransfection of CYB5A with
ination of the Eadie-Hofstee plot was used to determine the most appro-
CYP2A19 or CYP1A1 (data not shown).
priate model. When a “hook”-shaped as opposed to a linear Eadie-Hofstee
plot was observed, the data were fitted using the Hill equation because this
is characteristic of sigmoidal data (Madan et al., 2002).
Discussion
The present study investigated the specificity of CLZ as a probe
V
max ⅐ ͓S͔
substrate for porcine CYP2E1 and the effects of CYB5A on CLZ
catalytic activity. We show that the metabolism of CLZ is not limited
to CYP2E1 in the pig and that CYP1A1, CYP2A19, and CYP2C33v4
also metabolize CLZ. We investigated hCYP2E1 along with porcine
CYP2E1 to compare kinetic parameters for these homologs within the
same system. The apparent Km for porcine CYP2E1 was more than
double that of hCYP2E1, and the Vmax of hCYP2E1 was almost
double that of porcine CYP2E1. Anzenbacherov a´ et al. (2005) found
similar results in microsomal systems, with CLZ hydroxylation in
human greater than in conventional pig. Baranov a´ et al. (2005) also
found that CYP2E1 from minipig exhibited lower affinity for the
substrate in both reconstituted and microsomal systems with Km
values being ϳ1.2- to 4.7-fold greater compared with those for the
human counterpart. CYP2E1 from the minipig and conventional pig is
comparable with sequences differing by a single amino acid: a valine
at position 346 is found in place of an aspartic acid in the conventional
pig (Baranov a´ et al., 2005). Other studies have also concluded that the
enzymatic parameters for CLZ metabolism differ among species.
Bogaards et al. (2000) observed a range of kinetic parameters in
mouse, rat, rabbit, dog, minipig, monkey, and man with Km values
ranging from 25 to 306 ␮M and Vmax values ranging from 285 to 3184
pmol/min/mg microsomal protein. Although the magnitudes of the
apparent kinetic parameters are unique to the system in which they are
studied, the overall conclusion that the porcine CYP2E1 is capable of
CLZ metabolism, although it is less efficient than hCYP2E1 can be
drawn.
␯
ϭ
ϭ
(1)
(2)
K
m
ϩ ͓S͔
n
V
max ⅐ ͓S͔
␯
n
KЈ ϩ ͓S͔
Results
An intact cell system was used to assess the activity of the indi-
vidual P450 isoforms (CYP1A1, CYP2A19, CYP2E1, hCYP2E1,
CYP2C33v4, CYP2C49, and CYP3A) toward CLZ. Initial transfec-
tions consisted of 0.40, 0.70, 0.25, and 1 ␮g of POR, P450, CYB5R3,
and CYB5A plasmid amounts, respectively, because similar band
intensities were obtained for each protein on Western blotting. Typical
Western blots obtained from individual transfections are depicted in
Fig. 1. Pretrials were conducted to determine which P450s were active
in catalyzing CLZ hydroxylation with a CLZ concentration of 400
␮
M. Porcine CYP3A did not produce detectable metabolites and
CYP2C49 produced 10-fold lower metabolite levels than the other
P450s; therefore, these P450s were not chosen for further analysis.
The production of 6-OH-CLZ was linear with increasing amounts of
P450 expression plasmids that were transfected and was linear up to
7
2 h of incubation (data not shown). Control incubations of cells
without P450 plasmid but transfected with POR, CYB5R3, and
CYB5A and treated with CLZ did not produce any detectable 6-OH-
CLZ metabolite (data not shown).
Chlorzoxazone was incubated at 25 to 700, 50 to 900, and 50 to 700
M for transfections with hCYP2E1, porcine CYP2E1, and CYP1A1,
respectively (Fig. 2). The production of 6-OH-CLZ by these P450s
displayed sigmoidal kinetics, and the data were therefore modeled by
the Hill equation. For transfections with CYP2C33v4 and CYP2A19,
chlorzoxazone was incubated at 10 to 600 and 25 to 800 ␮M,
respectively (Fig. 3). The production of 6-OH-CLZ by these P450s
was modeled by the Michaelis-Menten equation. The kinetic param-
eters Km and Vmax along with the Vmax/Km ratio [intrinsic clearance
␮
Evidence supporting the contribution of other porcine P450 en-
zymes to CLZ metabolism has also been reported in literature. Court
et al. (1997) described a two-enzyme model for the metabolism of
CLZ in porcine hepatic microsomes, which suggests the involvement
of two kinetically distinct enzymes with different affinities for the
same substrate (Madan et al., 2002). Skaanild and Friis (2007) argue
that CLZ is a poor probe substrate for porcine CYP2E1; after treat-
ment of porcine microsomes with anti-human CYP2A6 antibody,
CLZ activity was reduced by an average of 65%, suggesting that
porcine CYP2A may contribute equally to metabolism. Myers et al.
(
C )], a measure of enzymatic efficiency toward CLZ clearance, are
int
summarized in Table 2.
The effect of CYB5A on CLZ metabolism was next investigated by
separate cotransfections of increasing amounts of CYB5A expression
plasmid with expression plasmids for hCYP2E1, CYP2E1, CYP2A19,
CYP2C33v4, and CYP1A1. The transfected cells were subsequently
incubated with chlorzoxazone at levels on the linear part of the kinetic
curve; this was 300 ␮M CLZ for hCYP2E1, porcine CYP2E1, and
CYP2A19 and 100 ␮M CLZ for CYP2C33 and CYP1A1. A significant
stimulatory dose response for CYB5A was found for three P450s (Fig. 4).
(
2001) treated barrows with inducers specific for the human CYP1A,
CYP2B, and CYP3A subfamilies, which increased apparent levels of
porcine CYP1A, CYP2B, and CYP3A proteins with no apparent
effect on CYP2A or CYP2E1 levels; however, CLZ activity was
increased in these treated liver fractions. This result suggests that
porcine CYP1A, CYP2B, and CYP3A may also contribute to CLZ
hydroxylation. Our study demonstrates that porcine CYP2A19 and
CYP1A1, but not CYP3A, are active with this substrate. However, it
is possible that other isoforms of CYP3A, which may have CLZ
hydroxylation activity, exist in the pig.
Antibodies and inducers may not have the same specificity for P450
isoforms across different species, and the sources of antibodies used
in experiments may yield various results. The use of individual
porcine cDNA-expressed enzymes allows for a more definitive char-
acterization of the individual enzymes, showing which porcine P450
isoforms are capable of CLZ metabolism. Although we did not quan-
tify the absolute amounts of P450s in our expression system, the
expression level of each P450 was normalized based on the density of
FIG. 1. Example of a typical Western blot showing expressed V5-His tagged
porcine P450s and hCYP2E1 as visualized by staining with anti-V5 antibody. All
P450s are coexpressed with POR, CYB5R3, and CYB5A (data not shown); each
well contains 20 ␮g of protein.

8
60
WIERCINSKA AND SQUIRES
FIG. 2. The production of 6-OH-CLZ by P450 isoforms that dis-
played sigmoidal kinetics and modeled by the Hill equation.
A, hCYP2E1; B, porcine CYP2E1; C, CYP1A1. The corresponding
Eadie-Hofstee plots displaying a hook shape, characteristic of sig-
moidal data, are depicted as insets. Each point represents a mean of
four experiments performed in triplicate (n ϭ 12) Ϯ S.D.
the Western blots that were immunostained for the V5 epitope on each yeast microsomes; however, the turnover numbers reported were
of the enzymes, and this normalization process accounted for small ϳ40-fold lower than that for CYP1A1. Yamazaki et al. (1995) dem-
differences in the levels of expression of the different P450s.
onstrated low levels of CLZ hydroxylation by human CYP3A4 in an
Several human P450s other than hCYP2E1 have been shown to Escherichia coli expression system. In contrast, Gorski et al. (1997)
metabolize CLZ. Masimirembwa et al. (1999) assessed the specific- observed a reduction in metabolism of CLZ after treatment of human
ities of human P450 substrates using microsomal yeast extracts con- microsomes with CYP3A4 inhibitors and antibodies but observed a
taining cDNA-expressed enzymes. CLZ metabolism occurred at a subsequent restoration of activity with the addition of ␣-naphthofla-
high turnover with CYP1A1 in addition to CYP1A2 and CYP2E1. vone, a CYP3A4 inducer. CLZ metabolism was also observed with
Carriere et al. (1993) observed an increase in CLZ metabolism in human CYP2A6 and CYP1A1 expressed in microsomes from B-
human hepatocytes after induction of CYP1A with 3-methylcholan- lymphoblastoid cells. However, treatment of human microsomes with
threne, in addition to microsomal yeast cells engineered to express inhibitors specific for each P450 isoform did not show significant
CYP1A1. Carriere et al. (1993) also reported detectable CLZ hy- inhibition of CLZ activity. Therefore, it was concluded that CYP3A4
droxylation activity by human CYP2C9 and CYP3A4 expressed in may make a significant contribution to CLZ metabolism in vivo,

CHLORZOXAZONE METABOLISM BY PORCINE P450
861
FIG. 4. The significant effect on CLZ hydroxylation by cotransfection with increas-
ing amounts of CYB5A expression plasmid along with expression vectors for
CYP2C33v4 (A), porcine CYP2E1 (B), and hCYP2E1 (C). There was a significant
increase in the CLZ hydroxylation rate by increasing the levels of CYB5A trans-
fection by linear regression analysis (P Ͻ 0.001). Data are presented as a mean of
four experiments performed in triplicate (n ϭ 12) Ϯ S.D.
FIG. 3. The production of 6-OH-CLZ by P450 isoforms that were modeled by the
Michaelis-Menten equation. A, CYP2C33v4; B, CYP2A19. The corresponding
Eadie-Hofstee plots displaying a linear shape are depicted as insets. Each point
represents a mean of four experiments performed in triplicate (n ϭ 12) Ϯ S.D.
TABLE 2
hydroxylation activity are isoform-specific, because it only signifi-
cantly augmented activity of porcine CYP2E1 and CYP2C33v4 and
human CYP2E1. In a study by Yamazaki et al. (1996), the presence
of CYB5A was shown to enhance the catalytic activity of hCYP2E1
toward CLZ, with only 7% activity reported in the absence of
CYB5A. Gillam et al. (1994) also found that metabolism of CLZ was
higher in the presence of human CYB5A with a decrease in Km and
increase in Vmax. Although the exact mechanism of CYB5A in P450
catalysis is unknown, studies using apo-CYB5A, which is devoid of
heme, show no enhancement of activity toward CLZ by hCYP2E1,
suggesting that the contribution of CYB5A is dependent on its elec-
tron-transferring properties (Yamazaki et al., 2002). CYB5A has been
shown to reduce the competition for POR, at least between human
CYP2A6 and CYP2E1, enhancing the activity of CYP2E1, which
Summary of kinetic parameters for CLZ hydroxylation by porcine P450s
and hCYP2E1
Kinetic parameters for hCYP2E1 porcine CYP2E1 and porcine CYP1A1 were modeled by
the Hill equation, because these isoforms displayed sigmoidal kinetics. Kinetic parameters for
porcine CYP2C33v4 and CYP2A19 were modeled by the Michaelis-Menten equation.
P450
K
m
V
max
C
int
␮
M
pmol/h/mg total cell protein
hCYP2E1
CYP2E1
CYP2A19
CYP2C33
CYP1A1
131.8 Ϯ 11.4
290.3 Ϯ 17.4
212.1 Ϯ 39.1
126.3 Ϯ 17.9
159.5 Ϯ 10.0
8650 Ϯ 356
4980 Ϯ 232
6680 Ϯ 441
2100 Ϯ 93.3
1650 Ϯ 55.3
65.6
17.1
31.5
16.6
10.3
whereas CYP2A6 and CYP1A1 probably do not. We did not find
detectable levels of 6-OH-CLZ produced with porcine CYP3A; this
may be an example of a difference in metabolic profiles among suggests that CYB5A enhances electron transfer (Tan et al. (1997).
species.
Studies have reported a lack of effect by CYB5A on the activity of
The effect of CYB5A on the catalytic properties of porcine P450 human CYP1A1/2 toward ethoxyresorufin and phenacetin (Yamazaki
enzymes has not been investigated extensively. The ability of porcine et al. 2002), whereas some have observed a slight augmenting effect
CYB5A to modify the activity of CYP17A1 in the pig has been with 2-aminoanthracene (Duarte et al., 2007). Yamazaki et al. (2002)
reported (Billen and Squires, 2009). The contribution of CYB5A to also reported an augmenting effect of CYB5A on CYP2A6-catalyzed
P450-mediated catalysis is complex and is dependent on the substrate coumarin and nicotine metabolism. We did not find an effect of
and P450 isoform (Schenkman and Jansson, 2003). In some cases, CYB5A on CLZ metabolism with either CYP2A19 or CYP1A1. The
CYB5A can modify the reaction by having an inhibitory or stimula- contribution of the human CYP2C subfamily to CLZ metabolism has
tory effect and in other cases the effect has been shown to be not been reported; Gorski et al. (1997) did not detect 6-OH-CLZ in
obligatory. Our results show that the effects of CYB5A on CLZ B-lymphoblastoid microsomes expressing human CYP2C9. With the

8
62
WIERCINSKA AND SQUIRES
(
2003) CYP2E1 activity before and after weight loss in morbidly obese subjects with
two porcine CYP2C isoforms investigated, only CYP2C33v4 was
efficient in metabolizing CLZ and CYB5A increased this activity.
The tissue content of various P450 isoforms and their activities
determines their contribution to the metabolism of a substrate in vivo
nonalcoholic fatty liver disease. Hepatology 38:428–435.
Ernstgård L, Warholm M, and Johanson G (2004) Robustness of chlorzoxazone as an in vivo
measure of cytochrome P450 2E1 activity. Br J Clin Pharmacol 58:190–200.
Friis C (1995) Is boar taint related to sex differences or polymorphism of skatole metabolism.
Proceedings of the EAAP Working Group on Production and Utilization of Meat from Entire
Male Pigs; 1995 Sept 27–29; Milton Keynes, UK. Meat and Livestock Commission, Milton
Keynes, UK; INRA, Paris, France.
Gillam EM, Guo Z, and Guengerich FP (1994) Expression of modified human cytochrome P450
2E1 in Escherichia coli, purification, and spectral and catalytic properties. Arch Biochem
Biophys 312:59–66.
(
Bertz and Granneman, 1997; Rendic and Di Carlo, 1997). The
contribution of enzymes to reactions is determined by the Vmax/Km
ratio in addition to the levels of their expression. Our results
indicate that CYP2E1, CYP1A1, and CYP2C33v4 have a lower
Vmax/Km ratio than CYP2A19. This result suggests that CYP2A19
is mostly responsible for CLZ hydroxylation; however, the relative
abundance of these isoforms in vivo must be considered. Currently,
information about the abundance of various porcine P450 isoforms
is limited. Kojima and Morozumi (2004) found that hepatic ex-
pression of CYP2C33v4 and CYP2E1 mRNA was greatest, fol-
lowed by CYP2C49 Ͼ CYP1A1 and CYP2A19 Ͼ CYP2B22.
Therefore, it is possible that CYP2C33v4 and CYP2E1 maybe be
the main isoforms responsible for CLZ metabolism. However,
Szot a´ kov a´ et al. (2004) found no correlation between CLZ metab-
olism and CYP2E1 protein from immunoblotting. Thus, conclu-
sions about the contribution of porcine P450s to CLZ metabolism
in vivo are highly depend on liver abundance, which is yet to be
conclusively determined.
In summary, we present definitive evidence for the contribution of
four porcine P450s to CLZ metabolism, with novel information about
the contribution of CYB5A in this metabolism for some isoforms. The
porcine enzymes are similar to their human homologs in terms of CLZ
metabolism and CYB5A augmentation. As in humans, CYP1A1,
CYP2E1, and CYP2A19 are capable of CLZ hydroxylation in pigs.
However, species differences are also evident because the porcine
CYP3A does not metabolize CLZ. We have shown that CYP2C33v4
contributes to CLZ hydroxylation, although human CYP2C9 does not
appear to metabolize CLZ; it is not clear whether other human CYP2C
isoforms do. A better understanding of porcine P450 isoform abun-
dance is needed before conclusions can be drawn about the use of
CLZ as an in vivo probe for porcine CYP2E1.
Gorski JC, Jones DR, Wrighton SA, and Hall SD (1997) Contribution of human CYP3A
subfamily members to the 6-hydroxylation of chlorzoxazone. Xenobiotica 27:243–256.
Handley-Gearhart PM, Stephen AG, Trausch-Azar JS, Ciechanover A, and Schwartz AL (1994)
Human ubiquitin-activating enzyme, E1. Indication of potential nuclear and cytoplasmic
subpopulations using epitope-tagged cDNA constructs. J Biol Chem 269:33171–33178.
Ingelman-Sundberg M (2004) Human drug metabolising cytochrome P450 enzymes: properties
and polymorphisms. Naunyn Schmiedebergs Arch Pharmacol 369:89–104.
Juskevich JC (1987) Comparative metabolism in food-producing animals: programs sponsored
by the Center for Veterinary Medicine. Drug Metab Rev 18:345–362.
Kojima M and Morozumi T (2004) Cloning of six full length cDNAs encoding pig cytochrome
P450 enzymes and gene expression of these enzymes in the liver and kidney. J Health Sci
5
0:518–529.
Lejus C, Fautrel A, Mall e´ dant Y, and Guillouzo A (2002) Inhibition of cytochrome P450 2E1 by
propofol in human and porcine liver microsomes. Biochem Pharmacol 64:1151–1156.
Lieber CS (1997) Cytochrome P-4502E1: its physiological and pathological role. Physiol Rev
7
7:517–544.
Madan A, Usuki E, Burton LA, Ogilvie WB, and Parkinson A. (2002) In vitro approaches for
studying the inhibition of drug-metabolizing enzymes and identifying the drug-metabolizing
enzymes responsible for the metabolism of drugs, in Drugs and The Pharmaceutical Sciences:
Drug-Drug Interactions (Rodrigues AD ed) pp 217–294, Marcel Dekker, New York.
Masimirembwa CM, Otter C, Berg M, J o¨ nsson M, Leidvik B, Jonsson E, Johansson T, B a¨ ckman
A, Edlund A, and Andersson TB (1999) Heterologous expression and kinetic characterization
of human cytochromes P-450: validation of a pharmaceutical tool for drug metabolism
research. Drug Metab Dispos 27:1117–1122.
Monshouwer M, van’t Klooster GA, Nijmeijer SM, Witkamp RF, and van Miert AS (1998)
Characterization of cytochrome P450 isoenzymes in primary cultures of pig hepatocytes.
Toxicol In Vitro 12:715–723.
Myers MJ, Farrell DE, Howard KD, and Kawalek JC (2001) Identification of multiple consti-
tutive and inducible hepatic cytochrome P450 enzymes in market weight swine. Drug Metab
Dispos 29:908–915.
Overton CL, Hudder A, and Novak FR (2008) The CYP2E subfamily, in Cytochrome P450: Role
in the Metabolism and Toxicity of Drugs and Other Xenobiotics (Ioannides C ed) pp 276–308,
Royal Society of Chemistry, Cambridge, UK.
Peng HM and Coon MJ (1998) Regulation of rabbit cytochrome P450 2E1 expression in HepG2
cells by insulin and thyroid hormone. Mol Pharmacol 54:740–747.
Peter R, B o¨ cker R, Beaune PH, Iwasaki M, Guengerich FP, and Yang CS (1990) Hydroxylation
of chlorzoxazone as a specific probe for human liver cytochrome P-450IIE1. Chem Res
Toxicol 3:566–573.
Raucy JL, Kraner JC, and Lasker JM (1993) Bioactivation of halogenated hydrocarbons by
cytochrome P4502E1. Crit Rev Toxicol 23:1–20.
Rendic S and Di Carlo FJ (1997) Human cytochrome P450 enzymes: a status report summarizing
their reactions, substrates, inducers, and inhibitors. Drug Metab Rev 29:413–580.
Schenkman JB and Jansson I (2003) The many roles of cytochrome b5. Pharmacol Ther
References
9
7:139–152.
Abdel-Razzak Z, Loyer P, Fautrel A, Gautier JC, Corcos L, Turlin B, Beaune P, and Guillouzo
A (1993) Cytokines down-regulate expression of major cytochrome P-450 enzymes in adult
human hepatocytes in primary culture. Mol Pharmacol 44:707–715.
Anzenbacherov a´ E, Baranov a´ J, Zuber R, Pechov a´ A, Anzenbacher P, Soucek P, and Martínkov a´
J (2005) Model systems based on experimental animals for studies on drug metabolism in man:
Skaanild MT and Friis C (2007) Is bupropion a more specific substrate for porcine CYP2E than
chlorzoxazone and p-nitrophenol? Basic Clin Pharmacol Toxicol 101:159–162.
Szot a´ kov a´ B, Baliharov a´ V, Lamka J, Nozinov a´ E, Ws o´ l V, Velík J, Machala M, Neca J, Soucek
P, Susov a´ S, et al. (2004) Comparison of in vitro activities of biotransformation enzymes in
pig, cattle, goat and sheep. Res Vet Sci 76:43–51.
Tan Y, Patten CJ, Smith T, and Yang CS (1997) Competitive interactions between cytochromes
P450 2A6 and 2E1 for NADPH-cytochrome P450 oxidoreductase in the microsomal mem-
branes produced by a baculovirus expression system. Arch Biochem Biophys 342:82–91.
Tsiaoussis J, Newsome PN, Nelson LJ, Hayes PC, and Plevris JN (2001) Which hepatocyte will
it be? Hepatocyte choice for bioartificial liver support systems. Liver Transpl 7:2–10.
Waxman DJ, Morrissey JJ, and LeBlanc GA (1989) Female-predominant rat hepatic P-450 forms
j (IIE1) and 3 (IIA1) are under hormonal regulatory controls distinct from those of the
sex-specific P-450 forms. Endocrinology 124:2954–2966.
Yamazaki H, Guo Z, and Guengerich FP (1995) Selectivity of cytochrome P4502E1 in chlor-
zoxazone 6-hydroxylation. Drug Metab Dispos 23:438–440.
Yamazaki H, Nakamura M, Komatsu T, Ohyama K, Hatanaka N, Asahi S, Shimada N,
Guengerich FP, Shimada T, Nakajima M, et al. (2002) Roles of NADPH-P450 reductase and
apo- and holo-cytochrome b5 on xenobiotic oxidations catalyzed by 12 recombinant human
cytochrome P450s expressed in membranes of Escherichia coli. Protein Expr Purif 24:329–
(
mini)pig cytochromes P450 3A29 and 2E1. Basic Clin Pharmacol Toxicol 96:244–245.
Balk MW (1987) Emerging models in the USA: swine, woodchucks and the hairless guinea pig,
in Animal Models: Assessing the Scope of Their Use in Biomedical Research (Kawamata J and
Melby EC eds) pp 311–326, Alan R. Liss, New York.
Baranov a´ J, Anzenbacherov a´ E, Anzenbacher P, and Soucek P (2005) Minipig cytochrome P450
2
E1: comparison with human enzyme. Drug Metab Dispos 33:862–865.
Bertz RJ and Granneman GR (1997) Use of in vitro and in vivo data to estimate the likelihood
of metabolic pharmacokinetic interactions. Clin Pharmacokinet 32:210–258.
Billen MJ and Squires EJ (2009) The role of porcine cytochrome b5A and cytochrome b5B in
the regulation of cytochrome P45017A1 activities. J Steroid Biochem Mol Biol 113:98–104.
Bogaards JJ, Bertrand M, Jackson P, Oudshoorn MJ, Weaver RJ, van Bladeren PJ, and Walther
B (2000) Determining the best animal model for human cytochrome P450 activities: a
comparison of mouse, rat, rabbit, dog, micropig, monkey and man. Xenobiotica 30:1131–
1
152.
Carriere V, Goasduff T, Ratanasavanh D, Morel F, Gautier JC, Guillouzo A, Beaune P, and
Berthou F (1993) Both cytochromes P450 2E1 and 1A1 are involved in the metabolism of
chlorzoxazone. Chem Res Toxicol 6:852–857.
Court HM, Von Moltke LL, Shader IR, and Greenblatt JD (1997) Biotransformation of CLZ by
hepatic microsomes from humans and ten other mammalian species. Biopharm Drug Dispos
3
37.
Yamazaki H, Nakano M, Gillam EM, Bell LC, Guengerich FP, and Shimada T (1996) Require-
ments for cytochrome b5 in the oxidation of 7-ethoxycoumarin, chlorzoxazone, aniline, and
N-nitrosodimethylamine by recombinant cytochrome P450 2E1 and by human liver micro-
somes. Biochem Pharmacol 52:301–309.
1
8; 213–226.
Duarte MP, Palma BB, Gilep AA, Laires A, Oliveira JS, Usanov SA, Rueff J, and Kranendonk
M (2007) The stimulatory role of human cytochrome b5 in the bioactivation activities of
human CYP1A2, 2A6 and 2E1: a new cell expression system to study cytochrome P450-
mediated biotransformation (a corrigendum report on Duarte et al. (2005) Mutagenesis 20,
Address correspondence to: Dr. E. J. Squires, Department of Animal and
Poultry Science, University of Guelph, Guelph, ON, Canada N1G 2W1. E-mail:
jsquires@uogulph.ca
9
3–100). Mutagenesis 22:75–81.
Emery MG, Fisher JM, Chien JY, Kharasch ED, Dellinger EP, Kowdley KV, and Thummel KE