Full text of DOI:10.1089/105072501750362763

THYROID
Volume 11, Number 7, 2001
Mary Ann Liebert, Inc.
Congenital Goiter with Hypothyroidism Caused by a
9 Splice Site Mutation in the Thyroglobulin Gene
5
1
1
1
1
Héctor M. Targovnik, Carina M. Rivolta, Fernando M. Mendive, Christian M. Moya,
2
2
Jussara Vono, and Geraldo Medeiros-Neto
In this work we have extended our initial molecular studies of a consanguineous family with two affected
goitrous siblings (H.S.N. and Ac.S.N.) with defective thyroglobulin (Tg) synthesis and secretion because of a
homozygotic deletion of a fragment of 138 nucleotides (nt) in the central region of the Tg mRNA, identified
previously in H.S.N. In order to identify the intron/exon boundaries and to analyze the regions responsible
for pre-mRNA processing corresponding to a 138 nt deletion, we performed a screening of a human genomic
library. The intron/exon junction sequences were determined from one positive clone by sequencing both
strands of the DNA template. The results showed that the deletion mapped between positions 5549 and 5686
of the Tg mRNA and corresponded to exon 30. The positions of the exon limits differed by three nucleotides
from the previously reported data obtained from direct sequencing of the deleted reverse transcriptase-poly-
merase chain reaction fragment from H.S.N. These variations are because the intron/exon junctions in this re-
gion were not available at the time when the deletion was first described. The deletion does not affect the read-
ing frame of the resulting mRNA and is potentially fully translatable into a Tg polypeptide chain that is
shortened by 46 residues. The same 138 nt deletion was observed in reverse transcriptase-polymerase chain re-
action studies performed in the thyroid tissues from Ac.S.N. Genomic DNA analysis showed that a G to T trans-
version was observed at position 11 in the donor site of intron 30. Both affected patients (H.S.N. and Ac.S.N.)
are homozygous for the mutation whereas the normal sister (At.S.N.) had a normal allele pattern. The func-
tional consequences of the deletion are related to structural changes in the protein molecule that either could
modify the normal routing of the translation product through the membrane system of the cell or could im-
pair the coupling reaction. Probably the mutant Tg polypeptide might be functionally active in the production
of thyroid hormone, because in the presence of a normal iodine ingestion (,150 mg/day), Ac.S.N. was able to
maintain normal serum levels of total triiodothyronine (T ) associated with relatively low serum total thyrox-
3
ine (T ) with normal somatic development without signs of brain damage.
4
Introduction
lecular studies revealed that exon 4 was missing from the
major Tg transcript in the goiter and that this aberrant splic-
HYROGLOBULIN (Tg) is a large glycoprotein that functions ing was due to a C to G transversion at position 23 in the
T
as the matrix for thyroid hormone synthesis and in stor- acceptor splice site of intron 3.
age of the inactive form of thyroid hormone and of iodine
1). The human Tg gene is a 300-kb unit containing 8.5 kb of position 1511 in exon 22 has been described in a study of
exon material, localized in chromosome 8 (8q24.2—8q24.3) family with congenital goiter (4). Two siblings were affected
1). The number of exons has been estimated as 48 (2). Sev- with goiter and hypothyroidism, whereas the father and
A cytosine to thymine transition creating a stop codon at
(
(
eral mutations in the Tg gene have been reported and are as- three other siblings had normal thyroid function. However,
sociated with congenital goiter and variable degrees of hy- were heterozygous for the nonsense mutation. This implies
pothyroidism (3–8).
that an additional mutation must be present in the affected
Ieiri et al. (3) reported a hypothyroid woman with con- individuals, generating a compound heterozygote genotype
genital goiter and marked impairment of Tg synthesis. Mo- (5).
1División Genética, Hospital de Clínicas “José de San Martín” and Cátedra de Genética y Biología Molecular, Facultad de Farmacia y
Bioquímica, Universidad de Buenos Aires, Buenos Aires, Argentina.
2
Laboratório Molecular de Tireóide (LIM-25), Division of Endocrinology, Hospital das Clínicas, Fac. Medicina Universidade de São
Paulo, São Paulo, Brazil.
6
85

686
TARGOVNIK ET AL.
More recently, van de Graaf et al. (6) identified a C to T Screening of a human genome library
transition at nucleotide (nt) position 886 in exon 7, creating
a stop codon at amino acid Arg 277 in three siblings from a
consanguineous marriage, with goiter and a moderate de-
gree of hypothyroidism. Additional analysis of the pedigree
indicated that the homozygous nonsense mutation cosegre-
gated with the clinical phenotype.
An aliquot of a human genomic library made of l Dash II
recombinant phages (Stratagene, La Jolla, Ca) was plated on
Escherichia coli XL1-BlueMRA and screened by the filter
replica method using reverse transcriptase-polymerase chain
reaction (RT-PCR) fragments as hybridization probes: PCR
2
.2, PCR 3.1, PCR 3.2, and PCR 3.3 (9). The probes mapping
Another report has indicated that cysteine substitutions
in the central region of the Tg mRNA (nt 3012–6010), ac-
cording to new cDNA numbering. Prehybridization, hy-
bridization, and washing of the filters were performed as de-
scribed by Mendive et al. (2).
(
C1245R and C1977S in exons 17 and 33, respectively) cause
an abnormal three-dimensional structure of Tg and defective
intracellular transport of Tg (7).
We have previously identified a 138-nt deletion in the Tg
mRNA in one member of a family with a history of con-
genital goiter (8). The affected members (two siblings) had Screening of recombinant positive phages by PCR and
congenital goiter, variable degrees of hypothyroidism, and DNA sequencing of recombinant phages
marked impairment of Tg synthesis. The diagnosis of defec-
The DNA from aliquots of the each positive phage stocks,
tive Tg was based on low serum total thyroxine (T4), low
obtained in the screening by plate hybridization, was puri-
serum total triiodothyronine (T3) (H.S.N.) or normal serum
fied by proteinase K treatment and phenol extraction.
total T3 (Ac.S.N.), a negative perchlorate discharge test, and
The polymerase chain reaction (PCR) was performed in
00 mL, using a standard PCR buffer (Gibco BRL, Life Tech-
the virtual absence of the serum Tg response to challenge by
bovine thyrotropin (TSH).
In the present article, we extend our initial molecular stud-
ies to show that the affected members of this family have an
aberrant splicing because of a G to T transvertion at position
1
nology, Gaithersburg, MD), containing 2.5 mM MgCl2, 200
mM each dNTP (dATP, dCTP, dTTP, and dGTP), 4% di-
methylsulfoxide, 2 units Taq polymerase (Gibco BRL) and 50
pmol of each reverse and forward primers. The samples were
subjected to 40 cycles of amplification. Each cycle consisted
of denaturation at 95°C for 30 seconds, primer annealing at
1
1 in the donor splice site of intron 30.
Materials and Methods
5
5°C for 30 seconds, and primer extension at 72°C for 1
minute. The primers used for PCR amplification were: for-
ward primer (EX 30 F): 59 TGACAACAGAACTTTTCTCC 39
and reverse primer (EX 30 R): 59 acGAGAAAGGCAC-
CATAGG 39 (Fig. 1). The amplified products, 138 bp, were
analyzed in a 2% agarose gel. The preparation of bacterio-
phage DNA was performed with Wizard lambda preps DNA
purification system (Promega, Madison, WI).
The exon and intron/exon junctions DNA sequences were
determined from l phage clone isolated using the Taq poly-
merase-based chain terminator method (fmol, Promega) and
the same exonic primers that were used for screening of re-
combinant positive phages by PCR.
Patients
This work was approved by the Ethical Committee of the
Hospital das Clínicas, University of Sao Paulo Medical School,
and informed consent was obtained from the patients.
A detailed clinical and laboratory evaluation of this con-
sanguineous family has been reported previously (8). In
brief, H.S.N., a 20-year-old male, had lived most of his life
in an iodine-deficient area (Bahia), had congenital goiter and
hypothyroidism, but seldom took the prescribed levothy-
roxine (LT4) tablets. In spite of high levels of serum TSH and
a multinodular goiter, serum Tg concentrations were below
the limit of detection and did not increase after bovine TSH
stimulation. Both siblings (H.S.N. and Ac.S.N.) underwent
thyroidectomy because of compression symptoms caused by
the presence of a large multinodular goiter. Only minute
amounts of immunoassayable Tg-related antigens were de-
tected by radioimmunometric assay in the goitrous tissue.
Agarose gel electrophoresis of the denatured soluble protein
fraction (SPF) confirmed the virtual absence of Tg in the thy-
roid gland. In both siblings, Tg mRNA was isolated from the
goitrous tissues. Subsequently it was documented that
H.S.N. had a 138-nt deletion in the central region of the Tg
RT-PCR amplification
Total RNA was prepared from human thyroid by the
method of Chomczynski and Sacchi (10). The primers, am-
plified regions, and conditions used for RT-PCR were de-
scribed previously (4,9).
Genomic PCR amplification and DNA sequencing
Leukocyte DNA was prepared by the sodium dodecyl sul-
mRNA (8). His affected sister (Ac.S.N.), an 11-year-old fate (SDS)-proteinase K method. For this PCR reaction, the
goitrous girl, had only mild signs of hypothyroidism and de- same PCR conditions as those described above were used.
veloped normally. The family had moved from a small vil- The primers used for PCR amplification were: forward
lage in the state of Bahia to Sao Paulo when Ac.S.N. was ap- primer (IN 29 F): 59 gaactattcctgtctgaccc 39 and reverse
proximately 2 years old. Therefore, for most of her life, primer (IN 30 R): 59 ccacagtgatccatgagttatgacac 39 (Fig. 1).
As.S.N. had a normal level of iodine ingestion through con-
The preparation of PCR amplification fragments was per-
stant use of iodized salt (40–100 mg/kg). Serum Tg basal lev- formed with Concert gel purification system (Gibco BRL).
els were low (1.0 mg/L) with a small increase to 2.9 mg/L af- The exon and intron/exon junctions DNA sequences were
ter bovine TSH stimulation.
determinated with the Taq polymerase-based chain termi-
Another clinically normal sister (At.S.N.), had normal thy- nator method (fmol, Promega) and the same intronic primers
roid function tests and normal serum Tg levels.
that were used for genomic PCR amplification.

SPLICING DEFECT IN THE THYROGLOBULIN GENE
687
FIG. 1. Nucleotide and deduced amino acid sequence of the thyroglobulin (Tg) gene exon 30 and intron 29/exon 30/in-
tron 30 junction sequences. The exon mapped between positions 5549 and 5686 of the Tg mRNA. The exonic sequences are
indicated by capital letters and the intronic sequences by lower-case letters. The positions of the amplification and sequence
primers are underlined. S indicates undetermined nucleotide.
Results
were amplified individually by PCR. Analysis by 1.5%
agarose gel electrophoresis of the products showed the ex-
pected sizes in all amplified fragments, except for that cor-
Characterization of intron 29/exon 30/intron 30 junction
In order to identify the intron/exon boundaries and to an- responding to the region between positions 5127–6010 (PCR
alyze the regions responsible for pre-mRNA processing cor- 3.3 fragment [9]) that lacked the normal 884-bp fragment.
responding a 138-nt deletion in the Tg mRNA of H.S.N., we The approximate size of the amplified fragment was 750 bp.
performed a screening of a human genomic library.
Sequencing of the smaller Ac.S.N. revealed that 138 bp were
6
About 1.9 3 10 phages of a human genomic DNA library missing between positions 5549 and 5686 of the TG mRNA.
were screened by plaque hybridization with RT-PCR probes Subsequently, we concluded that the region absent corre-
corresponding to 3 kb from the central region of the Tg sponded to exon 30. These results are in perfect agreement
mRNA. Fifty plaques were scored as positive. DNA was pre- with the data obtained previously in the thyroid tissue of
pared from each recombinant positive phage stocks and ex- H.S.N. (8).
onic primers were used to perform PCR (see Materials and
This deletion does not affect the reading frame of the re-
Methods). The predicted 138-bp amplified fragment was ob- sulting mRNA and is potentially fully translatable into a Tg
served in 3 of the 16 stocks investigated and the intron/exon polypeptide chain that is shorter by 46 residues. A glycine
junction sequences were determined from one positive clone residue is maintained by the junction between the proximal
by sequencing both strands of the DNA template. The re- G from glycine 1831 and the distal GT from arginine 1877.
sults showed that the 138-nt deletion mapped (Fig. 1) be- The predicted TG translation product is a madure protein of
tween positions 5549 and 5686 of the Tg mRNA and corre- 2703 amino acids with an expected , 323,000 daltons.
sponded to exon 30. The positions of the exon limits differed
by 3 nt from the previously reported data obtained from di- Genomic DNA analysis
rect sequencing of the deleted RT-PCR fragment from H.S.N.
The splice sites bordering exon 30 were PCR amplified and
sequenced from genomic DNA of the goitrous patients
H.S.N. and Ac.S.N.), their normal sister (At.S.N.), and one
normal control. A G to T transversion (Fig. 2) was observed
at position 11 in the donor site of intron 30 of the patients,
as compared to the normal sequence (TT instead of GT). The
(
8). These variations are due to the intron/exon junctions in
this region that contains the deletion of H.S.N. were not
available at time when the deletion was first described.
(
RT-PCR analysis
The Tg mRNA from control and Ac.S.N.’s thyroid tissue sequence analysis showed that both patients, H.S.N. and
were first reverse transcribed and then divided into several Ac.S.N., are homozygous for the mutation, whereas the
positions (16–8410) and the resulting complementary DNAs healthy sibling (At.S.N.) had the two normal alleles.

688
TARGOVNIK ET AL.
FIG. 2. Nucleotide sequences of the region of exon 30/intron 30 junction of the patients with congenital goiter showing
the homozygous G R T transversion in position 11 in the donor site of intron 30. Sequence reactions were made with the
same reverse primer (IN 30 R) that was used for genomic amplification. The arrows indicate the G R T transversion. C,
normal control; At.S.N., sister with normal thyroid function; H.S.N. and Ac.S.N., affected individuals.
Discussion
of the Tg gene in two siblings with congenital goitrous hy-
pothyroidism. This kindred had been previously studied by
The rapid accumulation of knowledge by the introduction us (8). The precise nature of the defect is a splicing error with
of molecular biology in the field of thyroid genetic diseases total elimination of the exon 30 of the Tg gene, by a G to T
has modified some physiopathological concepts and im- transversion at position 11 in the donor site of intron 30.
proved the diagnosis of resulting diseases. Prevalence of con- Homozygosity is consistent with a recessive trait. The pre-
genital hypothyroidism according to data from newborn cise excision of the 138 nt in the Tg mRNA results in an in-
screening programs is estimated to be 1 in 4,000 (ranging frame deletion of amino acid residues 1832–1877, which is
from 1 in 2,000 to 1 in 8,000). Patients with this heterogenous localized in the Tg type III repeat domain (subtypes: a.2 and
clinical and biochemical disorder can be divided into two b.1 [2,3]), causing a loss of 1 putative N-linked glycosylation
groups: nongoitrous and goitrous neonatal hypothyroidism. site. The functional consequences of the deletion are struc-
Nongoitrous neonatal hypothyroidism results from thyroid tural changes in the protein molecule that alter the normal
gland agenesis (athyreosis), dysgenesis (ectopic gland), and routing of translation product through the membrane sys-
hypoplasic thyroid gland. In most cases, the etiology is un- tem of the cell (16,17). Alternatively, it may impair or sub-
known. In a few patients, however, the congenital hypothy- stantially alter the coupling reaction. However, small
roidism is associated with mutations in genes responsible for amounts of functionally active Tg could be iodinated, and
the development of thyroid follicular cells: TSH-b (11), TTF- immediately hydrolized, yielding mostly T3, because of the
1
(12), PAX-8 (13), and TSH receptor genes (14). The pres- intense tissue stimulation by TSH.
ence of congenital goiter usually results from a number of
A previous report suggests that these patients synthesize
abnormalities related to the protein components of thyroid a mutant Tg that is defective for protein folding and assem-
hormonogenesis. Mutations in NIS symporter, Tg, thyroid bly, leading to markedly reduced ability to export the pro-
peroxidase (TPO), and pendrin genes originate a wide spec- tein from the endoplasmic reticulum with massive induction
trum of congenital goitrous hypothyroidism, mostly trans- of selective synthesis of molecular chaperones, which bind
mitted on the autosomal recessive mode (see Kopp [15] and to the misfolded exportable protein (17). Immunohisto-
references therein).
chemical localization of Tg data showed that the affected pa-
In the present study, we have identified a new mutation tients exhibit a marked decrease of reaction product in the

SPLICING DEFECT IN THE THYROGLOBULIN GENE
689
follicular lumina, with positive reaction product accumu- Vono is presently at the Northwestern University (Chicago,
lated intracellularly in thyroid epithelial cells. Similar results IL) in a postdoctorate fellowship.
were reported for the cog/cog mice (16) and human congen-
ital goiters with other Tg mutations (7).
This work was supported by grants from Universidad de
Buenos Aires (FA 124/95, TB 80/98), CONICET (7260/96,
In addition to the defect in intracellular transport, the ab- 0853/98), FONCYT (05-00000-01591/98), and Fundación Al-
normalities in the coupling machinery may contribute to de- berto J. Roemmers (1997, 1998). This work was partially sup-
velopment of the congenital hypothyroid goiters in our pa- ported by a FAPESP grant 96/00998-4 to G. Medeiros-Neto.
tients. A well-organized three-dimensional Tg structure
The nucleotide sequence data reported in this paper have
plays an important role in the coupling reaction that results been submitted to the GenBank, EMBL and DDJ databases
in the fusion of two iodotyrosyl residues. Five hormonogenic under the accession number AF169659.
acceptor tyrosines have been identified and localized at po-
sitions 5, 1291, 2554, 2568, and 2747 in human Tg and sev-
eral tyrosines have been proposed as donor sites (18). It is
References
acceptable that the deletion of 46 residues in the central re-
gion of Tg will affect its tertiary/quaternary structure im-
plying in an altered ability to transfer an iodophenoxyl group
from the donor site to the acceptor iodotyrosine in the cou-
pling machinery.
1
. Medeiros-Neto G, Targovnik HM, Vassart G 1993 Defective
thyroglobulinsynthesis and secretion causing goiter and hy-
pothyroidism. Endocr Rev 14:165–183.
2. Mendive FM, Rivolta CM, Vassart G, Targovnik HM 1999
Genomic organization of the 39 region of the human thy-
roglobulin gene. Thyroid 9:903–912.
The phenotype consequences of the defective Tg synthe-
sis were not the same for H.S.N. and Ac.S.N. Although they
shared the same abnormal mutant Tg, Ac.S.N. was only
mildly hypothyroid and developed normally without men-
tal retardation whereas H.S.N. had stunted growth, severe
hypothyroidism, and clinical signs of brain damage (mental
retardation). The major difference between the two siblings
may be related to environmental conditions. Although
Ac.S.N. lived most of her life in a iodine-sufficient environ-
ment (São Paulo), H.S.N. lived mostly in a low-iodine envi-
ronment (a small village in Bahia). In goitrous humans with
defective Tg synthesis (19) and in goitrous goats with a small
mutant Tg transcript (20) excess iodine was able to restore
euthyroidism in spite of marked structural changes in the
mutant Tg. We concluded that the normal daily iodine sup-
ply (Ac.S.N.) was able to induce a normal supply of T3 (but
not T4) that could maintain a certain degree of peripheral eu-
thyroidism at cellular level. By contrast, H.S.N., who was
raised in a low-iodine supply area, could not increase the
synthesis of thyroid hormone in the mutant Tg. This could
explain the different phenotype consequences for each sib-
ling.
In conclusion, we were able to extend our initial studies
in the defective Tg synthesis in this kindred with two af-
fected siblings and a normal sister. In both congenitally
goitrous and hypothyroid patients, a deletion of 138 nt was
identified between positions 5549 and 5686 of the Tg mRNA
corresponding to total elimination of exon 30. The resulting
Tg polypeptide is shortened by 46 residues and may be par-
tially functional for thyroid hormone synthesis in the pres-
ence of a normal iodine intake. The identification of an ad-
ditional mutation in the Tg gene expands our knowledge of
the molecular basis of congenital hypothyroidism and may
provide, by direct sequencing of DNA amplified by PCR, a
rapid prenatal diagnosis, and prevention of fetal hypothy-
roidism.
3. Ieiri T, Cochaux P, Targovnik HM, Suzuki M, Shimoda S-I,
Perret J, Vassart G 1991 A 39 splice site mutation in the thy-
roglobulin gene responsible for congenital goiter with hy-
pothyroidism. J Clin Invest 88:1901–1905.
4. Targovnik HM, Medeiros-Neto G, Varela V, Cochaux P,
Wajchenberg BL, Vassart G 1993 A nonsense mutation
causes human hereditary congenital goiter with preferential
production of a 171-nucleotide-deleted thyroglobulin ri-
bonucleic acid messenger. J Clin Endocrinol Metab 77:210–
2
15.
5. Targovnik HM, Frechtel GD, Mendive FM, Vono J, Cochaux
P, Vassart G, Medeiros-Neto G 1998 Evidence for the segre-
gation of three different mutated alleles of the thyroglobu-
lin gene in a Brazilian family with congenital goiter and hy-
pothyroidism. Thyroid 8:291–297.
6
. van de Graaf SAR, Ris-Stalpers C, Veenboer GJM, Cam-
menga M, Santos C, Targovnik HM, de Vijlder JJM,
Medeiros-Neto G 1999 A premature stopcodon in the thy-
roglobulin mRNA results in familial goiter and moderate
hypothyroidism. J Clin Endocrinol Metab 84:2537–2542.
7. Hishinuma A, Takamatsu J, Ohyama Y, Yokozawa T, Kanno
Y, Kuma K, Yoshida S, Matsuura N, Ieiri T 1999 Two novel
cysteine substitutions (C1263R and C1995S) of thyroglobu-
lin cause a defect in intracellular transport of thyroglobulin
in patients with congenital goiter and the variant type of
adenomatous goiter. J Clin Endocrinol Metab 84:1438–1444.
8. Targovnik H, Vono J, Billerbeck AEC, Cerrone G, Varela V,
Mendive F, Wajchenberg BL, Medeiros-Neto G 1995 A 138-
nucleotide deletion in the thyroglobulin ribonucleic acid
messenger in a congenital goiter with defective thyroglobu-
lin synthesis. J Clin Endocrinol Metab 80:3356–3360.
9
. Moya CM, Mendive FM, Rivolta CM, Vassart G, Targovnik
HM 2000 Genomic organization of the 59 region of the hu-
man thyroglobulin gene. Eur J Endocrinol 143:789–798.
0. Chomczynski P, Sacchi N 1987 Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloro-
form extraction. Anal Biochem 162:156–159.
1
1
1. Medeiros-Neto G, Herodotou DT, Rayan S, Kommerede S,
Lacerca L, Sandrini R, Boguszewski MCS, Hollenberg AN,
Rodovick S, Wondisford FE 1996 A circulating biologically
inactive thyrotropin caused by a mutation in the beta sub-
unit gene. J Clin Invest 97:1250–1256.
Acknowledgments
H.M. Targovnik is an established investigator of the Ar-
gentine National Research Council (CONICET). C.M. Rivolta
is a research fellow of the CONICET. F.M. Mendive is a re- 12. Acebron A, Aza-Blanc P, Rossi DL, Lamas L, Santisteban P
search fellow of the Universidad de Buenos Aires. Jussara
1995 Congenital human thyroglobulin defect due to low ex-

690
TARGOVNIK ET AL.
pression of the thyroid-specific transcription factor TTF-1. J 19. Vono J, Lima N, Knobel M, Medeiros-Neto G 1996 The ef-
Clin Invest 96:781–785.
3. Macchia PE, Lapi P, Krude H, Pirro MT, Missero C, Chio-
fect of oral administration of iodine to patients with goiter
and hypothyroidism due to defective synthesis of thy-
roglobulin. Thyroid 6:11–15.
1
vato L, Souabni A, Baserga M, Tassi V, Pinchera A, Fenzi G,
Gruters A, Busslinger M, Di Lauro R 1998 PAX8 mutations 20. van Voorthuizen WF, de Vijlder JJM, van Dijk JE, Tegelaers
associated with congenital hypothyroidism caused by thy-
roid dysgenesis. Nat Genet 19:83–86.
WHH 1978 Euthyroidism via iodine supplementation in
hereditary congenital goiter in goats with thyroglobulin de-
ficiency. Endocrinology 103:2105–2111.
1
1
1
1
4. Sunthornthepvarakul T, Gottschalk ME, Hayashi Y, Refetoff
S 1995 Resistance to thyrotropin caused by mutations in the
thyrotropin-receptor gene. N Engl J Med 332:155–160.
5. Kopp P 2000 Pendred’s syndrome and genetic defects in thy-
roid hormone synthesis. Rev Endocrinol Metab Disorders
Address reprint requests to:
Héctor M. Targovnik
1
:109–121.
División Genética
6. Kim PS, Kwon OY, Arvan P 1996 An endoplasmic reticu-
lum storage diseases causing congenital goiter with hy-
pothyroidism. J Cell Biol 133:517–527.
Hospital de Clinicas “José de San Martin”
Cátedra de Genética y Biologia Molecular
Facultad de Farmacia y Bioquímica
Universidad de Buenos Aires
7. Medeiros-Neto G, Kim PS, Yoo SE, Vono J, Targovnik HM,
Camargo R, Hossain SA, Arvan P 1996 Congenital hy-
pothyroid goiter with deficient thyroglobulin. Identification
of an endoplasmic reticulum storage disease with induction
of molecular chaperones. J Clin Invest 98:2838–2844.
8. Lamas L, Anderson PC, Fox JW, Dunn JT 1989 Consensus
sequences for early iodination and hormonogenesis in hu-
man thyroglobulin. J Biol Chem 264:13541–13545.
Av. Córdoba 2351
to
4
piso-sala5
1120-Buenos Aires
Argentina
1
E-mail: htargovn@huemal.ffyb.uba.ar