Crystal structure of the heme d1 biosynthesis enzyme NirE in complex with its substrate reveals new insights into the catalytic mechanism of S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferases

Article abstract of DOI:10.1074/jbc.M111.239855

During the biosynthesis of heme d₁, the essential cofactor of cytochrome cd₁ nitrite reductase, the NirE protein catalyzes the methylation of uroporphyrinogen III to precorrin-2 using S-adenosyl-L-methionine (SAM) as the methyl group donor. The crystal structure of Pseudomonas aeruginosa NirE in complex with its substrate uroporphyrinogen III and the reaction by-product S-adenosyl-L-homocysteine (SAH) was solved to 2.0 A resolution. This represents the first enzyme-substrate complex structure for a SAM-dependent uroporphyrinogen III methyltransferase. The large substrate binds on top of the SAH in a puckered conformation in which the two pyrrole rings facing each other point into the same direction either upward or downward. Three arginine residues, a histidine, and a methionine are involved in the coordination of uroporphyrinogen III. Through site-directed mutagenesis of the nirE gene and biochemical characterization of the corresponding NirE variants the amino acid residues Arg-111, Glu-114, and Arg-149 were identified to be involved in NirE catalysis. Based on our structural and biochemical findings, we propose a potential catalytic mechanism for NirE in which the methyl transfer reaction is initiated by an arginine catalyzed proton abstraction from the C-20 position of the substrate.

Full text of DOI:10.1074/jbc.M111.239855

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 30, pp. 26754–26767, July 29, 2011
© 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
Crystal Structure of the Heme d1 Biosynthesis Enzyme NirE in
Complex with Its Substrate Reveals New Insights into the
Catalytic Mechanism of S-Adenosyl-L-methionine-dependent
Uroporphyrinogen III Methyltransferases*
Received for publication, March 14, 2011, and in revised form, April 20, 2011 Published, JBC Papers in Press, May 31, 2011, DOI 10.1074/jbc.M111.239855
Sonja Storbeck‡1, Sayantan Saha§1, Joern Krausze§, Bjo¨rn U. Klink§¶, Dirk W. Heinz§, and Gunhild Layer‡2
From the ‡Institute of Microbiology, Technische Universita¨t Braunschweig, 38106 Braunschweig, Germany, the §Department of
Molecular Structural Biology, Helmholtz Centre for Infection Research, 38124 Braunschweig, Germany, and the ¶Duke University
Medical Center, Durham, North Carolina 27705
During the biosynthesis of heme d1, the essential cofactor of
cytochrome cd1 nitrite reductase, the NirE protein catalyzes the
methylation of uroporphyrinogen III to precorrin-2 using S-ad-
enosyl-L-methionine (SAM) as the methyl group donor. The
crystal structure of Pseudomonas aeruginosa NirE in complex
with its substrate uroporphyrinogen III and the reaction
by-product S-adenosyl-L-homocysteine (SAH) was solved to
denitrificans, Paracoccus pantotrophus, or the human patho-
gen Pseudomonas aeruginosa (2).
All naturally occurring tetrapyrroles are synthesized along a
branched multistep biosynthetic pathway and share uropor-
phyrinogen III (uro’gen III)3 as the last common precursor.
Uro’gen III is either decarboxylated to yield coproporphyrino-
gen III for heme and (bacterio)chlorophyll formation or meth-
ylated for the biosynthesis of siroheme, cobalamin, coenzyme
˚
2.0 A resolution. This represents the first enzyme-substrate
complex structure for a SAM-dependent uroporphyrinogen III
methyltransferase. The large substrate binds on top of the SAH
in a “puckered” conformation in which the two pyrrole rings
facing each other point into the same direction either upward or
downward. Three arginine residues, a histidine, and a methio-
nine are involved in the coordination of uroporphyrinogen III.
Through site-directed mutagenesis of the nirE gene and bio-
chemical characterization of the corresponding NirE variants
the amino acid residues Arg-111, Glu-114, and Arg-149 were
identified to be involved in NirE catalysis. Based on our struc-
tural and biochemical findings, we propose a potential catalytic
mechanism for NirE in which the methyl transfer reaction is
initiated by an arginine catalyzed proton abstraction from the
C-20 position of the substrate.
F
430, and heme d1 (1, 3). The methylation of uro’gen III at posi-
tions C-2 and C-7 leads to the formation of precorrin-2 (Fig. 1).
The two methyl groups are derived from S-adenosyl-L-methio-
nine (SAM) and are transferred onto uro’gen III by SAM-de-
pendent uro’gen III methyltransferases (SUMTs) (4). Up until
now, several SUMTs from different organisms have been iden-
tified, and their biochemical functions in cobalamin (CobA),
siroheme (CysG, SirA, UPM1, Met1p), and heme d1 (NirE) bio-
synthesis were characterized (5–13). Among these SUMTs
three subclasses can be distinguished based on their size and
functionalities. SUMTs like CobA, SirA, Met1p, and NirE are
usually dimeric proteins with subunits of about 30 kDa and
possess SUMT activity only (5–10, 13). In contrast, CysG is a
dimeric protein of 50-kDa subunits, each of which contains two
independent enzymatic modules. The C-terminal module
(CysGA) of the enzyme is homologous to CobA, SirA, Met1p,
and NirE and carries SUMT activity. The N-terminal module
(CysGB) of CysG functions as a bifunctional dehydrogenase-
ferrochelatase converting precorrin-2 into siroheme via the
intermediate sirohydrochlorin. Thus, CysG is a trifunctional
siroheme synthase (14, 15). Finally, in some organisms the cobA
gene is fused to hemD resulting in the production of a fusion
protein carrying uro’gen III synthase and SUMT activities (16,
17).
Tetrapyrroles such as hemes, (bacterio)chlorophylls, siro-
heme, or cobalamin play essential roles in many fundamental
biological processes, including respiration, photosynthesis, and
numerous enzymatic reactions (1). The dioxo-isobacteriochlo-
rin heme d1, another member of the tetrapyrrole family, serves
as the catalytically essential prosthetic group in the cytochrome
cd1 nitrite reductase that catalyzes the second step of the deni-
trification process in denitrifying bacteria such as Pseudomonas
The NirE protein was only recently characterized as a mono-
functional SUMT specifically required for heme d1 biosynthe-
sis. SUMT activity was demonstrated for NirE from P. aerugi-
nosa and P. pantotrophus in vivo and in vitro (10, 13).
Homodimeric NirE from P. aeruginosa showed inhibition by its
* This work was supported by grants from the Deutsche Forschungsgemein-
schaft Emmy-Noether Program (to G. L.) and FOR 1220 (to D. W. H.) and by
the Fonds der Chemischen Industrie (to G. L. and D. W. H.).
The atomic coordinates and structure factors (codes 2YBO and 2YBQ) have been
deposited in the Protein Data Bank, Research Collaboratory for Structural
Bioinformatics, Rutgers University, NewBrunswick, NJ(http://www.rcsb.org/). 3 The abbreviations used are: uro’gen III, uroporphyrinogen III; CobA, SUMT
1 Both authors contributed equally to this work.
involved in cobalamin biosynthesis; CysG, SirA, UPM1, Met1p, SUMTs
involved in siroheme biosynthesis; NirE, SUMT involved in heme d1 biosyn-
thesis; PDB, Protein Data Base; SAH, S-adenosyl-L-homocysteine; SAM,
S-adenosyl-L-methionine; SUMT, SAM-dependent uroporphyrinogen III
methyltransferase.
2 To whom correspondence should be addressed: Institute of Microbiology,
Technische Universita¨t Braunschweig, Spielmannstr. 7, 38106 Braun-
schweig, Germany. Tel.: 49-531-391-5803; Fax: 49-531-391-5854; E-mail:
g.layer@tu-braunschweig.de.
26754 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 1. Reaction catalyzed by NirE. NirE and other SUMTs catalyze the bis-methylation of uroporphyrinogen III to precorrin-2. The two methyl groups that
are attached to C-2 and C-7 are derived from SAM. SAH is produced as a reaction by-product.
EXPERIMENTAL PROCEDURES
substrate uro’gen III and the reaction by-product S-adenosyl-L-
homocysteine (SAH) as previously observed for other SUMTs
like CobA (5, 9). However, the homologous NirE protein from
P. pantotrophus did not show these substrate inhibition phe-
nomena (13).
Chemicals—All chemicals, reagents, and antibiotics were
purchased from Sigma-Aldrich or Merck. Restriction enzymes
and other DNA-modifying enzymes were obtained from New
England Biolabs. For purification of DNA fragments, the
QIAquick PCR purification and gel extraction kits were pur-
Crystal structures for SUMT proteins were solved for CysG
from Salmonella enterica (18), CobA from P. denitrificans (19),
and the SUMT from Thermus thermophilus (ttSUMT) (20), all
in complex with the reaction product SAH. As expected, the
overall protein fold of the different SUMT proteins is con-
served. Each subunit of the dimeric SUMTs consists of two
domains that are connected by a single linker. Based on their
overall structure SUMTs can be classified as class III methyl-
transferases (21). In all three available SUMT structures SAH
was found to bind to the inner surface of the large active site
pocket between the two domains.
chased from Qiagen as well as all crystallization suites. Ni2ϩ
-
SepharoseTM 6 Fast Flow and the HiLoadTM 26/60 SuperdexTM
75 preparation grade column were obtained from GE Health-
care. All primers were purchased from metabion international
AG (Martinsried, Germany). Uroporphyrin III was obtained
from Frontier Scientific Europe (Carnforth, UK).
Construction of Vectors—The construction of the vector
pET32a-nirE-Trx was described previously (10). For the con-
struction of the vector pET32a_PreS2-4_nirE the nirE gene
fused to a DNA fragment encoding a PreScissionTM cleavage
site was PCR-amplified using the primers 54nirE_MscI_fw
Despite the previous biochemical and structural studies of
SUMTs the current knowledge of the catalytic mechanism of
these enzymes is limited. The two methyl groups are sequen-
tially attached to uro’gen III with the C-2 position being meth-
ylated before the C-7 position (22, 23). After the first methyla-
tion at C-2 the resulting products precorrin-1 and SAH are
thought to be released from the active site of the enzyme (5). For
the second methylation at C-7 another SAM molecule and pre-
corrin-1 have to bind to the active site. The methyl transfer
reaction itself probably occurs through an SN2 mechanism as is
the case for other SAM-dependent methyltransferases (24).
After each methyl transfer a prototropic rearrangement of the
macrocycle double bonds is presumed to take place (18, 25).
Based on a model of the enzyme-substrate complex and site-
directed mutagenesis several predictions were made which
amino acids within the active site could be involved in catalysis.
However, due to the lack of a structure for the enzyme-sub-
strate complex the definite assignment of the precise functional
roles for these amino acid residues was not possible.
(GAATTGGCCATCTGGAAGTTCTGTTCCAGGG)
and
14nirE_XhoI_rv (GACTCGAGGGCGCATGCGAC) contain-
ing restriction sites for MscI and XhoI (underlined), respec-
tively, and the vector pGEX6p1-nirE as the template. The
resulting DNA fragments were purified, digested with MscI and
XhoI, and subsequently ligated into the similarly digested vec-
tor pET32a (Novagen) to generate the vector pET32a_PreS2–
4_nirE. The template vector pGEX6p1-nirE was generated by
cloning the PCR-amplified P. aeruginosa nirE gene into the vec-
tor pGEX6p1 (GE Healthcare) using the BamHI and NotI
restriction sites. For the construction of expression vectors
containing the nirE gene carrying different point mutations the
overlap extension PCR technique was used (26). After the PCR
amplification of two DNA fragments containing an overlapping
region with the appropriate point mutation, a fusion PCR was
performed to amplify the complete DNA fragment including
the point mutation. The obtained DNA fragments were cloned
into the vector pET32a_PreS2–4_nirE using BamHI and XhoI
restriction sites to replace the wild-type (WT) nirE with the
mutant nirE. After cloning, the correct nucleotide sequence of
the nirE gene was verified by sequencing of all nirE constructs
(GATC Biotech AG, Konstanz, Germany).
Here, we report the crystal structure of NirE from P. aerugi-
nosa in complex with its substrate uro’gen III and the reaction
by-product SAH at a resolution of 2.0 Å. Based on the structure
of this enzyme-substrate complex and supported by biochem-
ical studies employing NirE variants, we identified several
highly conserved amino acid residues most likely involved in
catalysis. We propose a catalytic mechanism in which two
arginines that are highly conserved in all SUMTs play essential
roles for the methyl transfer reaction.
Protein Production and Purification—Production and purifi-
cation of recombinant NirE from P. aeruginosa were performed
as described previously with minor modifications (10). Buffer A
was slightly modified and contained 50 mM Tris-HCl, pH 7.5,
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26755

Structure of NirE in Complex with Uroporphyrinogen III
150 mM NaCl, 10% (w/v) glycerol. The soluble protein fraction Ltd., Melbourne, UK) was used for preparing the sitting-drop
was treated three times for 10 s with ultrasound before being vapor diffusion setups. 200 nl of reservoir buffer of the JCSG
applied directly to a 1.5-ml Ni2ϩ-SepharoseTM 6 Fast Flow col- I-IV and ammonium sulfate screens (Qiagen) was mixed with
umn. After washing and elution steps the NirE-containing frac- 200 nl of NirE solution and incubated at 18 °C in the dark.
tions were pooled, and dithiothreitol (DTT) was added to a final Crystals grew within 3–6 days and were soaked with 20% glyc-
concentration of 5 mM. PreScissionTM protease or Tag off erol prior to shock cooling in liquid nitrogen. For crystallization
enterokinase (Novagen) was added to the NirE solution which of NirE with uro’gen III, the protein (10 mg/ml) was crystallized
was dialyzed overnight against buffer A. When cleaved with by sitting-drop vapor diffusion at 17 °C in an anaerobic cham-
PreScissionTM protease the dialyzed protein solution was again ber. Prior to use NirE was incubated with an 82-fold molar
applied to the Ni2ϩ-SepharoseTM 6 Fast Flow column to excess of uro’gen III and 1 mM SAH for 1 h. For the crystalliza-
remove the tag. For further purification of the now untagged tion drops, 1 ␮l of protein solution was mixed with 1 ␮l of
NirE, a gel permeation chromatography was performed using reservoir solution of the JCSGϩ Screen (Qiagen) and incubated
buffer A. The NirE-containing fractions were pooled and con- in the dark. Crystals grew within 4–8 days and were soaked
centrated by ultrafiltration (Amicon, Millipore GmbH, Esch- with 20% glycerol prior to shock cooling in liquid nitrogen.
born, Germany). Finally, the buffer was exchanged in an anaer-
Data Collection, Structure Determination, and Refinement—
obic chamber (Coy Laboratories, Grass Lake, MI) against X-ray diffraction data were collected in house at a Rigaku
thoroughly degassed buffer A. The purified and concentrated MicroMax 007HF rotating anode x-ray generator equipped
NirE protein (10 mg/ml) was directly used for crystallization.
with a Saturn 944ϩ charge-coupled device detector (Rigaku,
Reduction of Uroporphyrin III—Uroporphyrin III was chem- Sevenoaks, UK) and at beamline 14.2 of the Berliner Elek-
ically reduced to uro’gen III either with 3% sodium amalgam or tronenspeicherring-Gesellschaft fu¨r Synchrotronstrahlung
with H2/palladium as described previously (27, 28). For all crys- (BESSY, Berlin, Germany). Datasets of NirE in complex with
tallization setups the H2/palladium-reduced uro’gen III was SAH and NirE in complex with SAH and uro’gen III were pro-
used, and for the determination of the specific activity of NirE cessed with HKL2000 (30) and XDS (31, 32), respectively. Data
WT and mutant enzymes the sodium amalgam-reduced were phased by molecular replacement with MOLREP (33)
uro’gen III was used.
SAM Binding Assay—The SAM binding assay was performed search model. The MOLREP solution was manually corrected
as described previously (10). and rebuilt in COOT (34) and refined through rigid body,
using the monomer of CobA (PDB ID code 1S4D) (19) as the
Determination of NirE Activity—The enzymatic activity of restrained, and TLS refinement in REFMAC5 (35). Atomic dis-
NirE WT and mutant enzymes was determined in an in vitro placement factors were treated as being isotropic whereas
activity assay as described previously (10). Briefly, the activity anisotropic motion of the protein was accounted for by per-
assays were performed in an anaerobic chamber (Coy Labora- forming TLS refinement (36) using two or five TLS groups for
tories) under anaerobic conditions. Uro’gen III was generated dataset I and dataset II, respectively. The TLS groups were
from 1 mM 5-aminolevulinic acid using the enzymes HemB determined using the TLSMD server (37). Refinement was
from P. aeruginosa (0.14 ␮M), HemC (0.15 ␮M), and HemD stopped after converging values of Rwork and Rfree were reached.
(0.17 ␮M) both from Bacillus megaterium in a final volume of 1 Data collection and refinement statistics are summarized in
ml of degassed buffer B (50 mM Tris-HCl, pH 8.0, 100 mM KCl, Table 1. Figures were created with ESPript (38), LIGPLOT (39),
5 mM MgCl2, 50 mM NaCl, 5 mM DTT). NirE WT and mutant and PyMOL (40).
enzymes were added to a final concentration of 1.5 ␮M, respec-
Protein Data Bank Accession Numbers—The atomic coordi-
ϩ
tively. SirC from B. megaterium (1.5 ␮M) and NAD (100 ␮M) nates and structure factors have been deposited in the RCSB
were added to convert precorrin-2 to sirohydrochlorin for Protein Data Bank. The entry codes are 2YBO for NirE ϩ SAH,
quantification using the published extinction coefficient of and 2YBQ for NirE ϩ SAH ϩ uro’gen III.
sirohydrochlorin (⑀376 nm ϭ 2.4 ϫ 105 Ϫ1 cmϪ1) (29). 200 ␮M
M
RESULTS AND DISCUSSION
SAM was added to start the reaction. The assay mixture was
incubated at 37 °C in the dark, and product formation was mon-
Crystallization of NirE and Structure Determination—Re-
itored using a V-550 or V-650 spectrophotometer (Jasco, combinant purified NirE from P. aeruginosa was crystallized
Gross-Umstadt, Germany). The specific activity of NirE was either in the presence of added SAM or in the presence of added
determined as described previously (10) using chemically uro’gen III plus SAH by the sitting-drop vapor diffusion
reduced uro’gen III at a final concentration of 17 ␮M.
method. Crystals of NirE without uro’gen III were obtained in
Determination of Highly Conserved Amino Acid Residues— Tris, pH 8.0, 24% PEG 6000, and crystals of the NirE-substrate
For the determination of conserved amino acid residues among complex grew in 0.2 M lithium sulfate, 0.1 M Tris, pH 8.5, 1.26 M
SUMTs from different organisms an amino acid sequence ammonium sulfate. NirE crystals were base-centered orthorhom-
alignment (ClustalW) was created with the sequences of more bic. Apart from minor deviations in unit cell dimensions, crystals
than 60 different SUMTs. Those amino acids that were identi- of NirE with SAH and NirE with both SAH and uro’gen III were
cal in all SUMTs are termed “highly conserved” throughout this isomorphous (Table 1). The molecular replacement resulted in
manuscript.
a single peak in the rotation function indicating the presence of
Crystallization—For crystallization of NirE without uro’gen one NirE molecule in the asymmetric unit. This was in agree-
III, the protein (9.2 mg/ml) was incubated with 2 mM SAM for ment with Matthews coefficients (41) of 2.29 Å3 DaϪ1 (dataset
1 h prior to use. A crystallization robot (Mosquito; TTP abTech I) and 2.44 Å3 DaϪ1 (dataset II). Electron density unexplained
26756 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
TABLE 1
Crystallographic data and refinement statistics
Statistics
Dataset I: NirE ؉ SAH
Dataset II: NirE ؉ SAH ؉ uro’gen III
Data collection
Beamline
Rigaku MircoMax 007HF
1.541
BESSY (BL14.2)
0.91841
Wavelength (Å)
Resolution (Å)a
Space group
46.3-2.0 (2.05-2.00)
C2221
35.0-2.0 (2.05-2.00)
C2221
Unit cell parameters
a, b, c (Å)
60.9, 115.1, 76.8
90, 90, 90
19,360 (1,411)
4.4 (4.5)
60.9, 116.2, 77.1
90, 90, 90
18,362 (1,418)
3.9 (4.0)
␣, ␤, ␥ (°)
Unique reflectionsa
Multiplicitya
Completeness (%)a
I/␴Ia
99.82 (99.86)
20.19 (2.58)
0.043 (0.586)
35.1
92.6 (99.9)
22.8 (4.0)
0.083 (0.451)
34.4
a,b
Rmerge
Wilson B (Å2)
Solvent content (%)
46.4
49.7
Refinement
c
Rwork
0.2349
0.2868
0.2169
0.2526
d
Rfree
No. of atoms
Protein
1,864
26
1,825
86
Ligand
Water
195
129
Total
2,085
2,040
Atomic displacement factors B (Å2)e
Overall
21.4
21.4
23.6
33.6
33.7
22.7
58.8
24.0
1/1/1
Protein
SAH
Uro’gen III
Water
21.4
Molecules per asymmetric unit
(NirE/SAH/uro’gen III)
Real space correlation coefficientsf
Total
1/1/0
0.7676
0.7806
Protein
Backbone
0.8204
0.7848
0.9314
0.8546
0.8232
0.9427
0.7769
Side chains
SAH
Uro’gen III
Root mean square deviation from ideal
Bond lengths (Å)
Bond angles (°)
Ramachandran plot
Favored (%)
0.0239
2.167
0.0219
1.935
97.1
2.9
97.0
3.0
Allowed (%)
Disallowed (%)
0.0
0.0
a Values in parentheses account for the highest resolution shell.
b
R
merge ϭ ͚͉ IoϪ͗I͉͘/͚Io.
c Rwork ϭ (͚ʈFoPϪ͉Fcʈ/͚͉Fo͉); ͉Fo͉, structure factor magnitudes observed; ͉Fc͉, structure factors calculated.
d Rfree is computed as Rwork but using 5% randomly assigned reflections excluded from refinement.
e These B factors constitute the total B factors representing isotropic (thermal) and anisotropic (domain) movement.
f Real space correlation coefficient (RSCC) ϭ ⌺͉␳oϪ͗␳ ͉͘⌺͉␳c Ϫ ͗␳ ͉͘/(⌺͉ ␳oϪ͗␳ ͉͘2⌺͉␳cϪ͗␳ ͘ ͉)1/2; ␳, electron density values at grid points that cover the molecule in question;
2
␳o, experimental electron density; ␳c, model density.o
c
o
c
by the protein molecule indicated the presence of SAH and NirE monomer show a similar arrangement of secondary struc-
uro’gen III, each being present with one molecule in the asym- ture elements but do not share the same topology (Fig. 2, A and
metric unit.
B).
Overall Structure of NirE—The NirE monomer consists of
In the crystal structure, a homodimeric assembly of NirE is
two equally sized domains that are connected to each other by a present which is created by a 2-fold crystallographic symmetry
short linker. Each of the two domains consists of a five-stranded axis (Fig. 2C). This is in accordance with the dimeric organiza-
␤-sheet that is surrounded by helices (Fig. 2). In the N-terminal tion of the protein in solution (10). In the dimer, the two five-
domain A (residues 1–129), the five ␤-strands are parallel and stranded ␤-sheets of the domains B combine to form one large,
arranged in the order ␤5 ␤1 ␤4 ␤2 ␤3 (the numbering repre- slightly twisted, 10-stranded ␤-sheet. The total buried surface
sents the sequential appearance of the ␤-strands in the NirE of the dimer is 5140 Å2. Interestingly, the long loop between hF
primary structure). Helices hA, hB, and hC are located on one and ␤6 of domain B of one monomer protrudes toward the
face of the parallel ␤-sheet whereas hD and hE occupy the active site cleft of the other monomer where it participates in
opposite face. The short linker that connects the two domains substrate binding and catalysis (see below).
comprises amino acid residues 130–133. The ␤-strands of the
The overall fold and dimeric arrangement are highly similar
mixed ␤-sheet of the C-terminal domain B (residues 134–279) for both NirE with and without substrate bound. Apparently,
are arranged in the order ␤6 ␤7 ␤10 ␤8 ␤9. Helices hF and hJ are no major conformational changes of the NirE backbone occur
located on the same side of the mixed ␤-sheet whereas helices upon uro’gen III binding. As expected, the NirE structure is
hG, hH, and hI lie on the opposite side. The two domains of the very similar to the previously published SUMT structures,
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26757

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 2. Structure of NirE. A, topology diagram of NirE. Helices are depicted as cylinders and ␤-strands as arrows. The N-terminal and C-terminal domains are
labeled with A and B, respectively. B, monomer of NirE (content of the asymmetric unit) in schematic representation with SAH (light blue) and uro’gen III (light
orange) shown as sticks. Domains A and B are shown in lighter and darker shades of green, respectively, and the linker region is shown in gray. C, schematic
representation of the physiological dimer of NirE created by a crystallographic symmetry operation (rotation axis is indicated by a dashed line). The two
monomers are dark green and light green. SAH and uro’gen III are represented as in B. The two different views of dimeric NirE are related by a rotation about
ϳ90° around the 2-fold symmetry axis.
namely those of S. enterica CysG (PDB ID code 1PJQ) (18), P. loops are located between ␤3 and hD of domain A and between
denitrificans CobA (1S4D) (19), and T. thermophilus SUMT ␤6 and hG of domain B. In all SUMT structures, the amino
(1V9A) (20), which share 49, 41, and 40% amino acid sequence acids of these loops were found disordered. Although the flex-
identity with P. aeruginosa NirE, respectively (Fig. 3). The root ible loop of domain B does not contain highly conserved amino
mean square deviations between common C positions are acid residues, the disordered loop of domain A contains a highly
0.776 Å for NirE and CysG, 0.603 Å for NirE ␣and CobA, and conserved lysine residue (Lys-72 in NirE) which was found to be
0.836 Å for NirE and ttSUMT. Thus, the highest degree of sim- essential for catalysis in CysG (Lys-270) through site-directed
ilarity is found between NirE and CobA. The structural com- mutagenesis. It was proposed that this lysine could either be
parison of all four SUMTs also reveals that there are two loops involved in the coordination of the substrate carboxylate
that are highly flexible (Fig. 3B). In the NirE structure, these groups or play an essential role for the prototropic rearrange-
26758 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 3. Comparison of NirE with its homologs. A, structure-based amino acid sequence alignment of NirE from P. aeruginosa (NirE_PA) with the SUMT
domain of CysG from S. enterica (CysGA_SE) (18), a SUMT from T. thermophilus (SUMT_TT) (20), and CobA from P. denitrificans (CobA_PD) (19). Helices and
␤-structures as found in NirE are indicated. Red boxes highlight identical amino acids among these four SUMTs; black stars indicate highly conserved amino
acids identified through an alignment of 60 SUMTs from different organisms (see “Experimental Procedures”). Dashed green lines indicate flexible regions
whose amino acids were not included in the final NirE structure. Blue triangles highlight the amino acid residues that were subjected to site-directed mutagen-
esisinthisstudy. B, superpositionofNirE(green)withthestructuresofCobA(salmon), theSUMTdomainofCysG(blue), andttSUMT(gray). Thestructuralmodels
are shown in ribbon representation, and the SAH molecules are shown as ball and stick models. The beginnings and ends of flexible loops are indicated by a star
and a triangle, respectively.
ments of the macrocycle (18). Surprisingly, in our NirE-uro’gen structure without uro’gen III indicates that SAH was copurified
III complex structure the two flexible loops were still found with NirE and was not exchanged against SAM, which had been
disordered, and Lys-72 was not included in the final model. added in 7-fold molar excess to the crystallization setups. In
Thus, the exact function of this lysine remains unresolved.
both NirE structures the SAH molecule adopts the same bent
SAH Binds Tightly in the Active Site of NirE—The active site conformation as in the previously reported SUMT structures.
pocket of NirE is located between the two domains of each Additionally, the localization and coordination of the SAH are
monomer, as previously observed for CysG, CobA, and identical in both NirE structures independent of the presence
ttSUMT (18–20). In both NirE structures, i.e. without and with or absence of uro’gen III. Polar contacts between SAH and the
bound uro’gen III, SAH was bound deeply in the interior of the protein mainly involve the amide groups of the protein back-
pocket (Fig. 2 and see Fig. 5). The presence of SAH in the NirE bone (see Fig. 5). Hydrophobic interactions of the SAH with the
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26759

Structure of NirE in Complex with Uroporphyrinogen III
26760 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 5. Active site of NirE. Stereo top view (A) and stereo side view (B) of the NirE active site are shown. The protein chain is represented schematically;
important amino acids are shown as sticks. The chain of monomer A is dark green and that of monomer B light green. The hydrogen bonds and salt bridges are
drawn as black broken lines.
protein involve Met-186 and Leu-52, which face each other on site of the enzyme. From these crystallization setups, we
opposite sites of the molecule with the SAH sulfur atom sitting obtained NirE crystals with uro’gen III bound in the active site
between them at distances of about 4 Å, respectively. Pro-242 pocket.
and Ala-134 contribute to the hydrophobic environment of the
In the refined NirE-uro’gen III complex structure, the addi-
adenine ring of SAH whereas Tyr-185 stacks along the aliphatic tional electron density clearly defined the localization, orienta-
part of the homocysteine moiety. The coordination of the SAH tion, and conformation of the substrate. The large uro’gen III
in the active site pocket of NirE is highly similar to that previ- molecule sits above the SAH and is partially in contact with the
ously observed in CysG which, among the three other crystal- solvent (Figs. 4 and 5). In the omit map, initial electron density
lized SUMTs, also shows the highest degree of amino acid was clearly visible for the tetrapyrrole macrocycle as well as for
sequence identity to NirE.
the acetate and propionate substituents of two opposite pyrrole
Uro’gen III Binds in a Twisted Conformation in the Active Site rings (Fig. 4A). From the size and shape of the density for these
of NirE—The main goal of this study was to obtain the structure substituents it was possible to unambiguously distinguish
of NirE in complex with its substrate uro’gen III. For this pur- between acetate and propionate groups and therefore to assign
pose, NirE was incubated with an 82-fold molar excess of the respective pyrrole rings as being either B or D. This left us
uro’gen III that had been prepared by chemical reduction of with two possible orientations of the uro’gen III which could be
uroporphyrin III with H2/palladium. Additionally, SAH was converted into each other by flipping the molecule 180° over-
added to the NirE-uro’gen III mixture instead of SAM to pre- head keeping the same positions for rings A and C. However,
vent a catalytic reaction and to trap the substrate in the active because the stereochemistry of the methylation reaction is
FIGURE 4. Substrate binding site of NirE. A, stereo view of the omit maps of SAH and uro’gen III calculated in the absence of the substrates from the final
structure model. The 2Fo Ϫ Fc map is contoured to 1 ␴ and represented by a black mesh. The Fo Ϫ Fc map is contoured to 3 ␴ and represented by a green mesh.
B, stereo view of the 2Fo Ϫ Fc map of SAH and uro’gen III calculated in the presence of the substrates shown as black mesh contoured to 1 ␴. C, schematic
representation of interactions between NirE and uro’gen III. Polar interactions are drawn as green broken lines with their lengths given in angstroms. Residues/
atoms involved in hydrophobic contacts are surrounded by a red corona.
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26761

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 6. Active site of NirE and enzymatic activity. A, superposition of the NirE active site in the presence (green) and absence (gray) of uro’gen III. Amino
acid residues Arg-51, Arg*-149, and His-161 clearly change their orientation upon substrate binding. B, UV-visible absorption spectra of sirohydrochlorin
formed in NirE activity assay mixtures containing either WT NirE or variants thereof. The substrate uro’gen III was produced enzymatically as described under
“Experimental Procedures,” and the NirE reaction product precorrin-2 was converted into sirohydrochlorin by the enzyme SirC. The assay mixtures were
incubated overnight at 37 °C to allow for sirohydrochlorin formation before the spectra were recorded. The shown spectra represent the average of two
independent activity assay setups. C, specific activity of WT NirE and NirE variants determined as described under “Experimental Procedures” using chemically
produced uro’gen III as the substrate at a final concentration of 17 ␮M. In contrast to the overnight activity assay (B) the values for the specific activity represent
the initial reaction rates. The given values represent the average of three independent measurements. The SAM binding ability of WT NirE and NirE variants was
determined as described under “Experimental Procedures.” The strength of SAM binding is represented as identical to WT NirE (ϩϩϩϩ), slightly reduced
(ϩϩϩ), reduced (ϩϩ), and strongly reduced (ϩ).
known and the SAH is located beneath one face of the tetrapyr- (Fig. 4C). The distances and angles between the A and C rings
role, one of the two possible orientations of the substrate could N-H groups and the Met-186 sulfur are in accordance with the
be excluded. Thus, in our NirE-uro’gen III complex structure presence of these unusual sulfur-containing H bonds (42).
the substrate orientation shows rings A–D arranged in a clock- Therefore, Met-186 is important for the binding of both sub-
wise manner when viewed from the top (Fig. 5A).
strates, SAM (see above) and uro’gen III. Accordingly, a P. deni-
The uro’gen III was observed to bind to NirE in a twisted trificans CobA variant in which the corresponding methionine
“two-up, two-down” conformation, i.e. the two pyrrole rings residue (Met-184) had been replaced by an alanine was unable
that face each other point in the same direction either upward to bind SAM and showed almost no SUMT activity (19).
or downward out of the tetrapyrrole plane (Figs. 4 and 5). In the Besides the interaction between uro’gen III and Met-186,
NirE active site, pyrrole rings A and C point down toward the another hydrophobic contact between the substrate and the
interior of the active site pocket and the bound SAH, whereas protein is provided by His-161. The imidazole ring of His-161
rings B and D point upward. Rings A and C are inclined by stacks against pyrrole ring C of uro’gen III (Fig. 5A). This histi-
about 70° and 60° out of the tetrapyrrole plane, respectively, dine residue is part of the flexible loop of the C-terminal
rings B and D both by about 45°. Such a “puckered” conforma- domain of NirE and moves slightly backward upon substrate
tion was also observed for uro’gen III in the enzyme-product binding to accommodate the tetrapyrrole (Fig. 6A).
complex structure of uro’gen III synthase (28). Interestingly,
The eight carboxylate groups of the acetate and propionate
Met-186 is located directly below the tetrapyrrole and stacks substituents of uro’gen III are involved in polar contacts
against pyrrole rings B and D with its sulfur atom being placed (hydrogen bonds or salt bridges) with three conserved arginine
beneath the exact center of the macrocycle (Fig. 5). Met-186 residues, the NirE protein backbone, and several water mole-
seems to stabilize the central part of the substrate by providing cules (Figs. 4C and 5; to avoid too crowded figures, the water
a hydrophobic environment and forming hydrogen bonds molecules are not shown). The acetate carboxylate of ring A
(ϳ3.5 Å each) with the N-H groups of pyrrole rings A and C forms a polar contact with the guanidinium group of Arg-111
26762 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
and hydrogen bonds with three water molecules, whereas the catalysis. To identify those amino acid residues that are directly
propionate carboxylate of this ring makes a polar contact with involved in catalysis we performed site-directed mutagenesis.
the guanidinium group of Arg-51. This arginine residue is also Previously, it was proposed that the SAM-dependent methyl
involved in a polar contact with the carboxylate group of the transfer reaction could be initiated through a proton abstrac-
acetate substituent of ring B. The propionate side chain of ring tion from uro’gen III carried out by a basic amino acid residue
ϩ
B is held in its position via hydrogen bonds to the backbone (18). This H abstraction can occur from either a methylene
N-H group of Gly-189 and two water molecules. The ring C bridge between the pyrrole rings (most likely the C-20 position
acetate carboxylate group forms hydrogen bonds with three for the first methylation) or a pyrrole N-H group. Subsequent to
water molecules. The propionate carboxylate of the same ring the methyl group transfer from SAM onto uro’gen III, a bond
also makes a hydrogen bond with a water molecule. The highly rearrangement within the tetrapyrrole macrocycle is presumed
conserved amino acid Arg*-149, which belongs to the polypep- to take place (18, 25). Possibly, amino acid residues of the NirE
tide chain of the second monomer of dimeric NirE (indicated by active site could promote this prototropic rearrangement
an asterisk) and is located on the loop between hF and ␤6 of through acid/base catalysis.
domain B (see above), is also involved in the binding of uro’gen
Upon inspection of the NirE active site, we selected the
III, although it does not directly form hydrogen bonds or salt conserved basic residues Arg-51, Lys-102, Arg-111, Arg-149,
bridges. Rather, Arg*-149 seems to compensate the negative and His-161 for site-directed mutagenesis. Arg-51 is located
charges of the ring C propionate and the ring D acetate car- near the methylene bridge C-5 between rings A and B, the
boxylates with its guanidinium group. Of the three arginine residues Arg-111 and Arg*-149 are close to the C-20 position
residues involved in the coordination of the carboxylate groups between rings A and D, and finally His-161 is located in the
of the substrate, Arg-51 and Arg*-149 clearly change their ori- direct neighborhood of methylene bridge positions C-10 and
entation upon substrate binding (Fig. 6A). In the NirE structure C-15 as well as the N-H group of ring C. To knock out the
without bound uro’gen III the guanidinium group of Arg-51 putative function of His-161 as catalytically active base but
points upward and moves down in the presence of the sub- to retain its hydrophobic stacking interaction with pyrrole
strate. This movement is even more pronounced when the ring C, it was replaced by a phenylalanine. Although arginine
NirE-substrate-bound structure is compared with the CysG is usually considered to be a poor base, there are several
structure. Here, the side chain of the corresponding arginine examples reported in the literature showing the involvement
residue (Arg-249) would have to hinge down by about 90° to of arginine residues in proton abstractions (44). In these
adopt the same conformation as Arg-51 of NirE in the presence cases, the arginine residues are solvent-accessible and adja-
of uro’gen III. Depending on the absence or presence of the cent to carboxylate groups of glutamate or aspartate side
substrate, the side chain of Arg*-149 also drastically changes its chains. In the NirE active site, an acidic environment is pro-
orientation. In the NirE structure without uro’gen III bound, vided by the highly conserved residues Glu-114 and Glu-115
this arginine residue forms a salt bridge with the adjacent Asp*- as well as the carboxylate groups of the substrate, which are
150. The presence of the substrate induces a flipping of the close to the conserved residues Arg-51, Arg-111, and Arg*-
guanidinium group which then points toward the opposite 149. Therefore, all three arginines were chosen for site-di-
direction and participates in the coordination of the ring C and rected mutagenesis and were replaced by lysines. Addition-
D carboxylate groups (Fig. 6A).
ally, Glu-114 was subjected to site-directed mutagenesis as
Overall, the acetate and propionate substituents of uro’gen well and was exchanged against a glutamine.
III are not very tightly fixed in their positions by the surround-
Further, to investigate the role of the highly conserved Met-
ing amino acid residues. Rather, residues Arg-111, Arg-51, and 186 that is strikingly located in the center of the active site and
Arg*-149 and possibly also the highly conserved Lys-72 lying on participates in both SAH and substrate coordination, we
the disordered loop of domain A provide a positively charged exchanged this residue against a leucine. This substitution is
environment to accommodate the carboxylate groups of the more conservative than the previously reported methionine to
substrate. This loose coordination of the substrate carboxylate alanine exchange in CobA from P. denitrificans which resulted
groups is reflected in a high temperature factor (58.8 Å2) and a in a complete loss of enzyme activity (19). Finally, Gly-189 was
weaker electron density for the substrate compared with that of selected for replacement by an asparagine or a lysine based on
the bound SAH (Fig. 4A). The observed relatively loose coordi- the superposition of NirE with the structures of CysG and
nation of the uro’gen III side chains is in line with the fact that CobA in which it corresponds to Asn-385 and Lys-187, respec-
the enzyme has to bind the monomethylated precorrin-1 in the tively. The superposition revealed that Asn-385 and Lys-187
same active site pocket to perform the second methylation at could form polar contacts to the propionate carboxylate of the
C-7. Additionally, it also explains the observation that SUMTs substrate ring B, and we aimed to study the effect of their pres-
are able to accept uroporphyrinogen isomers other than ence at this particular position in NirE.
uro’gen III, such as uro’gens I, II, or IV, as substrates (23, 43).
All NirE variants were produced in Escherichia coli, purified, and
Generation of NirE Variants Carrying Amino Acid Exchanges analyzed for their SAM binding ability and catalytic SUMT activity. A
of Residues Potentially Involved in Catalysis—Our NirE- summary of the obtained results is shown in Fig. 6, B and C.
uro’gen III complex structure revealed for the first time the
Exchange of Amino Acid Residues Arg-51, Arg-111, Glu-
direct amino acid environment of the substrate uro’gen III in 114, Arg-149, His-161, and Gly-189 Does Not Disturb SAM
the active site of a SUMT. The amino acids surrounding uro’gen Binding—In our binding assay, the SAM binding ability of
III are involved in the coordination of the substrate and/or the NirE variants E114Q, R149K, and H161F was identical to
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26763

Structure of NirE in Complex with Uroporphyrinogen III
that of the WT protein. For the NirE variants R51K, R111K, SUMT activity. Therefore, the replacement of the lysine by
G189N, and G189K a slightly reduced (about 75% of WT) an alanine probably disrupted the active site architecture
SAM binding was measured. In contrast, the protein variant interfering with both SAM and uro’gen III binding. For the
M186L was more impaired in SAM binding (about 40% of WT), M186L variant which still exhibited a SAM binding ability of
and the K102A variant exhibited a strongly reduced ability to about 40% compared with WT NirE, only residual SUMT
bind the cofactor (about 20% of WT). Overall, these results are activity was observed. This dramatic decrease of the catalytic
in accordance with the localization of the respective amino acid activity clearly shows that Met-186 is critically involved in
residues in the NirE active site. Residues Arg-51, Arg-111, Glu- both SAM and uro’gen III binding as suggested by its pro-
114, Arg*-149, His-161, and Gly-189 are obviously not crucial nounced localization in the active site. Even the rather con-
for SAM binding, and therefore, any defects in SUMT activity servative exchange of methionine against a leucine led to the
caused by their substitution must be due to their contribution almost complete loss of SUMT activity. This indicates that
to uro’gen III coordination or NirE catalysis. The reduced SAM the sulfur atom of the methionine might help to position the
binding of the M186L variant was not unexpected because the substrate correctly through hydrogen bonds with the N-H
NirE structure and the structures of CysG and CobA had groups of pyrrole rings A and C.
revealed the hydrophobic interaction between this methionine
NirE variants R51K and H161F were able to bind SAM but
residue and the cofactor. The M186L variant, however, still showed reduced specific SUMT activities. However, both
exhibited SAM binding strong enough to allow for performing variants were still clearly able to catalyze the methyl transfer
SUMT activity assays and investigating the role of Met-186 in reaction. The amount of precorrin-2 produced by them in
uro’gen III binding and NirE catalysis (see below). The strongly the overnight incubation assay even equaled that of WT
reduced SAM binding capacity of K102A was surprising NirE. Both residues, Arg-51 and His-161, were found to
because it is not located in the direct neighborhood of the coordinate the substrate uro’gen III in our NirE-uro’gen III
cofactor. However, this lysine residue participates in an complex structure and hence to be directly involved in the
extended network of hydrogen bonds also involving the resi- binding of the substrate. As mentioned above, these amino
dues Glu-115, Gly-110, Arg-100, Gln-81, and Asp-50. All of acids were initially also considered suitable to act as base for
these amino acid residues except Arg-100 are highly conserved proton abstraction from uro’gen III to initiate the methyl
in SUMTs from different organisms. Therefore, Lys-102 transfer reaction. However, because R51K and H161F
together with the mentioned residues is essential for the overall retained the ability to convert uro’gen III into precorrin-2, it
structural integrity of the active site.
can be ruled out that they are directly involved in catalysis.
Amino Acids Arg-51, His-161, and Met-186 Are Involved in Rather, they solely assist in the coordination of uro’gen III as
Uro’gen III Coordination—The SUMT activity of NirE WT their substitution leads to reduced initial reaction rates that
and variants was measured using two slightly different assay result from reduced substrate affinities.
systems (Fig. 6, B and C). In one of them, the overnight
Amino Acids Arg-111, Glu-114, and Arg*-149 Are Involved in
production of sirohydrochlorin was determined (Fig. 6B), NirE Catalysis—Like R51K and H161F, the NirE mutants
and in the second the specific activity (i.e. the initial reaction R111K and R149K were able to bind SAM but showed
rates) was measured (Fig. 6C). For NirE variants carrying reduced SUMT activity. However, whereas the former were
exchanges of amino acid residues solely involved in substrate still able to form precorrin-2 (see above), both R111K and
coordination and not directly involved in catalysis a reduced R149K showed drastically reduced SUMT activity. Strik-
specific activity, but an equal overnight activity compared ingly, both arginines, Arg-111 and Arg*-149, are located in
with the WT NirE was expected. Michaelis-Menten kinetics close proximity to the uro’gen III C-20 position where the
cannot be performed with NirE due to the substrate inhibi- proton abstraction could take place. Further, both arginines
tion by uro’gen III and product inhibition by SAH (10).
are in close contact to several carboxylate groups either orig-
Compared with the WT, all analyzed NirE variants inating from the substrate or from the protein. Therefore,
showed reduced SUMT activity except for G189N and they are both situated in an environment that could enhance
G189K, which exhibited a higher activity in both assay sys- their ability to act as base for proton abstraction (44). Arg-
tems. The G189K variant catalyzed the methylation of 111 is in close contact to the strictly conserved Glu-114
uro’gen III almost twice as fast as the WT protein (specific which helps to position it near the substrate. To support this
activity). The active sites of the NirE variants G189N and hypothesis we also modified the conserved Glu-114 by
G189K resemble those of CysG and CobA, respectively (see changing it to glutamine. The resulting E114Q mutant was
above). Interestingly, in previous studies these two enzymes able to bind SAM like the WT NirE but showed likewise
also showed a higher specific activity than NirE (18, 19). The strongly reduced SUMT activity. This result underlines the
increased activity of enzymes carrying an asparagine or important role of Glu-114 for the correct functioning of Arg-
lysine at this specific position might be due to a more precise 111. In fact, Arg-111 is the only proteinogenic polar contact
and specific binding of uro’gen III and precorrin-1 through partner for the carboxylate group of Glu-114, which is oth-
polar contacts between the asparagine or lysine side chains erwise only in contact with three water molecules.
with the carboxylate groups of the substrates.
In summary, the described biochemical results for the
Both NirE variants K102A and M186L showed reduced NirE variants R111K, E114Q, and R149K strongly suggest
SAM binding (see above). Additionally, the exchange of Lys- that these residues are not only involved in the coordination
102 to an alanine residue resulted in the complete loss of of the substrate carboxylate side chains but also participate
26764 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
directly in catalysis. Based on our results, we cannot defi- in the NirE catalytic mechanism. Further biochemical analyses
nitely state which one of the two arginines, Arg-111 or Arg*-
149, acts as the base that initiates the methyl transfer reac-
tion. On one hand, both arginines are involved in polar
contacts with two carboxylate groups. These are the car-
boxylates of Glu-114 and the substrate ring A acetate side
chain for Arg-111 and those of the substrate ring D acetate
side chain and ring C propionate substituent for Arg*-149.
Such a carboxylate-rich environment was proposed to be a
common motif for some proteins that use arginine residues
as the catalytically essential base (44). It was argued that the
carboxylate groups in the neighborhood of the arginine
could facilitate the rapid exchange of protons with the sol-
vent. Accordingly, another common feature of this group of
enzymes was the solvent accessibility of their active sites.
Indeed, in our NirE-uro’gen III complex structure the active
site is also exposed to the solvent, although the two unre-
solved flexible loops mentioned above might cover the active
site to a certain extend and shield it from the surrounding
medium. Considering the distances of the guanidinium
groups of Arg-111 and Arg*-149 from the substrate C-20
position the side chain of Arg*-149 is positioned in a slightly
more favorable location than that of Arg-111. For Arg*-149
the guanidinium NH2 group located closest to C-20 is found
at a distance (N 3 C) of 4.66 Å. For Arg-111 the ⑀-NH group
is located closest to C-20 at a distance of 4.75 Å, whereas one
of the terminal NH2 groups of this residue is positioned at a
distance of 6.15 Å. However, the C-20 position of the sub-
strate might even move closer to both arginine residues
when the true cosubstrate SAM is present in the active site.
Because in our NirE-substrate complex the product SAH was
bound, that does not carry the methyl group, the uro’gen III
might in fact be positioned deeper in the active site than it
would be in the presence of SAM.
of the influence of these amino acid residues on NirE enzyme
activity showed that arginines Arg-111 and Arg*-149 as well as
glutamate 114 are probably directly involved in NirE catalysis.
All three amino acid residues are highly conserved among dif-
ferent SUMTs from diverse organisms. Based on the observed
localization of Arg-111, Arg*-149, and Glu-114 with respect to
the substrate uro’gen III we propose a potential mechanism for
the NirE reaction that might be valid for all members of the
SUMT family (Fig. 7A). In previous studies it was proposed that
the methyl transfer reaction catalyzed by SUMTs could be ini-
tiated by a proton abstraction from the substrate uro’gen III.
Based on our structural and biochemical observations
described herein, we propose that either Arg-111 or Arg*-149
acts as the catalytically active base which abstracts a proton
from C-20 of uro’gen III. The resulting movement of electrons
facilitates the nucleophilic attack of C-2 at the methyl group of
SAM.
In our NirE structure uro’gen III binds in a two-up, two-
down conformation that brings the N-H group of ring A
close to the sulfur atom of SAH and leaves the C-2 atom in a
relatively large distance to the SAH sulfur (6.15 Å). To inves-
tigate whether this uro’gen III conformation is compatible
with the presence of SAM in the active site, we modeled SAM
in place of SAH under the assumption that SAM would adopt
an identical conformation. This assumption was based on
x-ray structures of published SAM complexes (e.g. PDB ID
3GX3 and 3GX6) (45). In the presence of SAM, the ring A
N-H group clashes with the methyl group of the cosubstrate
in case that uro’gen III adopts its two-up, two-down confor-
mation (Fig. 7B). Thus, we assume that in the presence of
SAM the uro’gen III actually binds in a conformation in
which the ring A is flipped down to avoid this clash (Fig. 7C).
This conformation of uro’gen III with a planar arrangement
of ring A potentially resembles that of the reaction transition
state and might facilitate the formation of the new double
bond between C-20 and C-1 upon proton abstraction from
C-20. Furthermore, with the ring A flipped down the C-2
atom is positioned close enough to the SAM methyl group to
perform the nucleophilic attack.
Another striking observation that might explain the need of
both Arg-111 and Arg*-149 for catalysis is their direct neigh-
borhood to each other. In fact, the two guanidinium groups are
arranged almost in parallel with their planes at a distance of
about 3.5 Å. It is possible that the proximity of the positive
charge of one of the guanidinium groups favors the deproto-
nated state of the second which would then be available for
proton abstraction from C-20. Interestingly, the side chain of
Arg*-149 forms a salt bridge with Asp*-150 in the absence of
uro’gen III (see above). Possibly, the binding of the substrate to
the active site causes the side chain of Arg*-149 to move away
from Asp*-150 toward the active site where it forms polar con-
tacts with two of the substrate carboxylate side chains. How-
ever, in this new position Arg*-149 is now in close proximity to
positively charged Arg-111 which facilitates deprotonation of
the former. Subsequently, uncharged Arg*-149 can abstract a
proton from C-20, thus initiating the methyl transfer reaction.
Of course, positively charged Arg*-149 could also promote the
deprotonation of Arg-111, which then in turn might act as the
catalytically essential base.
After the methyl transfer a rearrangement of double bonds
within the tetrapyrrole macrocycle was proposed to take
place. Accordingly, it was reported that the double bond that
is located between C-3 and C-4 in uro’gen III is found either
between C-4 and C-5 or between C-4 and N-21 in precor-
rin-1 (22). Possibly, the highly conserved Lys-72 of NirE
might be involved in this tautomerization of the tetrapyrrole
as previously proposed for the corresponding Lys-270 of S.
enterica CysG (18). Unfortunately, this lysine residue is
located on the flexible loop of domain A which was not
resolved in our NirE structure. However, the K270I variant
of CysG was hardly active indicating the involvement of this
lysine in catalysis (18). Additionally, the water molecules
that were found around uro’gen III might also be involved in
the tautomerization of precorrin-1. After the first methyla-
tion at C-2 the newly formed precorrin-1 (Fig. 7D) and the
Implications for the Catalytic Mechanism of NirE and Other
SUMTs—Based on the crystal structure of NirE in complex
with its substrate uro’gen III, reported in this study, it was pos-
sible to identify several amino acid residues potentially involved reaction side product SAH are released from the active site.
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26765

Structure of NirE in Complex with Uroporphyrinogen III
FIGURE 7. Potential reaction mechanism and model of SAM in the NirE active site. A, proposed catalytic mechanism of NirE (see “Results and
Discussion” for detailed explanation). B–D, proposed conformation of bound uro’gen III in the presence of SAM in the NirE active site instead of SAH. The
molecules are shown in stick representation. SAM/SAH is shown in light blue, uro’gen III/precorrin-1 in light orange. B, clash between the methyl group
of modeled SAM and the N-H group of ring A in case that uro’gen III adopts its two-up, two-down conformation. C, proposed conformation of uro’gen
III in the presence of SAM. D, proposed conformation of precorrin-1 after the methyl transfer reaction and prototropic rearrangements.
To facilitate the release of the reaction products Arg*-149 entation of the initial substrate uro’gen III. This rotation
potentially reforms its salt bridge with Asp*-150 that was would place the methylene bridge C-5 in a position similar to
observed in the NirE structure without bound substrate. For that of the C-20 during the first methylation. Thus, to initiate
the second methylation at C-7 a new SAM molecule and the second methylation reaction we propose a proton abstrac-
precorrin-1 have to bind to the active site. We propose that tion from C-5 again catalyzed by the arginine pair Arg-111/
precorrin-1 binds to the enzyme in an orientation represent- Arg*-149 (Fig. 7A). Finally, to yield precorrin-2 another rear-
ing a 90° counterclockwise rotation with respect to the ori- rangement of double bonds has to occur.
26766 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 286•NUMBER 30•JULY 29, 2011

Structure of NirE in Complex with Uroporphyrinogen III
419–433
Acknowledgments—We thank Dr. Bohdan Snovydovych (Institute of
Organic Chemistry, Technische Universita¨t (TU) Braunschweig) for
technical help with the reduction of uroporphyrin III with H2/palla-
dium, and Nick Quade (Department of Molecular Structural Biology,
Helmholtz Centre for Infection Research, Braunschweig) for assis-
tance with data collection. We would like to thank Dr. Ju¨rgen Moser
(Institute of Microbiology, TU Braunschweig) for helpful discussions
and Prof. Dieter Jahn (Institute of Microbiology, TU Braunschweig)
for continuous support.
20. Rehse, P. H., Kitao, T., and Tahirov, T. H. (2005) Acta Crystallogr. D Biol.
Crystallogr. 61, 913–919
21. Schubert, H. L., Blumenthal, R. M., and Cheng, X. (2003) Trends Biochem.
Sci. 28, 329–335
22. Brunt, R. D., Leeper, F. J., Grgurina, I., and Battersby, A. R. (1989) J. Chem.
Soc. Chem. Commun. 428–431
23. Warren, M. J., Gonzalez, M. D., Williams, H. J., Stolowich, N. J., and Scott,
A. I. (1990) J. Am. Chem. Soc. 112, 5343–5345
24. Mascaro, L., Jr., Horhammer, R., Eisenstein, S., Seller, L. K., Mascaro, K.,
and Floss, H. G. (1977) J. Am. Chem. Soc. 99, 273–274
25. Warren, M. J., Bolt, E., and Woodcock, S. C. (1994) Ciba Found. Symp.
180, 26–49
REFERENCES
26. Aiyar, A., Xiang, Y., and Leis, J. (1996) Methods Mol. Biol. 57, 177–191
27. Layer, G., Verfu¨rth, K., Mahlitz, E., and Jahn, D. (2002) J. Biol. Chem. 277,
34136–34142
1. Battersby, A. R. (2000) Nat. Prod. Rep. 17, 507–526
2. Zumft, W. G. (1997) Microbiol. Mol. Biol. Rev. 61, 533–616
3. Layer, G., Reichelt, J., Jahn, D., and Heinz, D. W. (2010) Protein Sci. 19,
1137–1161
28. Schubert, H. L., Phillips, J. D., Heroux, A., and Hill, C. P. (2008) Biochem-
istry 47, 8648–8655
4. Leeper, F. J. (1985) Nat. Prod. Rep. 2, 561–580
29. Leech, H. K., Raux, E., McLean, K. J., Munro, A. W., Robinson, N. J.,
Borrelly, G. P., Malten, M., Jahn, D., Rigby, S. E., Heathcote, P., and War-
ren, M. J. (2003) J. Biol. Chem. 278, 41900–41907
5. Blanche, F., Debussche, L., Thibaut, D., Crouzet, J., and Cameron, B.
(1989) J. Bacteriol. 171, 4222–4231
6. Blanche, F., Robin, C., Couder, M., Faucher, D., Cauchois, L., Cameron, B.,
and Crouzet, J. (1991) J. Bacteriol. 173, 4637–4645
30. Minor, W., Cymborowski, M., and Otwinowski, Z. (2002) Acta Phys. Po-
lonica 101, 613–619
7. Fan, J., Wang, D., Liang, Z., Guo, M., Teng, M., and Niu, L. (2006) Protein
Expr. Purif. 46, 40–46
31. Kabsch, W. (2010) Acta Crystallogr. D Biol. Crystallogr. 66, 133–144
32. Kabsch, W. (2010) Acta Crystallogr. D Biol. Crystallogr. 66, 125–132
33. Vagin, A., and Teplyakov, A. (1997) J. Appl. Crystallogr. 30, 1022–1025
34. Emsley, P., and Cowtan, K. (2004) Acta Crystallogr. D Biol. Crystallogr. 60,
2126–2132
8. Leustek, T., Smith, M., Murillo, M., Singh, D. P., Smith, A. G., Woodcock,
S. C., Awan, S. J., and Warren, M. J. (1997) J. Biol. Chem. 272, 2744–2752
9. Robin, C., Blanche, F., Cauchois, L., Cameron, B., Couder, M., and
Crouzet, J. (1991) J. Bacteriol. 173, 4893–4896
35. Murshudov, G. N., Vagin, A. A., Lebedev, A., Wilson, K. S., and Dodson,
E. J. (1999) Acta Crystallogr. D Biol. Crystallogr. 55, 247–255
36. Schomaker, V., and Trueblood, K. N. (1968) Acta Crystallogr. B 24, 63–76
37. Painter, J., and Merritt, E. A. (2006) Acta Crystallogr. D Biol. Crystallogr.
62, 439–450
10. Storbeck, S., Walther, J., Mu¨ller, J., Parmar, V., Schiebel, H. M., Kemken,
D., Du¨lcks, T., Warren, M. J., and Layer, G. (2009) FEBS J. 276, 5973–5982
11. Warren, M. J., Roessner, C. A., Santander, P. J., and Scott, A. I. (1990)
Biochem. J. 265, 725–729
12. Woodcock, S. C., Raux, E., Levillayer, F., Thermes, C., Rambach, A., and
Warren, M. J. (1998) Biochem. J. 330, 121–129
38. Gouet, P., Robert, X., and Courcelle, E. (2003) Nucleic Acids Res. 31,
3320–3323
13. Zajicek, R. S., Bali, S., Arnold, S., Brindley, A. A., Warren, M. J., and Fer-
guson, S. J. (2009) FEBS J. 276, 6399–6411
39. Wallace, A. C., Laskowski, R. A., and Thornton, J. M. (1995) Protein Eng. 8,
127–134
14. Spencer, J. B., Stolowich, N. J., Roessner, C. A., and Scott, A. I. (1993) FEBS
Lett. 335, 57–60
40. DeLano, W. L. (2002) The PyMOL Molecular Graphics System, DeLano
Scientific LLC, San Carlos, CA
15. Warren, M. J., Bolt, E. L., Roessner, C. A., Scott, A. I., Spencer, J. B., and
Woodcock, S. C. (1994) Biochem. J. 302, 837–844
41. Matthews, B. W. (1968) J. Mol. Biol. 33, 491–497
42. Zhou, P., Tian, F., Lv, F., and Shang, Z. (2009) Proteins 76, 151–163
43. Scott, A. I., Williams, H. J., Stolowich, N. J., Karuso, P., Gonzalez, M. D.,
Blanche, F., Thibaut, D., Mu¨ller, G., Savvidis, E., and Hlineney, K. (1989)
J. Chem. Soc. Chem. Commun. 522–525
16. Anderson, P. J., Entsch, B., and McKay, D. B. (2001) Gene 281, 63–70
17. Lobo, S. A., Brindley, A., Warren, M. J., and Saraiva, L. M. (2009) Biochem.
J. 420, 317–325
18. Stroupe, M. E., Leech, H. K., Daniels, D. S., Warren, M. J., and Getzoff,
E. D. (2003) Nat. Struct. Biol. 10, 1064–1073
44. Guille´n Schlippe, Y. V., and Hedstrom, L. (2005) Arch. Biochem. Biophys.
433, 266–278
19. Ve´vodova´, J., Graham, R. M., Raux, E., Schubert, H. L., Roper, D. I., Brind-
ley, A. A., Ian Scott, A., Roessner, C. A., Stamford, N. P., Elizabeth Stroupe, 45. Montange, R. K., Mondrago´n, E., van Tyne, D., Garst, A. D., Ceres, P., and
M., Getzoff, E. D., Warren, M. J., and Wilson, K. S. (2004) J. Mol. Biol. 344,
Batey, R. T. (2010) J. Mol. Biol. 396, 761–772
JULY 29, 2011•VOLUME 286•NUMBER 30
JOURNAL OF BIOLOGICAL CHEMISTRY 26767

Protein Structure and Folding:
Crystal Structure of the Heme d1
Biosynthesis Enzyme NirE in Complex with
Its Substrate Reveals New Insights into the
Catalytic Mechanism of S
-Adenosyl-l-methionine-dependent
Uroporphyrinogen III Methyltransferases
Sonja Storbeck, Sayantan Saha, Joern
Krausze, Björn U. Klink, Dirk W. Heinz and
Gunhild Layer
J. Biol. Chem. 2011, 286:26754-26767.
doi: 10.1074/jbc.M111.239855 originally published online May 31, 2011
Access the most updated version of this article at doi: 10.1074/jbc.M111.239855
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 42 references, 9 of which can be accessed free at
http://www.jbc.org/content/286/30/26754.full.html#ref-list-1