Isolation of bacterial strains that produce the endocrine disruptor, octylphenol diethoxylates, in paddy fields

Article abstract of DOI:10.1271/bbb.66.1792

Topsoil samples were collected from 36 different paddy fields in West Japan. Each soil sample was incubated with a basal salt-medium containing 0.2% OPPEO. Twelve samples possessed OPPEO-degrading activity, from which twelve cultures of OPPEO-degrading ba

Full text of DOI:10.1271/bbb.66.1792

This article was downloaded by: [North Dakota State University]
On: 26 October 2014, At: 22:09
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
House, 37-41 Mortimer Street, London W1T 3JH, UK
Bioscience, Biotechnology, and Biochemistry
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/tbbb20
Isolation of Bacterial Strains that Produce the
Endocrine Disruptor, Octylphenol Diethoxylates, in
Paddy Fields
Eriko NISHIOa, Yayoi ICHIKIa, Hiroto TAMURAb, Shiro MORITAa, Katuji WATANABEc &
Hiromichi YOSHIKAWAa
a Department of Environmental Chemistry, Kyushu Kyoritsu University Kitakyushu
807-8585, Japan
b Department of Applied Biochemistry, Meijyo University Nagoya 468-8502, Japan
c Department of Agro-Environment Resource Research, Laboratory of Soil Microbiology,
National Agricultural Research Center for Kyushu Okinawa Region Kikuchi-gun,
Kumamoto 861-1192, Japan
Published online: 22 May 2014.
To cite this article: Eriko NISHIO, Yayoi ICHIKI, Hiroto TAMURA, Shiro MORITA, Katuji WATANABE & Hiromichi YOSHIKAWA
(2002) Isolation of Bacterial Strains that Produce the Endocrine Disruptor, Octylphenol Diethoxylates, in Paddy Fields,
Bioscience, Biotechnology, and Biochemistry, 66:9, 1792-1798, DOI: 10.1271/bbb.66.1792
To link to this article: http://dx.doi.org/10.1271/bbb.66.1792
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of
the Content. Any opinions and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied
upon and should be independently verified with primary sources of information. Taylor and Francis shall
not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other
liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or
arising out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions

Biosci. Biotechnol. Biochem., 66 (9), 1792–1798, 2002
Isolation of Bacterial Strains that Produce the Endocrine Disruptor,
Octylphenol Diethoxylates, in Paddy Fields
1
Eriko NISHIO,1 Yayoi ICHIKI,1 Hiroto TAMURA,2 Shiro MORITA
,
†
1,
Katuji WATANABE,3 and Hiromichi YOSHIKAWA
1Department of Environmental Chemistry, Kyushu Kyoritsu University, Kitakyushu 807-8585, Japan
2Department of Applied Biochemistry, Meijyo University, Nagoya 468-8502, Japan
3Department of Agro-Environment Resource Research, Laboratory of Soil Microbiology, National
Agricultural Research Center for Kyushu Okinawa Region, Kikuchi-gun, Kumamoto 861-1192, Japan
Received November 5, 2001; Accepted May 9, 2002
Topsoil samples were collected from 36 diŠerent
paddy ˆelds in West Japan. Each soil sample was incu-
of APPEO is e‹cient.8) Such degradation products
as short (typically 1–3) ethoxy chain length APnEOs,
APs themselves, and carboxylated APnECs,
however, occur frequently as stable intermediates in
eŒuent, activated sludge and surface water.9–13) This
means that the relatively benign surfactant is convert-
ed to more endocrine-disruptive compounds by the
biodegradation process.
The less common but important emulsiˆer, octyl-
phenol polyethoxylates (OPPEO), is widely used as a
wetting and dispersing agent in pesticide formula-
tions (Fig. 1). Since such metabolites as octylphenol
diethoxylate, octylphenol monoethoxylate and octyl-
phenol have been identiˆed in surface water, some
microorganisms which can degrade OPPEO seem to
exist in the environment. Farm land would seem to be
a place under selective pressure by the surfactant
since it is spread as an adjuvant component with
agricultural chemicals. The objective of this study is
to ˆnd OPPEO-degrading microorganisms in paddy
soil and to identify these species of the degrading
microorganisms.
bated with a basal salt-medium containing 0.2
z OP-
PEO. Twelve samples possessed OPPEO-degrading ac-
tivity, from which twelve cultures of OPPEO-degrading
bacteria were isolated. The isolated bacteria grew on a
medium containing 0.2
% OPPEO as the sole carbon
source, and OP2EO and OP3EO were accumulated in
the medium under aerobic conditions. OP1EO and oc-
tylphenol, which have often been identiˆed in surface
water together with OP2EO, were not observed in this
experiment. The bacterial isolates were gram negative
and tentatively identiˆed as Pseudomonas putida (10
isolates) and Burkholderia cepacia (one isolate) by BIO-
LOG and 16S rDNA RFLP analyses.
Key words: octylphenol polyethoxylate; octylphenol
diethoxylate; biodegradation; endocrine
disruptor; paddy ˆeld
During the last decade, about 40 non-steroidal
endocrine disruptors have been identiˆed.1–4) Endo-
crine disrupters include such degradation products of
alkylphenol polyethoxylates (APPEOs) as nonyl-
phenol polyethoxylates (NPPEOs) and octylphenol
polyethoxylates (OPPEOs) that are commercially im-
portant surfactants. APPEOs are composed of a
Materials and Methods
Materials and reagents. The OPPEO surfactant
(Triton X 100) was purchased from Aldrich Chemi-
cals (Milwaukee, U.S.A.). This compounds contains
a branched chain octylphenol attached to poly-
phenol nucleus that is o, m, and p-substituted with a
hydrophobic and branched alkyl moiety, and with a
hydrophilic polyethylene glycol chain linked to the
phenolic oxygen. While the longer types of APnEO
(n
À
3) lack estrogenic activity, it is known that the
3) and original octylphenol and
shorter types (n
Å
nonylphenol exhibit an estrogenic eŠect on aquatic
organisms and on mammals and birds.5–7) Biodegra-
dation of APPEO has been studied, and it has al-
ready been conˆrmed that the primary degradation
Fig. 1. Structure of OPPEO in Which n May Range from 3 to
16.
A commercial mixture also contains about 3
lene glycol.
z
of polyethy-
†
To whom correspondence should be addressed. Tel: +81-93-693-3167; Fax: +81-93-693-3201; E-mail: fortuna
＠
kyukyo-u.ac.jp
Abbreviations: OPPEO, 4-(1,1,3,3-tetramethylbutyl)phenol polyethoxylate (octylphenol polyethoxylate); OP3EO, octylphenol triethoxy-
late; OP2EO, octylphenol diethoxylate; OP1EO, octylphenol monoethoxylate; RFLP, restriction fragment length polymorphism

Octylphenol Polyethoxylate-degrading Bacteria in Paddy Fields
1793
＝
disperse polyethylene glycol units averaging n 10.
by silica gel column chromatography with
n
-hexane-
All other reagents, including high-performance
ethyl acetate (20:1) as the eluent to aŠord pure ethyl
liquid chromatographic grade
n
-hexane, ethanol,
6-[
ahexanoate in an 84.4
ethyl 6-[ -(1 ,1 ,3 ,3
dioxahexanoate (11.0 g 30 ml of dry THF) was
p
-(1
?
,1
?
,3
?
,3
?
-tetramethyl-butyl)phenyl]-3,6-diox-
yield (11.3 g). A solution of
? ? ? ?-tetramethylbutyl)phenyl]-3,6-
isopropanol, methanol and ethyl acetate were pur-
chased from Wako Pure Chemical Industries (Osaka,
Japan).
z
p
W
added to a suspension of LiAlH4 (1.5 g 50 ml of dry
W
Preparation of the standard degradation products.
9
THF) at below 5 C while stirring. After this addi-
a) 2-[
p
-(1
?
,1
?
,3
?
,3?
-tetramethylbutyl)phenoxy]etha-
tion, the mixture was stirred at room temperature for
4 hrs, before ethyl acetate (20 ml) was added drop-
nol (OP1EO): A solution of sodium octylphenoxide
(22.8 g) and ethyl bromoacetate (17.0 g) in dry
wise to the reaction mixture at below 10
pose excess LiAlH4. After the usual workup, crude 6-
-(1 ,1 ,3 ,3 -tetramethylbutyl)phenyl]-3,6-dioxa-
9C to decom-
DMSO (80 ml) was stirred overnight at 259C. After
the reaction had been completed, 200 ml of water was
added to the reaction mixture, and the mixture was
[
p
? ? ? ?
hexanol (OP2EO) was obtained as a pale yellow liq-
uid. This product was puriˆed by silica gel column
extracted with ether (200 ml
×
3). The ethereal layer
was washed twice with water and dried over anhy-
drous sodium sulfate. The ethereal layer was evapo-
rated in vacuo to give a crude product. This product
was puriˆed by silica gel column chromatography
chromatography with
as an the eluent to aŠord pure 6-[
methylbutyl)phenyl]-3,6-diox-ahexanol (OP2EO) in
a 78.3 (CDCl3): 0.71
yield (7.5 g). 1H-NMR
(CH3 2, s), 1.70 (CH2, s),
n
-hexane-ethyl acetate (15:1)
p
-(1?,1?,3?,3?-tetra-
z
d
with
aŠord ethyl
yacetate as a pale yellow liquid (22.8 g; 78.1
n
-hexane-ethyl acetate (15:1) as the eluent to
- (1 ,1 ,3 ,3 -tetramethylbutyl)phenox-
yield).
-tetramethyl-
3, s), 1.34 (CH3
× ×
×
＝
9.0 Hz), 7.29
p
?
?
?
?
3.80–4.21(CH2 4, m), 6.83 (2H, d,
J
9.0 Hz). 13C-NMR
d (CDCl3): 31.6 (3C),
＝
z
(2H, d,
J
A solution of this ethyl
p
-(1
?
,1
?
,3
?
,3
?
31.7 (2C), 32.2, 37.9, 56.9, 61.7, 67.2, 69.7, 72.5,
butyl)phenoxy-acetate (22.4 g 100 ml of dry THF)
113.7(2C), 127.0(2C), 142.5, 156.2. UV
l
max
W
was added dropwise to a suspension of LiAlH4 (1.83
(EtOH) nm (
e
): 283 (1,145), 277 (1,381), 225 (9,457).
): 294 (M+, 8), 223
＝
g 50 ml of dry THF) below 5
9
C while stirring. After
GCMS: tR 10.53 min; m z (
z
W
W
this addition, the mixture was stirred at room tem-
perature for 3 hrs. After the reaction had been com-
pleted, ethyl acetate (20 ml) was added dropwise to
(100), 135 (47).
c) 9-[ p-(1?,1?,3?,3?-Tetramethylbutyl)phenyl]-
3,6,9-trioxanonanol (OP3EO): OP3EO was synthe-
sized from OP2EO by a method similar to that for
the reaction mixture at below 10
excess LiAlH4. After the usual workup, crude
2-[ -(1 ,1 ,3 ,3 -tetramethylbutyl)phenoxy]ethanol
9
C to decompose
OP2EO in an 82.3
z
yield (5.1 g). 1H-NMR
d
× ×
(CDCl3): 0.71 (CH3 3, s), 1.34 (CH3 2, s), 1.70
p
?
?
?
?
(OP1EO) was obtained as a pale yellow liquid. The
product was puriˆed by silica gel column chro-
(CH2, s), 3.61–4.25 (CH2
×
6, m), 6.83 (2H, d,
J 9.0
＝
9.0 Hz). 13C-NMR
d (CDCl3):
＝
Hz), 7.29 (2H, d,
J
matography with
n
-hexane-ethyl acetate (20:1) as the
-(1 ,1 ,3 ,3 -tetramethyl-
31.6 (3C), 31.7 (2C), 32.2, 37.9, 56.9, 61.7, 67.2,
69.8, 70.3, 70.7, 72.5, 113.7 (2C), 126.9 (2C), 142.4,
eluent to aŠord pure 2-[
p
? ? ? ?
butyl)phenoxy]-ethanol (OP1EO, 16.7 g, 87.2
z
156.2. UV
(1,210), 225 (8,324). GCMS: tR
): 338 (M+, 6), 267 (100), 135 (25)
l
max (EtOH) nm (
e
): 283 (1,038), 277
1
yield). H-NMR
d
(CDCl3): 0.71 (CH3
×
3, s), 1.34
＝
10.53 min; m z
W
×
×
(CH3 2, s), 1.70 (CH2, s), 3.80–4.22(CH2 2, m),
(z
6.84 (2H, d,
13C-NMR
(CDCl3): 31.6(3C), 31.7(2C), 32.2, 37.7,
56.8, 60.0, 69.0, 113.7(2C), 127.0(2C), 142.5, 156.2.
J 9.0 Hz), 7.28 (2H, d, J 9.0 Hz).
＝ ＝
1
d
Instrumental analyses. 13C- and H-NMR spectra
were recorded by a JEOL AL400 instrument, using
tetramethylsilane as an internal standard.
The degradation process was tracked by an
IATROSCAN TH-10 instrument (Iatron Laborato-
ries) with Chromarod-S III.
UV lmax (EtOH) nm (e): 283 (1,350), 277 (1,580),
＝
225 (11,080). GCMS: tR 9.04 min; m z (
z): 250
W
(M+, 4), 179 (100), 135 (39).
b) 6-[ p-(1?,1?,3?,3?-Tetramethylbutyl)phenyl]3,6-
dioxahexanol (OP2EO): A solution of OP1EO (10 g
30 ml of dry THF) was added dropwise to a suspen-
sion of sodium hydride (60 in oil: 2.3 g 50 ml of
GCMS analyses were performed by a Perkin Elmer
GCMS Q-910 instrument equipped with a Supelco
SPBTM1 column (30 m length, 0.32 mm diameter) au-
tomatic injector.
HPLC analyses were performed by a Shimadzu
LC-6A instrument equipped with a Shodex MS pak
GF-310 4E column (4.6 250 mm).
×
W
z
W
dry THF) while stirring at room temperature. The
evolution of hydrogen ceased after 1 hr of stirring,
and an ethyl bromoacetate solution (7.0 g 30 ml of
W
dry THF) was then added dropwise to the reaction
mixture at 10
9
C. The reaction mixture was stirred at
PCR ampliˆcation was carried out with a TP-500
DNA thermal cycler (Takara Biochemicals).
room temperature for 1 hr and then re‰uxed for 3
hrs. After the usual workup, crude ethyl 6-[
(1 ,1 ,3 ,3 -tetramethylbutyl)phenyl]-3,6-dioxahex-
anoate was obtained. The crude product was puriˆed
p
-
?
?
?
?
Soil samples. The soil samples were collected in
April 2000 from 35 diŠerent paddy ˆelds in West

1794
E. NISHIO et al.
Japan (Nara prefecture, 6 locations, Osaka prefec-
ture 5 locations, Okayama prefecture, 6 locations,
Yamaguchi prefecture, 8 locations, Fukuoka prefec-
ture, 10 locations). The water content of the each soil
tion, the culture medium (500
an equal volume of ethyl acetate, and the ethyl
acetate layer (1 l) was analyzed by GCMS.
ml) was extracted with
m
sample was between 18
z
and 32
z
.
Tentative identiˆcation of the degradating bacter-
ia. The bacterial isolates were gram negative and ten-
tatively identiˆed by using the Carbon source utiliza-
tion system (Biolog; 5) and by a 16S rDNA RFLP
analysis.14,15)
a) The Biolog GN microtiter plates (Biolog Hayworth
Co., U.S.A) consisted of 95 substrate-containing
wells and one control well without the substrate.
Cells freshly grown on a BUGM (Biolog universal
growth medium) agar plate were suspended in sterile
Culture media. The basal-salts medium was pre-
pared in sterile water and contained 0.2 OPPEO
z
(wt vol) as the sole added carbon source. The basal
W
salts contained in this medium were (grams liter)
W
Na2HPO4 (6.8), KH2PO4 (3.0), NaCl (0.5),
(NH4)2SO4 (2.0), MgSO4 (0.24), CaCl2 (0.01),
together with OPPEO (2.0). The isolation medium
(ml 100 ml) was prepared from the basal salt-medi-
W
um (99.7), a vitamin solution (0.2) and a trace
element solution (0.1). The vitamin solution con-
saline (0.85
150 l of the suspension per well was inoculated into
the Biolog GN microtiter plates. The inoculated Bio-
log plates were incubated at 30 C. After 1 day of in-
z
NaCl). Immediately after suspending,
m
tained (mg 100 ml) pyridoxine hydrochloride (10.0),
W
ribo‰avin (5.0), thiamine hydrochloride (5.0),
9
nicotinic acid (5.0), lipoic acid (5.0),
p
-aminobenzoic
cubation, the results were read with a micro plate
reader at a wavelength of 590 nm.
b) Genomic DNA of isolated bacteria was extracted
as described by Saito and Miura.14) The purity of the
extracted DNA was checked by the 230:260, and
280:260 nm absorbance ratios. PCR ampliˆcation
acid (5.0), folic acid (2.0), biotin (2.0), and vitamin
B12 (0.1) and the trace element solution contained
・
・
(mg 100 ml) MnCl2 4H2O (20.0), CoCl2 6H2O (4.0),
W
・
・
Na2MO4 2H2O (26.0), and FeCl3 6H2O (15.0).
Isolation of the degrading bacteria. Each collected
soil sample (5.0 g) was inoculated into the sterile
basal salt-medium (20 ml, pH 7.5). Culture was agi-
was carried out in a 50-
36.6 l of double distilled water, 5
buŠer, 4 l of each deoxyribonucleotide triphosphate
(2.5 m ), 1 l of each primer (10 pmol), 0.4 l of
Taq DNA polymerase (5 U ml„1; Takara), and 1
of template DNA (0.5 g to 1.0 g). Ampliˆcation
was performed in an automated DNA thermal cycler
under the following conditions: denaturation at 94
for 2 min and 30 cycles of denaturation at 94 C for
30 s, primer annealing at 50 C for 60 s, and primer
extension at 72 C for 60 s. The primers were
designed from the conserved region of the 16S rDNA
ml volume consisting of
×
ml of 10 PCR
m
m
tated at 30
the suspension was left to stand for 10 min. The su-
pernatant of the culture (500 l) was transferred to
9
C and 120 rpm for two weeks, after which
M
m
m
m
l
m
m
m
the isolation medium (20 ml) and incubated for 7
days. After several transfers to the isolation medium,
the culture solution was spread on an isolation agar
medium. The colonies that appeared were distin-
guished by their color, form and transparency, and
all the colonies which seemed to be diŠerent were col-
lected and preserved on the slant medium. The OP-
PEO decomposition activity was examined for each
colony and the axenic strains were maintained on an
agar slant of the same medium.
9
C
9
9
9
15)
sequence of E. coli
GCTCAGATTGAACGCTGGCG3
sponding to the 22–41 positions, and the reverse
primer was GTCGAGCACAACACTTTACA5?
:
the forward primer was
5?
?
(41f) corre-
3?
(1066r) corresponding to the 1066–1085 positions.
Ten microliter of the ampliˆed 16S rDNA was
digested by selected restriction enzymes and then
Growth test and analysis of biodegradation by the
isolated bacteria with OPPEO as the sole carbon and
energy source. The isolated bacteria were
preliminarily cultured on an agar slant isolation
medium. The bacteria were suspended in the isola-
tion medium to make up a bacterial suspension (OD
electrophoretically separated in 2
z low-melting-
point agarose gel in a Tris-Borate buŠer. The gel was
stained with ethidium bromide, the fragments pat-
tern on the gel being recorded and the size of the
fragments being calculated from a densitogram.
DNA fragment sizes smaller than 50 bp were neglect-
ed. A similarity search was made by using the pro-
gram of Watanabe and Okuda.16,17) This program
provides 1533 kinds of 16S rDNA RFLP database
consisting of 378 kinds of bacterial genus and 1288
bacterial species.
＝
1.0). This suspension (1000
a fresh 0.2 OPPEO isolation medium (40 ml), and
the medium was agitated at 30 C and 120 rpm. Bac-
ml) was inoculated into
z
9
terial growth was monitored by the measurement of
the optical density of the medium at 660 nm every
3 hr.
An HPLC analysis was conducted as follows,
aliquots 100 ml that were withdrawn every 6 hr was
passed through a disposable disk ˆlter (0.2
l of the aliquots was analyzed by HPLC.
After 10 days of incubation under the same condi-
mm), and
Results and Discussion
5
m
Synthesis of the authentic samples

Octylphenol Polyethoxylate-degrading Bacteria in Paddy Fields
1795
Fig. 2. Iatroscan Chromatogram of OPPEO and Its Biodegrada-
tion Products.
Chromatogram a): OPPEO; b): Biodegradation products
after 7 days of incubation. Conditions: Stationary phase of
Chromarod-S III, mobile phase of ethyl acetate:acetone:H2O
(10:5:1), H2 gas ‰ow of 160 ml min, air ‰ow of 2.0 l min, scan-
W
W
Fig. 3. Typical GCMS Fragmentation Pattern of OPPEO.
ning speed of 30 sec scan, integrator attenuation of 16. Spot-
W
ting: a) A 0.2
z
OPPEO solution was extracted with an equal
l) was spot-
volume of ethyl acetate. The ethyl acetate layer (3
m
ted on Chromarod-S III. b) The incubation medium (0.5 ml) was
extracted with equal volume of ethyl acetate. The ethyl acetate
layer (3 ml) was spotted on Chromarod-S III.
tiˆed as shown in Table 1. Most of the 16S rDNA of
the 10 strains which had been assigned as P. putida
by the Biolog system had almost the same RFLP
digested by HaeIII, Hha I and AluI (Table 1), and
were assigned as P. putida, P. fulva, P. staminea, or
P. stuzeri by the program of Watanabe and Okuda.
Although this RFLP analysis was rapid, it proved im-
possible to distinguish among species with a geneti-
cally close relationship. In this case, P. putida, P.
fulva, P. staminea, and P. stuzeri had the same
RFLP digested by HaeIII, HhaI and AluI. The strain
S1, which was assigned as B. cepacia, and strain S11,
which was not identiˆed by Biolog, had the same
RFLP patterns as those of the Pseudomonas group.
Octylphenol was alkylated with ethyl bromoa-
cetate to aŠord ethyl octylphenoxyacetate in a 78.1
z
yield, and this phenoxyacetate was reduced with
LiAlH4 to give octylphenol monoethoxylate
(OP1EO) in an 87.2z yield. The obtained OP1EO
was treated with sodium hydride in dry THF, and the
resulting alkoxide was alkylate with ethyl bromoa-
cetate to give ethyl 6-[
butyl)phenyl]-3,6-dioxahexanoate in an 84.4
Reduction of the aŠorded ester by LiAlH4 gave octyl-
phenol diethoxylate (OP2EO) in a 78.3 yield.
p
- (1
?
,1
?
,3
?
,3
?
-tetramethyl-
z
yield.
z
GCMS and HPLC analyses of the biodegradation
products
Repetition of the same elongation reactions gave
OP3EO in a good yield.
The mass spectra of the authentic samples exhibit-
ed the typical fragmentation patterns shown in
Fig. 3. They aŠorded small but clear molecular ions,
typical M-71 ions resulting from loss of the 2,2-
dimethylpropyl radical (usually the base peak) and
Isolation and identiˆcation of the OPPEO-degrad-
ing bacteria
Each collected soil sample was shaken with the
basal salt medium for 7 day and the resulting suspen-
sion was extracted with ethyl acetate. The organic
layer was spotted on a Chromarod and analyzed by
an Iatroscan instrument. Typical chromatograms for
OPPEO and the biodegradation products are shown
in Fig. 2, the major biodegradation product being
identiˆed as OP2EO by comparing with the chro-
matogram of an authentic sample. Twelve bacterial
isolates were obtained by enrichment culture and the
subsequent isolation from the soil samples with OP-
PEO-degrading activity. These isolates were tenta-
tively identiˆed with the Biolog system as Pseudomo-
nas putida (10 isolates) and Burkholderia cepacia (1
isolate), while the remaining isolate couldn't be iden-
common m z 135 ions from loss of the polyoxyethy-
W
lene side chain by McLaŠerty rearrangement.
Growth tests were performed on isolated bacteria
S-5, S-10 and S-11 with OPPEO as the sole carbon
source as shown in Fig. 4. All isolates fed with OP-
PEO produced an insoluble white precipitate in the
culture medium after about 6 hr. With increasing in-
cubation time, the culture grew almost linearly until
21 hr, and then reached stationary phase.
The results of a time-course HPLC analysis on the
degradation process of Pseudomanas putida (S-10)
are shown in Fig. 5. The OP2EO and OP3EO peaks
were identiˆed by comparing with those of authentic
samples. The bacteria began to degrade OPPEO be-

1796
No.
E. NISHIO et al.
Table 1. Identiˆcation of Isolated Bacteria by Biolog and 16S rDNA RFLP
Base pair numbers of the restriction enzyme
decomposition fragments
Classiˆcation by
RFLP
*
Biolog ( )
Soil source
Alu
Hae III
Hha I
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
Yamaguchi 1
Yamaguchi 2
Yamaguchi 3
Fukuoka 1
Fukuoka 2
Osaka 1
Burkholderia cepacia (0.901) 387 212 184 160 687 160 100 380 300 242 208 Pseudomonas sp.
Pseudomonas putida (0.988) 406 212 („) 165 687 160 („) 381 304 248 211 Pseudomonas sp.
Pseudomonas putida (0.967) 407 213 („) 165 674 156 („) 377 304 248 214 Pseudomonas sp.
Pseudomonas putida (0.868) 408 220 200 169 700 167 100 351 273 226 192 Pseudomonas sp.
Pseudomonas putida (0962)
406 212 („) 165 688 160 100 378 302 248 211 Pseudomonas sp.
Pseudomonas putida (0.900) 393 208 184 152 700 165 106 376 296 242 205 Pseudomonas sp.
Pseudomonas putida (0.949) 400 208 184 152 700 165 106 371 292 238 205 Pseudomonas sp.
Pseudomonas putida (0.900) 387 212 184 152 688 165 100 372 296 242 208 Pseudomonas sp.
Pseudomonas putida (0.923) 407 220 195 160 685 159 („) 351 288 245 211 Pseudomonas sp.
Pseudomonas putida (0.951) 407 217 200 165 692 161 („) 346 277 229 200 Pseudomonas sp.
Osaka 2
Osaka 3
Osaka 4
S-10 Osaka 5
S-11 Osaka 6
N.I.
407 217 195 169 693 164 („) 346 273 223 192 Pseudomonas sp.
*
Degree of similarity N.I.: not identiˆed („): not observed
Fig. 4. Growth Curves of the Isolated Bacteria (S-5, S-10 and
S-11) in the Presence of OPPEO as the Sole Carbon Source.
Growth was assessed by optical density measurement of the
cultures every 3 hr. The culture medium suspension (2 ml) was
transferred to an Erlenmeyer ‰ask, and an equal volume of
methanol was added to the medium to dissolve the insoluble
metabolites. The optical density of the medium was measured at
660 nm.9)
Fig. 5. HPLC Chromatograms of the Time-Course Characteris-
tics for the Degradation Process of OPPEO by Pseudomonas
putida.
fore 6 hr, whereas the peaks of OP1EO and OP were
not apparent even after 12 hr. As the content of oc-
tylphenol oligoethoxylate increased with the time, it
is obvious that the high-molecular-weight component
was degraded to give the low-molecular-weight com-
ponent and that degradation stopped at OP2EO.
To determine the end product of OPPEO bio-
degradation, this surfactant was degraded by using
each bacterial isolate, and the end products were ana-
lyzed by GCMS after 10 days of incubation. All iso-
×
Column, Shodex Mspak GF-310 4E (4.6 250 mm);
column temperature, 40 C; solvent, 30 acetonitrile; ‰ow rate,
9
z
0.3 ml min; detection wavelength, 223 nm.
W
lates including Burkholderia cepacia, gave almost the
same GCMS data. The typical total ion chromato-
gram for S-5 (Pseudomanas putida) showed three
peaks (a-c) with retention times of 10.57 min (a) and

Octylphenol Polyethoxylate-degrading Bacteria in Paddy Fields
1797
of OP2EO. We have assumed that metabolite c must
have been a positional isomer of OP2EO, i.e. the
ortho isomer. This result indicates that the extract
did not contain any OP1EO and OP since there exist-
ed no peak with a shorter retention time than that of
OP2EO. It was revealed that all the isolated bacteria
degraded OPPEO from the end of the polyethoxy
chain and left mainly OP2EO in the culture medium
under aerobic conditions. Since OPPEO itself has
low toxicity and is not estrogenic,18) it has been widely
used as a wetting and dispersing additive in pesticide
formulations. It is, however, di‹cult to know the
actual conditions of use of OPPEO, since there is no
obligation to indicate OPPEO use. The results of this
present work indicate that the aerobic microorgan-
isms in paddy ˆelds could degrade OPPEO to en-
docrine-disrupting OP2EO and OP3EO. It therefore
seems necessary to investigate the formation of
OP2EO and OP3EO.
Acknowledgments
This work was supported in part by a Grant-in-aid
(Endocrine Disrupters) from the Ministry of Agricul-
ture, Forestry, and Fisheries of Japan (ED-02-V-1-1).
References
1) Soto, A. M., Sonnenschein, C., Chung, K. L.,
Fernandez, M. F., Olea, N., and Serrano, F. O., The
E-SCREEN assay as a tool to identify estrogens: an
update on estrogenic environmental pollutants. Envi-
ron. Health Perspect., 103 (Suppl 7), 113–122 (1995).
2) Klotz, D. M., Beckman, B. S., Hill, S. M.,
McLachlan, J. A., Walters, M. R., and Arnold, S.
F., Identiˆcation of environmental chemicals with
estrogenic activity using a combination of in vitro
assays. Environ. Health Perspect., 104, 1084–1089
(1996).
3) Korner, W., Hanf, V., Schuller, W., Bartsch, H.,
Zwirner, M., and Hagenmaier, H., Validation and
application of a rapid in vitro assay for assessing the
estrogenic potency of halogenated phenolic chemi-
cals. Chemosphere, 37, 2395–2407 (1998).
4) Jobling, S., Reynolds, T., White, R., Parker, M. G.,
and Sumpter, J. P., A variety of environmentally per-
sistent chemicals, including some phthalate plasticiz-
ers, are weakly estrogenic. Environ. Health Perspect.,
103, 582–587 (1995).
5) Tabira, Y., Nakai, M., Asai, D., Yakabe, Y.,
Tahara, Y., Shinmyozu, T., Noguchi, M., Takatsuki,
M., and Shimohigashi, Y., Structural requirements of
para-alkylphenols to bind to estrogen receptor. Eur.
J. Biochem., 262, 240–245 (1999).
Fig. 6. Total Ion Chromatogram and the Mass Spectra of the
OPPEO Biodegradation Products by Pseudomonas putida.
The culture medium (1 ml) was transferred to an Eppendorf
tube and extracted with HPLC-grade ethyl acetate (1 ml) by vor-
tex mixing for 5 min. The ethyl acetate layer (500
ferred to a new tube and centrifuged at 8000 rpm for 5 min. The
supernatant (400 l) was diluted with 1600 l of ethyl acetate,
ml) was trans-
m
m
and the resulting solution was analyzed by a Perkin Elmer Q-910
GCMS instrument ˆtted with a capillary column (SPDTM1, 30 m
by 0.32 mm) and an automated injector. The GC conditions
were as follows: injection volume, 3
psi; temperature gradient, 100 C isothermal for 3 min, 100–
300 C gradient at 20 C min, 300 C isothermal for 10 min; total
running time, 25 min. The voltage of the electron multiplier and
the ionizer temperature were 1100 V and 300 C, respectively.
ml; carrier gas, helium at 8.0
9
9
9
9
W
9
11.86 min (b). The spectra for (a) and (b) gave the
M+ ions at 294 and 338, corresponding to OP2EO
and OP3EO, respectively (Fig. 6). Typical peaks
(M-71) resulting from the loss of the 2,2-dimethyl-
propyl group were the base peaks of OP2EO and
OP3EO, respectively. Conˆrmation of their identity
was provided by comparing the retention times and
fragmentation patterns of OP2EO and OP3EO with
those of authentic samples. The total ion chromato-
gram showed another peak (c) whose retention time
was 10.87 min. In the spectrum for (c), the M+ ion is
at 294, and its fragmentation pattern is similar to that
6) Nagel, S. C., von Saal, F. S., Thayer, K. A., Dhar,
M. G., Boechler, M., and Welshons, W. V., Relative
binding a‹nity-serum modiˆed access (RBA-SMA)
assay predicts the relative in vivo bioactivity of the
xenoestrogens bisphenol A and octylphenol. Environ.
Health Perspect., 105, 70–76 (1997).

1798
E. NISHIO et al.
7) Laws, S. C., Carey, S. A., Ferrell, J. M., Bodman,
tert-octylphenol in water and ˆsh from rivers ‰owing
into Lake Biwa. Chemosphere, 41, 757–762 (2000).
13) Bolz, U., Korner, W., and Hagenmaier, H., Develop-
G. J., and Cooper, R. L., Estrogenic activity of octyl-
phenol, nonylphenol, bisphenol A and methoxychlor
in rats. Toxicol. Sci., 54, 154–167 (2000).
ment and validation of a GC MS method for deter-
W
8) Dominic, M. J., and White, G. F., Mechanism for
biotransformation of nonylphenol polyethoxylates to
xenoestrogens in Pseudomonas putida. J. Bacteriolo-
gy, 1998, 4332–4338 (1998).
9) Scott, M. J., and Jones, M. N., The biodegradation
of surfactants in the environment. Biochim. Biophys.
Acta, 1508, 235–251 (2000).
10) Ferguson, P. L., Iden, C. R., and Brownawell, B. J.,
Analysis of alkylphenol ethoxylate metabolites in the
aquatic environment using liquid chromatography-
electrospray mass spectrometry. Anal. Chem., 72,
4322–4330 (2000).
mination of phenolic xenoestrogens in aquatic sam-
ples. Chemosphere, 40, 929–935 (2000).
14) Saito, H., and Miura, T., Preparation of transform-
ing DNA by phenol treatment. Biochim. Biophys.
Acta, 72, 619–629 (1963).
15) Brosius, J., Palmer, M. L., Kennedy, P. J., and
Noller, H. F., Complete nucleotide sequence of a 16S
ribosomal RNA gene from Escherichia coli. Proc.
Natl. Acad. Sci. USA, 75, 4801–4805 (1978).
16) Watanabe, K., and Okuda, M., Japan Kokai Tokkyo
Koho, Registration No. 2000–215134 (July 14, 2000).
17) Watanabe, K., and Okuda, M., U.S. Patent, Method
and System for Searching for Relationships between
Base Sequences in Genes. Registration No. 24618
(July 10, 2001).
11) Petrovic, M., and Barcelo, D., Determination of
anionic and nonionic surfactants, their degradation
products, and endocrine-disrupting compounds in
sewage sludge by liquid chromatography mass spec-
18) White, R., Jobling, S., Hoare, S. A., Sumpter, J. P.,
and Parker, M. G., Environmentally persistent alkyl-
W
trometry. Anal. Chem., 72, 4560-4567 (2000).
12) Tsuda, T., Takino, A., Kojima, M., Harada, H.,
Muraki, K., and Tsuji, M., 4-Nonylphenols and 4-
phenolic compounds are estrogenic. Endocrinology
135, 175–182 (1994).
,