Oligo-β-(1 → 3)-glucans: Impact of thio-bridges on immunostimulating activities and the development of cancer stem cells

Article abstract of DOI:10.1021/jm500506b

Recent developments of innovative anticancer therapies are based on compounds likely to stimulate the immune defense of the patients. β-(1 → 3)-Glucans are natural polysaccharides well-known for their immunostimulating properties. We report here on the synthesis of small oligo-β-(1 → 3)-glucans characterized by thioglycosidic linkages. The presence of sulfur atom(s) was not only crucial to prolong in vivo immunoactive activities in time, compared to native polysaccharides, but sulfur atoms also had a direct impact on the development of colorectal cancer stem cells. As a result, a short, pure, and structurally well-defined trisaccharidic thioglucan demonstrated similar activities compared to those of natural laminarin.

Full text of DOI:10.1021/jm500506b

Article
pubs.acs.org/jmc
Oligo-β-(1 → 3)-glucans: Impact of Thio-Bridges on
Immunostimulating Activities and the Development of Cancer Stem
Cells
Balla Sylla,†,‡ Laurent Legentil,†,‡ Sujata Saraswat-Ohri,§ Aruna Vashishta,§ Richard Daniellou,∥
Hsei-Wei Wang,⊥ Vaclav Vetvicka,*,# and Vincent Ferrieres*,†,‡
̀
†Ecole Nationale Super
́
ieure de Chimie de Rennes, CNRS, UMR 6226, 11 Allee
́
de Beaulieu, CS 50837, 35708 Rennes Cedex 7,
France
‡Universite
́
europeenne de Bretagne, 5 Boulevard Laennec, 35000 Rennes, France
§Department of Neurological Surgery, University of Louisville, 220 Abraham Flexner Way, 15th Floor, Louisville, Kentucky 40202,
United States
́
̈
∥Institut de Chimie Organique et Analytique, Universite
Cedex 2, France
́ ́ ́
d’Orleans, CNRS, UMR 7311, BP 6759, Rue de Chartres, 45067 Orleans
⊥Lab of Systems Biomedicine, Institute of Microbiology and Immunology, Genome Research Center, Department of Research and
Development, National Yang Ming University,, Taipei City Hospital, No. 155, Sec 2, Li-Nong Street, Taipei 112, Taiwan
#Department of Pathology, University of Louisville, 627 South Preston Street, Louisville, Kentucky 40292, United States
S
* Supporting Information
ABSTRACT: Recent developments of innovative anticancer
therapies are based on compounds likely to stimulate the
immune defense of the patients. β-(1 → 3)-Glucans are natural
polysaccharides well-known for their immunostimulating
properties. We report here on the synthesis of small oligo-β-
(1 → 3)-glucans characterized by thioglycosidic linkages. The
presence of sulfur atom(s) was not only crucial to prolong in
vivo immunoactive activities in time, compared to native
polysaccharides, but sulfur atoms also had a direct impact on the development of colorectal cancer stem cells. As a result, a short,
pure, and structurally well-defined trisaccharidic thioglucan demonstrated similar activities compared to those of natural
laminarin.
approaches, it was shown that β-(1 → 3)-glucans can also act in
synergy with tumor-specific antibodies.8,9 Moreover, they can
find favorable effects in radio- or cardioprotection as well as in
protection against infections caused by bacteria and protozoa,
and many other biological properties have also been
reported.10−12
It is recognized that both physicochemical and biological
properties tightly depend on organisms which produce the
targeted polysaccharide and on general conditions of
production (salinity, temperature, harvest season). From a
structural point of view, properties of β-(1 → 3)-glucans vary
with the the following: molecular weight, the degree and
regioselectivity of branching that are species specific, the
solubility in water, the tridimensional conformation and related
changes between triple helix, single helix or random coils, the
dispersity, the batch homogeneity, and of course, the purity.
Although these polysaccharides are considered as nondigestible
carbohydrates, they can be fragmented in vivo into smaller
INTRODUCTION
■
The immunostimulating ability of β-(1 → 3)-glucans, which
were first used as folk medicine in Chinese populations and
further identified in fungi, yeasts, and seaweeds, is now well
established.1 It was subsequently shown that they interact with
specific receptors such as the complement receptor 3 (CR3),
dectin-1, lactosylceramides, and scavengers belonging to the
family of acetylated or oxidized low density lipoproteins.2−5
The corresponding biological cascades are therefore activated
and induce the production of effectors, for example, nuclear
factor-κB (NF-κB), tumor necrosis factor-α (TNF-α), inter-
leukins, interferons α and γ, thus resulting in the stimulation of
macrophages, monocytes, dendritic cells, and neutrophils in
mammals. These immunostimulating properties of β-(1 → 3)-
glucans have led to a great array of applications for the
development of immunotherapies in order to enhance the
natural ability of the immune system to fight against diseases or
to relieve the patients of the side effects associated with severe
treatments. For instance, lentinan is used against colorectal and
gastro-intestinal cancers,6 whereas schizophyllan is preferred for
the treatment of stomach and uterus cancers.7 In more recent
Received: March 31, 2014
Published: September 30, 2014
© 2014 American Chemical Society
8280
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
polymers by fermentation by the intestinal microbial flora and/
or within macrophages after internalization.2 These studies led
to an ambivalent conclusion. Large β-(1 → 3)-glucans can
directly elicit the immune response, and partial degradation
may interestingly extend the desired activity. However, random
hydrolysis occurs, especially by endoglucanases, thus resulting
in an uncontrolled variety of compounds with uncertain
activities and in a damaging loss of the desired immunostimu-
lating ability. In this context, we have initiated a program
dealing with the use of synthetic and structurally well-defined
oligo-β-(1 → 3)-glucans, mannose- and mannitol-conjugates,
and we have shown that linear penta- and hexasaccharides have
biological properties in vivo at least equivalent to those of
various natural poly-β-(1 → 3)-glucans.13−16 In this study, we
anticipate that the substitution of O-glycosidic linkages by thio-
bridges will positively increase lifetime of glucans and therefore
biological impact in vivo. Indeed, it is known that thioglycosides
are more stable than their O-counterparts against acidic or
enzymatic conditions and that this chemical modulation has
only minor impact on the tridimensional arrangement.17,18
Moreover, on the assumption that thioglucans are potentially
more stable, we also hypothesize that the biological efficiency of
the target thioglucans will be preserved even if the saccharidic
chain length is shortened compared to that of oligoglucans
previously studied and that systematic substitution is not
required. Therefore, we have designed two families of tri- and
tetrasaccharides (Figure 1): the first one presents only one
thioacetal must be first prepared to further react with an
electrophilic species presenting a leaving group at the 3-center.
This synthetic pathway was thus applied for the synthesis of 1−
4 starting from peracetylated glucans (Scheme 1). Tri- and
tetraglucans 1 and 2, containing one thioglycosidic linkage,
were thus obtained from peracetylated laminaribiose and
laminaritriose 5 and 12, respectively. After bromination of the
reducing anomeric center, the bromide in 6 and 13 was
substituted by thioacetate anion according to a SN2 mechanism.
Specific deacylation of 7 and 14 was further performed with
cysteamine in acetonitrile. The resulting hemithioacetal 8 and
15 were subsequently activated by deprotonation with sodium
hydride in the presence of 1,7,10-trioxa-4,13-diazacyclopenta-
decane, a crown ether called Kryptofix 21. Nucleophilic
substitution of the trifluoromethanesulfonyl group in allofur-
anosyl derivative 919 afforded the desired intermediates
building blocks 10 and 16, respectively. Even if stability of
glycosyl thiols is not guaranteed, only the desired β-anomers
were obtained, as certified by NMR data (JH1b‑H2b = 10.0 Hz for
both glucans) The subsequent removal of all protecting groups
was based on a three-step procedure: an acidic hydrolysis of
both isopropylidene protections, which also resulted in a ring
extension of the reducing residue, a peracetylation required for
efficient chromatographic purification (compounds 11 and 17),
and finally a Zemplen transesterification. A similar synthetic
scheme was applied for glucans 3 and 4; however, this scheme
was characterized by the presence of two thioglycosidic
linkages, respectively, starting from the known derivative 1819
and building block 11 previously obtained. Overall yields reach
24% for 3 and 4 starting from 18 and 23, respectively.
Biological Evaluations. With the synthetic thioglucans in
hand, we first focused on evaluation of their impact on
phagocytic ability. The effects of glucans on phagocytosis are
well established.20 As β-(1 → 3)-glucans stimulate primarily
cellular immunity, phagocytosis is the reaction of choice for
assessment of the immunostimulation activity of glucan or
glucan-based molecules. Testing both the stimulation of
peritoneal macrophages and peritoneal blood neutrophils and
monocytes, we used synthetic microspheres based on 2-
hydroxymethyl methacrylate. Our results showed strong effects
of 2, 3, and 4 in all experimental designs and also in a lower
extent for compound 1 (Figure 2A). As it is known that the
effects of one application are usually short-lived and that a
significant decrease of activities can be observed already after 48
h after application, we tested the possibility that substitution of
O-glycosidic linkage by thio-bridges led to an increased lifetime
of our samples. When we measured the phagocytic activity 3
days after a single application, we found almost identical effects
when compared to 24 h (Figure 2B), suggesting that our
thioglucans survived for a longer duration and therefore can
stimulate the immune system for a longer period of time. At the
same time, all compounds 1−4 caused an influx of peritoneal
macrophages (data not shown).
Figure 1. Chemical structure of potent immunostimulating oligo-β-(1
→ 3)-thioglucans.
sulfur atom connecting the two residues close to the reducing
end (mimics of laminaritriose 1 and laminaritetraose 2), and
the second one contains two successive sulfur bridges (mimics
of laminaritriose 3 and laminaritetraose 4).
RESULTS AND DISCUSSION
It is also established that glucans and oligosaccharides cause
stimulation of formation and/or secretion of various
cytokines.15 To determine if our samples influenced the
cytokine production, we measured the immunostimulating
activity through the production of IL-2 by splenocytes and
through the levels of IL-1β and TNF-α in peripheral blood. Our
data, summarized in Figure 3, showed that oligosaccharides 1,
2, and 4 stimulated the production of tested cytokines, with
tetrasaccharide 4 being consistently the most active one.
■
Chemistry. Two main strategies were envisaged for the
introduction of a sulfur atom between two glucosyl entities.
The first one relies on a standard glycosylation reaction based
on a glucopyranosyl donor and an acceptor bearing a thiol
function on position 3. Unfortunately, the desired iterative
approach,16 using either ethyl thioglucoside or a trichloroace-
timidate, was not efficient. The second strategy was first
described by Defaye and co-workers:19 a nucleophilic hemi-
8281
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
a
Scheme 1. Synthesis of the Mono- and Dithioglucans
a
Experimental conditions: (a) HBr, 33%, 0 °C; (b) KSAc, DMF; (c) H2NCH2CH2SH, CH3CN; (d) NaH, THF, Kryptofix 21; (e) i- TFA, H2O, ii-
Ac2O, pyridine; (f) MeONa, MeOH.
Previous studies using 4-deoxy-(1 → 3)-β-glucan-based
oligosaccharides showed significant effects on gene expres-
sion.14 Therefore, we further evaluated these effects using
human breast cancer cell line ZR-75−1 and human fibroblast
cell line Detroit-573. Our RT-PCR data showed differential
effects of individual oligosaccharides on individual genes
(Figures 4 and 5). In the case of NF-κB, samples 1 and 2
lowered expression in fibroblast, but 1 elevated the expression
in cancer cell line. Nevertheless, tetrasaccharide 4 strongly
increased the expression of NF-κB in fibroblasts. Conversely,
CDC42 belongs to the RHO family of proteins and is
implicated in the cell growth regulation.21 In addition, its levels
are elevated in numerous cancers.22 Our data showed that in
fibroblast, its level was elevated by 3 and 4. However, in the
cancer cell line, the level of CDC42 was significantly decreased
by 2.
PKC is a family of serine/threonine kinases involved in
numerous biological processes such as differentiation, cell
proliferation, and apoptosis. The role of PKC in cancer is
controversial, with findings of both elevated and suppressed
expression.23 In fibroblasts, PKC expression was elevated by all
oligosaccharides (in the case of 3, nonsignificantly), and in
breast cancer cells, we also found significant elevation by all
samples. We also focused our attention on CDC25, which
activates cyclin-dependent kinases by removing phosphate from
residues in the CDK active site. The CDC25s are proto-
oncogenes in humans and have been shown to be overex-
pressed in a number of cancers.24 In the fibroblast cell line,
samples 1, 2, and 3 strongly inhibited expression of CDC25,
whereas in the breast cancer cells, these effects were negligible.
As the lipopolysaccharide (LPS) contamination might
influence the effects of any biologically active molecule, we
measured the possible LPS contamination employing an E-
Toxate assay. All the samples showed LPS levels below 0.01
EU/mL. In addition, we added a 10 μg/mL solution of
polymyxin B to our samples and performed the phagocytic
assay again. As the results were identical to the results obtained
with untreated samples (data not shown), we did not use
polymyxin B in any additional assays.
Finally, colorectal cancer (CRC) is one of the most common
cancers worldwide. In Taiwan, for example, colon cancer is not
only the most prevalent cancer but also the third most fatal one.
Tumor recurrence after surgery and distant CRC liver
metastasis represents crucial transitions in disease development
and progression25 and has profound impacts on patient survival
for not only CRC but also a wide variety of cancers. Evidence
suggests that a small population of cancer cells within tumor
tissues possesses characteristics reminiscent of those of normal
stem cells. These cells, which are called cancer-initiating cells or
cancer stem cells (CSCs), are more malignant and resistant to
current chemo-radiotherapy methods. CSCs therefore are
recognized as the cell source of cancer initiation, recurrence,
and distant metastasis.26 It is urgent to develop new therapeutic
approaches for targeting colon CSCs, or colonosphere cells
since they intend to form spheres in serum-free culture
medium.27 Therefore, β-(1 → 3)-glucans were assessed for
their potency in inhibiting colon CSC-mediated tumor
formation and/or metastasis, using a serum-free culture system
that enables us to isolate colonospheres from primary CRC
tissues and cell lines.22 Two cell-lines from human colon
adenocarcinoma were probed: HCT15 and HT29 spheres. In
8282
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
Figure 2. Stimulation of peritoneal macrophages and peritoneal blood
neutrophils and monocytes (A) 24 h, (B) 3 days, after injection of
thioglucans 1−4. Cells with three or more particles were considered
positive. As a control, mice were injected with PBS. The results
Figure 3. Production of cytokines IL-1β, TNF-α, and IL-2 by
thioglucans 1−4. As a control, mice were injected with PBS. The
results represent the mean of three independent experiments SD. All
differences were significant at P < 0.05 level.
represent the mean of three independent experiments
SD. All
differences were significant at P < 0.05 level.
both cases, laminaritriose and laminaripentaose exhibited low to
moderate but promising activities (Figure 6). Laminarin, the
natural polymer isolated from Laminaria digitata, was the most
effective natural compound, showing interesting properties with
concentration as low as 10 μg/mL and a maximum dose/
response at 100 μg/mL. The observed activities were further
compared to those obtained from the non hydrolyzable
thioglucan 3, characterized by two thioglycosidic linkages. It
is even noteworthy that this trisaccharide demonstrated the
most striking results, being the most potent oligosaccharide and
even better than the natural laminarin, despite its short size and
molecular weight. Once again, the presence of sulfur atoms was
crucial for biological activity. Such promising results pave the
way for the development of immunomodulating oligosacchar-
ides in the fight of cancer. Future experiments will provide
indications onto the molecular pathways linked either to CSCs
renewal and drug resistance that could determine specific
tumor behaviors and new targets for further therapeutic studies.
Receptors for effective polysaccharides will also be explored.
CONCLUSION
■
In this study, we designed and synthesized small oligo-β-(1 →
3)-glucans characterized by the presence of one or two S-
glycosidic bounds, and we evaluated their biological properties.
These pure and structurally well-defined tri- and tetrasacchar-
ides exhibit very interesting immunostimulating abilities, right
from the triglucoside. We thus demonstrated for the first time
that very small glucans are as active as polyglucans in vivo and
that immunostimulating abilities are prolonged in time. These
results have to be connected with the presence of at least one
thioglycosidic linkage. Although it was quite difficult to propose
structure−activity relationships, all compounds 1−4 are
activators or inactivators on gene expression depending on
the structure. Very interestingly, thioglucan 3, which is hardly
hydrolyzable owing to the presence of two thioglycosidic
bounds, significantly suppresses spheroid formation and
proliferation of colon cancer stem-like cells from human
colon adenocarcinoma.
8283
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
1
CRMPO on a flash EA1112 CHN/O microanalyzer and/or H NMR
data (see Supporting Information). To determine the purity of the
final compounds 1−4, high-performance liquid chromatography
(HPLC) experiments were conducted using the Agilent 1200 HPLC
system (Shimadzu), equipped with LabSolution software, a micro-
vacuum degasser, a quartenary pump, an autosampler , a thermostatic
column compartment, a diode array detector, and an analytical Alltech
Prevail carbohydrate ES column (Analytical, 4.6 × 250 mm, 5 μm,
Grace Davison Product Lines) at 40 °C. All compounds tested in
biological assays were ≥95% pure (Supporting Information).
General Procedure for Bromination (A). To a solution of
peracetylated derivative in dichloromethane (1 mL) was added
dropwise 33% HBr in AcOH, and the resulting mixture was stirred
at 0 °C for 3 h. Then, dichloromethane (10 mL) was added, and the
resulting organic layer was washed with cold water (2 × 5 mL) and
brine (5 mL), dried (MgSO4), and concentrated under reduced
pressure. The residue was purified by column chromatography.
General Procedure for Thioacylation (B). Potassium thioacetate (2
equiv) was added to a solution of glycosyl bromide (1 equiv) in
dimethylformamide, and the suspension was stirred overnight at room
temperature. Solvent was removed under reduced pressure, and H2O
and dichloromethane were added to the reaction mixture. Sodium
persulfite was added, and the biphasic solution was brought to reflux.
After 12 h, the reaction was allowed to cool, and H2O and
dichloromethane were added. The resulting organic layer was dried
(MgSO4), filtered, and evaporated to dryness. The product was
purified by chromatography.
Figure 4. Evaluation of effects of thio-derivatives 1−4 on gene
expression using human breast cancer cell line ZR-75−1. As a control,
mice were injected with PBS. The results represent the mean of three
independent experiments SD. All differences were significant at P <
0.05 level.
General Procedure for Selective Deacylation (C). 2-Amino-
ethanethiol (1.1 equiv) was added to a solution of peracylated
thioacetate (1 equiv) in acetonitrile. The mixture was stirred at 65 °C
for 10 min and concentrated when TLC monitoring indicated
completion of the reaction. The residue was further dissolved into
dichloromethane and washed with H2O, then concentrated, and the
crude product was finally purified by column chromatography.
General Procedure for Coupling (D). Sodium hydride 60% (1.5
equiv) was added to a solution of the corresponding hemithioacetal (1
equiv) in dry THF at 0 °C. The suspension was stirred under N2 until
hydrogen formation has ceased. To this solution, 1,7,10-trioxa-4,13-
diazacyclopentadecane (Kryptofix 21, 0.18 equiv) and a solution of the
electrophile (1.1 equiv) in THF were added, and the mixture was
stirred at RT under N2. When TLC indicated the disappearance of the
nucleophilic compound, the mixture was concentrated under reduce
pressure, and the residue was diluted with dichloromethane, washed
with water, dried (MgSO4), and concentrated. The crude product was
purified by column chromatography.
General Procedure for Hydrolysis/Acetylation (E). A solution of
the required precursor in a mixture of CF3COOH/H2O (4:1, 26 mL)
was stirred at RT, for 1 h. Concentration under reduced pressure of
the mixture gave a brown residue, which was submitted to standard
acetylation (1:1 Ac2O/pyridine). Column chromatography yielded the
expected compound.
General Procedure for Final Deacylation (F). To a solution of the
peracetylated precursor dissolved in anhydrous methanol (2 mL) was
added a 0.1 M solution of sodium methylate in methanol (0.1 equiv).
The mixture was stirred at RT until no starting product was detected
by TLC. Neutralization was subsequently carefully performed by
adding IR-120 (H+ form). The resin was further filtered off, and the
solvent was removed under reduced pressure. The desired product was
purified by size exclusion chromatography over Sephadex G-25 gel
eluting with water.
Figure 5. Evaluation of effects of thio-derivatives 1−4 on gene
expression and human fibroblast cell line Detroit-573. As a control,
mice were injected with PBS. The results represent the mean of three
independent experiments SD. All differences were significant at P <
0.05 level.
EXPERIMENTAL SECTION
■
General Methods. All reactions were performed under nitrogen
atmosphere unless otherwise stated. Reactions were monitored by
TLC on E. Merck 60 F254 Silica Gel non-activated plates and
compounds were revealed by UV absorption and/or charring with a
5% solution of H2SO4 in EtOH followed by heating. Preparative
chromatography was conducted on Geduran Si 60 (40−63 μm) Silica
Gel. Optical rotations were measured on a PerkinElmer 341
polarimeter. 1H, 13C, HSQC COSY, TOCSY NMR spectra were
recorded at the ENSCR on a Bruker Avance III. Chemical shifts are
given in δ units (ppm) measured downfield from the solvent signal.
Sequence for the Synthesis of 1. 2,3,4,6-Tetra-O-acetyl-β-D-
glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl bro-
mide (6). General procedure A starting from 516 (10.2 g, 15.03 mmol),
HBr in AcOH (30 mL, 180.36 mmol) afforded 6 (9.05 g) in 86% yield.
1
TLC (3:7 AcOEt/petroleum ether); Rf 0.3; H NMR (CDCl3, 400
MHz): δ 6.50 (d, 1H, J1a,2a 4 Hz, H-1a), 5.15 (t, 1H, J2b,3b, J3b,4b 9.6 Hz,
H-3b), 5.10 (t, 1H, J3a,4a, J4a,5a 9.6 Hz, H-4a), 5.07 (dd, 1H, J4b,5b 9.6
Hz, H-4b), 4.89 (dd, 1H, J1b,2b 8.0 Hz, H-2b), 4.80 (dd, 1H, J2a,3a 9.6
Hz, H-2a), 4.67 (d, 1H, H-1b), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.4
Hz, H-6b), 4.23−4.15 (m, 1H, H-5a), 4.13 (dd, 1H, H-3a), 4.10−4.05
́
The HRMS were performed at the CRMPO (Centre Regional de
Mesures physiques de l’Ouest, University of Rennes 1, France) with a
MS/MS ZabSpec TOF Micromass by ESI in positive mode. Purity of
the compounds was estimated by elemental analyses recorded at the
8284
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
Figure 6. Trisaccharide 3 and laminarin suppress spheroid formation and proliferation of colon cancer stem-like cells. Left: photographic images of
̂
spheroid morphology. Scale bar = 50 μm. *: p < 0.05; **: p < 0.01. Right: a histogram showing spheres formed per 104 seeded cells.
(m, 2H, H-6a, H-6′a), 4.08 (dd, 1H, J5b,6′b 4.4 Hz, H-6′b), 3.74 (ddd,
1H, H-5b), 2.15−1.97 (7s, 21H, CH3CO2); 13C NMR (CDCl3, 100
MHz): δ 170.7−168.7 (CO), 100.7 (C-1b), 87.3 (C-1a), 76.5 (C-3a),
72.4 (C-5a, C-3b), 72.3 (C-2a), 71.7 (C-5b), 71.3 (C-2b), 67.8 (C-
4b), 66.6 (C-4a), 61.6 (C-6b), 61.0 (C-6a), 20.8−20.3 (CH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-
O-acetyl-1-thio-β-D-glucopyranose (7). Compound 7 was obtained
according to general procedure B starting from 6 (1.49 g, 2.13 mmol),
potassium thioacetate (0.49 g, 4.26 mmol). A chromatographic
purification (AcOEt/petroleum ether, 2:3) afforded 7 (1.27 g) in
85% yield. TLC (2:3 AcOEt/petroleum ether); Rf 0.3; 1H NMR
(CDCl3, 400 MHz): δ 5.14 (d, 1H, J1a,2a 10.8 Hz, H-1a), 5.12 (dd, 1H,
J2b,3b 9.2 Hz, J3b,4b 9.6 Hz, H-3b), 5.11 (dd, 1H, J2a,3a 9.2 Hz, H-2a),
5.05 (dd, 1H, J4b,5b 9.2 Hz, H-4b), 4.98 (dd, 1H, J3a,4a 9.2 Hz, J4a,5a 10.0
Hz, H-4a), 4.88 (dd, 1H, J1b,2b 8.0 Hz, H-2b), 4.60 (d, 1H, H-1b), 4.37
(dd, 1H, J6a,6′a 12.4 Hz, J5a,6a 4.4 Hz, H-6a), 4.18 (dd, 1H, J5b,6b 4.8 Hz,
H-6b), 4.10−4.05 (m, 1H, H6′b), 4.02 (dd, 1H, H-6′a), 3.93 (t, 1H,
H-3a), 3.79−3.75 (m, 1H, H-5a), 3.69−3.66 (m, 1H, H-5b), 2.36 (s,
3H, CH3COS), 2.13−1.98 (7s, 21H, CH3CO2); 13C NMR (CDCl3,
100 MHz): δ 192.6 (SCO), 170.7−168.7 (CO), 100.9 (C-1b), 80.0
(C-1a), 76.5 (C-3a, C-5a), 72.0 (C-3b), 71.8 (C-5b), 70.5 (C-2a, C-
3a), 67.9 (C-4b), 67.6 (C-4a), 61.9 (C-6b), 61.6 (C-6a), 30.9
(CH3COS), 20.9−20.3 (CH3CO2).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-1-thio-β-D-glucopyranose (8). The target disaccharide 8 was
synthesized as described in the general procedure C starting from 728
(694 mg, 1.5 mmol) and 2-aminoethanethiol (127.6 mg, 1.65 mmol)
in MeCN (10 mL). Chromatography (3:2 light petroleum ether/
8285
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
AcOEt) yielded 8 as white solid (75 mg, 77%). TLC (3:2 light
petroleum ether/AcOEt); Rf 0.3; [α]2D0 −18 (c 1.0; CHCl3); mp: 98−
5.18 (dd, 1H, J2a,3a 10.8 Hz, H-2a), 5.12−5.06 (m, 2H, H-3c, H-4c),
4.98 (dd, 1H, J4a,5a 9.4 Hz, H-4a), 4.93−4.85 (m, 3H, H-2b, H-2c, H-
4b), 4.63 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.55 (d, 1H, J1c,2c 8.0 Hz, H-
1c), 4.39 (dd, 1H, J5b,6b 3.6 Hz, H-6b), 4.24 (dd, 1H, J5a,6a 4.8 Hz, H-
6a), 4.17−4.16 (m, 1H, H-6c), 4.09−4.08 (m, 1H, H-6′a), 4.06−4.02
(m, 2H, H-6′c, H-6′b), 3.86 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.83−3.78 (m,
1H, H-5a), 3.71−3.65 (m, 2H, H-5b, H-5c), 2.97 (t, 1H, J3a,4a 10.8 Hz,
H-3a), 2.15 (s, 3H, OCOCH3), 2.14 (s, 3H, OCOCH3), 2.13 (s, 3H,
OCOCH3), 2.12 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s,
3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.03
(s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3);
13C NMR (CDCl3, 100 MHz) 11α: δ 170.5, 170.4, 170.3, 169.8, 169.7,
169.6, 169.5, 169.4, 169.2, 169.1, 168.7, (CO), 100.2 (C-1c), 88.7 (C-
1aα), 81.7 (C-1b), 79.9 (C-3b), 75.6 (C-5b), 72.9 (C-3c), 71.7 (C-4b,
C-5c), 71.6 (C-5a), 70.8 (C-2c), 69.9 (C-2a), 67.9 (C-4c, C-2b), 65.2
(C-4a), 62.0 (C-6c), 61.9 (C-6b), 61.6 (C-6a), 46.2 (C-3a), 20.8, 20.7,
20.6, 20.5, 20.4, 20.3, 20.2 (OCOCH3), 11β: δ 170.5, 170.4, 170.3,
169.8, 169.7, 169.6, 169.5, 169.4, 169.2, 169.1, 168.7 (CO), 100.2 (C-
1c), 93.3 (C-1aβ), 82.6 (C-1b), 79.9 (C-3b), 75.7 (C-5b), 75.2 (C-5a),
72.9 (C-3c), 71.7 (C-5c), 71.1 (C-2a), 70.9 (C-2b, C-2c), 65.7 (C-4a),
65.2 (C-4b, C-4c), 62.3 (C-6c), 62.1 (C-6b), 62.0 (C-6a), 49.9 (C-3a),
20.8, 20.7, 20.6, 20.5, 20.4, 20.3, 20.2 (OCOCH3).
β-D-Glucopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-3-
deoxy-3-thio-β-D-glucopyranose (1). Compound 1 was prepared
according to general procedure F starting from 11 (100 mg, 0.1 mmol)
dissolved in anhydrous methanol (2 mL), a 0.1 M solution of sodium
methylate in methanol (0.1 equiv). Size exclusion chromatography
yielded the required trisaccharide 1 as colorless oil (40.6 mg, 78%).
TLC (3:3:2, AcOEt/i-PrOH/H2O) Rf 0.2; [α]D20 −21.2 (c 1.0,
CHCl3); 1H NMR (CD3OD, 400 MHz) α/β ratio 0.6:1 (from
NMR integration of H-1 signal), 1α: δ 5.11 (d, 1H, J1aα,2aα 3.6 Hz, H-
1aα), 4.62 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.57 (d, 1H, J1c,2c 7.6 Hz, H-
1c), 3.89 (dd, 1H, J6c,6′c 11.6 Hz, J5c,6c 2.0 Hz, H-6c), 3.87 (dd, 1H,
J6b,6′b 12.0 Hz, J5b,6b 2.0 Hz, H-6b), 3.85−3.81 (m, 1H, H-5a), 3.74 (dd,
1H, J6a,6′a 11.2 Hz, J5a,6a 4.4 Hz, H-6a), 3.67 (dd, 1H, H-6′b), 3.65 (dd,
1H, H-6′c), 3.59 (t, 1H, J3b,4b 8.8 Hz, H-3b), 3.51 (dd, 1H, H-6′a),
3.49−3.44 (m, 2H, H-2b, H-4b), 3.39 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.37
(t, 2H, J2a,3a, J4a,5a 9.6 Hz, H-2a, H-4a), 3.39−3.35 (m, 1H, H-5b),
3.33−3.26 (m, 3H, H-2c, H-4c, H-5c), 3.12 (dd, 1H, J3a,4a 10.4 Hz, H-
3a); 1β: δ 4.63 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.57 (d, 1H, J1c,2c 7.6 Hz,
H-1c), 4.49 (d, 1H, J1aβ,2aβ 7.6 Hz, H-1aβ), 3.89 (dd, 1H, J6c,6′c 11.6 Hz,
J5c,6c 2.0 Hz, H-6c), 3.87 (dd, 1H, J6b,6′b 12.0 Hz, J5b,6b 2.0 Hz, H-6b),
3.86 (dd, 1H, J6a,6′a 11.2 Hz, J5a,6a 2.0 Hz, H-6a), 3.69 (dd, 1H, H-6′a),
3.67 (dd, 1H, H-6′b), 3.65 (dd, 1H, H-6′c), 3.59 (t, 1H, J3b,4b 8.8 Hz,
H-3b), 3.49−3.44 (m, 2H, H-2b, H-4b), 3.39 (t, 1H, J3c,4c 9.2 Hz, H-
3c), 3.39−3.31 (m, 2H, H-4a, H-5a), 3.39−3.35 (m, 1H, H-5b), 3.33−
3.26 (m, 3H, H-2c, H-4c, H-5c), 3.23 (dd, 1H, J2a,3a 10.8 Hz, H-2a),
2.79 (t, 1H, J3a,4a 10.0 Hz, H-3a); 13C NMR (CD3OD, 100 MHz) 1α:
δ 102.7 (C-1c), 91.4 (C-1aα), 85.2 (C-3b), 84.2 (C-1b), 79.3 (C-5b),
78.3 (C-5c), 75.9 (C-3c), 75.5 (C-5a), 73.4 (C-2b), 72.2 (C-2c), 70.5
(C-2a), 69.5 (C-4c), 67.0 (C-4b), 66.9 (C-4a), 60.9 (C-6c), 60.8 (C-
6b), 60.6 (C-6a), 50.9 (C-3a); 1β: δ 102.7 (C-1c), 96.9 (C-1aβ), 85.2
(C-3b), 84.2 (C-1b), 79.3 (C-5b), 78.3 (C-5c), 75.9 (C-3c), 75.5 (C-
5a), 73.2 (C-2b), 72.1 (C-2c), 69.5 (C-2a, C-4c), 67.8 (C-4b), 67.0
(C-4a), 60.9 (C-6c), 60.8 (C-6b), 60.6 (C-6a), 54.2 (C-3a). HMRS
(ESI+) m/z: [M + Na]+ calcd for C18H32O15NaS, 543.13596; found,
543.1367.
1
100 °C; H NMR (CDCl3, 400 MHz): δ 5.12 (t, 1H, J2b,3b, J3b,4b 9.2
Hz, H-3b), 5.06 (t, 1H, J4b,5b 9.2 Hz, H-4b), 4.98 (t, 1H, J3a,4a, J4a,5a 9.6
Hz, H-4a), 4.96 (dd, 1H, J1a,2a 10.4 Hz, J2a,3a 9.6 Hz, H-2a), 4.90 (dd,
1H, J1b,2b 8.0 Hz 9.2 Hz, H-2b), 4.60 (d, 1H, H-1b), 4.40 (t, 1H, J1a,SH
10.4 Hz, H-1a), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.4 Hz, H-6b),
4.16−4.10 (m, 2H, H-6a, H-6′a), 4.02 (dd, 1H, H-6′b), 3.84 (t, 1H, H-
3a), 3.69−3.66 (m, 2H, H-5a, H-5b), 2.29 (d, 1H, SH), 2.96 (s, 3H,
OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.02 (s,
3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.97
(s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.4,
170.3, 169.4, 169.3, 169.2, 169.1 (CO), 100.9 (C-1b), 79.8 (C-3a),
78.8 (C-1a), 76.3 (C-5a), 75.0 (C-2a), 72.9 (C-3b), 71.7 (C-5b), 71.0
(C-2b), 67.9 (C-4b), 67.8 (C-4a), 62.2 (C-6b), 61.6 (C-6a), 21.7, 20.8,
20.6, 20.5, 20.4, 20.3 (OCOCH3). HRMS (ESI+) m/z: [M + Na]+
calcd for (C26H36O17NaS), 675.15709; found, 675.1572.
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-
deoxy-3-thio-β-D-glucofuranose (10). According to the general
procedure D, the desired trisaccharide was obtained starting from
the nucleophile 8 (720 mg, 1.1 mmol) in THF (12 mL) containing
sodium hydride (39.8 mg, 1.65 mmol), 1,7,10-trioxa-4,13-diazacyclo-
pentadecane (Kryptofix 21, 4.3 mg, 0.18 equiv) and a solution of 919
(0.48 g, 1.2 mmol) in THF (8 mL). The desired product 10 (804 mg,
86%) was purified by column chromatography (3:2 toluene/AcOEt).
TLC (3:2 toluene/AcOEt): Rf 0.4; mp: 108−110 °C; [α]2D0 −28.5 (c
1
1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.81 (d, 1H, J1a,2a 3.6
Hz, H-1a), 5.12 (dd, 1H, J3c,4c 9.6 Hz, J2c,3c 9.4 Hz, H-3c), 5.06 (dd,
1H, J4c,5c 9.6 Hz, H-4c), 5.00 (dd, 1H, J1b,2b 10.2 Hz, J2b,3b 10.1 Hz, H-
2b), 4.93 (dd, 1H, J4b,5b 9.6 Hz, J3b,4b 9.4 Hz, H-4b), 4.89 (dd, 1H, H-
2c), 4.85 (t, 1H, J2a,3a 3.6 Hz, H-2a), 4.60 (d, 1H, J1c,2c 8.0 Hz, H-1c),
4.58 (d, 1H, H-1b), 4.38 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.2 Hz, H-6b),
4.32−4.20 (m, 2H, H-4a, H-5a), 4.23 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 2.4
Hz, H-6c), 4.11 (dd, 1H, H-6′c), 4.10 (dd, 1H, J6a,6′a 8.8 Hz, J5a,6a 4.6
Hz, H-6a), 4.03 (dd, 1H, H-6′b), 4.00 (dd, 1H, H-6′a), 3.89 (dd, 1H,
H-3b), 3.70−3.62 (m, 2H, H-5c, H-5b), 3.52 (dd, 1H, J3a,4a 3.7 Hz, H-
3a), 2.14 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.03 (s, 3H,
OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 6H, OCOCH3), 1.97 (s,
3H, OCOCH3), 1.50 [s, 3H, C(CH3)2], 1.41 [s, 3H, C(CH3)2], 1.33
[s, 3H, C(CH3)2], 1.31 [s, 3H, C(CH3)2]; 13C NMR (CDCl3, 100
MHz): δ 170.5, 170.4, 170.3, 169.3, 169.2, 169.1, 168.7 (CO), 111.9,
109.4 (2 CIV), 104.8 (C-1a), 100.9 (C-1c), 86.1 (C-2a), 82.8 (C-1b),
80.1 (C-4a), 79.9 (C-3b), 76.3 (C-5b), 73.7 (C-5a), 72.9 (C-3c), 71.7
(C-5c), 71.2 (C-2b), 71.0 (C-2c), 67.9 (C-4b, C-4c), 67.2 (C-6a), 62.2
(C-6c), 61.6 (C-6b), 49.9 (C-3a), 26.8, 26.5, 26.3, 25.3 [C(CH3)2],
20.9, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). Microanalysis: Calcd for
C38H54O22S: C, 51.00; H, 6.08; S, 3.58. Found: C, 50.53; H, 6.06; S,
3.42.
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-
3-thio-α,β-D-glucopyranose (11). The target compound 11 was
obtained according to general procedure E starting from 10 (1.74 g,
1.95 mmol) and CF3COOH/H2O (4:1, 26 mL). Acetylation was
performed using 1:1 Ac2O/pyridine (3 mL). Column chromatography
(2:3, cyclohexane/AcOEt) afforded the expected trisaccharide 11 (1.3
g, 70%) as colorless oil. TLC (2:3, cyclohexane/AcOEt): Rf 0.3, [α]D20
− 22.1 (c 1.0, CHCl3), α/β ratio 1.6:1 (from NMR integration of H-1
Sequence for the Synthesis of 2. 2,3,4,6-Tetra-O-acetyl-β-D-
glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 →
3)-2,4,6-tri-O-acetyl-α-D-glucopyranosyl bromide (13). Trisaccharide
13 (119 mg, 80%) was isolated as a colorless oil according to general
procedure A and starting from peracetylated laminaritriose 1216 (141
mg, 0.15 mmol) and 33% HBr in AcOH (1.5 mL, 12 equiv). TLC
1
signal), H NMR (CDCl3, 400 MHz) 11α: δ 5.81 (d, 1H, J1aα,2aα 3.2
Hz, H-1aα), 5.10−5.02 (m, 4H, H-4c, H-3c, H-4a, H-2a), 4.93−4.85
(m, 3H, H-2b, H-4b, H-2c), 4.72 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.56 (d,
1H, J1c,2c 8.4 Hz, H-1c), 4.36 (dd, 1H, J5b,6b 4.0 Hz, H-6b), 4.24 (dd,
1H, J5a,6a 4.8 Hz, H-6a), 4.17−4.16 (m, 2H, H-6′a, H-6c), 4.13−4.11
(m, 1H, H-6′c), 4.06−4.04 (m, 1H, H-5a), 4.05−4.02 (m, 1H, H-6′b),
3.90 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.71−3.65 (m, 2H, H-5b, H-5c), 3.17
(t, 1H, J3a,4a 11.2 Hz, H-3a), 2.15 (s, 3H, OCOCH3), 2.14 (s, 3H,
OCOCH3), 2.13 (s, 3H, OCOCH3), 2.12 (s, 3H, OCOCH3), 2.08 (s,
3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04
(s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3),
1.96 (s, 3H, OCOCH3); 11β: δ 5.59 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ),
1
(3:2, toluene/AcOEt): Rf 0.3; [α]2D0 +18.9 (c 1.0, CHCl3); H NMR
(CDCl3, 400 MHz): δ 6.52 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.12 (dd, 1H,
J1c,2c 8.4 Hz, J2c,3c 9.2 Hz, H-2c), 5.06 (dd, 1H, J4c,5c 9.6 Hz, J3c,4c 9.4
Hz, H-4c), 5.04 (t, 1H, J3a,4a, J4a,5a 9.6 Hz, H-4a), 4.93 (dd, 1H, J6a,6′a
11.2 Hz, J4b,5b 9.6 Hz, H-4b), 4.90 (dd, 1H, J1b,2b 8.0 Hz, J2b,3b 9.6 Hz,
H-2b), 4.88 (dd, 1H, H-3c), 4.78 (dd, 1H, J2a,3a 10.0 Hz, H-2a), 4.53
(d, 1H, H-1b), 4.50 (d, 1H, H-1c), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b
8286
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
4.0 Hz, H-6b), 4.34 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 4.8 Hz, H-6c), 4.22
(dd, 1H, J5a,6a 4.4 Hz, H-6a), 4.21−4.19 (m, 1H, H-5a), 4.15 (dd, 1H,
H-3a), 4.14−4.11 (m, 1H, H-6′a), 4.10 (dd, 1H, H-6′c), 4.04 (dd, 1H,
H-6′b), 3.82 (dd, 1H, H-3b), 3.73−3.65 (m, 2H, H-5b, H-5c), 2.21 (s,
3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07
(s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3),
2.00 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H,
OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.5, 170.4, 170.3,
169.5, 169.4, 169.3, 169.2, 169.1, 168.8 (CO), 101.0 (C-1c), 100.7 (C-
1b), 87.4 (C-1a), 78.9 (C-3b), 76.1 (C-3a), 72.8 (C-2c, C-2b), 72.5
(C-5a), 72.4 (C-2a), 71.6 (C-5c, C-5b), 70.9 (C-3c), 68.0 (C-4c, C-
4b), 66.5 (C-4a), 61.9 (C-6c), 61.6 (C-6b), 61.1 (C-6a), 20.8, 20.7,
20.6, 20.5, 20.4, 20.3 (OCOCH3).
16 was obtained starting from 15 (32 mg, 0.03 mmol) in dry THF (3
mL), sodium hydride (1.5 mg, 0.05 mmol), 1,7,10-trioxa-4,13-
diazacyclopentadecane (Kryptofix 21, 1.34 mg, 0.18 equiv), and a
solution of 9 (13.4 mg, 0.033 mmol) in THF (1 mL). The mixture was
further stirred for 5 h at RT under N2. After extraction, the crude
product was purified by column chromatography using 7:3 light
petroleum/AcOEt to yield 16 (29 mg, 71%). TLC (7:3, light
petroleum/AcOEt): Rf 0.3; [α]2D0 −17.5 (c 1, CHCl3); 1H NMR
(CDCl3, 400 MHz): δ 5.81 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.12 (dd, 1H,
J1d,2d 8.0 Hz, J2d,3d 9.6 Hz, H-2d), 5.09 (dd, 1H, J3d,4d 8.0 Hz, J4d,5d 9.6
Hz, H-4d), 5.01 (dd, 1H, J1b,2b 10.0 Hz, J2b,3b 9.6 Hz, H-2b), 4.93 (dd,
1H, J4c,5c 10.0 Hz, J3c,4c 8.8 Hz, H-4c), 4.91 (dd, 1H, H-3d), 4.90 (dd,
1H, J4b,5b 9.6 Hz, J3b,4b 8.8 Hz, H-4b), 4.89 (dd, 1H, J1c,2c 8.0 Hz, J2c,3c
9.6 Hz, H-2c), 4.85 (t, 1H, J2a,3a 3.6 Hz, H-2a), 4.59 (d, 1H, H-1b),
4.50 (d, 1H, H-1d), 4.45 (d, 1H, H-1c), 4.42 (dd, 1H, J6d,6′d 12.0 Hz,
J5d,6d 4.0 Hz, H-6d), 4.36 (dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 4.4 Hz, H-6c),
4.32−4.26 (m, 1H, H-5a), 4.24 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.4 Hz,
H-6b), 4.22 (dd, 1H, J4a,5a 4.4 Hz, J3a,4a 3.7 Hz, H-4a), 4.12 (dd, 1H,
J6a,6′a 8.8 Hz, J5a,6a 4.4 Hz, H-6a), 4.10 (dd, 1H, H-6′b), 4.06 (dd, 1H,
H-6′c), 4.05 (dd, 1H, H-6′d), 4.00 (dd, 1H, H-6′a), 3.90 (dd, 1H, H-
3b), 3.81 (dd, 1H, H-3c), 3.69−3.64 (m, 3H, H-5b, H-5c, H-5d), 3.52
(dd, 1H, H-3a), 2.16 (s, 3H, OCOCH3), 2.11 (s, 3H, OCOCH3), 2.07
(s, 6H, OCOCH3), 2.02 (s, 6H, OCOCH3), 2.01 (s, 6H, OCOCH3),
1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.51 [s, 3H,
C(CH3)2], 1.42 [s, 3H, C(CH3)2], 1.34 [s, 3H, C(CH3)2], 1.31 [s, 3H,
C(CH3)2]; 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5, 170.3,
169.4, 169.2, 169.1, 168.7, 168.6 (CO), 111.9, 109.4 (2 CIV), 104.8 (C-
1a), 100.7 (C-1c), 100.0 (C-1d), 86.1 (C-2a), 82.7 (C-1b), 80.1 (C-
4a), 79.3 (C-3b, C-3c), 76.3 (C-5b), 73.7 (C-5a), 72.8 (C-2d, C-2c),
71.6 (C-2b, C-5d), 71.5 (C-5c), 70.8 (C-4c, C-4b), 68.4 (C-3d), 68.3
(C-4d), 67.3 (C-6a), 62.3 (C-6b), 61.9 (C-6c), 61.6 (C-6d), 49.9 (C-
3a), 26.8, 26.6, 26.3, 25.3 [C(CH3)2], 21.0, 20.7, 20.6, 20.5, 20.4, 20.3
(OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-1-thio-β-
D-glucopyranose (14). Application of the general procedure B starting
from potassium thioacetate (25 mg, 0.22 mmol) and 13 (108 mg, 0.11
mmol) in DMF (2 mL) allowed the synthesis of 14 (73 mg, 68%)
which was purified by chromatography (1:1, toluene/AcOEt). TLC
1
(1:1, toluene/AcOEt): Rf 0.3; [α]2D0 −19,0 (c 1.0, CHCl3); H NMR
(CDCl3, 400 MHz): δ 5.14 (d, 1H, J1a,2a 10.8 Hz, H-1a), 5.13 (dd, 1H,
J1c,2c 8.0 Hz, J2c,3c 8.8 Hz, H-2c), 5.11 (t, 1H, J3c,4c 8.8 Hz, H-3c), 5.05
(t, 1H, J4c,5c 8.8 Hz, H-4c), 4.98 (dd, 1H, J4a,5a 9.6 Hz, J3a,4a 8.8 Hz, H-
4a), 4.96 (dd, 1H, J2a,3a 9.6 Hz, H-2a), 4.89 (t, 2H, J2b,3b, J4b,5b 8.8 Hz,
H-2b, H-4b), 4.48 (d, 1H, H-1c), 4.45 (d, 1H, J1b,2b 8.0 Hz, H-1b),
4.38 (dd, 1H, J6a,6′a 10.4 Hz, J5a,6a 4.0 Hz, H-6a), 4.32 (dd, 1H, J6b,6′b
8.4 Hz, J5b,6b 4.4 Hz, H-6b), 4.15 (dd, 1H, J6c,6′c 10.0 Hz, J5c,6c 4.4 Hz,
H-6c), 4.12 (dd, 1H, H-6′b), 4.04 (dd, 1H, H-6′c), 4.00 (dd, 1H, H-
6′a), 3.93 (dd, 1H, H-3a), 3.79 (dd, 1H, J3b,4b 8.0 Hz, H-3b), 3.80−
3.77 (m, 1H, H-5a), 3.76−3.67 (m, 2H, H-5b, H-5c), 2.37 (s, 3H,
SCOCH3), 2.13 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s,
3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.02
(s, 3H, OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3),
1.97 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 192.5
(SCO), 170.7, 170.6, 170.5, 170.3, 169.4, 169.2, 169.1, 169.0, 168.9,
168.6 (CO), 101.0 (C-1c), 100.7 (C-1b), 80.1 (C-1a), 79.6 (C-3b),
79.4 (C-3a), 76.4 (C-5a), 72.8 (C-2c, C-2b), 71.7 (C-5b), 71.6 (C-5c),
70.8 (C-3c, C-2a), 67.9 (C-4c, C-4b), 67.6 (C-4a), 61.9 (C-6b, C-6c),
61.6 (C-6a), 30.8 (SCOCH3), 21.0, 20.7, 20.6, 20.5, 20.4, 20.3
(OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyr-
anosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-3-thio-α,β-D-gluco-
pyranose (17). Tetrasaccharide 17 was prepared according to general
procedure E starting from 16 (28.7 mg, 0.024 mmol) and CF3COOH/
H2O (4:1, 1 mL), and then 1:1 Ac2O/pyridine (1 mL). Flash
chromatography gave the expected tetrasacharide 17 (15.6 mg, 51%).
1
TLC (2:3, cyclohexane/AcOEt); H NMR (CDCl3, 400 MHz) α/β
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-1-thio-β-D-glu-
copyranose (15). General procedure C was applied for the synthesis
of 15 starting from 14 (68 mg, 0.07 mmol) in MeCN (4 mL) and 2-
aminoethanethiol (6 mg, 0.07 mmol). Purification by chromatography
eluting with 7:3 toluene/AcOEt yielded 15 (40 mg, 62%). TLC (7:3,
toluene/AcOEt): Rf 0.2; [α]2D0 −26.9 (c 1, CHCl3); 1H NMR (CDCl3,
400 MHz): δ 5.12 (dd, 1H, J2c,3c 9.6 Hz, J3c,4c 9.2 Hz, H-3c), 5.05 (dd,
1H, J1c,2c 8.0 Hz, H-2c), 4.96 (dd, 1H, J1b,2b 8.4 Hz, J2b,3b 10.0 Hz, H-
2b), 4.94 (dd, 1H, J4b,5b 10.4 Hz, J3b,4b 9.2 Hz, H-4b), 4.92 (dd, 1H,
J4a,5a 10.4 Hz, J3a,4a 9.6 Hz, H-4a), 4.87 (dd, 1H, J4c,5c 10.8 Hz, H-4c),
4.85 (dd, 1H, J1a,2a 10.0 Hz, J2a,3a 10.8 Hz, H-2a), 4.49 (d, 1H, H-1c),
4.44 (d, 1H, H-1b), 4.37 (dd, 1H, J1a,SH 10.3 Hz, H-1a), 4.36−4.33 (m,
1H, H-6a), 4.33 (dd, 1H, J6b,6′b 8.0 Hz, J5b,6b 4.4 Hz, H-6b), 4.15−4.14
(m, 2H, H-6c, H-6′c), 4.04 (dd, 1H, H-6′b), 4.02 (dd, 1H, J6a,6′a 8.0
Hz, H-6′a), 3.83 (dd, 1H, H-3b), 3.79 (dd, 1H, H-3a), 3.70−3.65 (m,
3H, H-5a, H-5b, H-5c), 2.27 (d, 1H, SH), 2.18 (s, 3H, OCOCH3),
2.10 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H,
OCOCH3), 2.06 (s, 3H, OCOCH3), 2.02 (s, 3H, OCOCH3), 2.01 (s,
ratio 2:1 (from NMR integration of H-1 signal): δ 6.27 (d, 1H, J1aα,2aα
3.2 Hz, H-1aα), 5.59 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ), 5.17 (dd, 1H,
J2aβ,3aβ 10.8 Hz, H-2aβ), 5.09 (dd, 1H, J3aα,4aα 11.2 Hz, J4aα,5aα 9.2 Hz,
H-4aα), 5.08 (t, 2H, J3d,4d 9.6 Hz, H-3dα, H-3dβ), 5.06 (t, 2H, J4d,5d
10.4 Hz, H-4dα, H-4dβ), 5.04 (dd, 1H, J2aα,3aα 9.2 Hz, H-2aα), 5.02
(dd, 1H, J4aβ,5aβ 10.4 Hz, J3aβ,4aβ 10.0 Hz, H-4aβ), 4.96−4.84 (m, 10H,
H-2bα, H-2bβ, H-2dα, H-2dβ, H-2cα, H-2cβ, H-4bα, H-4bβ, H-4cα,
H-4cβ), 4.70 (d, 1H, J1bα,2bα 10.0 Hz, H-1bα), 4.62 (d, 1H, J1bβ,2bβ 10.0
Hz, H-1bβ), 4.47 (d, 2H, J1d,2d 8.0 Hz, H-1dα, H-1dβ), 4.42 (d, 1H,
J1cα,2cα 8.4 Hz, H-1cα), 4.40 (d, 1H, J1cβ,2cβ 7.6 Hz, H-1cβ), 4.39 (dd,
2H, J5d,6d 3.6 Hz, H-6dα, H-6dβ), 4.34−4.29 (m, 4H, H-6bα, H-6bβ,
H-6cα, H-6cβ), 4.24 (dd, 1H, J5aβ,6aβ 4.8 Hz, H-6aβ), 4.21 (dd, 1H,
J5aα,6aα 4.4 Hz, H-6aα), 4.18−4.10 (m, 6H, H-6′aα, H-6′bα, H-6′bβ, H-
6′cα, H-6′cβ, H-6′aβ), 4.08−4.05 (m, 2H, H-6′dα, H-6′dβ), 4.00−
3.96 (m, 4H, H-3bα, H-3bβ, H-3cα, H-3cβ), 3.87−3.79 (m, 1H, H-
5aα), 3.74−3.64 (m, 7H, H-5bα, H-5bβ, H-5cα, H-5cβ, H-5dα, H-
5dβ, H-5aβ), 3.17 (dd, 1H, H-3aα), 2.97 (dd, 1H, H-3aβ), 2.16 (s, 3H,
OCOCH3), 2.12 (s, 3H, OCOCH3), 2.11 (s, 3H, OCOCH3), 2.10 (s,
3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07
(s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.05 (s, 3H, OCOCH3),
2.03 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H,
OCOCH3), 1.99 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3); 13C
NMR (CDCl3, 100 MHz): δ 170.6, 170.4, 170.3, 169.5, 169.4, 169.2
169.1, 169.0, 168.7, 168.6, 168.3 (CO), 101.0 (C-1dα, C-1dβ), 100.7
(C-1cα, C-1cβ), 93.5 (C-1aβ), 88.7 (C-1aα), 82.8 (C-1bα), 81.9 (C-
1bβ), 79.6 (C-3cα, C-3cβ), 79.3 (C-3bα, C-3bβ), 75.6 (C-5bα, C-
5bβ), 75.3 (C-5aβ), 72.4 (C-2cα, C-2cβ), 71.8 (C-2bα, C-2bβ), 71.6
(C-5dα, C-5dβ), 71.5 (C-5cα, C-5cβ, C-5aβ), 71.3 (C-2aβ), 70.7 (C-
5aα), 70.4 (C-2dα, C-2dβ), 70.1 (C-2aα), 68.4 (C-3dα, C-3dβ), 68.1
6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13
C
NMR (CDCl3, 100 MHz): δ 170.7, 170.6, 170.5, 170.3, 169.4, 169.2,
169.1, 169.0, 168.9, 168.6 (CO) 101.0 (C-1c), 100.7 (C-1b), 79.2 (C-
3a), 79.0 (C-3b), 78.7 (C-1a), 75.3 (C-5a), 75.2 (C-2b), 72.8 (C-2c),
72.6 (C-2a), 71.6 (C-5b, C-5c), 70.8 (C-3c), 68.0 (C-4b, C-4c, C-4a),
61.9 (C-6c, C-6b), 61.6 (C-6a), 21.0, 20.7, 20.6, 20.5, 20.4, 20.3
(OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyr-
anosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-deoxy-3-thio-β-D-glu-
cofuranose (16). According to the general procedure D, compound
8287
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
(C-4bα, C-4bβ, C-4cα, C-4cβ), 65.3 (C-4dα, C-4dβ), 65.6 (C-4aβ),
65.3 (C-4aα), 62.1 (C-6dα, C-6dβ, C-6cα, C-6cβ), 61.6 (C-6bα, C-
6bβ), 61.4 (C-6aα, C-6aβ), 49.8 (C-3aβ), 46.2 (C-3aα), 20.8, 20.7,
20.6, 20.5, 20.4, 20.3 (OCOCH3).
4.42−4.40 (m, 2H, H-1c), 4.39−4.05 (m, 6H, H-6a, H-6b, H-6c),
3.85−3.80 (m, 1H, H-5aβ), 3.70−3.64 (m, 3H, H-5aα, H-5b, H-5c),
3.17 (dd, 1H, J3aα,4aα 11.2 Hz, H-3aα), 2.97 (dd, 1H, J3aβ,4aβ 10.0 Hz,
H-3aβ), 2.95−2.90 (m, 1H, H-3b), 2.15 (s, 3H, OCOCH3), 2.11 (s,
3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08
(s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3),
2.03 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 1.99 (s, 3H,
OCOCH3), 1.96 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ
170.4, 169.5, 169.2 169.1, 168.7, 168.6, 168.3 (CO), 93.4 (C-1aβ),
88.8 (C-1aα), 84.0 (C-1c), 82.6 (C-1bα), 81.7 (C-1bβ), 75.6 (C-5b,
C-5c), 75.3 (C-5aβ),72.8 (C-3c), 72.3 (C-2c), 71.8 (C-2b), 71.3 (C-
2aβ), 70.7 (C-5aα), 70.1 (C-2aα), 68.1 (C-4b), 65.5 (C-4aβ), 65.3 (C-
4c), 65.2 (C-4aα), 62.2, 61.7, 61.3 (C-6c, C-6b, C-6a), 49.7 (C-3aβ),
51.9 (C-3b), 46.1 (C-3aα), 20.8, 20.6, 20.5, 20.4, 20.3 (OCOCH3).
β-D-Glucopyranosyl-(1 → 3)-3-deoxy-3-thio-β-D-glucopyranosyl-
(1 → 3)-3-deoxy-3-thio-α,β-D-glucopyranose (3). Final deacetylation
(procedure F) of 20 (42 mg, 0.04 mmol) in anhydrous methanol (4
mL) with a 0.1 M solution of sodium methylate in methanol (0.1
equiv) and then Steric Exclusion chromatography (SEC) purification
gave 3 as a colorless oil (19 mg, 84%). TLC (5:5:2, BuOH/EtOH/
β-D-Glycopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-β-D-
glucopyranosyl-(1 → 3)-3-deoxy-3-thio-α,β-D-glycopyranose (2).
Final deacetylation (procedure F) of 17 (15 mg, 0.01 mmol) in
anhydrous methanol (1 mL) with a 0.1 M solution of sodium
methylate in methanol (0.1 equiv), and then SEC purification gave 2
as a colorless oil (6.3 mg, 77%). TLC (3:3:2, AcOEt/i-PrOH/H2O) Rf
0.2; 1H NMR (D2O, 400 MHz) α/β ratio 1.2:1 (from NMR
integration of H-1 signal), characteristic signals: δ 5.21 (d, 1H, J1aα,2aα
3.6 Hz, H-1aα), 4.74 (d, 4H, J1c,2c = J1d,2d 8.0 Hz, H-1cα, H-1cβ, H-
1dα, H-1dβ), 4.72 (d, 2H, J1b,2b 10.4 Hz, H-1bα, H-1bβ), 4.63 (d, 1H,
J1aβ,2aβ 7.6 Hz, H-1aβ), 3.12 (dd, 1H, J3aα,4aα 11.2 Hz, H-3aα), 2.90 (dd,
1H, J3aβ,4aβ 10.4 Hz, H-3aβ), other signals 3.92−3.83 (m, 8H, H-6aα,
H-6aβ, H-6bα, H-6bβ, H-6cα, H-6cβ, H-6dα, H-6dβ), 3.80−3.66 (m,
18 H, H-6′aα, H-6′aβ, H-6′bα, H-6′bβ, H-6′cα, H-6′cβ, H-6′dα, H-
6′dβ, H-4aα, H-4aβ, H-3dα, H-3dβ, H-4bα, H-4bβ, H-4cα, H-4cβ, H-
4dα, H-4dβ), 3.66−3.30 (m, 20H, H-5aα, H-5aβ, H-5bα, H-5bβ, H-
5cα, H-5cβ, H-5dα, H-5dβ, H-2aα, H-2aβ, H-2bα, H-2bβ, H-2cα, H-
2cβ, H-2dα, H-2dβ, H-3bα, H-3bβ, H-3cα, H-3cβ); 13C NMR (D2O,
100 MHz) δ 102.7 (C-1dα, C-1dβ, C-1cα, C-1cβ), 97.5 (C-1aβ), 91.3
(C-1aα), 82.9 (C-1bα), 82.0 (C-1bβ), 77.2 (C-5aα, C-5aβ, C-5bα, C-
5bβ, C-5cα, C-5cβ, C-5dα, C-5dβ), 74.6 (C-2aα, C-2aβ, C-2cα, C-2cβ,
C-2dα, C-2dβ), 72.4 (C-2bα, C-2bβ), 71.2 (C-4aα, C-4aβ, C-4bα, C-
4bβ, C-4cα, C-4cβ, C-4dα, C-4dβ), 62.1 (C-6aα, C-6aβ, C-6bα, C-
6bβ, C-6cα, C-6cβ, C-6dα, C-6dβ), 49.9 (C-3aβ), 46.3 (C-3aα).
HMRS (ESI+) m/z: [M + Na]+ calcd for C24H42O20NaS, 705.18879;
found, 705.1882.
1
H2O): Rf 0.3; H NMR (CD3OD, 400 MHz) α/β ratio 1:1.3 (from
NMR integration of H-1 signal): δ 5.14 (d, 1H, J1aα,2aα 3.5 Hz, H-1aα),
4.64 (d, 2H, J1c,2c 9.6 Hz, H-1b), 4.63 (d, 2H, J1b,2b 9.7 Hz, H-1c), 4.51
(d, 1H, J1aβ,2aβ 7.5 Hz, H-1aβ), 3.93−3.80 (m, 5H, H-5aα, H6b, H6c),
3.86 (dd, 1H, J6aβ,5aβ 2.5 Hz, J6aβ,6′aβ 11.6 Hz, H-6aβ), 3.79−3.60 (m,
5H, H-6aα, H6′b, H6′c), 3.68 (dd, 1H, J6′aβ,5aβ 5.5 Hz, H-6′aβ), 3.51
(dd, 1H, J2aα,3aα 10.6 Hz, H-2aα), 3.45−3.30 (m, 14H, H-4aβ, H-5aβ,
H-2b, H-4b, H-5b, H-3c, H-4c, H-5c), 3.36 (t, 1H, J4aα,5aα, J4aα,3aα 10.6
Hz, H-4aα), 3.28−3.22 (m, 2H, H-2c), 3.23 (dd, 1H, J2aβ,3aβ 10.0 Hz,
H-2aβ), 3.13 (t, 1H, H-3aα), 2.87−2.81 (m, 2H, H-3b), 2.80 (t, 1H,
J3aβ,4aβ 10.0 Hz, H-3aβ); 13C NMR (CD3OD, 100 MHz): δ 99.3 (C-
1aβ), 93.25 (C-1aα), 87.8, 87.5 (C-1b), 86.5 (C-1c), 83.84, 83.76 (C-
5b), 82.0 (C-3c), 80.4 (C-5aβ), 79.4 (C-5c), 75.3 (C-2aβ), 74.6 (C-
2c), 74.0, 73.8 (C-2b), 73.8 (C-5aα), 72.7 (C-2aα), 71.2 (C-4c), 69.5
(C-4aβ), 69.2 (C-4aα), 68.9 (C-4b), 63.0, 62.9, 62.8, 62.7 (C-6a, C-6b,
C-6c), 58.2, 58.1 (C-3b), 56.8 (C-3aβ), 53.2 (C-3aα). HRMS (ESI+)
m/z: [M + Na]+calcd for C18H32O14NaS2, 559.1131; found, 559.1201.
Sequence for the Synthesis of 4. 2,3,4,6-Tetra-O-acetyl-β-D-
glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 →
3)-2,4,6-tri-O-acetyl-3-deoxy-3-thio-1-α-D-glucopyranosyl bromide
(21). Building Block 21 was synthesized according to general
procedure A starting from 11 (720 mg, 0.73 mmol) in dichloro-
methane (2 mL) and 33% HBr in AcOH (4 mL, 12 equiv). A
chromatographic purification afforded the desired bromide 21 (525
mg, 72%) as a colorless oil. TLC (3:2, petroleum ether/AcOEt): Rf
0.3; [α]2D0 +29.7 (c 1.0, CHCl3); 1H NMR (CDCl3, 400 MHz): δ 6.64
(d, 1H, J1a,2a 3.6 Hz, H-1a), 5.10 (t, 1H, J2c,3c, J3c,4c 9.4 Hz, H-3c), 5.06
(t, 1H, J4c,5c 9.4 Hz, H-4c), 5.07−5.03 (m, 1H, H-4a), 4.94−4.86 (m,
2H, H-2b, H-4b), 4.89 (dd, 1H, J1c,2c 8.1 Hz, H-2c), 4.83 (dd, 1H, J2a,3a
11.3 Hz, H-2a), 4.70 (d, 1H, J1b,2b 10.1 Hz, H-1b), 4.56 (d, 1H, H-1c),
4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.2 Hz, H-6b), 4.29 (dd, 1H,, J6a,6′a
12.5 Hz, J5a,6a 4.2 Hz, H-6a), 4.23−4.19 (m, 1H, H-5a), 4.17 (dd, 1H,
J5c,6c 5.0 Hz, H-6c), 4.12 (dd, 1H, H-6′a), 4.12−4.08 (m, 1H, H-6′c),
4.04 (d, 1H, H-6′b), 3.90 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.71−3.65 (m,
2H, H-5b, H-5c), 3.29 (t, 1H, J3a,4a 11.2 Hz, H-3a), 2.13 (s, 3H,
OCOCH3), 2.10 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s,
3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00
(s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3);
13C NMR (CDCl3, 100 MHz): δ 170.5, 170.4, 170.3, 169.5, 169.4,
Sequence for the Synthesis of 3. 2,3,4,6-Tetra-O-acetyl-β-D-
glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3-β-D-glucopyr-
anosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-deoxy-3-thio-β-D-glu-
cofuranose (19). The required tetrasaccharide 19 was synthesized
according to procedure D starting from 1819 (70 mg, 0.1 mmol) in
solution in dry THF (3 mL), and a solution of 9 (45 mg, 0.12 mmol)
in THF (3 mL). After workup and column chromatography using 7:3,
petroleum ether/AcOEt, 19 was isolated as a colorless oil (61 mg,
1
67%). TLC (3:2, petroleum ether/AcOEt): Rf 0.3; H NMR (CDCl3,
400 MHz): δ 5.81 (d, 1H, J1a,2a 3.2 Hz, H-1a), 5.17 (t, 1H, J2c,3c, J3c,4c
9.2 Hz, H-3c), 5.06 (dd, 1H, J1b,2b 9.6 Hz, J2b,3b 10.4 Hz, H-2b), 5.04 (t,
1H, J4c,5c 9.2 Hz, H-4c), 4.89 (t, 1H, J3b,4b, J4b,5b 10.8 Hz, H-4b), 4.89
(dd, 1H, J1c,2c 10.4 Hz, H-2c), 4.83 (dd, 1H, J2a,3a 3.6 Hz, H-2a), 4.64
(d, 1H, H-1c), 4.60 (d, 1H, H-1b), 4.32−4.28 (m, 1H, H-5), 4.28−
4.08 (m, 6H, H-4a, H-6a, H-6b, H-6′b, H-6c, H-6′c), 4.00 (dd, 1H,
J5a,6′a 4.8 Hz, J6a,6′a 8.8 Hz, H-6′a), 3.71 (ddd, 1H, J5c,6c 2.4 Hz, J5c,6′c 4.8
Hz, H-5c), 3.65 (ddd, 1H, J5b,6b 2.4 Hz, J5b,6′b 7.6 Hz, H-5b), 3.53 (dd,
1H, J3a,4a 4.0 Hz, H-3a), 2.99 (dd, 1H, H-3b), 2.14 (s, 3H, CH3CO),
2.09 (s, 3H, CH3CO), 2.07 (s, 3H, CH3CO), 2.02 (s, 3H, CH3CO),
2.01 (s, 3H, CH3CO), 2.00 (s, 3H, CH3CO), 1.98 (s, 3H, CH3CO),
1.50 [s, 3H, (CH3)2C], 1.41 [s, 3H, (CH3)2C], 1.33 [s, 3H, (CH3)2C],
1.31 [s, 3H, (CH3)2C]; 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5,
170.2, 169.5, 169.3, 169.1, 168.5 (CH3CO), 111.9, 109.5 [(CH3)2C],
104.8 (C-1a), 86.1 (C-2a), 84.5, 84.3 (C-1b, C-1c), 80.1 (C-4a), 78.4
(C-5b), 76.0 (C-5c), 73.7, 73.6 (C-5a, C-3c), 71.8 (C-2c), 70.0 (C-
2b), 68.2 (C-4c), 67.3 (C-6a), 66.3 (C-4b), 62.5, 61.9 (C-6b, C-6c),
52.2 (C-3b), 50.1 (C-3a), 26.9, 26.6, 26.3, 25.3 [(CH3)2C]; ], 21.0,
20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-3-deoxy-3-thio-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-
acetyl-3-deoxy-3-thio-α,β-D-glucopyranose (20). Procedure E, start-
ing from 19 (53 mg, 0.06 mmol) and using CF3COOH/H2O (4:1, 4
mL), followed by acetylation (1:1 Ac2O/pyridine, 2 mL) and flash
chromatography gave the expected tetrasaccharide 20 (28 mg, 44%).
1H NMR (CDCl3, 400 MHz) α/β ratio 2:1 (from NMR integration of
H-1 signal): δ 6.29 (d, 1H, J1aα,2aα 3.2 Hz, H-1aα), 5.61 (d, 1H, J1aβ,2aβ
8.0 Hz, H-1aβ), 5.19 (dd, 1H, J2aβ,3aβ 10.8 Hz, H-2aβ), 5.10 (t, 2H,
J3c,4c 9.6 Hz, H-3c), 5.06 (dd, 1H, J2aα,3aα 9.2 Hz, H-2aα), 5.05−5.02
(m, 2H, H-4a), 4.96−4.84 (m, 8H, H-2b, H-2c, H-4b, H-4c), 4.73 (d,
1H, J1bα,2bα 10.0 Hz, H-1bα), 4.64 (d, 1H, J1bβ,2bβ 10.0 Hz, H-1bβ),
169.3, 169.2, 169.1, 168.8 (CO), 100.8 (C-1c), 89.0 (C-1a), 81.9 (C-
1b), 79.9 (C-3b), 75.7 (C-5b), 72.9 (C-5a), 72.8 (C-3c), 71.7 (C-5c,
C-2b), 71.3 (C-2a), 70.9 (C-2c), 67.8 (C-4c), 67.6 (C-4b), 64.4 (C-
4a), 62.0 (C-6c), 61.6 (C-6b), 61.4 (C-6a), 46.7 (C-3a), 20.8, 20.7,
20.6, 20.5, 20.4, 20.3 (OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-
1 → 3-dithio-β-D-glucopyranose (22). According to procedure B,
potassium thioacetate (196 mg, 1.72 mmol) and a solution of 21 (862
mg, 0.86 mmol) in DMF (5 mL) gave 22 (680 mg, 79%) which was
purified by column chromatography (3:2, cyclohexane/AcOEt). TLC
8288
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
(7:3, cyclohexane/AcOEt): Rf 0.4; mp: 122−124 °C; [α]2D0− 7.2 (c 1.0,
CHCl3); 1H NMR (CDCl3, 400 MHz): δ 5.18 (dd, 1H, J1a,2a 10.4 Hz,
J2a,3a 10.1 Hz, H-2a), 5.10 (d, 1H, H-1a), 5.08 (t, 1H, J2c,3c, J3c,4c 9.4 Hz,
H-3c), 5.06 (t, 1H, J4c,5c 9.4 Hz, H-4c), 5.03 (dd, 1H, J3a,4a 10.4 Hz,
J4a,5a 9.6 Hz, H-4a), 4.94−4.89 (m, 2H, H-2b, H-4b), 4.88 (dd, 1H,
J1c,2c 8.1 Hz, H-2c), 4.63 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.54 (d, 1H, H-
1c), 4.38 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 4.2 Hz, H-6c), 4.21 (dd, 1H,
J6a,6′a 12.5 Hz, J5a,6a 4.4 Hz, H-6a), 4.19−4.15 (m, 2H, H-6b, H-6′b),
4.08 (dd, 1H, H-6′c), 4.02 (dd, 1H, H-6′a), 3.90 (t, 1H, J3b,4b 9.2 Hz,
H-3b) 3.82−3.79 (m, 1H, H-5a), 3.68−3.65 (m, 2H, H-5b, H-5c),
3.66 (t, 1H, H-3a), 2.35 (s, 3H, SCOCH3), 2.09 (s, 3H, OCOCH3),
2.10 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H,
OCOCH3), 2.05 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s,
3H, OCOCH3), 1.98 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.95
(s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5,
170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.8, 168.4 (CO), 100.9 (C-
1c), 82.7 (C-1b), 82.2 (C-1a), 80.0 (C-3b), 78.4 (C-5a), 75.7 (C-5b),
72.8 (C-3c), 71.7 (C-2b), 71.6 (C-5c), 70.9 (C-2c), 70.1 (C-2a), 67.8
(C-4c, C-4b), 65.7 (C-4a), 62.2 (C-6b), 62.1 (C-6a), 61.5 (C-6c), 52.0
(C-3a), 30.8 (SCOCH3), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3, 20.2
(OCOCH3). Microanalysis: Calcd for C40H54O25S2: C, 48.09; H, 5.45;
S, 6.42. Found: C, 47.92; H, 5.58; S, 6.27.
(m, 2H, H-6c, H-6′c), 4.26−4.22 (m, 2H, H-6d, H-6′d), 4.10 (dd, 1H,
J3a,4a 4.0 Hz, J4a,5a 4.4 Hz, H-4a), 4.05 (dd, 1H, H-6′b), 4.00 (dd, 1H,
H-6′a), 3.84 (dd, 1H, H-3c), 3.70−3.61 (m, 3H, H-5b, H-5c, H-5d),
3.52 (dd, 1H, H-3a), 2.92 (dd, 1H, H-3b), 2.12 (s, 3H, OCOCH3),
2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H,
OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 6H, OCOCH3), 1.98 (s,
3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.49 [s, 3H, C(CH3)2], 1.40
[s, 3H, C(CH3)2], 1.32 [s, 3H, C(CH3)2], 1.31 [s, 3H, C(CH3)2]; 13
C
NMR (CDCl3, 100 MHz): δ 170.7, 170.4, 170.3, 169.5, 169.3, 169.2,
169.1, 168.8, 168.3 (CO), 111.9, 109.4 (2 CIV), 104.8 (C-1a), 100.9
(C-1d), 86.0 (C-2a), 84.8 (C-1c), 83.1 (C-1b), 80.1 (C-3c), 80.0 (C-
4a), 78.4 (C-5d), 75.6 (C-5b), 73.7 (C-5a), 72.8 (C-3d), 71.8 (C-2b),
71.7 (C-5c), 71.4 (C-2c), 70.9 (C-2d), 68.0 (C-4d), 67.9 (C-4c), 67.3
(C-6a), 66.3 (C-4b), 62.6 (C-6d), 62.2 (C-6c), 61.6 (C-6b), 51.9 (C-
3b), 50.1 (C-3a), 26.8, 26.6, 26.3, 25.3 [C(CH3)2], 20.9, 20.8, 20.7,
20.6, 20.5, 20.4, 20.3 (OCOCH3).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3-
thio-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-3-
thio-α,β-D-glucopyranose (25). Procedure E, starting from 24 (156 g,
0.13 mmol) and using CF3COOH/H2O (4:1, 4 mL), followed by
acetylation (1:1 Ac2O-pyridine, 3 mL) and flash chromatography gave
the expected tetrasaccharide 25 (86 mg, 52%). TLC (2:3, cyclo-
hexane/AcOEt): Rf 0.3; [α]2D0 −18.1 (c 1.0, CHCl3); 1H NMR
(CDCl3, 400 MHz) α/β ratio 1:1.1. (from NMR integration of H-1
signal): δ 6.27 (d, 1H, J1aα,2aα 3.6 Hz, H-1aα), 5.60 (d, 1H, J1aβ,2aβ 8.0
Hz, H-1aβ), 5.21 (dd, 1H, J2aβ,3aβ 10.8 Hz, H-2aβ), 5.10 (t, 2H, J3d,4d
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-1 →
3-dithio-β-D-glucopyranose (23). Application of general procedure C
starting from a solution of 22 (580 mg, 0.58 mmol) in acetonitrile (10
mL) and 2-aminoethanethiol (77.15 mg 0.58 mmol) gave 23 (382 mg
69%) as a white solid after chromatography eluting with 3:2
cyclohexane/AcOEt. TLC (3:2, cyclohexane/AcOEt): Rf 0.4; mp:
9.2 Hz, H-3dα, H-3dβ), 5.09−5.07 (m, 1H, H-2aα), 5.05 (t, 2H, J1b,2b
,
J2b,3b 9.6 Hz, H-2bα, H-2bβ), 5.04 (t, 2H, J3c,4c, J4c,5c 9.2 Hz, H-4cα, H-
4cβ), 5.00 (dd, 1H, J3aα,4aα 10.0 Hz, J4aα,5aα 9.2 Hz, H-4aα), 4.95 (dd,
2H, J1c,2c 9.6 Hz, J2c,3c 10.0 Hz, H-2cα, H-2cβ), 4.93 (dd, 1H, J4aβ,5aβ 9.6
Hz, H-4aβ), 4.90 (t, 2H, J4b,5b 10.8 Hz, H-4bα, H-4bβ), 4.89 (t, 2H,
J4d,5d 9.2 Hz, H-4dα, H-4dβ), 4.87 (t, 1H, J3aβ,4aβ 9.2 Hz, H-3aβ), 4.69
(d, 2H, H-1cα, H-1cβ), 4.62 (d, 2H, H-1bα, H-1bβ), 4.55 (d, 2H, J1d,2d
8.4 Hz, H-1dα, H-1dβ), 4.37 (dd, 2H, J6b,6′b 12.4 Hz, J5b,6b 4.4 Hz, H-
6bα, H-6bβ), 4.23−4.06 (m, 12H, H-6aα, H-6aβ, H-6cα, H-6cβ, H-
6dα, H-6dβ, H-6′aα, H-6′aβ, H-6′cα, H-6′cβ, H-6′dα, H-6′dβ), 4.00
(dd, 2H, H-6′bα, H-6′bβ), 3.84 (dd, 2H, H-3cα, H-3cβ), 4.82−4.80
(m, 2H, H-5aα, H-5aβ), 3.75−3.60 (m, 6H, H-5bα, H-5bβ, H-5cα, H-
5cβ, H-5dα, H-5dβ), 3.21 (t, 1H, H-3aα), 2.96−2.82 (m, 3H, H-3aβ,
H-3bα, H-3bβ), 2.15 (s, 3H, OCOCH3), 2.09 (s, 6H, OCOCH3), 2.08
(s, 6H, OCOCH3), 2.07 (s, 9H, OCOCH3), 2.06 (s, 6H, OCOCH3),
2.03 (s, 6H, OCOCH3), 2.00 (s, 3H, OCOCH3); 13C NMR (CDCl3,
100 MHz): δ 170.7, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.8,
168.3 (CO), 100.9 (C-1dα, C-1dβ), 93.3 (C-1aβ), 88.7 (C-1aα), 84.1
(C-1bβ), 82.8 (C-1bα), 80.0 (C-1cβ), 79.9 (C-1cα), 77.9 (C-3c), 77.7
(C-5d), 75.6 (C-5aβ), 75.3 (C-5aα), 72.8 (C-3d), 71.7 (C-2b, C-2c, C-
2d), 71.6 (C-5b, C-5c), 71.3 (C-2aβ), 70.1 (C-2aα), 67.9 (C-4b, C-
4c), 66.1 (C-4aβ), 65.4 (C-4d, C-4aα), 62.2 (C-6a, C-6c, C-6d), 61.6
(C-6b), 51.9 (C-3b), 50.1 (C-3a), 20.9, 20.8, 20.7, 20.6, 20.5, 20.4,
20.3 (OCOCH3).
118−120 °C; [α]2D0− 16.1 (c 1.0, CHCl3); H NMR (CDCl3, 400
1
MHz): δ 5.12 (dd, 1H, J2c,3c 9.2 Hz, J3c,4c 9.6 Hz, H-3c), 5.08 (dd, 1H,
J1a,2a 9.6 Hz, J2a,3a 10.4 Hz, H-2a), 5.06 (dd, 1H, J4c,5c 9.2 Hz, H-4c),
4.92 (dd, 1H, J3b,4b 9.2 Hz, J4b,5b 10.4 Hz, H-4b), 4.90 (dd, 1H, J4a,5a
10.4 Hz, J3a,4a 10.8 Hz, H-4a), 4.89 (t, 1H, J1b,2b, J2b,3b 10.4 Hz, H-2b),
4.88 (dd, 1H, J1c,2c 8.0 Hz, H-2c), 4.64 (d, 1H, H-1b), 4.56 (d, 1H, H-
1c), 4.43 (t, 1H, J1a,SH 9.6 Hz, H-1a), 4.40 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c
4.4 Hz, H-6c), 4.26 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 5.2 Hz, H-6b), 4.24
(dd, 1H, J6a,6′a 12.4 Hz, J5a,6a 4.8 Hz, H-6a), 4.18 (dd, 1H, H-6′b), 4.12
(dd, 1H, H-6′a), 4.06 (dd, 1H, H-6′c), 3.85 (dd, 1H, H-3b), 3.70−
3.66 (m, 3H, H-5b, H-5c, H-5a), 2.94 (t, 1H, H-3a), 2.39 (d, 1H, SH),
2.09 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.07 (s, 3H,
OCOCH3), 2.06 (s, 3H, OCOCH3), 2.05 (s, 3H, OCOCH3), 2.01 (s,
3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.98 (s, 3H, OCOCH3), 1.97
(s, 3H, OCOCH3), 1.95 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100
MHz): δ 170.7, 170.6, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.9,
168.8 (CO), 100.9 (C-1c), 82.9 (C-1b), 80.7 (C-1a), 80.0 (C-3b), 78.4
(C-5a), 75.7 (C-5b), 74.8 (C-2a), 72.8 (C-3c), 71.8 (C-2b), 71.6 (C-
5c), 70.9 (C-2c), 68.0 (C-4b), 67.9 (C-4c), 66.0 (C-4a), 62.4 (C-6a),
62.2 (C-6b), 61.6 (C-6c), 51.8 (C-3a), 20.9, 20.8, 20.7, 20.6, 20.5,
20.4, 20.2 (OCOCH3); Microanalysis: Calcd for C38H52O24S2: C,
47.70; H, 5.48; S, 6.70. Found: C, 47.38; H, 5.61; S, 6.25.
β-D-Glucopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-3-
deoxy-3-thio-β-D-glucopyranosyl-(1 → 3)-3-deoxy-3-thio-α,β-D-glu-
copyranose (4). Final Zemplen deacetylation was performed
according to procedure F starting from 25 (14 mg, 0.01 mmol) in
anhydrous methanol (1 mL) and a 0.1 M solution of sodium
methylate in methanol (0.1 equiv). Workup and size exclusion
chromatography gave the required tetrasaccharide 4 (6.7 mg, 88%).
2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-
acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3-
thio-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-
deoxy-3-thio-β-D-glucofuranose (24). The required tetrasaccharide
24 was synthesized according to procedure D starting from 23 (240
mg, 0.25 mmol) in dry THF (5 mL), 1,7,10-trioxa-4,13-diazacyclo-
pentadecane (Kryptofix 21, 9.8 mg, 0.18 equiv) and a solution of 9
(107.9 mg, 0.27 mmol) in THF (3 mL). After workup and column
chromatography using 7:3, petroleum ether/AcOEt, 24 was isolated as
a colorless oil (149 mg, 62%). TLC (7:3, petroleum ether/AcOEt): Rf
0.3; [α]2D0− 17.5 (c 1.0, CHCl3); 1H NMR (CDCl3, 400 MHz): δ 5.80
(d, 1H, J1a,2a 3.2 Hz, H-1a), 5.12 (t, 1H, J2d,3d, J3d,4d 9.6 Hz, H-3d), 5.08
(dd, 1H, J1d,2d 3.2 Hz, H-2d), 5.05 (t, 1H, J4d,5d 9.6 Hz, H-4d), 4.90
(dd, 1H, J3c,4c 9.2 Hz, J4c,5c 9.6 Hz, H-4c), 4.90 (dd, 1H, J1b,2b 10.4 Hz,
J2b,3b 9.6 Hz, H-2b), 4.88 (dd, 1H, J1c,2c 10.0 Hz, J2c,3c 9.6 Hz, H-2c),
4.83 (dd, 1H, J3b,4b 9.2 Hz, J4b,5b 9.6 Hz, H-4b), 4.80 (dd, 1H, J2a,3a 3.6
Hz, H-2a), 4.60 (d, 1H, H-1b), 4.58 (d, 1H, H-1c), 4.54 (d, 1H, H-
1d), 4.38 (dd, 1H, J6b,6b′ 12.4 Hz, J5b,6b 4.4 Hz, H-6b), 4.35 (dd, 1H,
1
TLC (5:5:2, BuOH/EtOH/H2O): Rf 0.2; H NMR (CD3OD, 400
MHz) α/β ratio 1.5:1 (from NMR integration of H-1 signal), 4α: δ
5.11 (d, 1H, J1aα,2aα 3.6 Hz, H-1aα), 4.67 (d, 1H, J1c,2c 10.0 Hz, H-1c),
4.62 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.56 (d, 1H, J1d,2d 8.0 Hz, H-1d), 3.92
(dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 2.1 Hz, H-6c), 3.90 (dd, 1H, J6d,6′d 12.0
Hz, J5d,6d 2.0 Hz, H-6d), 3.89 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.0 Hz, H-
6b), 3.80 (dd, 1H, J6a,6′a 11.6 Hz, J5a,6a 2.0 Hz, H-6a), 3.79 (dd, 1H, H-
6′c), 3.74 (dd, 1H, H-6′a), 3.70 (dd, 1H, H-6′b), 3.65 (dd, 1H, H-
6′d), 3.56 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.52 (dd, 1H, J2a,3a 10.2 Hz, H-
2a), 3.48−3.31 (m, 3H, H-2c, H-4c, H-5c), 3.46−3.32 (m, 3H, H-2b,
H-4b, H-5b), 3.39 (dd, 1H, J2d,3d 9.2 Hz, J3d,4d 8.8 Hz, H-3d), 3.37 (dd,
1H, J3a,4a 10.8 Hz, J4a,5a 9.2 Hz, H-4a), 3.33−3.30 (m, 1H, H-5d),
J
6a,6a′ 8.8 Hz, J5a,6a 4.4 Hz, H-6a), 4.32−4.28 (m, 1H, H-5a), 4.28−4.26
8289
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
3.32−3.30 (m, 1H, H-5a), 3.31 (dd, 1H, H-2d), 3.28 (dd, 1H, J4d,5d 9.2
Hz, H-4d), 3.14 (dd, 1H, H-3a), 2.86 (t, 1H, J3b,4b 10.0 Hz, H-3b); 4β
4.66 (d, 1H, J1c,2c 10.0 Hz, H-1c), 4.60 (d, 1H, J1b,2b 9.6 Hz, H-1b),
4.56 (d, 1H, J1d,2d 8.0 Hz, H-1d), 4.49 (d, 1H, J1aβ,2aβ 7.6 Hz, H-1aβ),
3.92 (dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 2.1 Hz, H-6c), 3.90 (dd, 1H, J6d,6′d
12.0 Hz, J5d,6d 2.0 Hz, H-6d), 3.89 (dd, 1H, J6a,6′a 11.6 Hz, J5b,6b 2.0 Hz,
H-6b), 3.88 (dd, 1H, J6b,6′b 12.4 Hz, J5a,6a 2.0 Hz, H-6a), 3.79 (dd, 1H,
H-6′c), 3.70 (dd, 1H, H-6′a), 3.68 (dd, 1H, H-6′b), 3.65 (dd, 1H, H-
6′d), 3.56 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.48−3.31 (m, 3H, H-2c, H-4c,
H-5c), 3.46−3.32 (m, 3H, H-2b, H-4b, H-5b), 3.40−3.30 (m, 2H, H-
4a, H-5a), 3.39 (t, 1H, J2d,3d, J3d,4d 9.0 Hz, H-3d), 3.33−3.30 (m, 1H,
H-5d), 3.31 (dd, 1H, H-2d), 3.28 (t, 1H, J4d,5d 9.0 Hz, H-4d), 3.24 (dd,
1H, J2a,3a 10.4 Hz, H-2a), 2.86 (t, 1H, J3b,4b 10.0 Hz, H-3b), 2.80 (t, 1H,
J3a,4a 10.0 Hz, H-3a); 13C NMR (CD3OD, 100 MHz): 4α: δ 105.1 (C-
1d), 93.2 (C-1aα), 88.8 (C-3d), 87.6 (C-1b), 85.9 (C-1c), 83.8 (C-
5b), 81.7 (C-5c), 81.6 (C-5a), 78.2 (C-5d), 77.8 (C-3c), 74.1 (C-2b),
74.0 (C-2c), 72.7 (C-2a), 71.5 (C-2d), 69.7 (C-4d), 69.5 (C-4c), 69.1
(C-4b), 68.8 (C-4a), 63.0 (C-6d), 62.9 (C-6c), 62.8 (C-6b), 62.6 (C-
6a), 58.0 (C-3b), 56.7 (C-3a); 4β: δ 105.1 (C-1d), 99.3 (C-1aβ), 88.8
(C-3d), 87.6 (C-1b), 85.9 (C-1c), 83.8 (C-5b), 81.7 (C-5c), 80.4 (C-
5a), 78.2 (C-5d), 77.8 (C-3c), 75.3 (C-2a), 74.1 (C-2b), 74.0 (C-2c),
71.5 (C-2d), 69.7 (C-4d), 69.5 (C-4c), 69.1 (C-4b), 68.8 (C-4a), 63.0
(C-6d), 62.9 (C-6c), 62.8 (C-6b), 62.6 (C-6a), 58.0 (C-3b), 53.2 (C-
3a). HRMS (ESI+)m/z: [M + Na]+ calcd for C24H42O19NaS2),
721.16594; found, 721.1661.
Animals. Female, 6−8 weeks old, BALB/c mice were purchased
from The Jackson Laboratory (Bar Harbor, ME, U.S.A.). All animal
work was done according to the University of Louisville IACUC
protocol. Animals were sacrificed by CO2 asphyxiation.
Cell Lines. The human breast cancer cell line ZR-75−1 and human
fibroblast cell line Detroit-573 were obtained from the American
Tissue Culture Collection, ATCC (Manassas, VA, U.S.A.). The cell
lines were grown in RPMI 1640 medium (HT-474 and HaCaT) or
Dulbecco’s medium (Detroit 573) containing HEPES buffer
supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine,
100 units/mL penicillin, and 100 μg/mL streptomycin, in plastic
disposable tissue culture flasks at 37 °C in a 5%, CO2/95% air
incubator.
Chemicals. RPMI 1640 medium, Iscoves’s modified Dulbecco’s
medium, HEPES, heparine, E-Toxate, polymyxin B, and antibiotics
were obtained from Sigma Chemical Co. (St. Louis, MO, U.S.A.).
Fetal calf serum (FCS) was procured from Hyclone Laboratories
(Logan, UT, U.S.A.). Laminarine, from Laminaria digitata, was
purchased from Sigma. This is a linear β-(1 → 3)-glucan composed
of 33 glucosyl units in average. Other oligo-β-(1 → 3)-glucans were
purchased from Seikagaku (Coger SA, France).
Phagocytosis. Peritoneal macrophages were isolated from the
peritoneal cavities of mice injected 1 or 4 days previously with
oligosaccharides. The cells were diluted in RPMI-1640 medium with
5% fetal calf serum (Hyclone, Logan, UT) to 1 × 107 and incubated
with HEMA particles as described earlier.29 Phagocytosis and
differential counts were evaluated after Giemsa staining. Macrophages
with three or more HEMA particles were considered positive.
Phagocytic activity in peripheral blood cells were evaluated by the
same technique using one drop of peripheral blood obtained from the
orbital plexus and collected into heparine.
The levels of IL-1β and TNF-α in serum samples were evaluated
using a commercial kit OptEIA Mouse IL-1β or OptEIA Mouse TNF-
α Set (Pharmingen, San Diego, CA, U.S.A.), respectively, according to
the manufacturer’s instructions. The optical density was determined
using a STL ELISA reader (Tecan U.S., Research Triangle Park, NC)
at 450 nm with a correction at 570 nm. Data shown were calculated
from the standard curve prepared by the automated data reduction
using linear regression analysis. A standard curve was run with each
assay.
RNA Extraction and Reverse Transcriptase-PCR. Total RNA
was extracted from control and treated cells using Trizol reagent (Life
Technologies, Inc.). RNA quality and quantity were determined by
ultraviolet spectrophotometry and agarose gel electrophoresis. Total
RNA (200 ng) was reverse transcribed using SuperScript One-Step
RT-PCR with Platinum Taq kit (Invitrogen Inc.) using gene-specific
primers with the following conditions: 30 min at 50 °C followed by 2
min at 95 °C and then 25 cycles of 30 s at 95 °C, 45s at 52 °C for NF-
κβ2, CDC42, CDC25 and β-Actin (43 °C for CDC42), 3 min at 72 °C
for NF-κβ2 (45 s for CDC42, CDC25, BCL-2, 90 s for β-Actin). PCR
reaction was completed by 7 min at 72 °C. RT-PCR products were
then separated on a 1.0% agarose gel, visualized under UV light and
photographed. β-Actin served as internal control.
Quantitative RNA Analysis. RNA was isolated from cells using
TRIZOL Reagent (Invitrogen). The remaining DNA was removed by
digestion with DNase I (Promega), and RNA was reverse transcribed
with AMV First-Strand cDNA Synthesis Kit (Invitrogen) in the
presence of random hexamers. For quantitative Real Time-PCR (qRT-
PCR), RT2 Real-Time SYBR Green mix (SuperArray Bioscience
Corporation, Frederick, MD) and the ΔΔct method of quantification
were applied. The reference RNA was β-actin. The qRT-PCR primers
were as follows:
β-actin 5′AATGTGGCCGAGGACTTTGATTGC3′
5′TTAGGATGGCAAGGGACTTCCTGT3′
NF-κB2 5′ATGAGAATGGATGGCAGGCCTTTG3′
5′CTCGCTTGCGTTTCAGTTGCAGAA3′
PKC 5′TTTCGGAGTAATCCTGCCTGGGAA3′
5′AGGGAGGCACTGGTGGAACTTAAA3′
CDC25 5′TCAGGTGCTGTCCATGGGAAAGAT3′
5′AACTCAACAGACTGGGCTCTTCCA3′
CDC42 5′AAGCCTATCACTCCAGAGACTGCT3′
5′GGGCAGCCAATATTGCTTCGTCAA3′
Semiquantitative PCR was performed for NFkB, CDC42, PKC, and
CDC25 using standard PCR primers. Quantification of the gel was
performed by densitometric analysis with ImageJ software using
standard techniques.
Statistics. Student’s t test was used to statistically analyze the data.
Biological Tests on Cancer Stem Cells. Colonosphere
cultivation: HCT15 CRC cells were grown in Dulbecco’s Modified
Eagle’s Medium (DMEM-high glucose; Gibco, Carlsbad, CA, U.S.A.)
supplemented with 10% fetal bovine serum (FBS, Gibco). For cancer
sphere culture, all cells were cultured in serum-free defined medium
medium consisting of DMEM-F12 (Gibco) with N2 Plus Supplement
(R&D, Minneapolis, MN, U.S.A.), 10 ng/mL recombinant bFGF
(PeproTech Asia, Rehovot, Israel), 10 ng/mL EGF (PeproTech Asia,
Rehovot, Israel), and 1% penicillin-streptomycin (Gibco). Medium
was changed every 3 days. Spheres formed on day 14 were used for
assays as described.31
Evaluation of IL-2 Production. Purified spleen cells (2 × 106/mL
in RPMI 1640 medium with 5% FCS) were added into wells of a 24-
well tissue culture plate. After addition of 1 μg of Concanavalin A into
positive-control wells, cells were incubated for 72 h. in a humidified
incubator (37 °C, 5% CO2). At the end point of incubation,
supernatants were collected, filtered through 0.45 μm filters, and tested
for the presence of IL-2.30 Levels of the IL-2 were measured using a
Quantikine mouse IL-2 kit (R&D Systems, Minneapolis, MN).
IL-β and TNF-α Assay. BALB/c mice were intraperitoneally
injected with 100 μg of oligosaccharides. Control mice obtained PBS
only. After different intervals, mice were sacrificed, and blood was
collected in Eppendorf tubes. Subsequently, the serum was prepared,
collected, and stored at −80 °C for no more than 1 week.
ASSOCIATED CONTENT
■
S
* Supporting Information
Supplemental 1H NMR spectra for selected compounds,
protocol for chromotography, chromatograms for selected
compounds. This material is available free of charge via the
Internet at http://pubs.acs.org.
8290
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
(11) Krosl, G.; Korbelik, M. Potentiation of photodynamic therapy
by immunotherapy: the effect of schizophylalan (SPG). Cancer Lett.
1994, 84, 43−49.
AUTHOR INFORMATION
Corresponding Authors
*E-mail: vincent.ferrieres@ensc-rennes.fr. Phone: (+33)2 23 23
80 58.
*E-mail: vaclav.vetvicka@louisville.edu. Phone: (502) 852-
1612.
■
(12) Paunesku, T.; Mittal, S.; Proctic, M.; Oryhon, J.; Korolev, S. V.;
Joachimiak, A.; Woloschak, G. E. Proliferating cell nuclear antigen
(PCNA) ringmaster of the genome. Int. J. Radiat. Biol. 2001, 77,
1007−1021.
(13) Saraswat-Ohri, S.; Vashishta, A.; Vetvicka, V.; Descroix, K.;
Notes
̀
Jamois, F.; Yvin, J.-C.; Ferrieres, V. Biological properties of (1→3)-β-
The authors declare no competing financial interest.
D-glucan-based synthetic oligosaccharides. J. Med. Food 2011, 14,
369−376.
ACKNOWLEDGMENTS
■
(14) Vetvicka, V.; Saraswat-Ohri, S.; Vashishta, A.; Descroix, K.;
B.S. is grateful to the Reg
thank La Ligue Contre le Cancer and Canceropole Grand
Ouest (Axis Marine Products in Cancerology and MabImpact
́
ion Bretagne for a grant. Authors
̀
Jamois, F.; Yvin, J.-C.; Ferrieres, V. New 4-deoxy-(1→3)-β-D-glucan-
based oligosaccharides and their immunostimulating potential.
Carbohydr. Res. 2011, 346, 2213−2221.
̌ ̌
(15) Descroix, K.; Vetvicka, V.; Laurent, I.; Jamois, F.; Yvin, J.-C.;
network) for financial supports. J. P. Gueg
Superieure de Chimie de Rennes) and Arnanud Bondon
(Universite de Rennes 1) are sincerely acknowledged for
́
an (Ecole Nationale
Ferrier
lating agents. Bioorg. Med. Chem. 2010, 18, 348−357.
(16) Jamois, F.; Ferrieres, V.; Guegan, J.-P.; Yvin, J.-C.; Plusquellec,
̀
es, V. New oligo-β-(1→3)-glucan derivatives as immunostimu-
́
́
̀
́
helpful assistance in recording NMR data. We are most grateful
to the PRISM core facility (Biogenouest, UMS Biosit,
D.; Vetvicka, V. Glucan-like synthetic oligosaccharides: Iterative
synthesis of linear oligo-β-(1→3)-glucans and immunostimulatory
effects. Glycobiology 2005, 15, 393−407.
́
Universite de Rennes 1, Campus de Villejean, 35043 RENNES
Cedex, FRANCE) for its technical support.
(17) Pachamuthu, K.; Schmidt, R. R. Synthetic routes to
thiooligosaccharides and thioglycopeptides. Chem. Rev. 2006, 106,
160−187.
ABBREVIATIONS USED
■
(18) Witczak, Z. J. Thio sugars: Biological relevance as potential new
therapeutics. Curr. Med. Chem. 1999, 6, 165−178.
(19) Contour-Galcera, M.-O.; Guillot, J.-M.; Ortiz-Mellet, C.;
Pflieger-Carrara, F.; Defaye, J.; Gelas, J. Synthesis of sulfur-linked
analogues of nigerose, laminarabiose, laminaratriose, gentiobiose,
gentiotriose, and laminaran trisaccharide Y. Carbohydr. Res. 1996,
281, 99−118.
(20) Novak, M.; Vetvicka, V. β-Glucans as biological response
modifiers. Endocr., Metab. Immune Disord.: Drug Targets 2009, 9, 67−
95.
(21) Lin, R.; Bagrodia, S.; Cerione, R.; Manor, D. A novel Cdc42Hs
mutant induces cellular transformation. Curr. Biol. 1997, 7, 794−797.
(22) Pan, Y.; Bi, F.; Liu, N.; Xue, Y.; Yao, X.; Zheng, Y.; Fan, D.
Expression of seven main Rho family members in gastric. Biochem.
Biophys. Res. Commun. 2004, 315, 686−691.
(23) Tam, W. L.; Lu, H.; Buikhuisen, J.; Soh, B. S.; Lim, E.; Reinhard,
F.; Wu, Z. J.; Krall, J. A.; Beirie, B.; Guo, W.; Chen, X.; Liu, X. S.;
Brown, M.; Lim, B.; Weinberg, R. A. Protein kinase C a is a central
signaling node and therapeutic target for breast cancer stem cells.
Cancer Cell 2013, 24, 347−364.
(24) Kristjansdottir, K.; Rudolph, J. Cdc25 phosphatases and cancer.
Chem. Biol. 2004, 11, 1043−1051.
(25) Lou, Z.; Meng, R. G.; Zhang, W.; Yu, E. D.; Fu, C. G.
Preoperative carcinoembryonic antibody is predictive of distant
metastasis in pathologically T1 colorectal cancer after radical surgery.
World J. Gastroenterol. 2013, 19, 389−393.
(26) Ben-Porath, I.; Thomson, M. W.; Carey, V. J.; Ge, R.; Bell, G.
W.; Regev, A.; Weinberg, R. A. An embryonic stem cell-like gene
expression signature in poorly differentiated aggressive human tumors.
Nat. Genet. 2008, 40, 499−507.
(27) Dallas, N. A.; Xia, L.; Fan, F.; Gray, M. J.; Gaur, P.; van Buren,
G.; Samuel, S.; Kim, M. P.; Lim, S. J.; Ellis, L. M. Chemoresistant
colorectal cancer cells, the cancer stem cell phenotype, and increased
sensitivity to insulin-like growth factor-I receptor inhibition. Cancer
Res. 2009, 69, 1951−1957.
(28) Moreau, V.; Viladot, J.-L.; Samain, E.; Planas, A.; Driguez, H.
Design and chemoenzymatic synthesis of thiooligosaccharide inhib-
itors of (1→3):(1→4)-β-glucanases. Bioorg. Med. Chem. 1996, 4,
1849−1855.
Ac, acetyl; calcd, calculated; equiv, equivalent; ESI, electrospray
ionization mass spectrometry; Et, ethyl; h, hours; HRMS, high-
resolution mass spectrometry; min, minutes; NMR, nuclear
magnetic resonance; RT, room temperature; TFA, trifluoro-
acetic acid; TLC, thin-layer chromatography
REFERENCES
■
(1) Brown, G. D.; Gordon, S. Fungal β-glucans and mammalian
immunity. Immunity 2003, 19, 311−315.
(2) Chan, G. C.-F.; Chan, W. K.; Sze, D. M.-Y. The effects of β-
glucan on human immune and cancer cells. J. Hematol. Oncol. 2009, 2,
doi:10.1186/1756-8722-2-25.
(3) Jozefowski, S.; Yang, Z.; Marcinkiewicz, J.; Kobzik, L. Scavenger
receptors and β-glucan receptors participate in the recognition of
yeasts by murine macrophages. Inflamm. Res. 2012, 61, 113−126.
(4) Sylla, B.; Gueg
Chauvin, C.; Daniellou, R.; Ferrier
́
an, J.-P.; Wieruszeski, J.-M.; Legentil, L.; Nugier-
es, V. Probing β-(1→3)-D-glucans
̀
interactions with recombinant human receptors using high resolution
NMR studies. Carbohydr. Res. 2011, 346, 1490−1494.
(5) Tanaka, H.; Kawai, T.; Adachi, Y.; Hanashima, S.; Yamaguchi, Y.;
Ohno, N.; Takahashi, T. Synthesis of β-(1→3) oligoglucans exhibiting
a Dectin-1 binding affinity and their biological evaluation. Bioorg. Med.
Chem. 2012, 20, 3898−3914.
(6) Ina, K.; Furutam, R.; Kataoka, T.; Kayakawa, S.; Yoshida, T.;
Miwa, T.; Yamamura, Y.; Takeuchi, Y. Lentinan prolonged survival in
patients with gastric cancer receiving S-1-based chemotherapy. World J.
Clin. Oncol. 2011, 2, 339−343.
(7) Fujimoto, S. Clinical efficacies of schizophyllan (SPG) on
advanced gastric cancer. Nippon Geka Gakkai Zasshi 1989, 90, 1447−
1450.
(8) Descroix, K.; Ferrieres, V.; Jamois, F.; Yvin, J.-C.; Plusquellec, D.
̀
Recent progress in the field of β-(1→3)-glucans and new applications.
Mini-Rev. Med. Chem. 2006, 6, 1341−1349.
(9) Xiang, D.; Sharma, V. R.; Freter, C. E.; Yan, J. Anti-tumor
monoclonal antibodies in conjunction with β-glucans: A novel anti-
cancer immunotherapy. Curr. Med. Chem. 2012, 19, 4298−4305.
(10) Okamura, K.; Suzuki, M.; Yajima, A.; Chihara, T.; Fujiwara, A.;
Fukuda, T.; Goto, S.; Ichinohe, K.; Jimi, S.; Kasamatsu, T.; Kawai, N.;
Mizuguchi, K.; Mori, S.; Nakano, H.; Noda, K.; Sekiba, K.; Suzuki, K.;
Suzuki, T.; Takahashi, K.; Takeuchi, K.; Takeuchi, S.; Ogawa, N.
Clinical evaluation of schizophyllan combined with irradiation in
patients with cervical cancer: A randomized controlled study. Cancer
1986, 58, 865−872.
(29) Vetvicka, V.; Dvorak, M.; Vetvickova, J.; Richter, J.; Krizan, J.;
Sima, P.; Yvin, J. C. Orally-administered marine β-(1→3)-glucan
Phycarine stimulates both humoral and cellular immunity. Int. J. Biol.
Macromol. 2007, 40, 291−298.
8291
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry
Article
(30) Vetvicka, V.; Terayama, K.; Mandeville, R.; Brousseau, P.;
Kournikakis, B.; Ostroff, G. Pilot study: orally administered yeast β-
(1→3)-glucan prophylactically protects against anthrax infection and
cancer in mice. JANA 2002, 5, 1−5.
(31) Hwang, W.-L.; Yang, M.-H.; Tsai, M.-L.; Lan, H.-Y.; Su, S.-H.;
Chang, S.-C.; Teng, H.-W.; Yang, S.-H.; Lan, Y.-T.; Chiou, S.-H.;
Wang, H.-W. SNAIL regulates interleukin-8 expression, stem cell-like
activity, and tumorigenicity of human colorectal carcinoma cells.
Gastroenterology 2011, 141, 279−291.
8292
dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292