Synthesis and properties of oligonucleotides involving a perylene unit linked to a 2′-deoxyribose residue

Article abstract of DOI:10.1081/NCN-120022841

We report here the synthesis and binding properties of oligonucleotides involving a perylene unit linked to the anomeric position of a 2′-deoxyribose residue. Both anomers were separated and incorporated separately at either the 5′-end or the internal position of a pyrimidine sequence. In any case the presence of the perylene unit stabilizes the complexes formed with either the single or the double-stranded target.

Full text of DOI:10.1081/NCN-120022841

This article was downloaded by: [Universitat Politècnica de València]
On: 14 October 2014, At: 04:48
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK
Nucleosides, Nucleotides and Nucleic Acids
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/lncn20
Synthesis and Properties of Oligonucleotides Involving
a Perylene Unit Linked to a 2′-Deoxyribose Residue
Yves Aubert a & Ulysse Asseline a b
a Centre de Biophysique Moléculaire , UPR 4301 CNRS affiliated with the University of
Orléans and with INSERM , Orléans Cedex, France
b Centre de Biophysique Moléculaire , UPR 4301 CNRS affiliated with the University of
Orléans and with INSERM, Rue Charles Sadron , F-45071, Orléans Cedex 02, France
Published online: 31 Aug 2006.
To cite this article: Yves Aubert & Ulysse Asseline (2003) Synthesis and Properties of Oligonucleotides Involving a Perylene
Unit Linked to a 2′-Deoxyribose Residue, Nucleosides, Nucleotides and Nucleic Acids, 22:5-8, 1223-1225, DOI: 10.1081/
NCN-120022841
To link to this article: http://dx.doi.org/10.1081/NCN-120022841
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the
Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and
are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and
should be independently verified with primary sources of information. Taylor and Francis shall not be liable for
any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of
the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions

NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS
Vol. 22, Nos. 5–8, pp. 1223–1225, 2003
Synthesis and Properties of Oligonucleotides Involving a
Perylene Unit Linked to a 20-Deoxyribose Residue
*
Yves Aubert and Ulysse Asseline
´
Centre de Biophysique Moleculaire, UPR 4301 CNRS affiliated with the
´
University of Orleans and with INSERM, Orleans Cedex, France
´
ABSTRACT
We report here the synthesis and binding properties of oligonucleotides involving
a perylene unit linked to the anomeric position of a 20-deoxyribose residue. Both
anomers were separated and incorporated separately at either the 50-end or the
internal position of a pyrimidine sequence. In any case the presence of the pery-
lene unit stabilizes the complexes formed with either the single or the double-
stranded target.
Key Words: Oligonucleotide-perylene conjugates; Perylene-20-deoxyribose unit;
Synthesis; Binding properties.
Modifications developed to increase the affinity of ‘‘antisense’’ and ‘‘antigene’’
oligonucleotides for their targets include the covalent coupling of intercalating
agents. We have previously reported that a perylene derivative involving five fused
rings linked to the 50- or the 30-end of a pyrimidine decamer stabilizes duplex and
triplex structures.[1] In order to further explore the possibility of increasing the
stability of the triplex and duplex structures we decided to incorporate the perylene
´
*Correspondence: Ulysse Asseline, Centre de Biophysique Moleculaire, UPR 4301 CNRS
affiliated with the University of Orleans and with INSERM, Rue Charles Sadron, F-45071
´
´
Orleans Cedex 02, France; Fax: +33 2 3863 1517; E-mail: asseline@cnrs-orleans.fr.
1223
DOI: 10.1081/NCN-120022841
Copyright # 2003 by Marcel Dekker, Inc.
1525-7770 (Print); 1532-2335 (Online)
www.dekker.com

1224
Aubert and Asseline
residue at the internal position of the oligonucleotide sequence. The covalent
attachment of a ligand to an internucleotidic phosphate induces the formation of
two stereoisomers with different properties. Following this method, linking the
ligand to any position of the sequence requires the preparation of sixteen pairs of
dinucleosides and the separation of the isomers before their incorporation inside
the sequence. In order to reduce the chemical work, we used another strategy based
on the linkage of the perylene moiety to the anomeric position of a 20-deoxyribose
residue.
The synthesis of the sugar-perylene unit was achieved as follows: first, the
perylene was monobrominated by reaction with N-bromosuccinimide,[2,3] then a
Sonogashira[4] reaction between the brominated perylene and propargyl alcohol gave
the perylene with a hydroxylated linker. The latter was then glycosylated by reaction
with 20-deoxy-3,5-di-O-(4-toluoyl)-a-D-erythro-pentofuranosyl chloride to give the
perylene sugar unit as the anomer mixture. The a- and b-anomers were separated
by chromatography and after removal of the p–toluoyl groups and dimethoxytrityla-
tion of the 50-hydroxyl function they were transformed into their H-phosphonate
derivatives by using the 2-chloro-5,6 benzo 1,3,2-dioxaphosphorin-4-one.[5] Monoin-
corporation of each anomer was then performed at either the 50-end or internal posi-
tion of a pyrimidine sequence (Fig. 1). The chain assembly was carried out at a
1 mmole scale and the perylene-sugar unit was incorporated manually. After the
chain assembly (trityl-off mode), deprotection was performed by treatment of the
modified oligonucleotides bound to the support with concentrated NH4OH solution
overnight at room temperature. After removal of the ammonia, extraction of the
organic impurities and filtration the crude modified oligonucleotides were analyzed
and purified by reversed-phase chromatography and characterized by electrospray
mass spectrometry.
The binding properties of the modified oligonucleotides 0 with the double-
0
0
stranded DNA target 5 TAGTTTCTCTTCTTTTTCTTCTCTT3=3 ATCAAAGAG-
0
AAGAAAAAGAAGAGAA5 (circularized by using two hexaethylene linkers[6] in
order to increase its stability) and the single-stranded complementary DNA target
Figure 1. Structures of the modified oligonucleotides.

Oligonucleotides with Perylene Unit
1225
0
0
5 CTCAGAGAAGAAAAAGAACTC3 were studied by absorption spectroscopy.
Molar extinction coefficients of the oligonucleotide-perylene conjugates 1, 2, 3 and
4 were determined by titration of conjugate solutions at 3ꢀC with a solution of the
single-stranded complementary sequence. Molar extinction coefficients of the targets
0
0
and unmodified oligonucleotide 5 TTCTTTTTCTTCTCT3 used as reference were
determined according to the literature.[7] In the case of the triplexes, the experiments
were performed with a 1 mM concentration in the circularized double-stranded target
and a 1.5 mM concentration in the third oligonucleotide in a 10 mM cacodylate buf-
fer, pH 7, containing 140 mM KCl and 5 mM MgCl2. In the case of the duplexes, a
1 mM concentration in oligonucleotides (each strand) was used in a 10 mM sodium
cacodylate buffer, pH 7, containing 100 mM NaCl. Duplex and triplex stabilities
were determined by thermal denaturation. One transition was observed in the melt-
ing profile of each duplex while two transitions were observed in the melting of each
triplex. The transition with the higher Tm corresponds to the melting of the target
duplex (around 77ꢀC for all complexes) and the transition with the lower Tm to
the dissociation of the third strand. The stabilization observed for the duplexes
was nearly equivalent when the incorporation was performed at the internal position
(ODNs 1 and 2) or at the 50-end (ODNs 3 and 4) of the sequence and no important
difference was observed with either of the anomers (D Tm ¼ þ 6-8ꢀC). In the case of
the triplexes, the strongest stabilization was observed when the perylene unit was
attached to the 50-end of the third strand (ODNs 3 and 4) (D Tm ¼ þ 12 and
11ꢀC, respectively). When the incorporation was performed at the internal position
(ODNs 1 and 2), the stabilizing effect was weaker (D Tm ¼ þ 8ꢀC with each anomer).
REFERENCES
1. Asseline, U.; Cheng, E. Synthesis and binding properties of perylene-oligo-20-
deoxyribonucleotides conjugates. Tetrahedron Lett. 2001, 42, 9005–9010.
2. Mitchell, R.H.; Lai, Y.-H.; Williams, R.V. N-Bromosuccinimide-dimethyl-
formamide: a mild, selective nuclear monobromination reagent for reactive
aromatic compounds. J. Org. Chem. 1979, 44, 4733–4735.
`
`
3. Lapouyade, R.; Pereyre, J.; Garrigues, P.C. Synthese organique. Synthese des
trois regioisomeres des pyrene et perylene monosubstitues. R. Acad. Sc. Paris.
´
`
`
´
`
´
1986, 303, [Series II, 10], 903–906.
4. Schlichting, P.; Rhor, U.; Mullen, K. New synthetic routes to alkyl-substituted
¨
and functionalized perylenes. Liebigs Ann.=Recueil 1997, 395–407.
5. Marugg, J.E.; Tromp, M.; Kuyl-Yeheskiely, E.; van der Marel, G.A.; van Boom,
J.H. A convenient and general approach to the synthesis of properly protected
d-nucleoside-30-hydrogenphoshonates via phosphite intermediates. Tetrahedron
Lett. 1986, 27, 2661–2664.
6. Rumney, S.; Kool, E.T. Structural optimization of non-nucleotide loop replace-
ments for duplex and triplex DNAs. J. Am. Chem. Soc. 1995, 117, 5635–5646.
7. Cantor, C.R.; Warshaw, M.M.; Shapiro, H. Oligonucleotide interactions. III.
Circular dichroism studies of the conformation of deoxyoligonucleotides. Biopo-
lymers 1970, 9, 1059–1077.