Enzymatic formation of a resorcylic acid by creating a structure-guided single-point mutation in stilbene synthase

Article abstract of DOI:10.1002/pro.2600

A novel C17 resorcylic acid was synthesized by a structure-guided Vitis vinifera stilbene synthase (STS) mutant, in which threonine 197 was replaced with glycine (T197G). Altering the architecture of the coumaroyl binding and cyclization pocket of the enzyme led to the attachment of an extra acetyl unit, derived from malonyl-CoA, to p-coumaroyl-CoA. The resulting novel pentaketide can be produced strictly by STS-like enzymes and not by Chalcone synthase-like type III polyketide synthases; due to the unique thioesterase like activity of STS-like enzymes. We utilized a liquid chromatography mass spectrometry-based data analysis approach to directly compare the reaction products of the mutant and wild type STS. The findings suggest an easy to employ platform for precursor-directed biosynthesis and identification of unnatural polyketides by structure-guided mutation of STS-like enzymes.

Full text of DOI:10.1002/pro.2600

Article
Protein Science
DOI 10.1002/pro.2600
Enzymatic formation of a resorcylic acid by creating a
structure-guided single-point mutation in stilbene
synthase
Ŧ
¶
¶
Ŧ
Ŧ, ¶, ‡, §,*
Namita Bhan , Lingyun Li , Chao Cai , Peng Xu , Robert J. Linhardt
, Mattheos
Ŧ, ‡*
A.G. Koffas
Ŧ
Department of Chemical and Biological Engineering, Rensselaer Polytechnic Institute,
¶
Center for Biotechnology and Interdisciplinary Studies, Troy, NY, Department of
Chemistry and Chemical Biology, Rensselaer Polytechnic Institute, Center for
‡
Biotechnology and Interdisciplinary Studies, Troy NY, Department of Biological
Sciences, Rensselaer Polytechnic Institute, Center for Biotechnology and
§
Interdisciplinary Studies, Troy NY, Department of Biomedical Engineering, Rensselaer
Polytechnic Institute, Center for Biotechnology and Interdisciplinary Studies, Troy, NY
Running title: Novel resorcylic acid by Stilbene synthase mutant
Address correspondence to:
Robert J. Linhardt, Center for Biotechnology and Interdisciplinary Studies, Room 4005C,
Rensselaer Polytechnic Institute, 110 8th Street, Troy, NY 12180Email: linhar@rpi.edu,
Phone no.: (518)ꢀ276ꢀ3404, FAX: (518)ꢀ276ꢀ3405
Mattheos Koffas, Center for Biotechnology and Interdisciplinary Studies, Room 4005D,
Rensselaer Polytechnic Institute, 110 8th Street, Troy, NY 12180Email: koffam@rpi.edu,,
Phone no.: (518)ꢀ276ꢀ2220, FAX: (518)ꢀ276ꢀ3405
This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process which may lead to
differences between this version and the Version of Record. Please cite this article as
doi: 10.1002/pro.2600
©
2014 The Protein Society
Received: Oct 06, 2014; Revised: Nov 01, 2014; Accepted: Nov 04, 2014
This article is protected by copyright. All rights reserved.

Protein Science
Page 2 of 34
Total number of manuscript pages: 19
Total number of supplementary material pages: 13
Total number of figures: 5
The supplementary material contains the XCMS data, MS/MS spectrum
mentioned in the manuscript, proof of instability of 3.
Names of the files included in supplementary information: R Script 1, XCMS data,
ꢀ
ꢀ
MS/MS of m/z 313.0708 [MꢀH] , MS/MS of fragment 1, m/z 269.0819 [MꢀH] ,
ꢀ
ꢀ
MS/MS of m/z 321.0976 [MꢀH] , MS/MS of fragment 1, m/z 276.1050 [MꢀH] ,
+
MS/MS of methylated lactone of 3, m/z 357.0770 [M+H] , Proof of instability of 3,
Conversion of 3 to 5 upon heating.
2
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 3 of 34
Protein Science
Abstract
A novel C17 resorcylic acid was synthesized by a structureꢀguided Vitis vinifera
stilbene synthase (STS) mutant, in which threonine 197 was replaced with
glycine (T197G). Altering the architecture of the coumaroyl binding and
cyclization pocket of the enzyme led to the attachment of an extra acetyl unit,
derived from malonylꢀCoA, to pꢀcoumaroylꢀCoA. The resulting novel pentaketide
can be produced strictly by STSꢀlike enzymes and not by Chalcone synthaseꢀlike
type III polyketide synthases; due to the unique thioesterase like activity of STSꢀ
like enzymes. We utilized a liquid chromatography mass spectrometryꢀbased
data analysis approach to directly compare the reaction products of the mutant
and wild type STS. The findings suggest an easy to employ platform for
precursorꢀdirected biosynthesis and identification of unnatural polyketides by
structureꢀguided mutation of STSꢀlike enzymes.
Keywords: Resorcylic acid, novel nonꢀnatural polyphenols, structureꢀguided
mutants, stilbene synthase, type III polyketides synthases
Impact of the work: In this work, we were able to generate a novel resorcylic
acid by carrying out structureꢀguided mutation of stilbene synthase. We also
show the utilization of online XCMS analysis for quick identification of novel
compounds formed by such in vitro enzymatic reactions.
3
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 4 of 34
Type III polyketide synthases (PKSs) are structurally simple homodimeric (~
2 KDa each) ketosynthase enzymes found in most plants that have also been
4
1ꢀ3
more recently observed in bacteria and fungi. Like type II and many type I
PKSs, type III PKSs are iterative enzymes, however their modulating
mechanisms are much more complicated as they orchestrate acyltransfer,
decarboxylation, condensation, cyclization and aromatization reactions in two
2,4,5
catalytically relevant cavities.
They catalyze the decarboxylative Claisen
condensation of one to several molecules of extender substrate onto a starter
substrate. Three well characterized cavities, the CoA binding tunnel, the
substrate binding pocket and the cyclization pocket are present in all type III
4
PKSs. Different type III PKSs differ in their preference for starter substrate,
number of iterative condensation of extender substrates, and the mechanism of
cyclization of the polyꢀβꢀketo intermetidate formed through Claisen condensation,
aldol condensation or lactonization (Scheme 1). Thus, these enzymes are
capable of producing a wide array of compounds, such as chalcones, pyrones,
acridones, phloroglucinols, stilbenes, and resorcinolic lipids.
Stilbene synthase (STS), like chalcone synthase (CHS), catalyzes the
iterative condensation of three acetyl units, derived from malonylꢀCoA, onto pꢀ
coumaroylꢀCoA to form a tetraketide intermediate. CHS cyclizes this intermediate
through a C1ꢀC6 Claisen condensation, automatically resulting in breaking of the
thioester bond of the product to the enzyme. In contrast, STS preferentially
cyclizes the polyketide through a C2ꢀC7 aldol condensation (Scheme 1). Thus,
STS requires an extra thioesteraseꢀlike (TEꢀlike) activity to offload the product
4
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 5 of 34
Protein Science
from the enzyme. Detailed structural studies of STS indicate the presence of a
hydrogenꢀbonding network (HBN) between the threonine 132, serine 338 and
glutamic acid 192 through a water molecule; this HBN is predicted to facilitate
6
STS thioesterase activity. This HBN is sterically possible only in the case of
STSs, as the amino acid residue at position 98 is replaced by a bulkier amino
acid like methionine (as compared to a smaller residue like valine in CHS),
bringing the threonine 132 into hydrogenꢀbonding distance with serine 338 and
6
glutamic acid 192.
Bisnoryangonin (BNY) and pꢀcoumaroyltriacetic lactone (CTAL) are obtained
7
as derailment products during the reaction. Several intuitive and structureꢀbased
mutations of CHSꢀlike enzymes have been carried out to alter substrate
specificity and size of the polyketide intermediate formed to produce novel,
8,9
natural or unnatural products. Some of these novel compounds have also
10ꢀ13
shown interesting biological activities.
The coumaroyl binding pocket is composed of the following structurally important
residues: serine 133, glutamic acid 192, threonine 194, threonine 197 and serine
3
38. The unique TEꢀlike activity of STSꢀlike enzymes has not yet been fully
exploited for the biosynthesis of novel compounds. We attempted to exploit this
TEꢀlike activity of STS, with the aim of generating novel polyketides that have not
been reported before. As a proof of concept, we first created a point mutation
replacing serine 338 by valine 338 in the Vitis vinifera STS (VvSTS), and as
expected an almost complete conversion of the STS into CHS was observed. A
~7.9ꢀfold increase in naringenin (1) production (Figure 1) was noted, and a ~6.0ꢀ
5
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 6 of 34
fold decrease in resveratrol (2) production (data not shown) was seen upon
carrying out a serine to valine mutation at amino acid 338. Serine 338 is a part of
the HBN, replacing it with a hydrophobic valine 338 disrupted the HBN. Next, to
retain the TEꢀlike activity of the enzyme, we created a mutant with the HBN intact,
replacing threonine 197 with glycine. The threonine to glycine mutation at amino
acid 197 predictably results in an increase in the substrate binding pocket size.
Upon carrying out homology modeling of the VvSTS based on the previously
published Acharis hypogaea (AhSTS) crystal structure and inspecting the
cavities for the wild type and mutant we found that the mutation results in
connection of the substrate binding pocket to the cyclization pocket. In Figure 2
the residue at position 197 is shown lining the coumaroylꢀbinding pocket. The
sterically important residues lining the CoA binding tunnel and cyclization pocket
are also shown in Figure 2. The overall size of the coumaroyl binding pocket and
3
3
cyclization pocket increased from 1029.2 Å to 1134.3 Å in the mutant as
compared to the wild type.
We tested the catalytic activity of threonine to glycine 197 (T197G) with its
natural substrates, malonylꢀCoA and pꢀcoumaroylꢀCoA. We utilized online high
resolutionꢀliquid chromatography mass spectrometry (HRꢀLCMS) data
comparison analysis software, made available through XCMS, to obtain the foldꢀ
changes in production of expected products and for the identification of peaks
novel to this mutant. This software helps detect dysregulation between two or
more sample groups. Due to the complexity of LCꢀMS data sets, direct manual
comparison can be extremely cumbersome. Furthermore, minor fluctuations
6
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 7 of 34
Protein Science
between two runs can result from column degradation, temperature changes,
changes in pH, changes of the mobile phase, etc., leading to a variation in the
retention time of a compound. XCMS overcomes these nonlinear deviations and
helps align the retention times between two runs by utilizing a feature detection
algorithm, centWave, for HRꢀLCMS data sets. It collects regions of interest in the
rawꢀdata and applies continuous wavelet transformation or Gaussꢀfitting in the
14,15
chromatographic domain.
The T197G mutant showed a 2ꢀfold decrease in its ability to synthesize
resveratrol, and a 4ꢀfold increase in naringenin production. Furthermore, the
derailment products BNY and CTAL increased by 7ꢀfold and 4ꢀfold, respectively
(SI Figure 1).
ꢀ
A novel parentꢀion peak [MꢀH] at m/z 313.0708 in the LCꢀESIMS (± 5 PPM)
indicated the formation of a coumaroylꢀderived pentaketide, with the predicted
molecular composition of C H O (~2.8% yield). This peak was recorded as [Mꢀ
17
13
6
ꢀ
13
H] m/z 321.0976 (+5 PPM) when C labeled malonylꢀCoA was used, indicating
3
the presence of 8 carbons derived from the acetyl units of malonylꢀCoA, thus,
confirming the formation of a pentaketide pꢀcoumaroylꢀCoA derived molecule.
This molecule could possibly cyclize through a C2ꢀC7 aldol condensation
(resulting in compound 3) or C1ꢀC6 Claisen condensation (resulting in compound
ꢀ
4
) (Figure 3). The MS/MS spectrum of [MꢀH] m/z 313.0708 gave the fragment
ꢀ
ꢀ
m/z 269.0819, corresponding to [MꢀHꢀCO ] (SI Figure 2 and 3), and that of [MꢀH]
2
m/z 321.0976 gave the fragment m/z 276.1050, corresponding to a loss of [MꢀHꢀ
13
CO ] (SI Figure 4 & 5) This indicates the loss of a carbon derived from malonylꢀ
2
7
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 8 of 34
CoA, which is possible only for compound 3. Further comparison of the MS/MS
spectrum of the stableꢀisotope labeled novel pentaketide to the unlabeled
compound was completely consistent with the fragmentation pattern expected for
compound 3 (SI Figure 2,3,4 & 5).
We also carried out a complete methylation of the reaction mixture and
16
carried out LCꢀMS analysis of the resulting products. A peak unique to the
+
T197G reaction mixture was obtained with parentꢀion peak [M+H] at m/z
3
57.0770 (± 5 PPM) (6 SI Figure 6). This correlates to the methylated lactone of
. The fragmentation pattern corresponded to methylated lactone of 3 precisely
3
(
SI Figure 6).
We propose a possible mechanism of reaction for the production of resorcylic
2,17
acid by the T197G mutant.
There are three possible scenarios for the
cyclization of the polyketide intermediate through aldol condensation (Scheme 2).
Scenario (1) indicates occurrence of aldol condensation and aromatization before
hydrolysis, resulting in producing the resorcylic acid scaffold (Scheme 2a). If the
hydrolysis precedes the aldol condensation, two cases for synthesis of the
resorcinol scaffold are possible: the first (Scheme 2b), aldol condensation, which
does not accompany decarboxylation, and the second (Scheme 2c)
decarboxylative aldol condensation. In the second case (Scheme 2c), retention
or detachment of the carboxylic acid depends on whether or not decarboxylation
is concerted with aromatization. We observed that the T197G mutant produced
the pentaketide resorcylic acid 3 exclusively when the reaction period was
shortened. The prolonged reaction resulted in a decrease of 3, and an increase
8
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 9 of 34
Protein Science
in 5. Therefore, we conclude that the resorcinol produced by the T197G mutant
STS is a result of nonꢀenzymatic decarboxylation of 3. This was further confirmed
by heating the reaction products at 44°C, and observing that all of 3 was
converted into 5 (SI Figure 7 and 8). Due to this instability of carboxylic acids, a
18
property of that has also been discussed by Gorham et al., we were unable to
obtain purified 3 and corresponding NMR data.
Our results suggested that the rational engineering of STSꢀlike enzymes is a
promising approach for the biosynthesis of chemically and structurally divergent
nonꢀnatural polyketides. Since we can now manage to control the number of
malonylꢀCoA condensations, as well as manipulate the mechanism of the
cyclization, the next step will be to carry out reactions to generate polyketides
with desired ring systems.
In summary, this is the first demonstration of the enzymatic formation of the
nonnatural C2ꢀC7 aromatic pentaketide derived from pꢀcoumaroylꢀCoA by a
structureꢀbased rationally designed single point mutant T197G of STS. We also
13
demonstrate that the application of C labeled malonlyꢀCoA and XCMS analysis
can be used to identify small quantities of novel products being formed during the
enzymatic reactions, with only the online HRꢀLCMS data.
Experimental Section
Site-directed mutagenesis
The plasmids expressing the VvSTS mutant was constructed with a QuikChange
SiteꢀDirected Mutagenesis Kit (Stratagene), according to the manufacturer’s
protocol, using the following pairs of primers: T197G Fw: 5’ꢀ
9
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 10 of 34
GAGATCACAGTTGTTGGCTTTCGCGGCCCTTCCꢀ3’
GGAAGGGCCGCGAAAGCCAACAACTGTGATCTCꢀ3’.
and
Rv:
5’ꢀ
Protein Expression and purification
After confirmation of the sequence, the plasmid was transformed into E. coli
BL21* (De3). The cells harboring the plasmid were cultured to an OD600 of 0.6 in
ꢀ1
LB medium containing chloramphinecol (30 ꢁg mL ) at 37°C. Subsequently,
isopropylthioꢀβꢀDꢀgalactopyranoside (IPTG) (1.0 mM) was added to induce
protein expression, and the cells were further cultured at 30°C for 4 h. All of the
following procedures were performed at 4 °C. E. coli cells were harvested by
centrifugation at 4000 × g, and frozen at ꢀ80 °C until further processing. The cells
were disrupted by incubating with lysis buffer (50 mM NaH PO , 300 mM NaCl,
2
4
ꢀ1
1
0 mM imidazole, pH 8.0) and lysozyme (10 mg ml ) and culture volume of
ꢀ1
Benzonase® nuclease (3 units ml ), at 4 °C for 30 min. The lysate was then
centrifuged at 12,000 × g for 30 min. The supernatant was loaded onto a NiꢀNTA
spin column (Qiagen) equilibrated with lysis buffer. The column was then washed
with wash buffer (50 mM NaH PO , 300 mM NaCl, 20 mM imidazole, pH 8.0).
2
4
The Hisꢀtag was cleaved from the column using elution buffer (50 mM NaH PO ,
2
4
3
00 mM NaCl, 300 mM imidazole, pH 8.0). The protein concentration was
determined by the Bradford method (Protein Assay, BioꢀRad) with bovine serum
albumin as the standard.
1
0
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 11 of 34
Protein Science
Enzymatic reaction
The reaction mixture contained 4ꢀcoumaroylꢀCoA (54 ꢁM), malonylꢀCoA (108
13
ꢁ
M) or C ꢀmalonylꢀCoA (108 ꢁM) and the purified enzyme (20 ꢁg) in potassium
3
phosphate buffer (500 ꢁL, 100 mM, pH 7.0). Incubations were performed at 30°C
for 30 min and were stopped by the addition of ethyl acetate (500 ꢁL) with 1%
HCl. The products were then concentrated in a speed vacuum and reꢀsuspended
in ethyl acetate (10 ꢁL), and centrifuged at 14000 rpm for 10 min before running
on a column. The products were separated by reverseꢀphase HPLC (Agilent
1
260) on a Zorbax C18 column (4.6 × 150 mm, 5 ꢁm, at a flow rate of 0.7 mL
ꢀ1
min ). Gradient elution was performed with H O and acetonitrile (ACN), both
2
containing 0.2% trifluoroacetic acid: 0–7 min, 30% ACN; 5–17 min, linear
gradient from 30% to 60% ACN; 17–25 min, 60% ACN; 25–27 min, linear
gradient from 60% to 70% ACN. UVꢀdetection was used for calculating foldꢀ
changes in production of resveratrol and naringenin by the Wt STS in
comparison to T197G STS, using a freshly generated standard curve for
resveratrol and naringenin. All calculations were based on triplicates. Three
reactions were pooled into ethyl acetate (10 ꢁL) for LCꢀMS analysis. Online HR–
ESIꢀLCMS spectra were measured with an Agilent Technologies HPLC 1200
series HPLC coupled to a Thermo Scientific LTQ Orbitrap XLTM mass
spectrometer fitted with an electrospray ionization (ESI) source. The ESI capillary
temperature and the capillary voltage were 320°C and 4.0 V, respectively. The
tube lens offset was set at 20.0 V. All spectra were obtained in the negative and
positive mode, over a mass range of m/z 150–500, and at a range of one scan
1
1
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 12 of 34
every 0.2 s. The collision gas was helium, and the relative collision energy scale
was set at 30.0% (1.5 eV). Dependent MS/MS scans were acquired for the first
four most abundant ions.
Methylation of reaction mixture
Two enzymatic reactions (500 ꢁLꢀscale) (as previously described) were
performed in tandem, combined, and completely dried before carrying out the
methylation reaction. For complete methylation, trimethylsilyl diazomethane (50
ꢁ
L) was added to the dried sample along with ethyl ether (1 mL) and methanol
16,19
(100 ꢁL). After a period of 1 h trimethylsilyl diazomethane (50 ꢁL) was added.
The reaction was rotated at room temperature over night and dried on a speed
vacuum. The products resulting from the methylation reaction were reꢀsuspended
in methanol (10 ꢁL) and analysed by HRꢀLCMS in positive mode as previously
described. Dependent MS/MS scans were acquired for the first three most
abundant ions.
Substrates
20 13
4
ꢀCoumaroylꢀCoA was chemically synthesized as previously described.
C ꢀ
3
malonylꢀCoA, malonylꢀCoA, resveratrol and naringenin were purchased from
Sigma.
XCMS and MZmine data processing
Raw data was converted to XML format using R processor (Script S1, obtained
from
1
2
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 13 of 34
Protein Science
http://www.metabolomics.strath.ac.uk/showPage.php?page=processingscripts),
21
and analyzed using XCMS online. XCMS was utilized for calculating fold
changes in CTAL and BNY. All calculations were based on triplicates.
Homology modeling and Docking
The models of the WtVvSTS and T197GVvSTS were generated by the SWISSꢀ
MODEL package (http://expasy.ch/spdbv/) provided by the SwissꢀPDBꢀViewer
22
program based on the crystal structure of wildꢀtype STS from Acharis hypogaea
23
(
PDB code: 1Z1E). The model quality was assessed using PROCHECK . In the
Ramachandran plot calculated for the model, most of the amino acid residues
were present in the energetically allowed regions with only a few exceptions,
primarily Gly residues that can adopt phi/psi angles in all four quadrants. The
homology model created for VvSTS was uploaded onto SWISSꢀDock. The mol2
file for malonylꢀCoA was uploaded onto SWISSꢀDock in the ligand selection tab.
The mol2 file for malonylꢀCoA was generated using UCSF Chimera, the .sdf file
for malonylꢀCoA obtained from PDB (PDB code: MLC) was opened using UCSF
Chimera, and the hydrogen atoms were added using Tools/Structure
Editing/AddH menu, and the file was then saved in the mol2 format. The best
predicted malonylꢀCoA docking model, based on energy minimization and the
previously published structure of chalcone synthase complexed with malonylꢀ
CoA structure (PDB code: 1CML) was then used to generate Figure 2. The cavity
24
volume was calculated by the program CASTP (http://cast.engr.uic.edu/cast/) .
All protein structure figures were prepared with PYMOL (DeLano Scientific,
http://www.pymol.org).
1
3
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 14 of 34
Supplementary Material
The supplementary material contains the XCMS data, naringenin production by
the mutant, MS/MS spectrum mentioned in the manuscript, proof of instability of
3
.
Names of the files included in supplementary information: R Script 1, Naringenin
ꢀ
production by S338VVvSTS, XCMS data, MS/MS of m/z 313.0708 [MꢀH] ,
ꢀ
ꢀ
MS/MS of fragment 1, m/z 269.0819 [MꢀH] , MS/MS of m/z 321.0976 [MꢀH] ,
ꢀ
MS/MS of fragment 1, m/z 276.1050 [MꢀH] , MS/MS of methylated lactone of 3,
+
m/z 357.0770 [M+H] , Proof of instability of 3, Conversion of 3 to 5 upon heating.
Acknowledgements
The authors would like to acknowledge the guidance of Dr. Dmitri Zagorevski for
help with LCꢀMS analysis. The authors acknowledge no conflict of interest.
Keywords: novel resorcylic acid • stilbene synthase • biocatalysis • type III
polyketide synthases • XCMS analysis
References
1
2
.
.
Funa N, Ohnishi Y, Fujii I, Shibuya M, Ebizuka Y, Horinouchi S (1999) A
new pathway for polyketide synthesis in microorganisms. Nature 400:897ꢀ
8
99.
Katsuyama Y, Ohnishi Y (2012) Type III polyketide synthases in
microorganisms. In: Hopwood DA, editor. Natural Product Biosynthesis by
Microorganisms and Plant, Pt A. Volume 515, Methods in Enzymology.
San Diego: Elsevier Academic Press Inc 359ꢀ377.
3
.
Yu DY, Xu FC, Zeng J, Zhan JX (2003) Type III polyketide synthases in
natural product biosynthesis. Iubmb Life 64:285ꢀ295.
1
4
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 15 of 34
Protein Science
4
5
6
.
.
.
Austin MB, Noel AJP (2003) The chalcone synthase superfamily of type III
polyketide synthases. Nat Prod Rep 20:79ꢀ110.
Abe I (2012) Novel applications of plant polyketide synthases. Curr Opin
Chem Biol 16:179ꢀ185.
Austin MB, Bowman ME, Ferrer JL, Schroder J, Noel JP (2004) An aldol
switch discovered in stilbene synthases mediates cyclization specificity of
type III polyketide synthases. Chem Biol 11:1179ꢀ1194.
7
.
Hrazdina G, Kreuzaler F, Hahlbrock K, Grisebach H (1976) Substrate
specificity of flavanone synthase from cell suspension cultures of parsley
and structure of release products in vitro. Arch Biochem Biophys 175:392ꢀ
3
99.
8
9
1
.
Abe I (2008) Engineering of plant polyketide biosynthesis. Chem Pharm
Bull 56:1505ꢀ1514.
.
Abe I (2009) Engineered biosynthesis of plant polyketides: Structureꢀ
based and precursorꢀdirected approach. Top Curr Chem 297:45ꢀ66.
Morita H, Yamashita M, Shi SꢀP, Wakimoto T, Kondo S, Kato R, Sugio S,
Kohno T, Abe I (2011) Synthesis of unnatural alkaloid scaffolds by
exploiting plant polyketide synthase. Proc Natl Acad Sci USA 108:13504ꢀ
0.
1
3509.
1
1.
Chemler JA, Lim CG, Daiss JL, Koffas MA (2010) A versatile microbial
system for biosynthesis of novel polyphenols with altered estrogen
receptor binding activity. Chem Biol 17:392ꢀ401.
1
1
2.
3.
Chemler JA, Koffas MAG (2008) Metabolic engineering for plant natural
product biosynthesis in microbes. Curr Opin Biotech 19:597ꢀ605.
Bhan N, Mora Pale M, Masuko S, James P, Wood J, McCallum S,
Linhardt R.J., Dordick J.S., Koffas M.A.G. Antimicrobial mechanism of
resveratrolꢀtransꢀdihydrodimer produced from peroxidaseꢀmediated
oligomerization of resveratrol. (Submitted).
1
1
4.
5.
Tautenhahn R, Bottcher C, Neumann S (2008) Highly sensitive feature
detection for high resolution LC/MS. Bmc Bioinform 9:504.
Smith CA, Want EJ, O'Maille G, Abagyan R, Siuzdak G (2006) XCMS:
Processing mass spectrometry data for metabolite profiling using
Nonlinear peak alignment, matching, and identification. Anal Chem
7
8:779ꢀ787.
1
1
6.
7.
Eckermann C, Schroder G, Eckermann S, Strack D, Schmidt E, Schneider
B, Schroder J (2003) Stilbenecarboxylate biosynthesis: a new function in
the family of chalcone synthaseꢀrelated proteins. Phytochem 62:271ꢀ286.
Funa N, Awakawa T, Horinouchi S (2007) Pentaketide resorcylic acid
synthesis by type III polyketide synthase from Neurospora crassa. J Biol
Chem 282:14476ꢀ14481.
1
1
8.
9.
J Gorham, The stilbenoids. Harbome JB ST, Reinhold L, editor. Oxford:
Pergamon Press; 1980.
Hirano K, Sakai S, Ishikawa T, Avci FY, Linhardt RJ, Toida T (2005)
Preparation of the methyl ester of hyaluronan and its enzymatic
degradation. Carb Res 340:2297ꢀ2304.
1
5
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 16 of 34
2
2
0.
1.
Stockigt J, Zenk MH (1975) Chemical syntheses and properties of
hydroxycinnamoyl coenzyme A derivative. Z Naturforschung 30:352ꢀ358.
Tautenhahn R, Patti GJ, Rinehart D, Siuzdak G (2012) XCMS online: A
webꢀbased platform to process untargeted metabolomic data. Anal Chem
8
4:5035ꢀ5039.
2
2
2
2.
3.
4.
Guex N, Peitsch MC (1997) SWISSꢀMODEL and the SwissꢀPdbViewer:
An environment for comparative protein modeling. Electrophoresis
1
8:2714ꢀ2723.
Liang J, Edelsbrunner H, Woodward C (1998) Anatomy of protein pockets
and cavities: Measurement of binding site geometry and implications for
ligand design. Protein Sci 7:1884ꢀ1897.
Liang J, Woodward C (2014) Anatomy of protein pockets and cavities:
Measurement of binding site geometry and implications for ligand design.
<http://cast.engr.uic.edu/cast/%3E. Accessed 2014 July 25th, 2014.
1
6
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 17 of 34
Protein Science
Figure and scheme legends
Figure 1. Naringenin production by WtVvSTS and the single point mutant
S338VVvSTS.
Figure 2. Stereo view of malonylꢀCoA bound to VvSTS. The sterically important
residues from the (1) CoA binding pocket (Lys 55, Arg 58 and Lys 62) are shown
in purple; (2) Coumaroyl binding pocket (Ser 133, Glu 192, Thr 194, Thr 197 and
Ser 338) are shown in blue; (3) Cyclization pocket (Thr 132, Met 137, Phe 215,
Ile 254, Glu 256, Phe 265 and Pro 375) are shown in brown. MalonylꢀCoA is
labeled as MLC 390.
Figure 3. Possible structures formed by 4 molecules of malonylꢀCoA and one
molecule of pꢀcoumaroylꢀCoA. Compound 3 is a resorcylic acid derivative.
Compound 4 is a phlorophenone derivative.
Scheme 1. Proposed mechanism for the formation of bisnoryangonin (BNY), pꢀ
coumaroyltriacetic acid lactone (CTAL) naringenin chalcone and resveratrol from
pꢀcoumaroylꢀCoA and malonylꢀCoA.
Scheme 2: Possible scenarios for mechanism of formation of recorcylic acid: (a)
Hydrolysis of the thioester takes place after aldol condensation and aromatization,
and therefore the carboxyl group remains. (b) Resorcinol synthesis by hydrolysis
followed by decarboxylative aldol condensation and aromatization. (c)
Synchronous synthesis of alkylresorcylic acid and resorcinol by hydrolysis
followed by aldol condensation and aromatization.
1
7
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 18 of 34
196x125mm (300 x 300 DPI)
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 19 of 34
Protein Science
323x131mm (72 x 72 DPI)
John Wiley & Sons
This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

Page 23 of 34
Protein Science
Supplementary information for
Enzymatic formation of resorcylic acid by creating a
structure guided single point mutation in stilbene
synthase
[
a]
[b]
Namita Bhan , Lingyun Li , Chao Cai , Peng Xu , Robert J. Linhardt
[b]
[a]
[a,b]
and Mattheos
[a]
A. G. Koffas*
Ŧ Department of Chemical and Biological Engineering, Rensselaer Polytechnic Institute, Center for
Biotechnology and Interdisciplinary Studies, Troy, NY, ¶ Department of Chemistry and Chemical
Biology, Rensselaer Polytechnic Institute, Center for Biotechnology and Interdisciplinary Studies,
Troy NY, ‡ Department of Biological Sciences, Rensselaer Polytechnic Institute, Center for
Biotechnology and Interdisciplinary Studies, Troy NY, § Department of Biomedical Engineering,
Rensselaer Polytechnic Institute, Center for Biotechnology and Interdisciplinary Studies, Troy, NY
Running title: Novel resorcylic acid by stilbene synthase mutant
Address correspondence to:
Mattheos Koffas,
Career Development Associate Professor
Center for Biotechnology and Interdisciplinary Studies, Room 4005D
Rensselaer Polytechnic Institute
1
10 8th Street
Troy, NY 12180Email: koffam@rpi.edu, Phone no.: (518)-276-2220
FAX: (518)-276-3405
S1
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 24 of 34
Table of Contents
R Script 1………………………………………………………………………...S3
Figure 1: XCMS data…………………………….……………………..…...….S4
-
Figure 2: MS/MS of m/z 313.0708 [M-H] ……………………………………..S5
-
Figure 3: MS/MS of fragment 1, m/z 269.0819 [M-H] …..………………...…S6
-
Figure 4: MS/MS of m/z 321.0976 [M-H] ……………………………………..S7
-
Figure 5: MS/MS of fragment 1, m/z 276.1050 [M-H] …..……...……...….....S8
+
Figure 6: MS/MS of methylated lactone of 3, m/z 357.0770 [M+H] .………..S9
Figure 7: Proof of instability of 3…………..……………….…….…………..S10
Figure 8: Conversion of 3 to 5 upon heating……………….…….…………..S11
References………………………………………………………………………S12
S2
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 25 of 34
Protein Science
R Script 1
setwd("c:/rprocessing/rawdata") msconvert <- c("C:/pwiz/msconvert.exe")
FILES <- list.files(recursive=TRUE, full.names=TRUE, pattern="\\.raw")
show(FILES) for (i in 1:length(FILES))
{system (paste(msconvert," --mzXML --filter \"peakPicking true 1\" --filter \"polarity positive\" -
o C:/rprocessing/converted/posmzxmlfiles -v",FILES[i]))} for (i in 1:length(FILES))
{system (paste(msconvert," --mzXML --filter \"peakPicking true 1\" --filter \"polarity negative\" -
o C:/rprocessing/converted/negmzxmlfiles -v",FILES[i]))}
Script S1: R script for converting data obtained in positive and negative mode LC-MS raw data
into .XML format.
S3
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 26 of 34
XCMS data
Figure S1: Comparison of extracted ion chromatograms (EIC) of products formed by T197G
mutant (red) to wild-type VvSTS (black). (a) EIC of resveratrol (b) EIC of naringenin (c) EIC of
-
BNY (d) EIC of CTAL (e) EIC of m/z 313.0708 [M-H] .
S4
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 27 of 34
Protein Science
-
MS/MS Spectrum of m/z 313.0708 [M-H]
-
Figure S2: MS/MS of m/z 313.0708 [M-H] . Fragments 1, 2, 3, 4 and 5 can be successfully
correlated with compound 3.
S5
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 28 of 34
MS/MS of fragment 1, m/z 269.0819 [M-H]-
-
Figure S3: MS/MS of m/z 269.0819 [M-H] . MS/MS of the first transition of m/z 313.0708 can
be successfully correlated with compound 3.
S6
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Page 29 of 34
Protein Science
-
MS/MS Spectrum of m/z 321.0976 [M-H]
-
13
Figure S4: MS/MS of m/z 321.0976 [M-H] (using C -malonyl-CoA) corresponding to m/z
3
3
13.0708 (using unlabeled malonyl-CoA). Fragments 1, 2, 3, 4 and 5 can be successfully
correlated with compound 3.
S7
John Wiley & Sons
This article is protected by copyright. All rights reserved.

Protein Science
Page 30 of 34
MS/MS of fragment 1, m/z 276.1050 [M-H]-
-
Figure S5: MS/MS of m/z 276.1050 [M-H] . MS/MS of the first transition of m/z 321.0976 can
be successfully correlated with compound 3.
S8
John Wiley & Sons
This article is protected by copyright. All rights reserved.