A fluorescent assay suitable for inhibitor screening and vanin tissue quantification

Article abstract of DOI:10.1016/j.ab.2009.12.010

Vanin-1 is a pantetheinase that catalyzes the hydrolysis of pantetheine to produce pantothenic acid (vitamin B5) and cysteamine. Reported here is a highly sensitive fluorescent assay using a novel fluorescently labeled pantothenate derivative. The assay has been used for characterization of a soluble version of human vanin-1 recombinant protein, identification and characterization of hits from high-throughput screening (HTS), and quantification of vanin pantothenase activity in cell lines and tissues. Under optimized assay conditions, we quantified vanin pantothenase activity in tissue lysate and found low activity in lung and liver but high activity in kidney. We demonstrated that the purified recombinant vanin-1 consisting of the extracellular portion without the glycosylphosphatidylinositol (GPI) linker was highly active with an apparent K_m of 28 μM for pantothenate-7-amino-4-methylcoumarin (pantothenate-AMC), which was converted to pantothenic acid and AMC based on liquid chromatography-mass spectrometry (LC-MS) analysis. The assay also performed well in a 384-well microplate format under initial rate conditions (10% conversion) with a signal-to-background ratio (S/B) of 7 and a Z factor of 0.75. Preliminary screening of a library of 1280 pharmaceutically active compounds identified inhibitors with novel chemical scaffolds. This assay will be a powerful tool for target validation and drug lead identification and characterization.

Full text of DOI:10.1016/j.ab.2009.12.010

Analytical Biochemistry 399 (2010) 284–292
Contents lists available at ScienceDirect
Analytical Biochemistry
journal homepage: www.elsevier.com/locate/yabio
A fluorescent assay suitable for inhibitor screening and vanin tissue quantification
b
a
a
a
a
b
Benfang H. Ruan a, , Derek C. Cole , Paul Wu , Amira Quazi , Karen Page , Jill F. Wright , Nelson Huang ,
Joseph R. Stock b, Karl Nocka a, Ann Aulabaugh c, Rustem Krykbaev a, Lori J. Fitz a, Neil M. Wolfman a,
Margaret L. Fleming a
*
a Inflammation and Immunology, Pfizer Biotherapeutics R&D, Cambridge, MA 02140, USA
b Chemical Sciences, Pfizer, Pearl River, NY 10965, USA
c Screening Sciences, Pfizer, Pearl River, NY 10965, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 28 October 2009
Received in revised form 3 December 2009
Accepted 8 December 2009
Available online 14 December 2009
Vanin-1 is a pantetheinase that catalyzes the hydrolysis of pantetheine to produce pantothenic acid (vita-
min B5) and cysteamine. Reported here is a highly sensitive fluorescent assay using a novel fluorescently
labeled pantothenate derivative. The assay has been used for characterization of a soluble version of human
vanin-1 recombinant protein, identification and characterization of hits from high-throughput screening
(HTS), and quantification of vanin pantothenase activity incell lines andtissues. Under optimized assay con-
ditions, we quantified vanin pantothenase activity in tissue lysate and found low activity in lung and liver
but high activity in kidney. We demonstrated that the purified recombinant vanin-1 consisting of the extra-
cellular portion without the glycosylphosphatidylinositol (GPI) linker was highly active with an apparent
Keywords:
Vanin-1
Fluorescent assay
Inflammatory disease
HTS assay
Lead identification
Tissue quantification
Km
Km of 28 lM for pantothenate–7-amino-4-methylcoumarin (pantothenate–AMC), which was converted
to pantothenic acid and AMC based on liquid chromatography–mass spectrometry (LC–MS) analysis. The
assay also performed well in a 384-well microplate format under initial rate conditions (10% conversion)
with a signal-to-background ratio (S/B) of 7 and a Z factor of 0.75. Preliminary screening of a library of
1280 pharmaceutically active compounds identified inhibitors with novel chemical scaffolds. This assay
will be a powerful tool for target validation and drug lead identification and characterization.
Ó 2009 Elsevier Inc. All rights reserved.
Pantetheinase activity
Pantetheinase activity has been correlated to oxidative stress
and inflammation [1–7], suggesting a possible role for vanin-1 as
a tissue sensor in pathological conditions associated with a large
oxidative stress component. Vanin-1 is a member of the biotini-
dase family and is expressed at the cell surface via a glycosylphos-
phatidylinositol (GPI)1 anchor in epithelial cells [3]. Vanin-1
knockout mice are resistant to systemic oxidative stress and intesti-
nal inflammation, as evidenced by the decreased presence of inflam-
matory mediators and increased antioxidative responses [1,8].
Vanin-1 knockout mice lack detectable cysteamine in tissues,
suggesting that catabolism of pantetheine by vanin-1 is the primary
source of endogenous cysteamine. Interestingly, cystamine (oxidized
form of cysteamine) administration to vanin-1 knockout animals re-
verses the protection observed in intestinal and oxidative stress
models [6]. Vanin-1, via its pantetheinase activity, regulates the spe-
cific intracellular pathways that lead to generation of pro-inflamma-
tory mediators. Therefore, inhibiting vanin-1 pantetheinase activity
might be beneficial in treating inflammatory bowel disease.
Pantetheinase assays reported so far are not suitable for high-
throughput screening (HTS) because the assays either require radio-
active materials or result in a product that is insensitive to detection.
For example, early assay formats measured cysteamine production
by derivatizing cysteamine followed by chromatographic separation
[9–13] or measured pantothenic acid (vitamin B5) formation using
14C-labeled pantetheine followed by paper chromatography [14]. La-
ter, an assay using S-pantetheine-3-pyruvate as substrate was devel-
oped. Hydrolysis gives pantothenic acid and S-cysteamine-3-
pyruvate, which then spontaneously cyclizes to aminoethylcysteine
ketamine that can be quantitated by ultraviolet (UV) absorbance at
296 nm [15]. However, S-pantetheine-3-pyruvate is unstable, and
UV absorbance measurement at 296 nm is not suitable for HTS
because many small molecules absorb at this wavelength and will
* Corresponding author. Fax: +1 617 665 5386.
E-mail addresses: ruanb@wyeth.com, ruanbf@yahoo.com (B.H. Ruan).
Abbreviations used: GPI, glycosylphosphatidylinositol; HTS, high-throughput
1
screening; UV, ultraviolet; pantothenate–AMC, pantothenate–7-amino-4-methyl-
coumarin; LOPAC, library of pharmacologically active compounds; TFA, trifluoroacetic
acid; DMSO, dimethyl sulfoxide; HPLC, high-performance liquid chromatography;
MS, mass spectrometry; ESI, electrospray ionization; NMR, nuclear magnetic
resonance; cDNA, complementary DNA; PCR, polymerase chain reaction; CMV,
cytomegalovirus; DHFR, dihydrofolate reductase; CHO, Chinese hamster ovary; PBS,
phosphate-buffered saline; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel
electrophoresis; SEC–MALS, size exclusion chromatography–multiangular light
scattering; DTT, dithiothreitol; BSA, bovine serum albumin; EX, excitation; EM,
emission; tR, retention time; S/B, signal-to-background ratio; SD, standard deviation;
IQR, interquartile range; BCA, bisinchoninic acid; qRT, quantitative reverse transcrip-
tion; BME, b-mercaptoethanol; mRNA, messenger RNA.
0003-2697/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.ab.2009.12.010

Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
285
interfere.Recently, anitroanilidederivativeofpantothenatewasused
asavanin-1substratewithUV/visiblereadoutat400 nm, althoughno
chemical structure was disclosed [7]. Again, UV/visible absorbance
measurement at 400 nm might not be suitable for HTS because small
molecules may interfere. Therefore, we investigated other pantothe-
nate derivatives as potential vanin-1 substrates to develop an assay
that is suitable for HTS and for the quantitation of vanin-1 in various
cell types and tissues. Reported here is the development of a vanin-1
HTS-amenable assay using pantothenate–7-amino-4-methylcouma-
rin (pantothenate–AMC) as a substrate and application of this novel
fluorescent assay to screen a LOPAC (library of pharmacologically ac-
tive compounds) to identify small molecule vanin-1 inhibitors and to
quantify vanin-1 in mouse tissue extracts.
vanin-1 ectodomain plasmid construct using the transfection re-
agent TransIT LT1 (Mirus Bio, Madison, WI, USA) and subsequently
put into 20 nM methotrexate for selection for 2 weeks. Clones were
picked and analyzed for expression level by anti-His6ꢀ Western
blot analysis. The best clone was expanded into HYPERFlask (Corn-
ing, Lowell, MA, USA). Once the cells were confluent, the medium
was changed to serum-free medium R1CD1 and the temperature
was shifted to 32 °C. Three harvests of conditioned medium were
collected after 3 days each.
The recombinant His- and Flag-tagged vanin-1 was purified over a
10-mlHisTrapFastFlowcolumn(GEHealthcare,Piscataway,NJ, USA).
Bound protein was washed with 50 mM Tris, 1 M NaCl, and 15 mM
imidazole buffer (pH 8.0). The recombinant vanin-1 was eluted with
50 mM Tris, 1 M NaCl, and 250 mM imidazole buffer (pH 8.0), dia-
lyzed against phosphate-buffered saline (PBS, pH 7.2), and character-
ized by sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS–PAGE) gels and Western blot analysis using 10% tricine gels
(Invitrogen, Carlsbad, CA, USA). The molecular weight was deter-
mined by size exclusion chromatography–multiangular light scatter-
ing (SEC–MALS) analysis as followings. The recombinant vanin-1 was
injected onto a YMC-Pack Diol-300 column (500 ꢀ 8.0 mm i.d.,
Waters) using a Waters HPLC unit. The column was developed with
50 mM phosphate buffer with 300 mM NaCl (pH 7.2) at a flow rate
of 1 ml/min. The eluted proteins were detected by a miniDAWN Tri-
star multiangular light scattering device connected in tandem with
an OptiLab rEX refractive index detector (Wyatt Technology, Santa
Barbara, CA, USA) to determine the homogeneity and molecular
weight of the protein as itmigrates through the SEC column. The puri-
fied recombinant vanin-1 was greater than 95% pure by Coomassie
blue stain analysis, and the endotoxin level was less than 1 EU/ml.
The protein (1.75 mg/ml) was stored in PBS at ꢁ80 °C.
Materials and methods
Materials
b-Alanine 7-amido-4-methylcoumarin was purchased from Chem-
Impex International (Wood Dale, IL, USA), and other chemicals were
purchased from Sigma–Aldrich (St. Louis, MO, USA). Protein purifica-
tion reagents were obtained from Pierce (Rockford, IL, USA). Assays
were run in Matrix 384-well polypropylene plates using a PlateMate
2 ꢀ 2 robotbyMatrix(Hudson, NH, USA). Fluorescentassayswere car-
ried out on an Envision plate reader (PerkinElmer, Waltham, MA, USA)
or a Safire multidetection monochromator microplate reader (Tecan,
Durham, NC, USA). NIC-H292 cells were obtained from American Type
Culture Collection (ATCC, Manassas, VA, USA).
Chemical synthesis of pantothenate–AMC
A solution of b-alanine 7-amido-4-methylcoumarin trifluoro-
acetic acid (TFA) salt (H-b-Ala-AMC.TFA, 36 mg, 1 eq) and R-(ꢁ)-
pantolactone (45 mg, 3 eq) was heated to 60 °C in ethanol (5 ml)
for 2 days. The solvent was evaporated, and the residue was dis-
solved in dimethyl sulfoxide (DMSO)/water and purified by re-
verse-phase high-performance liquid chromatography (HPLC) on
a C18 column with 5% to 95% acetonitrile in water containing
0.05% TFA buffer to give pantothenate–AMC (32 mg, >99% purity)
LC–MS analysis of pantothenate–AMC hydrolysis by vanin-1
Pantothenate–AMC (200
lM, 100 ll) was incubated in phos-
phate buffer (100 mM potassium phosphate buffer [pH 8.0],
5 mM dithiothreitol [DTT], 0.01% bovine serum albumin [BSA],
and 0.0025% Brij-35) in the presence or absence of vanin-1 protein
(100 nM) at 37 °C for 1 h. The reaction products were detected by
fluorescent analysis using an excitation (EX) wavelength of
350 nm and an emission (EM) wavelength of 460 nm by a Safire
plate reader. The products were characterized by LC–MS analysis
performed on a Waters LCT mass spectrometer coupled with an
Agilent 1100 HPLC device. The HPLC column (Waters Symmetry
as
a
white powder. MS (ESI) m/z 377.1 (M+H)+, 1H NMR
(300 MHz, DMSO-d6) d 10.41 (br s, 1H), 8.04 to 7.62 (m, 3H), 7.47
(dd, J = 9.0, 3.0 Hz, 1H), 6.27 (s, 1H), 5.39 (d, J = 5.7 Hz, 1H), 4.47
(5, J = 5.7 Hz, 1H), 3.71 (d, J = 5.7 Hz, 1H), 3.48 to 3.14 (m, 4H),
2.58 (t, J = 6.9 Hz, 2H), 2.39 (s, 3H), 0.80 (s, 3H), 0.77 (s, 3H).
2.1 ꢀ 50 mm, 3.5
lm) was developed in a gradient of solvent A
(water with 0.1% formic acid) and solvent B (acetonitrile with
0.1% formic acid) at a flow rate of 0.6 ml/min. The gradient started
at 2% solvent B in solvent A for 3 min, linearly ramped to 5% solvent
B in 4 min and then to 100% solvent B in 4 min, and finally held at
100% solvent B for another 2 min. The eluted fractions were ana-
lyzed by MS with ESI using the following parameters: capillary
voltage, 3500 V; cone voltage, 25 V; desolvation temperature,
350 °C; source temperature, 120 °C; scan speed, 100 to 2000 Da
in 1 s. Data acquisition was made by alternating between positive
ion mode and negative ion mode with an interscan delay of 0.7 s.
Vanin-1 plasmid constructs
Human vanin-1 complementary DNAs (cDNAs) were purchased
from Origin and subcloned into pDEST12.2 vector by homologous
recombination using Gateway technology. Human vanin-1 ectodo-
main construct (amino acid position 22–483) was modified by
replacing the endogenous vanin-1 leader with the honeybee mela-
nin prepro leader followed by a Gly-Ser-Gly-His6ꢀ tag–Gly-Ser-
Gly-Flag tag by overlap polymerase chain reaction (PCR) of 45 to
50 bp synthetic oligonucleotides and cloned by InFusion cloning
(Clontech, Mountain View, CA, USA) into pDONR221, which was per-
formed by Dragonfly Sciences (Wellesley, MA, USA). The insert was
Gateway subcloned into a mammalian expression vector with a
cytomegalovirus (CMV) promoter. All PCR-derived products were
sequenced to ensure sequence fidelity.
Assay optimization
The optimal assay conditions were obtained by varying the indi-
vidual buffer components—DTT (0 lM–50 mM), DMSO (0–50%), pH
(3–10), and vanin-1 (10 pM–32 nM) in 50 mM potassium phosphate
buffer containing 0.01% BSA, 0.0025% Brij-35, and pantothenate–
Expression and purification of human vanin-1 protein
AMC (1 or 2 lM) in a black 384-well at 25 °C for 1 h. The progress
of the reaction was followed every 2 min by fluorescence (Safire,
EX 350 2.5 nm, EM 460 2.5 nm), and the conversion rate was cal-
culated using standard titration curves of AMC and pantothenate–
Dihydrofolate reductase (DHFR)-negative Chinese hamster
ovary (CHO) DUKX cells were transfected with the above-described

286
Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
obtained from Spotfire analysis, and hits were defined as greater than
thecutoff%inhibition = median%inhibition + 3 ꢃ IQR/1.34. A counter
screen assay, using AMC instead of vanin-1 enzyme, was run under
the same condition on the hits to identify compounds that interfered
with the assay detection.
AMC. The final assay conditions used in subsequent experiments
were phosphate buffer B: 100 mM potassium phosphate buffer (pH
7.5), 0.01% BSA, 0.5 mM DTT, 1% to 5% DMSO, and 0.0025% Brij-35.
Km value for pantothenate–AMC
IC50 measurement
The Km measurement was done in 30
containing vanin-1 (0.5 nM) and pantothenate–AMC (0–120
l
l of reaction mixtures
M)
l
Threefold dilutions of compounds were made in 100% DMSO.
Compounds (50 lM–0.85 nM), pantothenate–AMC (1 lM), and va-
in phosphate buffer B. Reactions were carried out in triplicate at
25 °C in the presence or absence of vanin-1 enzyme, and the fluo-
rescence (Safire, EX 350 2.5 nm, EM 460 2.5 nm) was recorded
every 2 min. The amount of AMC produced in each reaction was
determined by two methods. One is to convert fluorescence into
mass based on AMC fluorescent dose–response curve (EM
460 nm). The other method is to separate pantothenate–AMC
(retention time [tR] = 6.0 min) and AMC (tR = 7.1 min) by reverse-
phase HPLC (Phenomenex Luna C18 column, 4.6 ꢀ 250 mm,
nin-1 (0.6 nM) in final concentrations were mixed in optimized
phosphate buffer B containing 3% DMSO in 384-well plates, and
the reaction was carried out in duplicate at 25 °C for 1 h. In addi-
tion, a counter screen assay was carried out under the same condi-
tions except that the addition of vanin-1 (0.6 nM) was replaced
with AMC (60 nM). IC50 values from both assays were calculated
from the fit of the % inhibition of individual dose–response curves
using Eq. (3):
5 lm) in a linear gradient of solvent A (water with 0.1% TFA) and
solvent B (acetonitrile with 0.1% TFA) and then to quantify AMC
based on UV absorbance, which showed linear dose response for
both AMC (355 nm) and pantothenate–AMC (331 nm). The appar-
ent Km values were determined in KaleidaGraph 3.0 by fitting the
initial velocities of AMC production at various pantothenate–
AMC concentrations to the hyperbolic Michaelis–Menten equation.
% inhibition ¼ 100 ꢀ ½Cn=ðIC50 þ CnÞꢂ;
where C is the inhibitor concentration and n is the Hill slope deter-
ð3Þ
mined by curve fitting.
Quantification of vanin-1 in cells and tissue homogenates
NCI-H292 lung epithelial cells, previously transfected and se-
lected for stable expression of human vanin-1 or control, were pla-
ted in 96-well plates and allowed to grow to confluence. Cells were
Assay performance
To evaluate the quality of the assay for use in an HTS campaign,
performance was assessed by calculating the Z factor value of the va-
nin-1 HTS assay. Reactions (4224) were carried out in 11 384-well
plates. Among these, 50% of the reactions included 0.5 nM vanin-1
(high control)and the other 50% had the same volumeof buffer with-
out vanin-1 (low control). The signal of the high controls was ob-
washed three times with PBS and lysed with RIPA buffer (100
ll).
Cell lysate (50 l), pantothenate–AMC (20 M final), and DTT
l
l
(0.1 mM final) were mixed in PBS in a 96-well plate, and the
change in fluorescence was measured over a 90-min period. A
standard curve was generated using purified recombinant vanin-
1 under the same buffer conditions to adjust for RIPA buffer effect.
Remaining lysate was used to measure total protein using a
bicinchoninic acid (BCA) protein assay (Thermo Scientific, Rock-
ford, IL, USA). Vanin-1 activity was calculated by taking the slope
at 60 min, fitting the data to the standard curve, and normalizing
for total protein content.
Mouse tissues were harvested from C57Bl/6 mice and homoge-
nized in potassium phosphate buffer with 0.1% Triton X-100 and
0.6% sulfosalicylic acid. Protein amounts were determined by BCA
protein assay, and 10 lg of protein was assayed for vanin-1 activity
using the conditions described above.
tained by incubating
1 lM pantothenate–AMC with vanin-1
(0.5 nM) in the optimized phosphate buffer B at 25 °C for 1 h. The
low controls were obtained in the absence of vanin-1, and the sig-
nal-to-background ratio (S/B) of the assay at initial rate conditions
was calculated by dividing the mean of the positive controls by the
mean of the negative controls. A total of 4224 data points were col-
lected from the 11 384-well plates. The Z factor value was calculated
using the following equation:
Z ¼ 1 ꢁ ½ð3SD of high controlÞ
þ ð3SD of low controlÞꢂ=jðmean of high control
ꢁ mean of low controlÞj:
ð1Þ
Quantitative reverse transcription–PCR
Hit identification using LOPAC
Mouse tissues were harvested from C57Bl/6 mice and homoge-
nized in RLT buffer. Homogenate was cleared over a QIAshredder
column, RNA was prepared using RNeasy mini columns, and geno-
mic DNA was removed by treatment with DNase (Qiagen, Valencia,
CA, USA). The concentration of total RNA in each sample was deter-
mined by absorbance at 260 nm.
Oligonucleotides were designed to mouse b-actin and mouse
vanin-1 using Primer Express software (Applied Biosystems, Foster
City, CA, USA). Forward and reverse primer sequences were as fol-
lows: b-actin 50 ACGGCCAGGTCATCACTATTG and 50 CAAGAAGGAA
GGCTGGAAAAGA, mouse vanin-1 50 TTAAAAGCCAGTTCGCTGGAT
AC and 50 GGGTGTCCTTAGGCAGGATCA. Probes with a 50 FAM re-
porter dye and a 30 TAMRA quencher were also generated as fol-
lows: b-actin 50 CAACGAGCGGTTCCGATGCCC, mouse vanin-1 50
TTCCTCGCGGCTGTTTACGAGCA. Duplicate reactions were set up
in a 384-well plate using a quantitative reverse transcription
(qRT)-PCR MasterMix (Quanta Biosciences, Gaithersburg, MD,
USA) and 25 ng of template RNA per reaction and were analyzed
using a 7900 Real Time PCR System (Applied Biosystems). Data
A small set of pharmaceutically active compounds was then
evaluated in the assay to identify hits and to determine the level
of compound optical interference. Compounds (1280) from the LO-
PAC set (Sigma–Aldrich) were diluted in DMSO. In 384-well plates,
compounds (10 lM) in DMSO, pantothenate–AMC (1 lM final),
and vanin-1 (0.6 nM final) in phosphate buffer B were added in
sequential order, and the reactions were carried out in triplicate
at 25 °C for 1 h. The no-compound control was used as the high
control (0% inhibition), and the substrate conversions were 10%
based on calibration curves generated using AMC. The no-enzyme
control was used as the low control (100% inhibition), and the per-
centage inhibition was calculated using the following equation:
% inhibition ¼ 100 ꢃ ½1 ꢁ ðS ꢁ low controlÞ=ðhigh control
ꢁ low controlÞꢂ;
ð2Þ
whereSis the fluorescent signalinthe presence ofinhibitor. Themed-
ian and the corresponding interquartile range (IQR) values were

Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
287
were fitted to a standard curve generated from a positive control
source of RNA, and expression values for vanin-1 were normalized
to those for b-actin within each sample.
In any case, the initial effort was to test pantothenate–AMC in
which the cystamine moiety of pantetheine is replaced with the
AMC moiety (Fig. 2A), with the hope that pantothenate–AMC (an
amide) would be hydrolyzed to give D-pantothenic acid and AMC
(an amine). As shown in Fig. 2B, after excitation at 340 nm, the sub-
strate (pantothenate–AMC) and the expected product (AMC) show
different emission spectra at 460 nM. The weak fluorescence signal
from the pantothenate–AMC increases approximately 20-fold
when the amide bond is cleaved to release the free amine (AMC),
providing a significant window for a sensitive assay.
Next we asked whether vanin-1 can cleave pantothenate–AMC.
Incubation of pantothenate–AMC with the recombinant vanin-1 or
the native vanin-1-containing lysate led to an increase in fluores-
cent signal (EX 340 nm, EM 460 nm) with incubation time, indicat-
ing rapid hydrolysis (Fig. 2C).
The chemical nature of the hydrolysis products was further con-
firmed by LC–MS analysis. In the absence of recombinant vanin-1,
pantothenate–AMC (tR = 9.9 min, m/z 377, M+H+ [Fig. 2E]) re-
mained stable after 1 h (Fig. 2D, top panel) because a single peak
was detected with a tR of 9.9 min, which was identified as panto-
thenate–AMC by MS [m/z 377 (M+H+, calc. 377); m/z 399
(M+Na+, calc. 399); m/z 359 (MꢁH2O+H+, calc. 359)], as shown in
Fig. 2E, indicating no hydrolysis. After 1 h in the presence of va-
nin-1, the pantothenate–AMC (tR = 9.9 min) peak disappeared,
and two new peaks with tR at 1.6 and 9.8 min were observed
Results and discussion
Characterization of the vanin-1 enzyme
To examine vanin-1 pantetheinase activity, a soluble form of va-
nin-1 was cloned with the C-terminal GPI signal and downstream
sequences removed, the addition of an N-terminal His6 tag and
Flag tag, and replacement of the endogenous signal peptide with
the honeybee prepromelittin (Fig. 1A). His-and Flag-tagged va-
nin-1, produced in CHO cells, was purified using nickel affinity
chromatography and showed greater than 95% purity by SDS–
PAGE gel (Fig. 1B). The molecular weight of the purified recombi-
nant vanin-1 determined by SEC–MALS was 72,690 g/mol
(Fig. 1C), whereas the theoretical molecular weight for vanin-1 is
54 kDa. This suggested that the recombinant vanin-1 is glycosyl-
ated at several of its six potential N-linked glycosylation sites as re-
ported previously [17]. The activity of the purified recombinant
vanin-1 was measured by hydrolysis of its natural substrate, pan-
tetheine. The complete conversion of pantetheine (tR = 4.56 min,
m/z 279, 301, 317) to cysteamine and pantothenic acid
(tR = 0.89 min, m/z 220, 242, 258) after vanin-1 hydrolysis was ob-
served by LC–MS analysis.
(Fig. 2D, bottom panel). The peak at 1.6 min was identified as D-
pantothenic acid based on its mass spectrum [m/z 258 (M+K+, calc.
258); m/z 242 (M+Na+, calc. 242); m/z 220 (M+H+, calc. 220)], as
shown in Fig. 2F, and the peak at 9.8 min was AMC [m/z 198
(M+Na+, calc. 198); m/z 176 (M+H+, calc. 176)], as shown in
Fig. 2G. This demonstrated that pantothenate–AMC was hydro-
lyzed by vanin-1 at the amide bond.
Feasibility of pantothenate–AMC as a substrate for vanin-1
The traditional methods for vanin-1 quantification use pantethe-
ine (the natural vanin-1 substrate) or pantetheine-3-pyruvate (a
synthetic derivative), but neither is a suitable substrate for HTS. A
simple and sensitive HTS assay may consist of a nonfluorescent sub-
strate that, after hydrolysis, releasesa fluorescent moleculethatmay
easily be quantified by fluorescent intensity. A fluorescently labeled
pantetheine derivative is a possible substrate for such an assay.
However, it was not clear whether the additional fluorescent group
would prevent the substrate from binding and being hydrolyzed by
vanin-1 because not all pantetheine derivatives are vanin-1 sub-
strates. Dupre and coworkers [15] discovered that vanin-1 has good
substrate specificity for certain pantetheine derivatives such as
S-patetheine-3-pyruvate. However, other derivatives such as
pantetheine-40-phosphate have only approximately 10% activity
compared with pantetheine. Still other derivatives, such as panto-
thenoyl-cysteine-40-phosphate, pantothenoylcysteine, pantetheine
thiazoline, and coenzyme A, could not be hydrolyzed by vanin-1.
Assay optimization and robustness of the assay
Vanin-1 belongs to the nitrilase superfamily, which contains the
invariant catalytic triad residues: glutamate, lysine, and cysteine
[18]. Regeneration of the active site cysteine (Cys211 in human va-
nin-1) is critical for the enzymatic activity [19]. Therefore, we
investigated whether the concentration of reducing agent DTT is
important for vanin-1 enzymatic activity. Interestingly, vanin-1
activity was reduced in the absence of DTT, in the presence of a
high level of 50 mM DTT, or with the use of b-mercaptoethanol
(BME). This indicated that the in vitro assay requires DTT to regen-
erate vanin-1 activity, but too much DTT also inhibits the enzyme
activity (Fig. 3A). DTT concentrations between 0 and 50 mM were
tested, and the optimal concentration was 0.4 mM (Fig. 3A). The
Fig. 1. Vanin-1 cloning and purification. (A) Human vanin-1 ectodomain construct. The honeybee prepromelittin leader peptide is boxed with a solid line. The His6 tag is
boxed with a dashed line. The Flag tag is indicated by overhead carets, and the six putative N-linked glycosylation sites are underlined. (B) Coomassie blue-stained gel image
of the purified recombinant vanin-1. Lane 1: molecular weight markers; lanes 3, 4, and 5: 5, 10, and 15
lg of nonreduced protein, respectively; lanes 7, 8, and 9: 5, 10, and
15 lg of reduced protein. (C) Multiangular light scattering chromatogram of purified recombinant vanin-1.

288
Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
Fig. 2. Pantothenate–AMC is a feasible substrate for vanin-1 HTS. (A) Reaction scheme of pantothenate–AMC hydrolysis catalyzed by vanin-1 to give pantothenic acid and
AMC. (B) Fluorescence emission spectra of pantothenate–AMC (N) and AMC (j) on excitation at 340 nm. (C) Time course of pantothenate–AMC hydrolysis in the presence (j)
or absence (h) of vanin-1. (D) LC–MS analysis of pantothenate–AMC hydrolysis reactions in the absence (top panel) or presence (bottom panel) of vanin-1. (E) Mass spectrum
of the peak eluted at 9.9 min (D top panel, pantothenate–AMC). (F) Mass spectrum of the peak eluted at 1.6 min (D bottom panel, pantothenic acid). (G) Mass spectrum of the
peak eluted at 9.8 min (D bottom panel, AMC).
optimal pH for the enzyme is between 6.5 and 8.0 (Fig. 3B). Greatly
reduced vanin-1 activity was observed at both acidic (pH 3.0) and
basic (pH 10.0) conditions, in agreement with the early report that
vanin-1 plays a role in intestine and bowel disease where epithelial
cells are under essentially neutral pH conditions [1].
For HTS and hit characterization, DMSO is critical for compound
solubility; therefore, it is important to determine the maximal
amount of DMSO that may be tolerated in the vanin-1 assay. Essen-
tially the same activity was observed between 0% and 4% DMSO,
but a steep drop of vanin-1 activity was observed at higher DMSO
concentrations (Fig. 3C). Under the optimal buffer conditions in the
to 5 lM at pH 5.0 in acetate buffer [14]. Also, a 2-fold drop in Km
was observed in potassium phosphate buffer compared with that
in Tris buffer at the same pH of 7.5 with the same reducing agents
[16]. The Km for pantothenate–AMC was determined in phosphate
buffer B using 0.5 nM vanin-1 enzyme, and the time courses of
fluorescent changes at 460 nm were linear within 60 min of reac-
tion time under the assay conditions used, as shown in Fig. 4A.
The slopes measured from linear curve fitting (Fig. 4, R = 0.99) were
used as initial velocities, and the fluorescent signals were con-
verted to mass concentrations (nM) based on the standard curve
generated from a series of dilutions of AMC. In the fluorescent
presence of 1
l
M pantothenate–AMC, the recombinant vanin-1
measurement, initial velocities at 30, 60, and 120
concentrations are essentially the same. Fitting of the initial veloc-
ities to the Michaelis–Menten equation (0–30 M substrate con-
centration) yielded an apparent Km value of 13 for
lM substrate
(0.06–0.5 nM) provided a constant hydrolysis rate over a period
of 1 h with less than 20% conversion (Fig. 3D). To estimate the
reproducibility of the assay, we measured the assay Z value using
l
1 lM
0.5 nM recombinant vanin-1 and 1
l
M pantothenate–AMC. The
pantothenate–AMC using the soluble recombinant human vanin-
1 (Fig. 4B). Because fluorescent suppression at high substrate con-
centration due to the inner filter effect has been reported previ-
ously [20], we further corrected the inner filter effect by an
orthogonal HPLC assay to monitor AMC production. In orthogonal
HPLC assay, product AMC was further measured by UV absorbance
at 355 nm after HPLC separation. Initial velocities from the HPLC
assay (Fig. 4C) were still linear but did not reach saturation at sub-
no enzyme controls showed a background of 427 27 U, and the
vanin-1-added reactions showed a maximal signal of 2814
171 U. The calculated S/B is 6.6, and the Z factor is 0.75 at a sub-
strate-to-product conversion rate of 10% (Fig. 3E), which is well
within the range of an HTS-compatible assay.
Km determination
strate concentration greater than 30
fitting (0–200 M substrate concentration) of initial velocities
from HPLC assay showed an apparent Km of 28 1.8 M for panto-
thenate–AMC (Fig. 4D). Considering the difference in assay condi-
tions (e.g., buffer and enzyme source), an apparent Km of 28
lM. Michaelis–Menten curve
l
The Km values for pantothenate derivatives have been reported
previously, although the Km values appeared to be sensitive to as-
l
say conditions. A Km of 20
lM was reported for pantetheine using
l
M
native pig vanin-1 in Tris buffer at pH 9.0, whereas the Km dropped

Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
289
Fig. 3. Assay optimization and Z factor measurement. (A) Increasing DTT concentrations from 0 to 50 mM added to the vanin-1 assay. (B) Various pH values (pH 3.0–10.0) in
the presence of 3% DMSO. (C) Increasing concentrations of DMSO (0–50%). (D) Time course of vanin-1 reactions in phosphate buffer B in the presence of various amounts of
vanin-1 (0–32 nM, 2-fold dilutions). (E) Z factor measurement at a substrate conversion rate of 10%. Black bars show optimal activity.
for pantothenate–AMC is similar to the Km for pantetheine (5–
20 M) reported previously [14,16].
fluorescence (EX 340 2.5 nm, EM 460 2.5 nm), but 4% of the
compounds increased the signal (EM 460 2.5 nm) from 2500 to
50,000 or quenched the signal from 2500 to 0 (Fig. 5A). Further-
more, compounds were tested for vanin-1 inhibitory activity under
the optimized conditions (Fig. 5B). Spotfire analysis evaluated the
inhibition distribution curve of the LOPAC and showed a median
percentage inhibition of 5% and an IQR of 9% inhibition. Thus, the
calculated cutoff value for hits was 25%, giving a 4% hit rate with
the current assay configuration.
l
Screening the LOPAC
To date, only pantetheine derivatives with Ki values at the
micromolar (lM) level have been reported as vanin-1 inhibitors
[19]. To identify additional vanin-1 small molecule inhibitors, we
performed a pilot screening experiment and evaluated a LOPAC
of 1280 compounds at 10 lM compound and 1 lM pantothe-
nate–AMC concentrations. In the absence of vanin-1 and the pres-
ence of AMC, the majority of compounds (96%) had no affect on the
To confirm the reliability of the compound screening assay,
the top six hits (70–83% inhibition at 10
lM compound concen-
tration) were selected for IC50 determinations in both vanin-1

290
Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
Fig. 4. Apparent Km of pantothenate–AMC for vanin-1. (A) Time course of fluorescent changes in vanin-1 reactions at various pantothenate–AMC concentrations (0–120
2-fold dilutions). Slopes (initial velocities) were obtained by linear curve fitting (R > 0.99). (B) The fluorescent assay initial velocities were fit to the Michaelis–Menten
hyperbolic equation to obtain an apparent Km of 13 M for pantothenate–AMC. (C) Time course of UV absorbance changes at 355 nm in vanin-1 reactions after HPLC
lM,
1
l
separation. (D) The initial velocities from the HPLC assay were fit to the Michaelis–Menten equation to obtain a more precise apparent Km of 28 1.8 lM for pantothenate–
AMC.
assay and AMC counter screen assay. As shown in Fig. 6, in va-
nin-1 assay, each dose–response curve can be fitted with a sig-
moid curve-fitting model in the XLfit program. Six compounds
from 20 independent assays gave reproducible IC50 values at
assay up to 50 lM compound concentration. The agreement be-
tween the IC50 and the single concentration percentage inhibi-
tion indicated that the fluorescent vanin-1 assay can be used
to identify inhibitors in the single concentration assay; thus,
the assay should be suitable for a large-scale HTS screen and
subsequent hit characterization.
1
lM pantothenate–AMC concentration (Table 1). In addition,
these compounds showed no inhibition in AMC counter screen
Fig. 5. Screening the LOPAC using vanin-1 fluorescent assay. (A) Compound fluorescence profile (EX 340 nm, EM 460 nm). (B) Vanin-1 inhibitory activity profile for LOPAC.

Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
291
Fig. 6. IC50 measurement of vanin-1 inhibitors from LOPAC screening using an 11-point dose–response curve: (A) CGP-74514A hydrochloride, 7.9
lM; (B) 5-(N,N-
hexamethylene)amiloride, 4
l
M; (C) 8-cyclopentyl-1,3-didropylxanthine, 13.5
lM; (D) NSC-95397, 5.7
lM; (E) b-lapachone, 9.5
lM; (F) roscovitine, 17.6
l
M.
ing production formation at 296 nm. To test the potential of the
pantothenate–AMC fluorescent assay for tissue quantification, sub-
strate specificity was measured for NCI-H292 cells with or without
stable expression of vanin-1 using a series dilution of the purified
recombinant vanin-1 tested under the same assay conditions. Un-
der the assay conditions, the AMC signal was not quenched in the
presence of up to 10% of lysate buffer. As shown in Fig. 7A, panteth-
einase activity was clearly detected in lysates from NCI-H292 cells
expressing vanin-1 but not in untransfected NCI-H292 cells. This
indicated that, except for vanin-1, other proteins in the NCI-H292
cell lysate do not hydrolyze pantothenate–AMC at a detectable le-
vel. Therefore, pantothenate–AMC was further used as the sub-
strate to measure the total vanin (vanin-1 and potentially vanin-
3) protein level in mouse tissues, and RT–PCR reactions were car-
ried out to measure vanin-1 at the messenger RNA (mRNA) level.
As shown in Fig. 7B, vanin proteins were expressed at a higher level
in mouse kidney than in liver as reported previously [3], but lung
expressed a similar level of vanin proteins to that of liver. Impor-
tantly, the level of pantothenase activity correlated well with the
Table 1
IC50 measurement of vanin-1 inhibitors from LOPAC.
Compound
Vanin-1 assay
(n = 20) ( M)
Counter screena
(lM)
l
CGP-74514A hydrochloride
5-(N,N-hexamethylene)amiloride
8-Cyclopentyl-1,3-didropylxanthine
NSC-95397
b-Lapachone
Roscovitine
7.9 0.5
>50
>50
>50
>50
>50
>50
4.04 0.25
13.5 0.6
5.7 0.4
9.50 0.35
17.6 1.2
a
Counter screen assay was carried out under the same conditions as the vanin-1
assay except that the addition of vanin-1 was replaced with the product AMC
(60 nM).
Vanin in cells and tissues
Previously, pantetheinase activity in tissues [3] has been deter-
mined using S-pantetheine-3-pyruvate as a substrate by measur-
A
B
C
2000
1500
1000
500
0
400
300
200
100
0
2
1.5
1
0.5
0
nd
lung
liver kidney
vector
hVNN1
lung liver kidney
Fig. 7. Levels of pantetheinase activity in human cells and mouse tissues. (A) NCI-H292 cells stably transfected with vanin-1 or vector control, nd stands for not detected. (B)
Mouse tissue homogenates were assayed for pantetheinase activity, and the specific activity was obtained using a standard curve of the purified recombinant vanin-1 protein
and normalized to the amount of total protein per sample. (C) The level of vanin-1 mRNA in mouse tissue homogenates was measured by real-time RT-PCR and normalized to
the actin mRNA in corresponding tissues. Error bars are representative of three wells or animals.

292
Assay for vanin tissue quantification / B.H. Ruan et al. / Anal. Biochem. 399 (2010) 284–292
[4] S. Meghari, C. Berruyer, H. Lepidi, F. Galland, P. Naquet, J.L. Mege, Vanin-1
controls granuloma formation and macrophage polarization in Coxiella burnetii
infection, Eur. J. Immunol. 37 (2007) 24–32.
transcript (VNN1 mRNA) levels in corresponding tissues as deter-
mined by RT–PCR quantification (Fig. 7C).
[5] C. Berruyer, F.M. Martin, R. Castellano, A. Macone, F. Malergue, S. Garrido-
Urbani, V. Millet, J. Imbert, S. Duprè, G. Pitari, P. Naquet, F. Galland, Vanin-1ꢁ/ꢁ
mice exhibit a glutathione-mediated tissue resistance to oxidative stress, Mol.
Cell. Biol. 24 (2004) 7214–7224.
[6] C. Berruyer, L. Pouyet, V. Millet, F.M. Martin, A. LeGoffic, A. Canonici, S. Garcia,
C. Bagnis, P. Naquet, F. Galland, Vanin-1 licenses inflammatory mediator
production by gut epithelial cells and controls colitis by antagonizing
peroxisome proliferator-activated receptor gamma activity, J. Exp. Med. 203
(2006) 2817–2827.
[7] G. Min-Oo, A. Fortin, G. Pitari, M. Tam, M.M. Stevenson, P. Gros, Complex
genetic control of susceptibility to malaria: positional cloning of the Char9
locus, J. Exp. Med. 204 (2007) 511–524.
[8] L. Di Leandro, B. Maras, M.E. Schininà, S. Dupré, I. Koutris, F.M. Martin, P.
Naquet, F. Galland, G. Pitari, Cystamine restores GSTA3 levels in vanin-1 null
mice, Free Radic. Biol. Med. 44 (2008) 1088–1096.
Conclusions
Pantetheine is a natural substrate for vanin-1. Here we have
shown that the pantothenate moiety is critical for vanin-1 recogni-
tion, whereas the cysteamine moiety is dispensable. Replacing the
cysteamine moiety of pantetheine with a fluorescent group gener-
ated a novel vanin-1 substrate, pantothenate–AMC, which could be
recognized and hydrolyzed efficiently by both the native vanin-1
and the novel soluble recombinant vanin-1. Also demonstrated
was the capability of the assay to quantify pantetheinase activity
in cells and tissues. In addition, the assay was developed for robotic
HTS in 384-well plates to identify weak inhibitors with novel
chemical structures. Our assay provides a powerful tool to validate
vanin-1 as a novel target for other inflammatory disorders and to
identify small molecule vanin-1 inhibitors and characterize their
mechanism of action.
[9] M. Friedman, A.T. Noma, J.R. Wagner, Ion-exchange chromatography of sulfur
amino acids on a single-column amino acid analyzer, Anal. Biochem. 98 (1979)
293–304.
[10] M. Hsiung, Y.Y. Yeo, K. Itiaba, J.C. Crawhall, Cysteamine, penicillamine,
glutathione, and their derivatives analyzed by automated ion exchange
column chromatography, Biochem. Med. 19 (1978) 305–317.
[11] G.L. Newton, R. Dorian, R.C. Fahey, Analysis of biological thiols: derivatization
with monobromobimane and separation by reverse-phase high-performance
liquid chromatography, Anal. Biochem. 114 (1981) 383–387.
[12] K. Imai, T. Toyo’oka, Y. Watanabe, A novel fluorogenic reagent for thiols:
ammonium 7-fluorobenzo-2-oxa-1,3-diazole-4-sulfonate, Anal. Biochem. 128
(1983) 471–473.
[13] A.J. Jonas, J.A. Schneider, A simple, rapid assay for cysteamine and other thiols,
Anal. Biochem. 114 (1981) 429–432.
[14] C. Wittwer, B. Wyse, R.G. Hansen, Assay of the enzymatic hydrolysis of
pantetheine, Anal. Biochem. 122 (1982) 213–222.
Acknowledgments
We thank Melisa Ho, Patricia Lowden, Shihua Yao, and Robert
Czerwinski for supplying materials. We also thank Mark Stahl,
Samuel Goldman, and Mary Collins for providing suggestions and
support.
[15] S. Dupre, R. Chiaraluce, M. Nardini, C. Cannella, G. Ricci, D. Cavallini,
Continuous spectrophotometric assay of pantetheinase activity, Anal.
Biochem. 142 (1984) 175–181.
References
[16] K. Airas, Kinetic studies on pantothenase from Pseudomonas fluorescens: effects
of pH on substrate and inhibitor binding, Biochem. J. 157 (1976) 415–421.
[17] T.Z. Kristiansen, J. Bunkenborg, M. Gronborg, H. Molina, P.J. Thuluvath, P.
Argani, M.G. Goggins, A. Maitra, A. Pandey, A proteomic analysis of human bile,
Mol. Cell. Proteomics 3 (2004) 715–728.
[1] F. Martin, M.F. Penet, F. Malergue, H. Lepidi, A. Dessein, F. Galland, M. de Reggi,
P. Naquet, B. Gharib, Vanin-1(ꢁ/ꢁ) mice show decreased NSAID- and
Schistosoma-induced intestinal inflammation associated with higher
glutathione stores, J. Clin. Invest. 113 (2004) 591–597.
[18] F. Corpet, Multiple sequence alignment with hierarchical clustering, Nucleic
Acids Res. 16 (1988) 10881–10890.
[2] M. Aurrand-Lions, F. Galland, H. Bazin, V.M. Zakharyev, B.A. Imhof, P. Naquet,
Vanin-1, a novel GPI-linked perivascular molecule involved in thymus homing,
Immunity 5 (1996) 391–405.
[19] G. Pitari, G. Maurizi, P. Ascenzi, G. Ricci, S. Dupre,
A kinetic study on
pantetheinase inhibition by disulfides, Eur. J. Biochem. 226 (1994) 81–86.
[20] Y. Liu, W. Kati, C.M. Chen, R. Tripathi, A. Molla, W. Kohlbrenner, Use of a
fluorescence plate reader for measuring kinetic parameters with inner filter
effect correction, Anal. Biochem. 267 (1999) 331–335.
[3] G. Pitari, F. Malergue, F. Martin, J.M. Philippe, M.T. Massucci, C. Chabret, B.
Maras, S. Duprè, P. Naquet, F. Galland, Pantetheinase activity of membrane-
bound vanin-1: lack of free cysteamine in tissues of vanin-1 deficient mice,
FEBS Lett. 483 (2000) 149–154.