Use of hydrophobic bacterium Rhodococcus rhodochrous NBRC15564 expressed thermophilic alcohol dehydrogenases as whole-cell catalyst in solvent-free organic media

Article abstract of DOI:10.1016/j.procbio.2013.03.022

The hydrophobic bacterium Rhodococcus rhodochrous NBRC15564 was employed as a whole-cell biocatalyst to examine its potential for bioconversion in solvent-free organic media. The genes encoding two different thermostable alcohol dehydrogenases (ADH_Tt1 and ADH_Tt2) of Thermus thermophilus HB27 were expressed in R. rhodochrous cells. To inactivate indigenous mesophilic enzymes in R. rhodochrous, transformant cells were heated at 70 C for 10 min. Heat-treated hydrophobic wet cells were used for the bioconversion of 2,2,2-trifluoroacetophenone (TFAP) to α-(trifluoromethyl) benzyl alcohol (TFMBA) as a model reaction with ADH_Tt1. NADH, which was supplied in aqueous solution, was regenerated by converting cyclohexanol to cyclohexanone by ADH_Tt2. All reactions were performed by suspending heat-treated cells in solvent-free organic media consisting of 3.7 M TFAP and 4.8 M cyclohexanol (1:1, v/v ratio) at 60 C. When 800 mg heat-treated R. rhodochrous cells were dispersed in 2 mL of solvent-free organic media (400 mg cells/mL), the product concentration reached about 3.6 M TFMBA by 48 h with a total NADH turnover number of approximately 900. The overall productivity was 190 mol TFMBA/kg cells/h.

Full text of DOI:10.1016/j.procbio.2013.03.022

Process Biochemistry 48 (2013) 838–843
Contents lists available at SciVerse ScienceDirect
Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio
Use of hydrophobic bacterium Rhodococcus rhodochrous NBRC15564 expressed
thermophilic alcohol dehydrogenases as whole-cell catalyst in solvent-free
organic media
Aiko Hibino∗, Hisao Ohtake
Department of Biotechnology, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
The hydrophobic bacterium Rhodococcus rhodochrous NBRC15564 was employed as a whole-cell bio-
catalyst to examine its potential for bioconversion in solvent-free organic media. The genes encoding
two different thermostable alcohol dehydrogenases (ADHTt1 and ADHTt2) of Thermus thermophilus HB27
were expressed in R. rhodochrous cells. To inactivate indigenous mesophilic enzymes in R. rhodochrous,
transformant cells were heated at 70 ◦C for 10 min. Heat-treated hydrophobic wet cells were used for
the bioconversion of 2,2,2-trifluoroacetophenone (TFAP) to ␣-(trifluoromethyl) benzyl alcohol (TFMBA)
as a model reaction with ADHTt1. NADH, which was supplied in aqueous solution, was regenerated by
converting cyclohexanol to cyclohexanone by ADHTt2. All reactions were performed by suspending heat-
treated cells in solvent-free organic media consisting of 3.7 M TFAP and 4.8 M cyclohexanol (1:1, v/v ratio)
at 60 ◦C. When 800 mg heat-treated R. rhodochrous cells were dispersed in 2 mL of solvent-free organic
media (400 mg cells/mL), the product concentration reached about 3.6 M TFMBA by 48 h with a total
NADH turnover number of approximately 900. The overall productivity was 190 mol TFMBA/kg cells/h.
© 2013 Elsevier Ltd. All rights reserved.
Received 28 January 2013
Received in revised form 22 March 2013
Accepted 26 March 2013
Available online 12 April 2013
Keywords:
Thermostable enzyme
Hydrophobic bacteria
Alcohol dehydrogenase
Organic media
Whole-cell catalysis
Rhodococcus rhodochrous
1. Introduction
aqueous phase [4,19,20]. However, a small interfacial area limits
the mass transfer of the substrate and product.
Biocatalysis has emerged as an important technology for pro-
ducing specialty and commodity chemicals [1–5]. Enzymes have
great potential and versatility for catalyzing reactions with high
regio-, stereo-, and enantio-selectivities, which are important in
industrial organic synthesis, but difficult to achieve by chemical
means [6–9]. Since enzymes can catalyze chemical reactions under
mild conditions, they have a potential to provide an environmen-
tally benign approach to industrial chemical processes [10]. In
enzymatic processes, coenzyme requirements often make the reac-
tion prohibitive [5,11]. On the other hand, whole cells have been
used to regenerate cofactors such as NADH and NADPH. Whole cells
can be readily removed from reaction mixtures by centrifugation
in downstream processes [5].
Many organic solvents are toxic to metabolically active cells. In
addition, the complete removal of water from the reaction system
results in the loss of biocatalytic activity in living cells [5,11,12]. To
minimize the toxicity of organic solvents, biocatalytic processes in
aqueous-organic biphasic media have been developed [4,13–19].
The presence of an organic phase increases substrate solubility,
while minimizing the toxicity of chemicals to living cells in the
Organic monophasic media could be an alternative to aqueous-
organic biphasic systems, when both substrate and product are
water-insoluble or unstable in water [21]. The use of solvent-
free organic media seems to be potentially beneficial for product
recovery and waste disposal. Some enzymes can catalyze reac-
tions in organic media [4,19]. For example, Mutti and Kroutil
[22] have recently reported the asymmetric amination of ketones
using lyophilized crude cell-free extracts in an organic solvent.
Thermophilic enzymes often show resistance to high or low pH,
detergents, and organic solvents [23–28].
In the present study, the hydrophobic bacterium Rhodococcus
rhodochrous NBRC15564, which expressed thermophilic alcohol
dehydrogenases (designated ADHTt1 and ADHTt2) of Thermus ther-
mophilus HB27, was examined for its bioconversion activity in
solvent-free organic media. This bacterium showed high affinity
for water-immiscible hydrophobic chemicals and could be well dis-
persed in organic media [29]. To inactivate indigenous mesophilic
enzymes, R. rhodochrous transformants were heated at 70 ◦C for
10 min. The bioconversion of 2,2,2-trifluoroacetophenone (TFAP)
to ␣-(trifluoromethyl) benzyl alcohol (TFMBA) was employed as
a model reaction with ADHTt1 (Fig. 1). NADH was regenerated by
converting cyclohexanol to cyclohexanone with ADHTt2. Cyclohex-
anol, but not isopropyl alcohol, was employed as a substrate for
NADH regeneration, because volatile chemicals are difficult to use
∗
Corresponding author. Tel.: +81 6 6879 7435; fax: +81 6 6879 7439.
E-mail address: aiko hibino@bio.eng.osaka-u.ac.jp (A. Hibino).
1359-5113/$ – see front matter © 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.procbio.2013.03.022

A. Hibino, H. Ohtake / Process Biochemistry 48 (2013) 838–843
2.4. BATH assay
839
BATH assay was performed by the method of Hamada et al. [37]. Cells were
washed with 0.85% NaCl and resuspended in 4 mL of the same solution at an OD660
of 1.0. After adding 400 ␮L of n-tetradecane, n-hexadecane or toluene, the cell
suspension was gently vortexed for 1 min and left to stand at room temperature
for 1 h. BATH (%) was calculated from the initial and final OD600s in the aqueous
phase as
initial OD660 − final OD660
BATH (%) = 100 ×
initial OD660
Fig. 1. Bioconversions of 2,2,2-trifluoroacetophenone (TFAP) to ␣-(trifluoromethyl)
benzylalcohol (TFMBA) and cyclohexanol to cyclohexanone using ADHTt1 and
ADHTt2, respectively.
2.5. Enzyme assay
Crude ADHTt1 activity in the aqueous medium was assayed by measuring
the change in absorbance at 340 nm of NADH at 60 ◦C. To obtain crude ADHTt1
,
100 mg/mL bacterial cells were sonicated using an ultrasonic disruptor (UD-201:
Tomy, Japan), heated at 70 ◦C for 10 min and centrifuged at 8000 × g for 10 min.
Crude enzyme assay was performed by adding 10 ␮L of supernatant to 1 mL of
a preheated assay mixture containing 2 mM TFAP and 0.2 mM NADH. The NADH
aqueous solution was prepared using 100 mM Tris–HCl (pH 8.0). The absorp-
tion coefficient of NADH at 340 nm was 6.22 mM/cm. ADHTt1 activity in the
whole cells was assayed by adding 200 mg of the heat-treated cells to 2 mL of
the assay mixture containing 37 mM TFAP, 9.3 M cyclohexane, and 4 mM NADH.
NADH was dissolved with ultrapure water (Milli-Q) at 250 mM, and 32 ␮L of
250 mM NADH was added to the reaction mixture at a final concentration of
4 mM.
in organic media at 60 ◦C. ADHTt1 was the thermophilic alchol dehy-
drogenase of T. thermophilus HB27, which has been described by
Pennacchio et al. [30]. ADHTt1 was employed as a highly enan-
tioselective short-chain NAD(H)-dependent alchol dehydrogenase.
ADHTt2 was a homolog of alcohol dehydrogenase of Thermus sp.
ATN1, which could effectively use cyclohexanol to regenerate
NADH [31,32].
All the reactions were performed in solvent-free organic media
consisting of 3.7 M TFAP and 4.8 M cyclohexanol (a 1:1, v/v ratio)
at 60 ◦C.
2.6. SDS-PAGE
After disrupting 100 mg/mL R. rhodochrous cells, which expressed ADHTt1 and
ADHTt2, by sonication, the samples were heated at 70 ◦C for 10 min and centrifuged at
10,000 × g for 2 min. About 50 ␮L of the supernatant was mixed with 50 ␮L of Sample
Buffer (100 mM Tris–HCl (pH 6.8), 20% (v/v) glycerol, 12% (v/v) ␤-mercaptoethanol,
and 4% SDS and 0.004% bromophenol blue) and boiled for 3 min. About 20 ␮L of each
sample was subjected to SDS-PAGE.
2. Materials and methods
2.1. Chemicals
TFAP, TFMBA, and (R)-(−)-TFMBA were purchased from Tokyo Chemical
Industry, Japan. (S)-(+)-TFMBA was obtained from Sigma–Aldrich (MO, USA). Cyclo-
hexanol, cyclohexanone, cyclohexane, n-tetradecane, n-hexadecane, and toluene
were purchased from Nakalai (Kyoto, Japan). NADH was obtained from Wako (Osaka,
Japan). All the chemicals used in the present study were of analytical grade.
2.7. Bioconversion
Various amounts of heat-treated wet R. rhodochrous cells were suspended in
2 mL of 3.7 M TFAP and 4.8 M cyclohexanol (1:1, v/v ratio). NADH was supplied
in an aqueous solution at the start of incubation at 60 ◦C. NADH was dissolved
with Milli-Q at 250 mM. When the final NADH concentration in the reaction
mixture was 0.4, 4.0 or 40 mM, 3.2, 32 or 320 ␮L water was brought into the
2 mL organic media, respectively. After centrifugation, the supernatant was deter-
mined using a gas chromatography system (GC-2014, Shimadzu, Kyoto, Japan)
with a flame ionization detector. GC analysis was performed with a DB-17 column
(30 m × 0.250 mm × 0.25 ␮m, J&W Scientific, USA) and nitrogen at 70 kPa as the car-
2.2. Bacterial strains and plasmids
R. rhodochrous NBRC15564 was obtained from the Biological Resource Center,
National Institute of Technology and Evaluation. Escherichia coli B strain BL21 (DE3)
(Novagen, Germany), Rhodococcus opacus B-4 [33], and Rhodococcus erythropolis PR4
[34] were used in the bacterial adhesion to hydrocarbon (BATH) assay. E. coli DH5␣
was used as the molecular cloning host. To clone the alcohol dehydrogenase gene of
T. thermophilus HB27 (adhTt1) [30], a DNA fragment was amplified by PCR with the
primers 5ꢀ-ttcatatgggccttttcgctggcaa and 5ꢀ-ttgaattcctacaccggccgccccgccatcatg (the
NdeI and EcoRI restriction sites are underlined, respectively). T. thermophilus HB27
genomic DNA was used as the template. The amplified DNA fragment was digested
with EcoRI and cloned into EcoRI- and EcoRV-digested pBR322. The DNA fragment
containing adhTt1 was digested with NdeI and EcoRI and subcloned into pTipQT2 [35]
or pET-21a(+) (Novagen, Germany).
rier gas. Column temperature was initially kept at 90 ◦C for 3 min, increased to 240 ◦
C
at a rate of 20 ◦C/min and kept at 240 ◦C for 3 min. Both the injector and detector
temperatures were set at 260 ◦C. Chiral GC was performed with a MEGA-DEX DMP ␤
column (25 m × 0.250 mm × 0.25 ␮m, MEGA S.N.C., Italy) and nitrogen at 70 kPa as a
carrier gas [30]. Column temperature was initially kept at 130 ◦C for 2 min, increased
to 150 ◦C at a rate of 2.5 ◦C/min and kept at 150 ◦C for 3 min.
To clone the adhTt2 gene from T. thermophilus HB27 (GenBank acces-
sion no. YP 004007), which encodes
a homolog of alcohol dehydrogenase of
3. Results
Thermus sp. ATN1, a DNA fragment was amplified by PCR with the primers 5ꢀ-
aacatatgagggccgtggtctac and 5ꢀ-ttggatcctcagggcacgagggcgacctt (the NdeI and BamHI
restriction sites are underlined, respectively) [31,32]. The amplified DNA fragment
was digested with BamHI and cloned into BamHI- and EcoRV-digested pBR322. The
DNA fragment containing adhTt2 was digested with NdeI and BamHI and subcloned
into pTipRC2 [35].
3.1. Effect of heat treatment on bioconversion
The affinity of bacterial cells to water-immiscible hydrophobic
chemicals was examined by BATH assay (Table 1). The BATH assay
showed that R. rhodochrous had the highest affinity for the water-
immiscible hydrophobic chemicals among the bacterial strains
examined. To study the effect of heat treatment on cell hydropho-
bicity, BATH assay was also performed with cells that had been
subjected to heating at 70 ◦C for 10 min. Except in the case of E. coli,
no significant change was observed in the results of BATH assay
before and after heat treatment. R. rhodochrous NBRC15564, which
exhibited the highest affinity to hydrophobic chemicals, was used
for further study.
Interestingly, the heat-treated R. rhodochrous cells showed bet-
ter performance in the conversion of TFAP to TFMBA than the
untreated cells (Fig. 2). It has been reported that a high temper-
ature plays a significant role in the proper folding or oligomeric
structural formation of thermostable enzymes [38]. However, no
2.3. Growth conditions and cell preparation
E. coli was grown in LB medium at 37 ◦C. Other bacterial strains were grown
in 3% TSB medium (Becton, Dickinson and Company, USA) at 30 ◦C. Agar (1%) was
added when a solid medium was used. When needed, 100 ␮g of ampicillin or 15 ␮g
of tetracycline or 25 ␮L of chloramphenicol (Wako, Japan) were added to 1 mL of the
culture medium. To induce protein synthesis, 1 mM IPTG (Wako, Japan) or 20 ␮g/mL
thiostrepton (Sigma–Aldrich, USA) was added. R. opacus B-4, R. erythropolis PR4, and
R. rhodochrous NBRC15564 were transformed by the method of Na et al. [36]. For
heat treatment, cells were washed with 0.1 M Tris–HCl (pH 8.0), resuspended in
the same buffer at 100 mg cells/mL and heated at 70 ◦C for 10 min. Cell pellets were
obtained by centrifugation at 8000 × g for 10 min and stored at 4 ◦C. The stored cell
could be used for at least 7 months. The extracellular water content of cell pellets
was estimated using the method described by Yamashita et al. [29]. The total amount
of water in cell pellets was estimated by subtracting the dry pellet weight from the
wet pellet weight.

840
A. Hibino, H. Ohtake / Process Biochemistry 48 (2013) 838–843
Table 1
Effect of heat treatment on bacterial affinity to water-immiscible hydrophobic chemicals.
BATH (%)
n-Tetradecane
n-Hexadecane
Toluene
Unheated
Heated
Unheated
Heated
95a
Unheated
Heated
93a
R. opacus B-4
93
41
1
2
1
1
90
40
98
15a
1
4
1
95
46
1
2
1
4
95a
50a
R. erythropolis PR4
R. rhodochrous NBRC15564
E. coli BL21 (DE3)
56
1
1
43
1
98
97
98
93
35
2
1
100a
8.2
3.0
7.5
17a
1
Before and after heat treatment at 70 ◦C for 10 min, the cells were washed with 0.85% NaCl and resuspended in 4 mL of the same solution (OD660 = 1.0). After adding of
400 ␮L of n-tetradecane, n-hexadecane or toluene, the cell suspension was gently vortexed for 1 min and left to stand at room temperature for 1 h. The data represent the
mean standard deviation of three independent experiments.
a
The standard deviation was less than 1.
significance difference was detected between the bioconversion
activities of crude ADHTt1 and ADHTt2 before and after heat treat-
ment at 70 ◦C for 10 min (data not shown). Thus, the heat treatment
may have improved the membrane permeability of R. rhodochrous
cells, since the estelic lipid in the cell membrane is heat-sensitive
[39]. Kashihara et al. [40] have reported that heat treatment at 70 ◦C
can cause cell wall destabilization, forming openings on the cell
membrane in bacterial cells.
3.3. Improvement in TFMBA production
Expression of ADHTt1 and ADHTt2 in R. rhodochrous was con-
firmed by SDS-PAGE (Fig. 4). SDS-PAGE analysis showed the
production of 27- and 36-kDa proteins corresponding to ADHTt1
and ADHTt2, respectively. Pennacchio et al. [30] have reported that
ADHTt1 activity increases with increasing temperature up to 73 ◦C.
When the crude ADHTt1 and ADHTt2 activities were examined in
the present study, both the enzymes showed the highest activ-
ity at 70 ◦C (data not shown). However, these enzyme activities
were assessed in aqueous environments. To study the effects of
3.2. Effect of cell hydrophobicity on bioconversion
E. coli is an excellent host in terms of easy handling and availabil-
ity of molecular tools [22]. When crude ADHTt1 was prepared from
200 mg of bacterial cells, the total enzyme activity was significantly
higher in E. coli than in R. rhodochrous and R. erythropolis (Fig. 3a).
However, heat-treated whole cells of R. rhodochrous showed bet-
ter performance in the bioconversion of TFAP to TFMBA in organic
media than those of E. coli (Fig. 3b). In addition, TFMBA production
increased with increasing cell mass of R. rhodochrous or R. erythro-
polis from 200 to 800 mg. The % conversion of TFAP to TFMBA was
not proportional to bacteria cell mass. This was likely to reflect that
bacterial cells were not freely dispersed in organic media. Previ-
ously, we have showed that the hydrophobic bacterium R. opacus
formed small cell aggregates in organic media [29]. Since E. coli cells
showed essentially no affinity to organic media, increasing the cell
mass failed to increase TFMBA production. These results suggest the
advantage of hydrophobic cells as a whole-cell catalyst in organic
media.
16
14
12
10
8
6
4
2
Fig. 3. The percent conversion of TFAP to TFMBA by crude ADHTt1 (a) and ADHTt1
-
expressing whole cells (b). To obtain crude ADHTt1, 200 mg of R. erythropolis, R.
rhodochrous, or E. coli cells was sonicated using an ultrasonic disruptor, heated at
70 ◦C for 10 min and centrifuged at 8000 × g for 10 min. Crude enzyme assay was per-
formed by adding 10 ␮L of the cell-free supernatant to 1 mL of an aqueous solution
containing 2 mM TFAP and 0.2 mM NADH at 60 ◦C. The data is given by % conver-
sion of 2 mM TFAP to TFMBA after 1 min of incubation. Whole-cell ADHTt1 activity in
organic media was assayed by adding 200, 400 or 800 mg of heat-treated R. erythro-
polis (black), R. rhodochrous (white), or E. coli (gray) wet cells to 2 mL of an organic
solution containing 37 mM TFAP, 9.3 M cyclohexane, and 4 mM NADH. The data is
given by % conversion of 37 mM TFAP to TFMBA after 1 h of incubation. Error bars
represent the standard deviations of three independent reactions.
0
0
1
2
3
4
5
Time (h)
Fig. 2. Effect of heat treatment on the conversion of TFAP to TFMBA. A mass of
200 mg heat-treated (diamonds) or untreated wet cells (squares) were added to
the reaction mixture containing 2 mL of 3.7 M TFAP and 4.8 M cyclohexanol. At the
start of incubation at 60 ◦C, 32 ␮L of aqueous 250 mM NADH was added to the mix-
ture. The final concentration of NADH was 4 mM. Error bars represent the standard
deviations of three independent reactions.

A. Hibino, H. Ohtake / Process Biochemistry 48 (2013) 838–843
841
100
90
80
70
60
50
40
30
20
10
0
0
10
20
30
40
50
Time (h)
Fig. 6. Effect of cell concentration on the conversion of TFAP to TFMBA. A mass of
200 (squares), 400 (diamonds), or 800 mg (circles) heated-treated wet R. rhodochrous
cells was added to 2 mL of the reaction mixture consisting of 3.7 M TFAF and 4.8 M
cyclohexanol. At the start of incubation at 60 ◦C, 32 ␮L of Milli-Q water containing
250 mM NADH was added to the reaction mixture. Error bars represent the standard
deviations of two to five independent reactions.
mixture (Table 2). With increasing NADH concentration from 0.4
to 4.0 mM, the conversion of TFAP to TFMBA increased from 64
to 97% in 48 h (Fig. 7). However, no significant improvement was
observed with increasing NADH concentration from 4.0 to 40 mM.
When the NADH concentration was 40 mM, 320 ␮L of aqueous solu-
tion containing 250 mM NADH was added to the organic media. This
indicated that the volume of water added to the organic media was
approximately ten times more than that at 4.0 mM NADH. When
320 ␮L aqueous solution containing 25 mM NADH was add to the
2 mL reaction mixture (a final concentration of 4.0 mM NADH), the
conversion of TFAP to TFMBA was decreased by 7%, compared to
the addition of 32 ␮L aqueous solution containing 250 mM NADH
(Table 2). When 97% of 3.7 M TFAP was converted to TFMBA, the
overall turnover number of NADH was approximately 900.
Fig. 4. SDS-PAGE of T. thermophilus HB27 ADHTt1 and ADHTt2 expressed in R.
rhodochrous cells. Left lane, molecular mass markers; right lane, ADHTt1 and ADHTt2
of Thermus thermophilus HB27 expressed in R. rhodochrous cells. The arrows indicate
ADHTt1 and ADHTt2, respectively.
temperature on ADHTt1 and ADHTt2 activities in organic media, the
bioconversion of TFAF to TFMBA was conducted using heat-treated
R. rhodochrous cells at various temperatures from 50 to 70 ◦C (Fig. 5).
The results showed that the bioconversion rate was significantly
high at 60 ◦C, compared to those observed at 50 and 70 ◦C. This
optimal temperature was approximately 10 ◦C lower in the organic
media than those detected with crude ADHTt1 and ADHTt2 in aque-
ous environments. However, the reason is unclear at this time. For
further study, TFAF bioconversion was conducted at 60 ◦C.
To study the effect of cell concentration on TFMBA production,
bioconversion assay was performed using various cell concentra-
tions (Fig. 6). The product concentration at 48 h increased from
0.94 to 3.6 M with increasing cell mass from 200 to 800 mg
(100–400 mg/L). Heat-treated R. rhodochrous cells failed to exhibit
bioconversion of TFAP, unless NADH was added to the reaction
4. Discussion
Many organic solvents are toxic to metabolically active micro-
bial cells [5]. The use of aqueous-organic two-phase media
is one possible solution to this problem [4,5,13–19]. On the
other hand, the use of solvent-tolerant microorganisms, includ-
ing Pseudomonas, Bacillus, and Rhodococcus species, is beneficial
for whole-cell bioconversion in two-phase media [19]. Organic
monophase media could be an alternative to aqueous-organic
100
90
80
70
60
50
40
30
20
10
0
18
16
14
12
10
8
6
4
2
0
10
20
30
40
50
0
0
1
2
3
4
5
Time (h)
Time (h)
Fig. 7. Effect of NADH addition on the conversion of TFAP to TFMBA. A mass of
800 mg of heated-treated wet cells was added to 2 mL of a reaction mixture con-
taining 3.7 M TFAF and 4.8 M cyclohexanol. At the start of incubation at 60 ◦C, 3.2
(squares), 32 (circles), or 320 ␮L (diamonds) of Milli-Q water containing 250 mM
NADH was added to the reaction mixture. The NADH concentrations in the reac-
tion mixture were 0.4 (squares), 4.0 (circles), and 40 mM (diamonds). Error bars
represent the standard deviations of two to four independent reactions.
Fig. 5. Effect of temperature on the conversion of TFAP to TFMBA. A mass of 200 mg
heat-treated wet cells was added to 2 mL of the reaction mixture containing 3.7 M
TFAF and 4.8 M cyclohexanol. Bioconversion of TFMF to TFMBA was performed at
50 (squares), 60 (diamonds), and 70 ◦C (circles). At the start of incubation, 32 ␮L
of water containing 250 mM NADH was added to the reaction mixture. Error bars
represent the standard deviations of three independent reactions.

842
A. Hibino, H. Ohtake / Process Biochemistry 48 (2013) 838–843
Table 2
Effect of the addition of water containing NADH on the conversion of TFAP to TFMBA.
NADH supply
NADH concentration in the reaction mixture (mM)
Conversion of TFAP to TFMBA by 48 h (%)
No addition of NADH
0
4.0
4.0
Not detected
97%
90%
Addition of 32 ␮L water containing 250 mM NADH
Addition of 320 ␮L water containing 25 mM NADH
Addition of 320 ␮L water containing 250 mM NADH
40
90%
A mass of 800 mg of heated-treated wet cells was added to 2 mL of a reaction mixture consisting of 3.7 M TFAP and 4.8 M cyclohexanol (1:1, v/v ratio). At the start of incubation
at 60 ◦C, 32 ␮L water, 32 ␮L aqueous 250 mM NADH (the final concentration of 4.0 mM NADH in the reaction mixture), 320 ␮L aqueous 25 mM NADH (the final concentration
of 4.0 mM NADH), or 320 ␮L aqueous 250 mM NADH (the final concentration of 40 mM NADH) was added to the reaction mixture.
two phase systems, when both substrate and product are
water-insoluble or unstable in water [21]. In previous studies
[21,29,41,42], organic solvents have been used to dissolve water-
immiscible hydrophobic substrates for monophase media. The
conversion of cholesterol to cholest-4-ene-3-one has been per-
formed using Nocardia species in carbon tetrachloride [41] and
Bacillus subtilis AF 333249 in toluene [42]. Yamashita et al. [29] have
reported that the hydrophobic bacterium R. opacus B-4 could con-
vert indole to indigo in an essentially water-free bis (2-ethylhexyl)
phthalate (BEHP).
When 800 mg R. rhodochrous cells were collected from 2 mL aque-
ous cell suspension by centrifugation at 8000 × g for 10 min, the
resulting cell pellet contained about 10% (w/w) extracellular water
(data not shown). This indicates that about 80 ␮L water (equiv-
alent to 80 mg water) was removed into the cell pellet from the
2 mL cell suspension. Assuming that the extracellular space of
cell pellet was filled with the organic media, product loss from
2 mL organic media due to cell separation could be approximately
5%.
Alcohol dehydrogenases display low to moderate enantioselec-
tivities in aqueous monophase systems [44]. Pennacchio et al. [30]
have shown that purified ADHTt1 exhibits more than 93% enantio-
selectivity in the conversion of TFAP to (R)-(−)-TFMBA in aqueous
environments. In the present study, ADHTt1 in R. rhodochrous cells
showed an approximately 52% enantioselectivity in the organic
media. Scholz et al. [21] have reported that wet E. coli cells
showed a lower enantioselectivity for 2-chloromandelonitrile, 2-
fluoromandelonitrile and 2-furaldehyde than lyophilized cells. del
Olmo et al. [48] have also shown that S. cerevisiae could carry out
the asymmetric aldol condensation between 4-nitrobenzaldehyde
and acetone with the highest enantioselectivity of 45% ee at 2.5%
of water in organic media. In this case, the enantioselectivity
decreased from 45 to 5% with increasing water content from 2.5 to
50%. Taking together, it cannot be ruled out that the water brought
into the reaction mixture caused a reduction of the enantioselectiv-
ity of ADHTt1 in organic media in the present study. Further study
is needed to clarify the effect of water content on enantioselec-
tivity of enzymes in organic media. Unfortunately, due to loss of
ADHs activity, heat-treated cells could not be re-used in the present
model system.
Heat treatment is likely to improve membrane permeability
in addition to the inactivation of indigenous mesophilic enzymes.
Restiawaty et al. [49] have reported that heat-treated E. coli
recombinants could effectively convert glycerol to glycerol-3-
phosphate using polyphosphate as the extracellular phosphate
donor. The improvement in membrane permeability by heat treat-
ment allowed high-molecular-weight polyphosphates to diffuse
into the cytoplasmic space where they were used in glycerol
phosphorylation catalyzed by thermostable polyphosphate kinase.
Moreover, bioconversion at elevated temperatures has several
advantages such as the prevention of contamination, the decrease
in viscosity, and the enhancement of diffusion [50]. However, it
should be noted that volatile chemicals are difficult to use as sub-
strate in organic media at elevated temperature. This was the
reason that cyclohexanol, but not isopropanol, was employed as
the substrate for NADH regeneration by ADHTt2 in the present
study.
In summary, 97% of 3.7 M TFAP was converted to TFMBA using
800 mg heat-treated R. rhodochrous wet cells after 48 h in solvent-
free organic media consisting of 3.7 M TFAP and 4.8 M cyclohexanol
(1:1, v/v ratio). The final product concentration reached about
3.6 M TFMBA at an NADH turnover number of approximately 900.
The use of solvent-free organic media is potentially beneficial,
since organic solvents are often toxic, costly and harmful to the
environment.
Lyophilized E. coli has also been used for bioconversion in
organic media [21,43,44]. Lyophilized E. coli cells, which overex-
press an alcohol dehydrogenase from Rhodococcus ruber, have been
used in a micro-aqueous system with 99% (v/v) isopropanol [43].
Lyophilized E. coli cells, which express the Candida parapsilosis
carbonyl reductase, have been applied to a reaction medium con-
taining only water-immiscible hydrophobic substrates. This system
could convert 300–500 g/L acetophenone to (S)-phenylethanol
with a product yield of 98% or greater in 14 days [44]. Lyophilized
Saccharomyces cerevisiae has also been used for the reduction of
keto esters in organic media [45]. Rather et al. [46] have reported
the use of lyophilized cells of the thermotolerant yeast Pichia
etchellsii for the synthesis of long-chain alkyl glycosides. In these
systems, biocatalytic activity increased with increasing water activ-
ity. Scholz et al. [21] have shown that living E. coli cells exhibit a
higher activity to produce chiral cyanohydrins from various alde-
hydes and hydrogen cyanide than lyophilized E. coli cells. Although
lyophilization is useful for improving cell permeability, it seems
costly and time-consuming. In the present study, the hydrophobic
bacterium R. rhodochrous was used as the biocatalyst in solvent-
free organic media without cell lyophilization. By suspending
heat-treated R. rhodochrous cells in organic media consisting of
the hydrophobic substrates TFAP and cyclohexanol, approximately
3.6 M TFMBA was produced from TFAP in 48 h (Fig. 7). This is the first
report on the use of hydrophobic bacterial cells for bioconversion
in solvent-free organic media.
Hydrophobic bacteria could be well dispersed in organic media
[29]. Species in the mycolata family of actinomyces, including
Rhodococcus species, contain mycolic acids in their cell wall. This is
likely responsible for their cell surface hydrophobicity [47]. In the
present study, R. rhodochrous NBRC15564 was used as the whole-
cell biocatalyst, since it showed the highest affinity to hydrophobic
chemicals among the bacterial strains examined. The TFMBA yield
by R. rhodochrous increased in increasing cell concentration in
organic media (Fig. 3b). By contrast, no significant increase in the
yield of TFMBA was detected with the hydrophilic E. coli cells.
This implies the advantage of hydrophobic cells over hydrophilic
cells as whole-cell catalysts in solvent-free organic media. Cell-
surface hydrophobicity may favor the interaction between bacterial
cells and hydrophobic compounds. This likely allows R. rhodochrous
to exhibit a high bioconversion activity in solvent-free organic
media. In addition, the cell pellets of R. rhodochrous could be
readily removed from the reaction mixture after 48 h of incuba-
tion by centrifugation (800 × g for 10 min). No slurry or gel-like
material was detected with the supernatant by visual observation.

A. Hibino, H. Ohtake / Process Biochemistry 48 (2013) 838–843
843
Acknowledgment
[28] Rocha-Martín J, Vega D, Bolivar JM, Hidalgo A, Berenguer J, Guisán JM, et al.
Characterization and further stabilization of a new anti-prelog specific alcohol
dehydrogenase from Thermus thermophilus HB27 for asymmetric reduction of
carbonyl compounds. Bioresour Technol 2012;103:343–50.
[29] Yamashita S, Satoi M, Iwasa Y, Honda K, Sameshima Y, Omasa T, et al. Utilization
of hydrophobic bacterium Rhodococcus opacus B-4 as whole-cell catalyst in
anhydrous organic solvents. Appl Microbiol Biotechnol 2007;74:761–7.
[30] Pennacchio A, Pucci B, Secundo F, La Cara F, Rossi M, Raia CA. Purification and
characterization of a novel recombinant highly enantioselective short-chain
NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus. Appl
Environ Microbiol 2008;74:3949–58.
[31] Hollmann F, Kleeb A, Otto K, Schmid A. Coupled chemoenzymatic transfer
hydrogenation catalysis for enantioselective reduction and oxidation reactions.
Tetrahedron Asymmetry 2005;16:3512–9.
[32] Höllrigl V, Hollmann F, Kleeb AC, Buehler K. Schmid A.TADH, the thermostable
alcohol dehydrogenase from Thermus sp. ATN1: a versatile new biocatalyst for
organic synthesis. Appl Microbiol Biotechnol 2008;81:263–73.
This work was supported in part by a grant-in-aid for scientific
research from the Ministry of Education, Culture, Sports, Science
and Technology of Japan.
References
[1] Schmid A, Dordick JS, Hauer B, Kiener A, Wubbolts M, Witholt
B. Industrial biocatalysis today and tomorrow. Nature 2001;409:
258–68.
[2] Straathof AJ, Panke S, Schmid A. The production of fine chemicals by biotrans-
formations. Curr Opin Biotechnol 2002;13:548–56.
[3] Pollard DJ, Woodley JM. Biocatalysis for pharmaceutical intermediates: the
future is now. Trends Biotechnol 2007;25:66–73.
[4] Garikipati SV, McIver AM, Peeples TL. Whole-cell biocatalysis for 1-
naphthol production in liquid–liquid biphasic systems. Appl Environ Microbiol
2009;75:6545–52.
[5] Murphy CD. The microbial cell factory. Org Biomol Chem 2012;10:1949–57.
[6] van Beilen JB, Duetz WA, Schmid A, Witholt B. Practical issues in the application
of oxygenases. Trends Biotechnol 2003;21:170–7.
[7] Bühler B, Schmid A. Process implementation aspects for biocatalytic hydrocar-
bon oxyfunctionalization. J Biotechnol 2004;113:183–210.
[8] Urlacher VB, Schmid RD. Recent advances in oxygenase-catalyzed biotransfor-
mations. Curr Opin Chem Biol 2006;10:156–61.
[9] Nolan LC, O’Connor KE. Dioxygenase- and monooxygenase-catalysed synthe-
sis of cis-dihydrodiols, catechols, epoxides and other oxygenated products.
Biotechnol Lett 2008;30:1879–91.
[10] Tao Y, Bentley WE, Wood TK. Phenol and 2-naphthol production by toluene 4-
monooxygenases using an aqueous/dioctyl phthalate system. Appl Microbiol
Biotechnol 2005;68:614–21.
[33] Na KS, Kuroda A, Takiguchi N, Ikeda T, Ohtake H, Kato J. Isolation and char-
acterization of benzene-tolerant Rhodococcus opacus strains. J Biosci Bioeng
2005;99:378–82.
[34] Komukai-Nakamura S, Sugiura K, Yamauchi-Inomata Y, Venkateswaran K,
Yamamoto S, Tanaka H, et al. Construction of bacterial consortia that degrade
Arabian light crude oil. J Ferment Bioeng 1996;82:570–4.
[35] Nakashima N, Tamura T. Isolation and characterization of
a rolling-
circle-type plasmid from Rhodococcus erythropolis and application of the
plasmid to multiple-recombinant-protein expression. Appl Environ Microbiol
2004;70:5557–68.
[36] Na KS, Nagayasu K, Kuroda A, Takiguchi N, Ikeda T, Ohtake H, et al. Development
of a genetic transformation system for benzene-tolerant Rhodococcus opacus
strains. J Biosci Bioeng 2005;99:408–14.
[37] Hamada T, Sameshima Y, Honda K, Omasa T, Kato J, Ohtake H. A comparison of
various methods to predict bacterial predilection for organic solvents used as
reaction media. J Biosci Bioeng 2008;106:357–62.
[38] Izumikawa N, Shiraki K, Nishikori S, Fujiwara S, Imanaka T, Takagi M. Biophysi-
cal analysis of heat-induced structural maturation of glutamate dehydrogenase
from a hyperthermophilic archaeon. J Biosci Bioeng 2004;97:305–9.
[39] Konings WN, Albers SV, Koning S, Driessen AJ. The cell membrane plays a crucial
role in survival of bacteria and archaea in extreme environments. Antonie Van
Leeuwenhoek 2002;81:61–72.
[40] Kashihara H, Kang BM, Omasa T, Honda K, Sameshima Y, Kuroda A, et al. Electron
microscopic analysis of heat-induced leakage of polyphosphate from a phoU
mutant of Escherichia coli. Biosci Biotechnol Biochem 2011;74:865–8.
[41] Buckland BC, Dunnill P, Lilly MD. The enzymatic transformation of water-
insoluble reactants in nonaqueous solvents. Conversion of cholesterol to
cholest-4-ene-3-one by a Nocardia sp. Reprinted from Biotechnology and Bio-
engineering, vol. XVII, pp. 815–826 (1975). Biotechnol Bioeng 2000;67:714–9.
[42] Andhale MS, Sambrani SA. Cholesterol biotransformation in monophasic sys-
[11] Nikolova P, Ward OP. Whole cell biocatalysis in nonconventional media. J Ind
Microbiol 1993;12:76–86.
[12] Dordick JS. Designing enzymes for use in organic solvents. Biotechnol Prog
1992;8:259–67.
[13] Witholt B, de Smet MJ, Kingma J, van Beilen JB, Kok M, Lageveen RG, et al.
Bioconversions of aliphatic compounds by Pseudomonas oleovorans in mul-
tiphase bioreactors: background and economic potential. Trends Biotechnol
1990;8:46–52.
[14] Freeman A, Woodley JM, Lilly MD. In situ product removal as a tool for biopro-
cessing. Biotechnology (NY) 1993;11:1007–12.
[15] Wubbolts MG, Favre-Bulle O, Witholt B. Biosynthesis of synthons in two-liquid-
phase media. Biotechnol Bioeng 1996;52:301–8.
[16] Daugulis AJ. Partitioning bioreactors. Curr Opin Biotechnol 1997;8:169–74.
[17] León R, Fernandes P, Pinheiro HM, Cabral JMS. Whole-cell biocatalysis in organic
media. Enzyme Microb Technol 1998;23:483–500.
[18] Collins LD, Daugulis AJ. Benzene/toluene/p-xylene degradation. Part I. Solvent
selection and toluene degradation in a two-phase partitioning bioreactor. Appl
Microbiol Biotechnol 1999;52:354–9.
[19] Heipieper HJ, Neumann G, Cornelissen S, Meinhardt F. Solvent-tolerant bacte-
ria for biotransformations in two-phase fermentation systems. Appl Microbiol
Biotechnol 2007;74:961–73.
tems by solvent tolerant Bacillus subtilis AF 333249. Indian
J Biotechnol
2006;5:389–93.
[43] de Gonzalo G, Lavandera I, Faber K, Kroutil W. Enzymatic reduction of ketones
in micro-aqueous media catalyzed by ADH-A from Rhodococcus ruber. Org Lett
2007;9:2163–6.
[44] Jakoblinnert A, Mladenov R, Paul A, Sibilla F, Schwaneberg U, Ansorge-
Schumacher MB, et al. Asymmetric reduction of ketones with recombinant
E. coli whole cells in neat substrates. Chem Commun (Camb) 2011;47:12230–2.
[45] Rotthaus O, Kürger D, Demuth M, Schaffner K. Reductions of keto esters with
baker’s yeast in organic solvents—a comparison with the results in water. Tetra-
hedron 1997;53:935–8.
[46] Rather MY, Mishra S, Verma V, Chand S. Biotransformation of methyl-␤-d-
glucopyranoside to higher chain alkyl glucosides by cell bound ␤-glucosidase
of Pichia etchellsii. Biores Technol 2012;107:287–94.
[47] Sokolovská I, Rozenberg R, Riez C, Rouxhet PG, Agathos SN, Wattiau P.
Carbon source-induced modifications in the mycolic acid content and cell
wall permeability of Rhodococcus erythropolis E1. Appl Environ Microbiol
2003;69:7019–27.
[48] del Olmo ML, Andreu C, Asensio G. Use of Saccharomyces cerevisiae as a whole
cell system for aldol condensation in organic medium: study of the factors
affecting the biotransformation. J Mol Catal B Enzym 2011;72:90–4.
[49] Restiawaty E, Iwasa Y, Maya S, Honda K, Omasa T, Hirota R, et al. Feasibility of
thermophilic ATP regeneration system using Thermus thermophilus polyphos-
phate kinase. Process Biochem 2011;46:1747–52.
[50] Becker P, Abu-Reesh I, Markossian S, Antranikian G, Märkl H. Determination
of the kinetic parameters during continuous cultivation of the lipase produc-
ing thermophile Bacillus sp. IHI-91 on olive oil. Appl Microbiol Biotechnol
1997;48:184–90.
[20] Bruce LJ, Daugulis AJ. Solvent selection strategies for extractive biocatalysis.
Biotechnol Prog 1991;7:116–24.
[21] Scholz KE, Okrob D, Kopka B, Grünberger A, Pohl M, Jaeger KE, et al. Synthesis
of chiral cyanohydrins by recombinant Escherichia coli cells in a micro-aqueous
reaction system. Appl Environ Microbiol 2012;78:5025–7.
[22] Mutti FG, Kroutil W. Asymmetric bio-amination of ketones in organic solvents.
Adv Synth Catal 2012;354:3409–13.
[23] Vieille C, Burdette DS, Zeikus JG. Thermozymes. Biotechnol Annu Rev
1996;2:1–83.
[24] Niehaus F, Bertoldo C, Kähler M, Antranikian G. Extremophiles as a source
of novel enzymes for industrial application. Appl Microbiol Biotechnol
1999;51:711–29.
[25] Bruins ME, Janssen AE, Boom RM. Thermozymes and their applications:
a
review of recent literature and patents. Appl Biochem Biotechnol
2001;90:155–86.
[26] Demirjian DC, Morís-Varas F, Cassidy CS. Enzymes from extremophiles. Curr
Opin Chem Biol 2001;5:144–51.
[27] Rocha-Martín J, VegaD. Cabrera Z, Bolivar JM, Fernandez-Lafuente R, Berenguer
J, Guisan JM. Purification, immobilization and stabilization of a highly enantio-
selective alcohol dehydrogenase from Thermus thermophilus HB27 cloned in E.
coli. Process Biochem 2009;44:1004–12.