Novel ruthenium(II) triazine complex [Ru(bdpta)(tpy)]2+ co-targeting drug resistant GRP78 and subcellular organelles in cancer stem cells

Article abstract of DOI:10.1016/j.ejmech.2018.07.048

Ruthenium(II/III) metal complexes have been widely recognized as the alternative chemotherapeutic agents to overcome the drug resistance and tumor recurrence associated with platinum derivatives. In this work, a novel ruthenium(II) triazine complex namely

Full text of DOI:10.1016/j.ejmech.2018.07.048

European Journal of Medicinal Chemistry 156 (2018) 747e759
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Research paper
Novel ruthenium(II) triazine complex [Ru(bdpta)(tpy)]2þ co-targeting
drug resistant GRP78 and subcellular organelles in cancer stem cells
Baskaran Purushothaman 1, Parthasarathy Arumugam 1, Hee Ju, Goutam Kulsi,
Annie Agnes Suganya Samson, Joon Myong Song*
College of Pharmacy, Seoul National University, Seoul 151-742, South Korea
a r t i c l e i n f o
a b s t r a c t
Article history:
Ruthenium(II/III) metal complexes have been widely recognized as the alternative chemotherapeutic
agents to overcome the drug resistance and tumor recurrence associated with platinum derivatives. In
this work, a novel ruthenium(II) triazine complex namely, 1 ([Ru(bdpta)(tpy)]2þ) was synthesized and
spectroscopically characterized. Drug resistant cancer stem cells (CSCs) were used to evaluate the
cytotoxicity of Ru(II) complex 1. The complex 1 showed a greater cytotoxic potential with IC50 values
lower than that of cisplatin. The intracellular localization assay confirmed that the complex 1 was
effectively distributed into mitochondria as well as endoplasmic reticulum (ER), and executed a ROS-
mediated calcium and Bax/Bak dependent intrinsic apoptosis. Interestingly, direct interaction between
complex 1 and glucose regulated protein 78 (GRP78), a protein associated with drug resistance caused
the ROS-mediated ubiquitination of GRP78. Notably, western blot and confocal microscopy analysis
confirmed that complex 1 significantly reduced the protein levels of GRP78. Dose-dependent in vivo
antitumor efficacy against CD133þHCT-116 CSCs derived tumor xenograft further validated that complex
1 could be an effective chemotherapeutic agent.
Received 9 April 2018
Received in revised form
14 July 2018
Accepted 17 July 2018
Available online 20 July 2018
Keywords:
Ruthenium(II) complex
Cancer stem cells
Glucose regulated protein 78
Mitochondria
Apoptosis
© 2018 Published by Elsevier Masson SAS.
1. Introduction
[15e17]. Rapidly dividing cells express the elevated levels of
transferrin due to the higher requirement of iron. It has previously
Platinum based cisplatin derivatives such as cisplatin, carbo-
platin and oxaliplatin are the commonly employed chemothera-
peutic drugs against solid tumours such as testicular, head and
neck, bladder, ovarian, and lung cancers [1,2]. However, long-term
administration of platinum derivatives results in side effects, as
well as drug resistance and subsequently relapse of cancer [3e5]. In
search of potential alternatives to the platinum derivatives, ruthe-
been reported that the expression of iron transport proteins such as
transferrin and ferritin were increased in metastasis cancer [18,19].
Hence, ruthenium(II, III) complexes are more likely to accumulate
in cancer tissue. After a successful preclinical studies, NAMI-A, the
first ruthenium(III) complex has completed the phase-I/II clinical
trials in combination with gemcitabine in non-small cell lung
cancer (NSCLC) patients. However, the trial was unsuccessful due to
the side effects and less activity of NAMI-A in NSCLC [20,21]. The
disappointing results of NAMI-A necessitate the design of new
ruthenium complexes in the field of anti-cancer drug discovery. In
the present work, we have synthesized a novel ruthenium(II)
complex with specific ligand to overcome multidrug resistance in
cancer stem cells (CSCs), namely ruthenium(II) triazine complex 1
([Ru(bdpta)(tpy)]2þ). The tridentate ligand 4-(4,6-bis(3,5-
dimethyl-1H-pyrazole-1-yl)-1,3,5,-triazine-2-yl)-N,N-diethylani-
line (bdpta) was used in the synthesis of ruthenium(II) complex 1.
In our design, the pyrazolyl-1,3,5-triazine (bdpta) was taken as a
core component and it acts as chelating ligand to synthesize
complex 1. The 1,3,5-triazine chemical core based compounds have
been used as anticancer agents for many groups [22e24]. Few
nium based metal complexes have emerged as
a potential
contender to platinum derivatives [6,7]. Recent in-vitro and in-vivo
studies on ruthenium(II, III) metal complexes indicated that de-
rivatives of ruthenium metal complexes could resolve the issues
such as side effects and drug resistance in cancer [8e14]. Ruth-
enium(III) complex exhibits a strong affinity towards serum albu-
min and transferrin, this property ensures the smooth
transportation of ruthenium complex across the vascular system
* Corresponding author.
E-mail address: jmsong@snu.ac.kr (J.M. Song).
These authors contributed equally to this work.
1
https://doi.org/10.1016/j.ejmech.2018.07.048
0223-5234/© 2018 Published by Elsevier Masson SAS.

748
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
ruthenium complexes containing 1,3,5-triazine ligand were re-
ported and their redox behaviour and luminescence properties
were studied [25,26]. However, no attention has been focused on
the ruthenium(II) complexes containing a pyrazolyl-1,3,5-triazine
core as an anticancer agent, targeting subcellular organelles as
well as drug resistant proteins. Inspired by these findings our
attention was focused on the synthesis of novel Ru(II) complexes
with ligands targeting subcellular organelles. The complex 1 con-
taining N,N-diethylaniline moiety in 1,3,5-triazine core targets
mitochondria in cancer stem cells. Similarly, a polypyridyl group of
the complex 1 helps to accumulate in endoplasmic reticulum (ER)
due to its lipophilic nature [27].
Clusterin is an anti-apoptotic protein, elevated expression of clus-
terin has been reported in the paclitaxel/docetaxel resistance in
prostate, breast and lung cancer [34,35]. ATR is a cell cycle regu-
lating protein, it has been demonstrated that suppression of ATR
stimulates the malignant cells to apoptosis [36]. In addition, the
in vivo efficacy of complex 1 was evaluated using CD133þHCT-
116 CSCs induced tumor xenograft mice model. This work, to the
best of our knowledge, presents a detailed biological evaluation of a
multi-targeting ruthenium(II) triazine complex 1 on CSCs by
in vitro, as well as in vivo model.
2. Results and discussion
The newly synthesized Ru(II) complex 1 was characterized by
spectroscopic methods and their cytotoxicity was evaluated using a
cancer cell lines as well as CSCs. The CSCs was chosen as an in vitro
model to study the cytotoxicity, sub-cellular localization, drug
resistance and other molecular mechanisms pertaining to the
ruthenium(II) complex. For this purpose, CD133þ MCF-7 cells and
CD133þ HCT-116 cells were used. Cancer cells which expressing
CD44 and CD133 markers are widely recognized as CSCs. A number
of reports indicated that cisplatin resistance cancer cell lines
expressed significant levels of stem cell markers such as CD133 and
CD44 [28]. In addition, CSCs are widely considered for the recur-
rence of cancer since they express high levels of proteins associated
with drug resistance and cell survival mechanism [29]. Hence, the
CSCs model is an ideal model to evaluate the efficacy of drug per-
taining to drug resistance. It has been reported that the ROS
induced oxidation process can bring conformational changes to
protein and its side chain amino acids, which leads to the ubiq-
uitination of modified protein [30,31]. Due to the ROS generating
ability of the complex 1, its ROS mediated direct effect on the
proteins associated with drug resistance mechanism such as GRP-
78, clusterin (CLU), and ataxia telangiectasia and Rad3-related
protein (ATR) were analysed. GRP78, a major molecular chaperon
in the ER, was demonstrated in the drug resistance, stemness
characteristics of cancer cells and the recurrence of cancer [32,33].
2.1. Synthesis and characterization of Ru(II) complex 1
The ligand 4-(4,6-bis(3,5-dimethyl-1H-pyrazole-1-yl)-1,3,5,-
triazine-2-yl)-N,N-diethylaniline (bdpta) was prepared using a
previously described method and it is explained in detail in the
supporting information [37,38]. The ruthenium(II) complex 1 was
synthesized with their corresponding ligand (bdpta). The synthetic
protocol for Ru(II) complex 1 is represented in Scheme 1. The
[Ru(tpy)Cl3] (iv) was prepared by refluxing the equivalent molar
ratio of 2,2':60,200-terpyridine (iii) and RuCl3$3H2O in ethanol at
80 ꢀC for 3 h. The complex 1 was synthesized from an equal molar
ratio of [Ru(tpy)Cl3] and bdpta in ethylene glycol at 170 ꢀC over-
night under nitrogen protection. This was followed by anion ex-
change with NaClO4 and purification by column chromatography
with CH3CN and 10% KNO3 as an eluent. The complex 1 was isolated
as brown solid. The stability of the synthesized Ru(II) complex 1
was checked by dissolving the compound in PBS buffer and kept at
room temperature for 24 h. No obvious change was observed, and
this was further confirmed by using UV-Vis absorption spectros-
copy. The UV-Vis absorption and emission spectrum of ruth-
enium(II) complex 1 were measured in acetonitrile (See Fig. S1).
The electronic absorption spectrum for the Ru(II) complex 1 display
high energy bands at 396 nm, due to ligand-centered
p-p*
Scheme 1. Synthesis of Ru(II) complex 1; Reagents and conditions: (a) N,N-diethylaniline, 75 ꢀC, 8 h; (b) 3,5-dimethylpyrazole, K metal, THF, reflux, 8 h; (c) RuCl3$3H2O, ethanol,
reflux, 3 h; (d) bdpta, ethylene glycol, N2, reflux, 16 h.

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
749
Table 1
addition, CSCs expresses elevated levels of antioxidant enzymes
[40]. In the present study, as compared to the cisplatin, complex 1
showed two to threefold efficacy against cancer cell lines and
cancer stem cells.
IC50 value for complex 1 and cisplatin against MCF-7 and HCT-116 cancer cells,
CD44þMCF-7 and CD133þHCT-116 CSCs.a
Complex Name
IC50 Values (
m
M)
CD44þMCF-7 HCT-116
2.62 0.05 3.89 0.09
MCF-7
CD44þHCT-116
2.3. The cellular uptake and subcellular localization of Ru(II)
complex 1
Ru(II) complex 1 2.1 0.06 3.48 0.07
Cisplatin
5.1 0.23 8.63 0.42
6.01 0.49 11.14 0.7
a
Cell viability was determined by SRB assay after 48 h incubation (mean of three
independent experiments SD).
Successful chemotherapeutic efficacy of anticancer drug is
mostly dependent on the cellular uptake and accumulation in
intracellular organelles. To assess the levels of cellular uptake of the
Ru(II) complex 1, CD44þMCF-7 cells were treated with 10
mM of
transitions. The broad and low energy absorbance between 515 nm
are characteristic of metal-to-ligand charge-transfer (MLCT) tran-
sitions from the Ru(II) metal centre to the polypyridyl ligand.
The 1H NMR spectra of complex 1 in CD3OD show downfield
shifts in the positions of aromatic protons due to the incorporation
of terpyridine and bdpta ligands that were observed between
complex 1, and their intracellular fluorescence intensity was
investigated at 620 nm by FACS at different time intervals (30, 60,
and 90 min) (Fig. 1). The results herein show that the fluorescence
intensity of complex 1 was gradually increased from 30 min on-
wards and attained saturation at 60 min. The observed fluorescence
intensity of complex 1 within 30 min suggests a rapid cellular up-
take by MCF-7 CSCs. In order to analyse the mechanism of action of
the complex 1, subcellular localization assays were performed in
CD133þHCT-116 C SCs using organelle-specific dyes. Mito-tracker
red and ER tracker red dyes were used to assess the accumulation
of complex 1 in mitochondria (Fig. 2A) and ER (See Fig. 2B)
respectively. In addition, Hoechst dye was used for nuclear entry.
The overlapping confocal fluorescence microscopy images clearly
indicated that the complex 1 mostly distributed in mitochondria as
well as ER in the cytoplasm of CD133þHCT-116 cells. Subcellular
localization assay of complex 1 was also performed in CD44þMCF-
7 cells and confirmed that complex 1 effectively distributed in
mitochondria and ER (See Supplementary Fig. S2). These results
further showed that the complex 1 was poorly distributed in the
nucleus. The observed results indicated that the ER dependent
mitochondria mediated apoptotic pathway could be the mode of
action of the complex 1.
d
¼ 10.38 ppm and
diethylaniline and pyrazole group in the complex 1 show upfield
shifts in the spectrum, which were observed between
¼ 6.52 ppm
and
d
¼ 6.52 ppm. The aliphatic protons of N,N-
d
d
¼ 1.32 ppm. The characteristic peaks of pyrazole C-H in
complex 1 show at 6.31 ppm and aromatic protons of N,N-
diethylaniline show at 8.43e8.36 and 6.97e6.89 ppm. The ligand
and Ru(II) complex 1 was characterized by 1H, 13C NMR, MALDI-TOF
MS, UV-Vis spectroscopy and reported in Supplementary
Figs. S8eS12.
2.2. Cytotoxicity activity studies of Ru(II) complex 1
The cytotoxicity of Ru(II) complex 1 was evaluated by sulfo-
rhodamine B (SRB) assay using a set of cancer cell lines (MCF-7 and
HCT-116 cell line) and CSCs (CD44
þ
MCF7 and
CD133 þ HCT116 cells). Cisplatin was used as a positive control.
Table 1 depicts the IC50 values of complex 1, and cisplatin against
the above-mentioned cancer cell lines. In our present work, the
cytotoxicity study shows that the complex 1 was more potent than
the cisplatin under condition at 48 h treatment. Notably, the IC50
value of complex 1 for all the cell lines and CSCs used in the study
was much lower than cisplatin. Efficacy of the cytotoxic activities
observed in the following order: 1 > cisplatin. The IC50 values of
2.4. Ruthenium(II) complex 1 induces ROS in cancer stem cells
Accumulation of transition metal complexes like ruthenium(II)
complex 1 in mitochondria or ER can effectively generate reactive
oxygen species (ROS) through Fenton type redox reactions [41].
Redox cycling is an important characteristic of transition metals,
this property enables the transition metals to simultaneously
inactivate the antioxidant proteins and also generate the free rad-
icals in the cancer cells under an acidic microenvironment [42].
Excessive ROS generation is one of the characteristic features of
cancer cells. Increased metabolic activity of peroxisomes and
mitochondria are the major contributors of ROS in tumor. Cancer
cells effectively utilize the ROS for their cell proliferation, angio-
genesis, and metastasis progression [43]. Cancer cells can delicately
balance the excessive ROS by increasing the expression of antioxi-
dant proteins such as glutathione and thioredoxin [44,45]. Hence,
cancer cells can withstand metabolic and pharmacological insults
up to their threshold limit of ROS toxicity. In addition, it is well
proven that CSCs synthesize high levels of antioxidant enzyme as
well as non-enzyme anti-oxidant proteins, compared to the pro-
liferative cancer cells [46,47]. This survival mechanism enables the
CSCs to develop drug resistance against chemotherapeutic drugs.
Treatment strategies such as simultaneously increasing the ROS
generation as well as suppressing the anti-oxidant potential of the
cancer cell, can lead to irreversible oxidative stress and subsequent
apoptosis. Earlier studies indicated that the inhibition of certain
antioxidant systems can effectively kill cancer cells through an
apoptotic cell death mechanism by elevating the ROS levels behind
the threshold limit of cancer cells [48,49]. It has been reported that
ruthenium(II) polypyridyl complexes can markedly increase the
complex
CD133þHCT-116 cell lines are 2.1
2.62 0.05 M, and 3.89 0.09 M respectively (Table 1). Signifi-
1
against MCF-7, CD44þMCF-7, HCT-116, and
0.06 M, 3.48 0.07 M,
m
m
m
m
cantly higher IC50 values against CSCs were observed as compared
to the cancer cells. It should be considered that CSCs generates
relatively low levels of ROS as compared to the cancer cells [39]. In
Fig. 1. FACS analysis shows the uptake of the Ru(II) complex 1 by CD44þMCF-7 cells at
different time points (30, 60 and 90 min). Cells were treated with 10 mM of complex 1.

750
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
Fig. 2. Subcellular localization of complex 1 in CD133þHCT-116 cells. Cells were treated with 10
m
M of complex 1 for 1 h at 37 ꢀC in a humidified atmosphere of 5% CO2. (A)
Mitochondrial localization: a) Nuclear staining, b) Emission of complex 1, c) Emission of Mito-tracker red, d) The merged images. (B) Localization of endoplasmic reticulum: a)
Nuclear staining, b) Emission of complex 1 (green), c) Emission of ER-tracker red, d) the merged images. (For interpretation of the references to colour in this figure legend, the
reader is referred to the Web version of this article.)
intracellular ROS level [14,50]. In the present study, we observed an
elevated ROS generation in CSCs of HCT-116 and MCF-7 in a con-
centration dependent manner (0, 1, 2, and 3 mM) within 6 h of
Moreover, Ca2þ is necessary for the proper activation of a number of
molecular chaperones such as GRP-78 [51,52]. Therefore, fluctua-
tions of Ca2þ levels in the ER can severely impact protein folding
capacities. Oxidative stress due to enhanced ROS levels causes a
Ca2þ influx into the cytoplasm from ER, or sarcoplasmic reticulum
(SR) through the ER/SR-localized channels [53]. The acute release of
Ca2þ from the ER can trigger a variety of signaling mechanisms that
promote cell death, mainly via mitochondrial modulation [54,55].
The cellular localization study clearly indicated that the ruth-
enium(II) complex 1 is mostly distributed in mitochondria and ER.
Hence, complex 1 induced ROS could mediate calcium release from
ER, which could play a role in the activation of caspase mediated
apoptosis. To find the mechanism of complex 1 mediated cell
cytotoxicity high content assay was employed as previously
demonstrated in our lab to assess the induction of mitochondrial
permeability transition pore (MPTP) to the inner mitochondrial
membrane, cytosolic calcium level and the activation of caspase-3
[56]. Fig. 4 represents the cell death mechanism of complex 1 in
complex 1 treatment (Fig. 3). Fig. 3A shows the 20,70-dichloro-
fluorescein diacetate (DCFH-DA) staining of complex 1 treated CSCs
of HCT-116 and MCF-7 cell lines. Oxidation-sensitive DCFH-DA
generates green fluorescence in the presence of ROS. Fig. 3B depicts
the average fluorescence intensity of DCFH-DA staining at different
concentrations of complex 1 treated cells. Due to the efficiency in
ROS generation, the complex 1 exhibited good cytotoxic potential,
irrespective of cell types, including CSCs of HCT-116 and MCF-7.
2.5. High-content cell death dynamics and evaluation of the MPT,
cytosolic calcium, caspase3/7
The interplay between ROS and calcium homeostasis and their
combined role in cell death pathways have been well established in
cancer cells. The ER lumen is a major storage of intracellular Ca2þ
.
Fig. 3. (A) Intracellular ROS generation in complex 1 treated CD44þMCF-7 and CD133þHCT-116 cells. Cells were treated with different concentrations of complex 1 (1, 2 and 3
mM)
for 6 h, at 37 ꢀC in a humidified atmosphere of 5% CO2. (B) Bar graph represents the average fluorescence intensity of 20,70-dichlorofluorescin diacetate. Error bars represent the
standard deviation of three independent measurements. (**P < 0.01, ***P < 0.001Vs Control).

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
751
Fig. 4. High-content assay to find MPTP, Cytosolic calcium and caspase 3/7 in complex 1 treated CD133þHCT-116 cells, performed using AOTF. Cancer cells were treated with
different concentration of complex 1 (0, 1, 2 and 3
M) for 16 h at 37 ꢀC in a humidified atmosphere of 5% CO2. Fluorescent emission of Calcein AM, Calcium orange, and Magic red
m
caspase 3/7 was monitored at 525 nm, 580 nm, and 630 nm respectively using AOTF. (A) The green fluorescent images correspond to cellular images of MPT, orange fluorescent
images represent cytosolic calcium, and red fluorescent image represents caspase- 3/7. (B) Bar graph represents the average fluorescence intensity of Calcein AM, calcium indicator
orange and caspase 3/7. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
CSCs of HCT-116. MPTP was assessed by measuring the fluorescence
intensity of Calcein AM translocated into the mitochondria. How-
ever, CoCl2 used in the study can enter and quench the Calcein AM
only in the presence of MPTP. Hence, the fluorescence intensity of
Calcein AM is indirectly proportional to the levels of MPTP. The
observed results show that treatment of complex 1 drastically
reduced the fluorescence intensity of the Calcein-AM accumulated
in the mitochondria of CSCs in a concentration dependent manner
compared to the control. A sharp reduction in the fluorescence
intensity of the Calcein-AM accumulated in mitochondria was
Cyt-c and the subsequent activation of caspase-3. The result
observed herein shows an increased level of cytosolic calcium and
caspase-3 activation in a concentration dependent manner in
response to the complex 1 treatment.
2.6. Expression of pro-apoptotic Bax and Bak in complex 1 treated
CD133þHCT-116 C SCs
ER stress response critically regulates the formation of MPTP. It
has been generally speculated that calcium released from ER and
subsequent increased cytosolic calcium generally stimulates the
MPTP formation in mitochondria adjacent to the ER alone. How-
ever, activation and subsequent oligomerization of pro-apoptotic
proteins such as Bak and Bax on the outer mitochondrial
observed from 1
mM of complex 1 treatment and it was saturated at
2
mM of complex 1. The MPTP formation on the inner mitochondrial
membrane causes membrane depolarization, matrix swelling, and
a rupture of outer membrane. It collectively causes the release of
Fig. 5. (A) Expression of pro and anti-apoptotic proteins in complex 1 treated CD133þHCT-116 C SCs. a. Expression of Bax b. Expression of Bak c. Expression of Bcl-2 (i- DAPI, ii-Bax/
Bak/Bcl-2, iii- Overlay). (B) Western blot analysis of Bcl-2, Bak, and Bax, respectively, in control and complex 1 treated cells. (C) Graph represents the relative expression of Bcl-2, Bax
and Bak with control. Error bars represent the standard deviation of three independent measurements (*P < 0. **P < 0.01, Vs Control).

752
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
membrane stimulates the intrinsic apoptosis independent of cal-
cium release [55]. Oligomerization of Bak/Bax leads to MOMP
which causes the release of cytochrome c (Cyt c). In the cytosol, Cyt
c activates the caspase-3 and caspase-7, the major effectors of
apoptosis [54,57,58]. It has to be noted that MOMP is a point of no
return for cell survival. In the present study, Fig. 5Aea and A-b
represent the expression of Bax and Bak in control and complex 1
treated CSCs respectively. Oligomerized structures of Bax and Bak
was observed in complex 1 treated cells. However, the oligomeri-
zation of Bax and Bak was poorly observed in control cells. Fig. 5B
represents the western blot analysis of Bak and Bax. Significantly
increased (p < 0.01) Bax and Bak levels were observed in complex 1
treated CSCs compared to the control. Moreover, Fig. 5 A-c repre-
sents the immunofluorescence analysis of anti-apoptotic protein
Bcl-2 expression in control and complex 1 treated HCT-116 C SCs.
The protein level of Bcl-2 was further assessed by western blot
method and represented in Fig. 5B and C. The result shows that Bcl-
2 expression was significantly suppressed in complex 1 treated
CSCs (p < 0.01) as compared to the control. The observed reduced
anti-apoptotic Bcl-2 expression in complex 1 treated cells can
maintain the outflow of the Cyt-c release from the mitochondria. In
addition, it has been reported that activated Bax positively regu-
lates calcium release from the ER [59,60]. A transient over-
expression of Bax results in the release of ER Ca2þ with a subse-
quent increase in mitochondrial Ca2þ and enhanced Cyt c release
[61]. In contrast, cells with deficiency of both Bax and Bak have
reduced Ca2þ release from ER [62e64]. Herein, observed results
confirmed that complex 1 induced both MPTP and MOMP forma-
tion in mitochondria of cancer cells and ensures an effective
intrinsic apoptosis mediated killing of cancer cells.
2.7. Ruthenium(II) complex 1 suppress GRP-78 levels in cancer stem
cells
Considering the ROS generating ability of the complex 1, it al-
lows us to speculate that the complex 1 can influence the ROS
dependent conformational changes on proteins closely associated
with drug resistance. Initially, the effect of complex 1 on the pro-
teins associated with drug resistance such as GRP-78, CLU, and ATR
were analysed. The GRP-78, CLU, and ATR were cloned with YFP,
RFP, and GFP bearing plasmids, respectively and were separately
transfected into HEK-293 cells. The GRP-78, CLU, and ATR overex-
pressed HEK-293 cells were treated with complex 1 at concentra-
tions of 1, 2, 3, 4, and 5 mM for 16 h and then fluorescence intensity
of fluoroproteins were observed. Interestingly, in response to the
complex 1 treatment, a dose dependent reduced expression of GRP-
78 was observed, while the remaining two proteins were not
decreased compared to the control (Fig. 6). However, significance
differences in m-RNA levels of GRP78 were not observed between
control and complex 1 treated CSCs (Fig. 6D). This leads to the
conclusion that a direct interaction between GRP78 and ruthenium
complex 1 could degrade the GRP-78 protein via ROS induced
Fig. 6. (A) Expression of (a) GRP78 (b) Clusterin (c) ATR in response to the different concentration of complex 1 in pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1
transfected HEK293 cells. (B) Vector design of pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1. (C) Bar graph represents the average fluorescence intensity of GFP, RFP
and GFP in plasmid transfected HEK293 cells at different concentration of complex 1. (D) mRNA expression of GRP78 in complex 1 treated CD133þHCT-116 cells. The mRNA
expression was analysed by RT-PCR. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
753
modifications. It has previously been reported that an ROS induced
oxidation process can induce conformational changes in protein
and make them prone to ubiquitination [30,31]. To confirm this,
molecular docking was performed with an X-ray crystal structure of
GRP 78 (PDB: 3ldl) using Accelrys Discovery Studio (v 4.0). The
docking results revealed that complex 1 did not interfere with the
function of the ATP domain of GRP78. However, the ruthenium
complex 1 formed a strong non-covalent interaction with specific
amino acid residues of GRP-78 at the interface of the dimeric
structure of the protein, thereby intercalating between the dimeric
structures of GRP-78 (Fig. 8). The observed docking results implied
that the ROS generated in the vicinity of the complex 1 and GRP-78
interface could modify the conformation of GRP78 and subse-
quently its ubiquitin mediated lysis. Confocal analysis of the pre-
sent study confirmed that the maximum of GRP-78 expression
overlapped within the ER region. In addition, it showed that GRP78
expression was reduced in accordance with the concentration of
complex 1 (Fig. 7 and Supplementary Fig. S4). It has to be noted that
the lifetime of ROS is in the microseconds, hence its effect will be
more in the vicinity where it has existed. This allowed us to
conclude that the binding of complex 1 with GRP-78 could inflict
conformational changes to the GRP-78 which leads to its ubiquitin
mediated degradation. Western blot analysis also confirmed that
complex 1 dose dependently reduced the protein levels of GRP-78
(Fig. 7C and D). Earlier, elevated levels of GRP-78 expression were
evidenced in CD44þMCF-7 cells, compared to their normal coun-
terpart. Chiu et al. reported that CD24ꢁCD44 þ Grp78 þ cells
exhibited superior chemo and radio resistance compared with
CD24ꢁCD44 þ cells in head and neck cancer cell lines [65]. Simi-
larly, the knock down of GRP78 has been implicated in the
improved sensitivity to chemo and radio therapy [66]. This clearly
suggests that the suppressive effect of complex 1 against GRP-78 is
a highly advantageous property that can reduce the chances of
tumor recurrence in cancer treatment.
2.8. Molecular docking
Molecular modelling studies were undertaken to provide
further insights into the manner in which complex 1 first binds to
the GRP78. Two possibilities were considered for the docking of the
complex 1 with GRP 78: (i) Whether the complex 1 can bind to the
ATPase domain of the GRP78 and, (ii) Whether the complex 1 can
bind at the dimer interface utilizing the amino acid residue of both
the monomer units (GRP78) of A and B. In the first scenario, it could
not accommodate ATPase domain of GRP78 as the size of the
complex 1 is large. In the second scenario, complex 1 was docked
successfully into the dimer interface of GRP 78. The corresponding
docking results are shown in Fig. 8 depicting the 3D diagram of the
interaction of complex 1 with GRP78. From the protein ligand
interaction (See Supplementary Figs. S5eS7), it is observed that Tyr
209 of both monomer units A and B make a strong H bond with
distance 2.53 and 2.85 Å respectively. This seems to be the reason
for the stability of the molecule (complex 1) within the binding
pocket of the target protein GRP78. There are some electrostatic
interactions with Glu 358 of both monomers A and B with distances
5.58 and 5.54 Å, respectively. In addition, Arg 214 of both monomer
units also shows electrostatic interactions with distances 4.10 and
4.27 Å respectively. These electrostatic interactions are vital for the
stabilization of the binding mode. Lys213 of unit A and Ile388 of
unit B constitute a hydrophobic interaction with complex 1, with
distances 5.13 and 4.44 Å. Tyr 209 of unit B unit has a hydrophobic
interaction with the distance 4.42 Å. The interactions between
ligand (complex 1) and the hydrophobic side chains of protein
(GRP78) contribute significantly to the binding free energy. The
computer simulated docking results also support the results of
biological activities of complex 1.
2.9. In vivo anticancer activity of ruthenium(II) complex 1
In vivo chemotherapeutic potential of ruthenium(II) complex 1
against a CD133þHCT-116 CSCs derived tumor xenograft in athymic
nude mice was investigated. Fig. 9A describes the protocol of the
xenograft model. During the treatment period of two weeks, mice
daily received 0.03 mg or 0.06 mg of complex 1/kg body weight.
Tumor weight and volume in the complex 1 treated mice group
were significantly decreased as compared to the control group of
mice (Fig. 9B and C). Tumor volume decreased 55% and 80%
respectively in 0.03 and 0.06 mg/kg body weight treated animals
compared to the control (Fig. 9D). Similarly, the observed tumor
weight in control, low dose and high dose of the complex 1 treated
animals are 3.2 g, 1.6 g, 1.15 g respectively, which shows the anti-
cancer efficacy of complex 1 (Fig. 9E). Furthermore, the complex
1 treated mice group maintained normal body weight during the
entire course of treatment and no mortalities were observed. These
findings support the less toxic nature of complex 1 against normal
cells. Treatment failure and tumor recurrence are mostly depen-
dent on the CSCs population in cancer. In order to find the cytotoxic
ability of complex 1 against CD133 þ cells, mice were treated with
anti-CD133 antibody tagged with alexaflour-705. The complex 1
treated experimental mice show a 2 fold and 4-fold reduction of
Fig. 7. (A) Expression of GRP78 in control and complex 1 (0, 1 and 3
mM) treated
CD133þHCT-116 cells. Fluorescence expression of GRP-78 was merged with the fluo-
rescence expression of ER tracker red. (B) Bar graph represents the average fluores-
cence intensity of GRP-78 in CD133
þ
HCT cancer cells treated with different
concentrations of complex 1. (C) Western blot represents the expression of GRP78 in
control and complex 1 treated CD133þHCT-116 cells. (D) Bar graph represents the
relative expression of GRP-78 with control. Error bars represent the standard deviation
of three independent measurements (**P < 0.01, Vs Control). (For interpretation of the
references to colour in this figure legend, the reader is referred to the Web version of
this article.)

754
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
Fig. 8. The docking of complex 1 with dimeric GRP 78.
Fig. 9. (A) Treatment protocol. (B) Representative photographs of experimental mice (Control, Low dose, and High dose. (C) Representative photographs of tumor isolated from the
experimental mice (Control, Low dose, and High dose). (D) Tumor volumes of experimental mice during treatment period. (E) Tumor weight of tumor xenograft isolated from the
experimental mice. (F) Fluorescence emission of CD133 antibody tagged with Alexaflour680 in control and complex 1 treated experimental mice. (G) Bar graph represents the
fluorescence intensity of CD133 antibody tagged with Alexaflour680.
fluorescence intensity respectively in the low and high dose treated
groups, compared with control (Fig. 9G). This clearly indicates that
the GRP78 suppressing nature of the complex 1 possesses the
efficient cytotoxic ability against CSCs.
caspase-3, an effector of apoptosis. Apart from this, direct interac-
tion of complex 1 with the dimers of GRP-78 inflicts ROS mediated
conformational changes to GRP-78, which leads to the ubiquitina-
tion of GRP-78. Degradation of GRP-78 is highly advantageous since
elevated GRP78 is responsible for chemo and radio resistance. In
addition, ruthenium(II) complex 1 exhibits excellent in vivo thera-
peutic potential against colon tumor xenograft. The observed re-
sults in this study show that complex 1 has the potential be a viable
alternative to platinum based chemotherapeutic agents.
3. Conclusions
In summary, novel ruthenium(II) triazine complex
1
([Ru(bdpta)(tpy)]2þ) was synthesized and characterized by spec-
troscopic methods. In vitro cytotoxicity study of complex 1 showed
excellent IC50 value comparable to that previously reported for
cisplatin. Interestingly, the complex 1, with its excellent ROS
generating potential and its tendency to accumulate in mitochon-
dria and ER induces an intrinsic apoptosis in CSCs. Similarly, com-
plex 1 causes MPTP, as well as MOMP in mitochondria, by elevating
calcium and Bax/Bak respectively, which ensures the activation of
4. Experimental section
4.1. Materials and methods
Ruthenium trichloride trihydrate and other reagents or chem-
icals were purchased from Sigma Aldrich, South Korea. Analytical

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
755
grade solvents were purchased from Alfa Aesar or Sigma Aldrich
South Korea, and degassed with 100% dry nitrogen for 20 min
before use for the reactions. Deionized water was used for the
preparation of sodium chlorate solution. For column purification
acetonitrile and toluene commercial grade solvents were used and
purchased from Daejung Chemicals, South Korea. 1H and 13C NMR
spectra were recorded in deuterated methanol, chloroform or
dimethyl sulfoxide (Cambridge Isotope Labs), containing 0.05% v/v
TMS as an internal standard, using Bruker AVANCE400 and
AVANCE600 spectrometer. The abbreviations for the peak multi-
plicities are as follows: s (singlet), d (doublet), dd (doublet of
doublets), t (triplet), q (quartet), m (multiplet), and br (broad).
Chemical shifts are reported in values (ppm) relative to internal
TMS, and J values are reported in Hz. High resolution Mass spec-
troscopy data was obtained with an Agilent 6530 Q-TOF LC-MS
spectrometer. MALDI-TOF mass spectrum was obtained with
MALDI TOF-TOF 5800 System (AB SCIEX, USA). The column chro-
matography was carried out in Silica gel (Merck, silica gel 60, par-
ticle size 0.063e0.200 mm, 70e230 mesh ASTM) or neutral
alumina (Alfa Aesar, 60 mesh, Brockmann grade 1, 58 Aꢀ) with
mentioned commercial grade solvents as mobile phase. The prog-
ress of all reactions was monitored by thin layer chromatography
(TLC), which was performed on 2.0 ꢂ 4.0 cm2 aluminum sheets
precoated with silica gel 60 (HF-254, Merck) to a thickness of
0.25 mm. The developed chromatograms were viewed under ul-
traviolet light (254 and 365 nm). All the compounds including in-
termediates were detected with 254 nm UV light. Absorption
spectra were recorded in 1 cm quartz cuvettes using Evolution™ 60
UV-Visible Spectrophotometer (Thermo Fischer Scientific, USA).
group, -CH2 carbon), 110.8 (tpy, CH), 111.4 (Pyrazole, -CH carbon),
121.0 (N,N-diethylaniline ring Ar CH), 121.2 (tpy, CH), 123.8 (tpy,
CH), 131.6 (tpy, CH), 136.9 (N,N-diethylaniline ring Ar CH), 137.9
(tpy, CH), 144.0 (N,N-diethylaniline group, -C-N carbon), 149.2
(Pyrazole, -C¼N carbon), 151.7 (tpy, C¼N), 152.5 (Pyrazole, -C-N
carbon), 155.4 (tpy, C-N) 156.3 (tpy, C¼N), 164.0 (tpy, C-N), 164.2
(triazine C¼N), 174.1 (triazine N¼C-N). MALDI-TOF mass spectra:
752.07 (C38H39N11Ru), HRMS (ESI): Calcd for C38H39N11Ru:
750.8770, found: 750.8780. UV-Visible spectrum (CH3CN): lmax
396 nm and 515 nm.
4.3. Molecular docking
Molecular docking of complex 1 into the three-dimensional X-
ray crystal structure of GRP78 (PDB: 3ldl) was carried out using
Accelrys Discovery Studio (v 4.0) as implemented through the
graphical user interface DS-CDOCKER protocol. The 3D structure of
complex 1 was constructed using Discovery studio small molecule
window and energy was minimized by CHARMm force field with
and minimum RMS gradient of 0.09. The three-dimensional crystal
structure of GRP78 (PDB: 3ldl) was retrieved from the RCSB Protein
Data Bank (http://www.rcsb.org/pdb/). Discovery studio 4.0 uses a
simulated annealing procedure to explore the binding possibilities
of a ligand in a binding pocket. Before the docking procedure, all
bound water molecules and ATP molecules as heteroatoms were
removed from the protein crystal structure. The homodimer
structure of GRP 78 was taken to dock the drug molecule (complex
1). Binding site uses a CHARMm-based molecular dynamics scheme
to seek for the optimal binding sites for docking. Then, the optimal
binding site was chosen based on the shape and location of the
cavity, the location of the residue and the conserved amino acid.
Among the nine potential binding sites, the site 1 was chosen for
docking study. A site sphere radius was set to assign the entire
binding pocket where the other parameters were set as default. The
docking program CDOCKER was used to perform the automated
molecular simulation where the Top hits was set as 10, the Random
Conformations was set as 10. The top compounds were ranked by
the corresponding values of -CDOCKER energy, -CDOCKER inter-
action energy and all the values were preserved to find the most
probable binding mode.
Emission spectra were obtained on
a
Jasco-FP 6500
spectrofluorometer.
4.2. Synthesis and characteristics
4.2.1. Synthesis of ruthenium(II) complex 1: [Ru(bdpta)(tpy)](ClO4)2
The mixture of 2,2':60,200-terpyridine (iii) (300 mg, 1.29 mmol)
and RuCl3$3H2O (0.336 g, 1.29 mmol) in anhydrous ethanol (80 ml)
were refluxed at 80 ꢀC for 3 h. The excess ethanol was concentrated
by rotary evaporator to get the red solid which was washed with
diethyl ether and hexane. The red solid of [Ru (tpy)Cl3] was ob-
tained and dried, it was used for the next step of the synthesis
without further spectral analysis. 400 mg (0.85 mmol) of [Ru (tpy)
Cl3], 25 ml of dry ethylene glycol and 354 mg of bdpta ligand
(0.9 mmol) were added and refluxed at 170 ꢀC for 16 h under N2
atmosphere. The reaction mixture was then cooled to room tem-
perature and 1 M of NaClO4 was added. The reddish brown solid
was filtered and dissolved in dichloromethane. Dried over Na2SO4.
Then the solvent was evaporated on the rotary evaporator. The
crude ruthenium complex was purified twice by column chroma-
tography on neutral alumina (CH3CN/Toluene, 40/60, v/v). The dark
reddish brown colour band was collected and sat. NaClO4 was
added, then the solvents were distilled to get product as perchlo-
rate salt. The brown colour solid was then washed with diethyl
ether, hexane and dried under vacuum. Yield: 400 mg, 51.4%. Rf
4.4. Maintenance of cell culture
Breast cancer cell line MCF-7 and colon cancer cell line HCT-116
was obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea).
Dulbecco's modified Eagle's medium (DMEM; Gibco-BRL, Grand
Island, NY) supplemented with 10% heat-inactivated fetal bovine
serum (FBS; GibcoBRL, Grand Island, NY), 10
mg/mL streptomycin,
100 U/mL penicillin, and 5 g/mL neomycin (PSN; 15,640e055,
m
Gibco-BRL) was used to culture both MCF-7 and HCT-116 cell line.
Cell cultures were maintained at 37 ꢀC in a humidified atmosphere
containing 5% CO2.
4.5. Isolation of CSC from the MCF-7 and HCT-116 cell line
value: 0.3 (CH3OH: CH2Cl2, 20:80). 1H NMR (400 MHz, CD3OD)
d/
ppm: 10.38e10.31 (m, 1H, tpy), 8.84 (dd, 1H, tpy), 8.69 (dd, J ¼ 8.2,
1.4 Hz, 1H, tpy), 8.43e8.36 (m, 2H, aniline ring Ar proton),
8.35e8.25 (m, 2H, tpy), 7.98 (t, J ¼ 7.9 Hz, 1H, tpy), 7.89 (ddd, J ¼ 7.1,
5.7, 1.3 Hz, 1H, tpy), 7.66 (td, J ¼ 7.7, 1.8 Hz, 1H, tpy), 7.20e7.10 (m,
2H, tpy), 6.97e6.89 (m, 2H, N,N-diethylaniline ring Ar proton), 6.52
(dd, J ¼ 7.7, 1.1 Hz, 1H, tpy), 6.31 (s, 2H, pyrazole CH proton), 3.61 (q,
J ¼ 7.1 Hz, 4H, alkyl CH2), 3.34 (s, 6H, pyrazole ring 2-CH3), 3.07 (s,
6H, pyrazole ring 2-CH3), 1.34e1.21 (m, 6H, alkyl -CH3). 13C NMR
Cancer stem cell marker CD44 was used to sort out CSC from
MCF-7 cell line. Similarly, CD133 marker was used to isolate CSC
from HCT-116 cell line. CSCs from cell lines were sorted by using
CD44 and CD133 microbead kit (MACS Miltenyi Biotec) as described
previously [67]. Briefly, MCF-7 and HCT-116 cells were detached
from the cell culture by using Accutase cell dissociation reagent.
Cells were centrifuged at 230 rcf for 3 min and supernatant was
discorded. Then, cells were resuspended in a mixture containing
(600 MHz, DMSO‑d6):
(N,N-diethylaniline group, -CH3 carbon), 16.1 (N,N-diethylaniline
d
/ppm: 12.6 (pyrazole, -CH3 carbon), 14.0
80
mL of sorting buffer and 20 mL of microbead solution provided in
the kit and incubated for 15 min at 4 ꢀC. Followed by the incubation,

756
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
cells were dissolved in 1 ml of sorting buffer and centrifuged (300 g,
10 min) to collect the cell pellet. The cell pellet was again resus-
pended in 500 mL of sorting buffer. The LS column and pre-
and ruthenium complexes were observed using Confocal Micro-
scope (Leica, TCS SP8). Complex 1 was excited at 514 nm and
emission was measured at 540e600 nm. MitoTracker Red CMXRos
and ER-ID® Red dye was excited at 594 nm and emission was
observed at 605e700 nm. Excitation and emission wavelength of
Hoechst 33258 nuclear dye was 405 nm and 450e500 nm.
separation filter provided in the kit (MACS Miltenyi Biotec) were
fixed in the magnetic field of the MACS separator and subsequently
rinsed with cell sorting buffer. The prepared cell suspension was
pipetted into pre-separation filter. CSCs bound with magnetic
beads were strongly adhered with LS column, the unbound cells
were flushed out by the repeated application of sorting buffer.
Finally, the CSC adhered with LS column were flushed out by
applying a pressure using syringe provided in the kit.
4.10. High-content MPT, cytosolic Ca2þ and caspase3/7 screening
assay
CSCs were cultured in 12 well culture flask and maintained in
DMEM medium supplemented with 10% FBS for 24 h at 37 ꢀC in 5%
CO2 atmosphere. Then, cells were maintained with and without
complex 1 for 16 h. After washing with 1 ꢂ PBS buffer, cells were
incubated with calcium indicator orange (Invitrogen, CA, and USA)
at room temperature in the dark for 45 min. Cells were washed
with 1 ꢂ PBS and incubated with calceinacetoxymethyl ester (Cal-
cein-AM) (Invitrogen, CA, USA) for 30 min at 37 ꢀC. Then, caspase-3
substrate (Thermo Scientific, U.S.A) was added, and cells were
incubated at 37 ꢀC in the dark for 6 min. Followed by CoCl2 was
added and incubated at 37 ꢀC in the dark for 10 min. Finally, cells
were washed with 1 ꢂ PBS and subjected to imaging analysis using
acousto-optic tunable filter (AOTF) enabled microscopic device as
described previously [56]. Calcium indicator orange was excited at
561 nm and emission was measured at 549 nm. Excitation and
emission of Calcein-AM was 488 nm and 516 nm, respectively.
Caspase-3 was excited at 488 nm and emission was measured at
530 nm. Images were analysed using commercially available soft-
ware (MetaMorph, Version 7.7, Molecular Devices, CA, and USA).
4.6. Cellular uptake
The cellular uptake in CD44þMCF-7 cells was monitored by
FACS analysis at different time point. CD44þMCF-7 cells were
treated with complex 1 at 20, 40, and 60 min. After incubation,
fluorescence intensity of complex 1 was analysed by using FACS.
Cells were excited with 488 nm laser and then emission was
observed at 515e545 nm range. For each sample, approximately
10,000 cells were measured. Data was analysed using FlowJo
software.
4.7. Cytotoxicity assay in vitro
Sulforhodamine B based cytotoxicity assay was performed ac-
cording to the manufacturer's protocol (In Vitro Toxicology Assay
Kit, Sigma-Aldrich, USA). Briefly, 1 ꢂ 106 cells were separately
seeded in 24 well plate and incubated at 37 ꢀC in DMEM medium
supplemented with 10% FBS for 48 h. Afterward, cells were treated
with Ru(II) complex 1 at different concentrations (0e100
mM) and
4.11. List of antibodies
incubated for 48 h. After treatment, cells were fixed using ice cold
trichloroacetic acid (50%, w/v) and incubated for 1 h at 4 ꢀC. The
fixing solution was removed and plates were washed with water
and air dried. 0.4% Sulforhodamine B Solution was added to the
culture wells and incubated for 20 min at room temperature. After
staining, culture wells were washed with 1% acetic acid and air
dried. Bound SRB was eluted with 10 mM Tris. Absorbance was read
at a wavelength of 540. The background absorbance of multiwell
plates were measured at 690 nm and subtract from the measure-
ment at 565 nm. Experiments were performed in triplicate.
The following antibodies were used for western blot and
immunofluorescence analysis: Total cell lysates were collected us-
ing RIPA sample buffer. Western blot analysis was performed as
described previously. The following antibodies were used: Goat
anti-GRP78 (Cat. No. sc-1051), mouse anti-Bax (Cat. No. sc-23959)
and Bcl-2 (Cat. No. sc-7382) antibodies; and rabbit anti-Bak (Cat.
No. sc-832) were purchased from Santa Cruz Biotechnology (Santa
Cruz, CA, USA). HRP- conjugated goat anti-mouse (Cat. No. sc-
2005), HRP conjugated anti-rabbit IgG (Cat. No. sc-2030), PE-con-
jugated goat anti-mouse IgG (Cat. No. sc-3738), FITC conjugated
anti-rabbit IgG (Cat. No. sc-2012), and FITC-conjugated anti-goat
IgG (Cat. No. sc-2024) were purchased from Santa Cruz Biotech-
nology (Santa Cruz, CA, USA), and HRP-conjugated anti-goat IgG
(Cat. No. ab-97110) was purchased from abcam (abcam, USA).
4.8. Quantification of intracellular ROS
Cancer stem cells of MCF-7 and HCT-116 were seeded in 12-well
culture plate and incubated overnight at 37 ꢀC in 5% CO2. Then, cells
were treated with and without complex 1 for 6 h and incubated at
37 ꢀC in 5% CO2 environment. At the end of treatment, cells were
fixed with 4% formaldehyde and incubated at room temperature for
4.12. Western blot analysis
10 min. After washing with 1 ꢂ PBS, cells were treated with 20
m
M
Total cell lysates were collected using RIPA buffer. After centri-
fuging at 12000 rpm for 15min, the supernatants were collected.
The protein samples were separated on a 10% SDS-PAGE and
transferred to a nitrocellulose membrane. The membrane was
blocked in 5% skim milk in TBS-T for 1 h. After blocking, the
membranes were incubated with the primary antibodies specific
for Bax (1:1000), Bak (1:1000), Bcl-2 (1:2000), and GRP-78 (1:500)
in TBS-T for 1 h. After washing twice with TBS-T for 10 min, the
membrane was incubated with an appropriate HRP conjugated
secondary antibody. The membranes were then developed with an
enhanced chemiluminescence reagent (Thermo Scientific, U.S.A).
of 20,70-dichlorofluorescin diacetate (DCFDA) and incubated for
15 min at room temperature. Fluorescence intensity of ROS induced
20,70-dichlorofluorescin was measured with the excitation and
emission wavelengths of 495 and 529 nm.
4.9. Intracellular localization assay
CSCs were seeded on cover glass and incubated at 37 ꢀC for 24 h.
Then, cells were treated with 10 mM of ruthenium complex and
incubated for 2 h at 37 ꢀC. After drug treatment, cells were washed
with 1 ꢂ PBS and incubated with either MitoTracker® Red CMXRos
(Thermofischer scientific, USA) or ER-ID® Red (Enzo Life Sciences,
Inc., USA) along with Hoechst 33258 nuclear dye (Sigma Aldrich,
USA) for 30 min. Finally, cells were fixed with 4% formaldehyde for
15 min at room temperature. Fluorescence intensity of tracker dyes
4.13. Plasmid construction and transfection of GRP78, CLU and ATR
Genomic DNA from the control human sample was isolated
using a QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA) as

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
757
instructed by the manufacturer. DNA (200 ng) was amplified with
the specific primers, GRP78: Forward (50 pmol; 50-AAAGCTTTTAT-
GAAGCTCTCCCTGGTGG-30) and GRP78:Reverse (50 pmol; 50-
AGGATCCCTACAACTCATCTTTTTCTGCTG-30) or CLU: Forward
(50 pmol; 50-AAAGCTTATGCAGGTTTGCAGCCAGC-30) and Clu:
Reverse (50 pmol; 50- GGATCCCTCCTCCCGGTGCTTTTTG-30), or ATR:
Forward (50 pmol; 50- AAGCTTATGGCCACGGCGGAGC-30) and ATR:
Reverse (50 pmol; 50- GGATCCTTTTATTTTATTTTCCTCACTCTCCT-30),
with the following temperature profile: 95 ꢀC for 4 min; 30 cycles of
95 ꢀC for 30 s, 59e66 ꢀC for 30 s and 72 ꢀC for 1 min; and a final
extension at 72 ꢀC for 5 min. GRP78, CLU and ATR primers were
designed to amplify GRP78, CLU and ATR transcripts of the
respective genes. PCR amplification was confirmed by analysis of
the amplified 1.9 kb GRP78, 1.5 kb CLU and 850 bp ATR fragments
using 1.2% agarose gel with standard molecular weight markers.
PCR-amplified GRP78, CLU and ATR fragments were restricted with
HindIII/BamHI enzymes. Restricted GRP78, CLU and ATR fragments
were ligated with pTag-YFP-C (4.7 kb; Evrogen, Moscow, Russia),
pDs-Red2-N1 (4.7 kb; Clontech, USA) and pAC-GFP1-N1 (4.7 kb;
Clontech, USA), respectively. Ligated fusion gene vectors were
separately transformed into competent E. coli DH5a cells through
chemical transformation as suggested by the manufacturer (Invi-
trogen, Carlsbad, CA). The transformants (pTag-YFP-GRP78-C, pDs-
CLU-Red2-N1 and pAC-ATR-GFP1-N1) were selected on LB agar
instrument (7300) was used to execute the RT- PCR. Data were
normalized with GAPDH and analysed by the 2ꢁDDCT method.
4.15. Conjugation of GRP-78 with quantum dot-antibody for
immunofluorescence assay
The antibody specific for GRP78 was conjugated with Q-dot 705
(Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA),
respectively. To initiate the Q-dot conjugation with antibody,
Firstly, the antibodies were treated with dithiothreitol (DTT) which
introduce disulphide bond break and convert the antibodies into
reduced state. Then, antibodies were incubated with maleimide-
functionalized Q-dot for 1 h at room temperature. Then, the con-
jugations were treated with 2-mercaptoethanol in order to remove
the maleimide group. The unconjugated Q-dot were eluted using
column provided in the kit. The Q-dot -antibody conjugation was
diluted at 1:200 with 1% BSA for immunofluorescence analysis. The
excitation and emission used for the fluorescence analysis was 405/
705 respectively.
4.16. Immunofluorescence staining and confocal microscopy
Immunofluorescence analysis for Bcl-2, Bax, Bak, and Q-dot-
conjugated GRP78 (Q-dot GRP-78) was performed as described
previously [69,70]. Briefly, Cells cultured on cover slides were
subjected to complex 1 treatment and then fixed with 4% formal-
dehyde for 15 min. After fixation, cells were washed with 1X PBS
and incubated with primary antibodies (Bax and Bak, 1:150; GRP-
78, 1:200) for 1 h. After washing with 1XTBS, Bax and Bak treated
cells were incubated with PE-conjugated goat anti-mouse IgG
(1:250) for 1 h. The cell nuclei were stained with Hoechst DNA stain
(1∶2000) for 5 min. After washing with TBS, cells were imaged
using fluorescence microscopy. The excitation and emission used
for the fluorescence analysis of PE-conjugated secondary antibody
was 561nm/575e620 nm respectively. The excitation and emission
maximum for Q-dot GRP-78 was 405/705 respectively. Fluores-
cence images were obtained using an Olympus FLUOVIEW 500
confocal microscope.
plates supplemented with kanamycin (30 mg/mL). Plasmids from
resistant colonies were isolated using a Plasmid Midi Kit (Qiagen).
Plasmids cloned with GRP78, CLU and ATR genes were cotrans-
fected into HEK-293 cells. Human embryonic kidney cells (HEK-
293) were obtained from the Korean Cell Line Bank (KCLB1, Seoul,
South Korea) and cultured in DMEM supplemented with 10% FBS.
First, HEK-293 cells (5 ꢂ 105 cells per well) were seeded into 24-
well culture plates containing DMEM and FBS without antibiotics
for up to 24 h. Next day, the plasmids DNA (GRP78, CLU and ATR)
were co-transfected into HEK-293 cells using Lipofectamine 2000
(Invitrogen) according to the manufacturer's directions. The cell
culture plates were kept at 37 ꢀC in a CO2 incubator for 6 h. The cells
were then washed and grown in the complete medium for 48 h at
37 ꢀC in a CO2 incubator. Followed by, GRP78, CLU and ATR ampli-
fied cells were incubated with different concentrations of complex
1 for 16 h at 37 ꢀC in a 5% CO2 incubator. Fluorescence micrographs
of HEK-293 cells were then taken for quantitative analysis. Data
acquisition and quantitative analysis were performed as previously
described [68].
4.17. Human colon carcinoma xenograft model
In vivo animal experiments were carried out according to the
protocols approved by the institutional animal care and use
committee of Seoul National University. Seven-week old Swiss
female athymic mice were purchased from Daehan Biolink
(Seoul, Korea). All Mice were housed in a specific pathogen-free
condition at the animal facility centre of the College of Phar-
macy at Seoul National University (Seoul, Korea) and were
4.14. Quantitative RTePCR
HEK293 cells were treated with and without complex 1 for 16 h
and maintained in DMEM medium at 37 ꢀC in a CO2 incubator.
Afterward, total RNA was extracted as described by the manufac-
turer's protocol (Dynabeads® MRNA Purification Kit, Invitrogen,
USA). Integrity of isolated RNA was qualitatively assessed by the
ratio of absorbance at 260/280 nm and then by 1% agarose RNA gel
electrophoresis. The concentration of RNA was measured at 260 nm
using a Nanodrop (Thermo Scientific, U.S.A). From the total RNA,
cDNA specific for GAPDH, and GRP78 were prepared using Quan-
tiTect Reverse Transcription Kit (Qiagen, USA) as described by the
manufacturer's protocol. Two picomol of primers were used for the
amplification of target m-RNA. Starting template quantity of the
samples was determined using GAPDH expression, and then
quantitative PCR reactions were carried out. The following primers
were used, GAPDH sense CATGAGAAGTATGACAACAGCCT, antisense
AGTCCTTCCACGATACCAAAGT; GRP78 sense GTTCTTGCCGTTCA
AGGTGG, antisense TGGTACAGTAACAACTGCATG. SYBR green
method was adopted to perform the RT-PCR (SYBR green qPCR kit,
Thermo Scientific, USA). Applied Biosystems™ Real-Time PCR
maintained at 25 ꢀC with
a 12 h light and dark cycle.
CD133þHCT-116 cells (3 ꢂ 106 Cells) isolated from HCT-116 cell
culture were mixed with 100 mL of LDEV-Free Reduced Growth
Factor Basement Membrane Matrix (Geltrex; Thermofischer Sci-
entific, USA) and then subcutaneously injected in the right flank
of the mice. When tumor reached the volume of 100 mm3, the
mice were divided in to three groups. Each group contains six
animal. Control group received intraperitoneal (i.p.) injection of
1xPBS containing 4% DMSO. Other two group of mice were
treated daily with 0.03 mg/kg/body weight or 0.06 mg/kg/body
weight of complex 1 by i. p. injection. Treatment was repeated
for 2 weeks and stopped when control tumor size reached
approximately 1500 mm3. Mice were monitored daily for tumor
size and body weight during the course of treatment. Tumor
volumes (mm3) were calculated as follows: volume ¼ (largest
diameter in mm) (perpendicular diameter in mm)2 ꢂ 0.5.

758
B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
[13] M. Pal, U. Nandi, D. Mukherjee, Detailed account on activation mechanisms of
ruthenium coordination complexes and their role as antineoplastic agents,
Eur. J. Med. Chem. 150 (2018) 419e445.
[14] D. Wan, B. Tang, Y.-J. Wang, B.-H. Guo, H. Yin, Q.-Y. Yi, Y.-J. Liu, Synthesis and
anticancer properties of ruthenium (II) complexes as potent apoptosis in-
ducers through mitochondrial disruption, Eur. J. Med. Chem. 139 (2017)
180e190.
[15] A. Bijelic, S. Theiner, B.K. Keppler, A. Rompel, X-ray structure analysis of
indazolium trans-[Tetrachlorobis (1 H-indazole) ruthenate (III)](KP1019)
bound to human serum albumin reveals two ruthenium binding sites and
provides insights into the drug binding mechanism, J. Med. Chem. 59 (2016)
5894e5903.
4.18. Optical imaging of CD133 in tumor xenograft
Tumor treatment was stopped when the control tumor size
reached 1000 mm3. Afterward, mice were intravenously injected
with 50 mg of Alexa flour 705 tagged anti-CD133 antibody. Four
hours post injection, mice were anesthetized with isoflurane.
Fluorescence images of CD133 in control and complex 1 treated
mice were taken by an optical tomography system. Mice were
placed on the imaging platform and images were taken using the
Optix in vivo imaging system (Optix MX3, ART Advanced Research
Technologies INC, Canada).
[16] M. Groessl, M. Terenghi, A. Casini, L. Elviri, R. Lobinski, P.J. Dyson, Reactivity of
anticancer metallodrugs with serum proteins: new insights from size exclu-
sion chromatography-ICP-MS and ESI-MS, J. Anal. Atomic Spectrom. 25 (2010)
305e313.
ꢀ
4.19. Statistical analysis
[17] K. Spiewak, G. Stochel, M. Brindell, Influence of redox activation of NAMI-A on
affinity to serum proteins: transferrin and albumin, J. Coord. Chem. 68 (2015)
3181e3192.
All experiments were repeated three times within three inde-
pendent cultures (n ¼ 3). The results are expressed as mean SD.
Data was compared using one-way analysis of variance (ANOVA)
with a TukeyeKramer post-test. The results were considered to be
statistically significant when p ꢃ 0.05.
[18] J.C. Kwok, D.R. Richardson, The iron metabolism of neoplastic cells: alterations
that facilitate proliferation? Crit. Rev. Oncol.-Hematol. 42 (2002) 65e78.
[19] M.J. Brookes, S. Hughes, F.E. Turner, G. Reynolds, N. Sharma, T. Ismail, G. Berx,
A.T. McKie, N. Hotchin, G.J. Anderson, Modulation of iron transport proteins in
human colorectal carcinogenesis, Gut 55 (2006) 1449e1460.
[20] S. Leijen, S.A. Burgers, P. Baas, D. Pluim, M. Tibben, E. van Werkhoven,
E. Alessio, G. Sava, J.H. Beijnen, J.H. Schellens, Phase I/II study with ruthenium
compound NAMI-A and gemcitabine in patients with non-small cell lung
cancer after first line therapy, Invest. N. Drugs 33 (2015) 201e214.
[21] E. Alessio, Thirty years of the drug candidate NAMI-a and the myths in the
field of ruthenium anticancer compounds: a personal perspective, Eur. J.
Inorg. Chem. 2017 (2017) 1549e1560.
Acknowledgments
This work was supported by National Research Foundation of
Korea (NRF) grant funded by the Ministry of Education, Science and
Technology (MEST) (2016R1A4A1010796). We are grateful to the
Research Institute of Pharmaceutical Sciences at Seoul National
University for providing experimental equipment's, in-vitro and
animal facility.
[22] P. Singla, V. Luxami, K. Paul, Triazineebenzimidazole hybrids: anticancer ac-
tivity, DNA interaction and dihydrofolate reductase inhibitors, Bioorg. Med.
Chem. 23 (2015) 1691e1700.
[23] M.E. Van Dort, H. Hong, H. Wang, C.A. Nino, R.L. Lombardi, A.E. Blanks,
ꢀ
S. Galban, B.D. Ross, Discovery of bifunctional oncogenic target inhibitors
against allosteric mitogen-activated protein kinase (MEK1) and phosphati-
dylinositol 3-kinase (PI3K), J. Med. Chem. 59 (2016) 2512e2522.
[24] P. Dao, N. Smith, C.l. Tomkiewicz-Raulet, E.d. Yen-Pon, M. Camacho-Artacho,
D. Lietha, J.-P. Herbeuval, X. Coumoul, C. Garbay, H. Chen, Design, synthesis,
and evaluation of novel imidazo [1, 2-a][1, 3, 5] triazines and their derivatives
as focal adhesion kinase inhibitors with antitumor activity, J. Med. Chem. 58
(2014) 237e251.
[25] M.I. Polson, E.A. Medlycott, G.S. Hanan, L. Mikelsons, N.J. Taylor, M. Watanabe,
Y. Tanaka, F. Loiseau, R. Passalacqua, S. Campagna, Ruthenium Complexes of
Easily Accessible Tridentate Ligands Based on the 2-Aryl-4, 6-bis (2-pyridyl)-
s-triazine Motif: absorption Spectra, Luminescence Properties, and Redox
Behavior, Chem. Eur J. 10 (2004) 3640e3648.
[26] E.A. Medlycott, G.S. Hanan, F. Loiseau, S. Campagna, Tuning the excited-state
energy of the organic chromophore in bichromophoric systems based on the
Ru(II) complexes of tridentate ligands, Chem. Eur J. 13 (2007) 2837e2846.
[27] J. Liu, Y. Chen, G. Li, P. Zhang, C. Jin, L. Zeng, L. Ji, H. Chao, Ruthenium (II)
polypyridyl complexes as mitochondria-targeted two-photon photodynamic
anticancer agents, Biomaterials 56 (2015) 140e153.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.ejmech.2018.07.048.
References
[1] S. Dasari, P.B. Tchounwou, Cisplatin in cancer therapy: molecular mechanisms
of action, Eur. J. Pharmacol. 740 (2014) 364e378.
[2] B. Stordal, N. Pavlakis, R. Davey, Oxaliplatin for the treatment of cisplatin-
resistant cancer: a systematic review, Canc. Treat Rev. 33 (2007) 347e357.
[3] L. Galluzzi, L. Senovilla, I. Vitale, J. Michels, I. Martins, O. Kepp, M. Castedo,
G. Kroemer, Molecular mechanisms of cisplatin resistance, Oncogene 31
(2012) 1869e1883.
[28] M.P. Barr, S.G. Gray, A.C. Hoffmann, R.A. Hilger, J. Thomale, J.D. O'Flaherty,
D.A. Fennell, D. Richard, J.J. O'Leary, K.J. O'Byrne, Generation and characteri-
sation of cisplatin-resistant non-small cell lung cancer cell lines displaying a
stem-like signature, PLoS One 8 (2013), e54193.
[29] A. Flemming, Cancer stem cells: targeting the root of cancer relapse, Nat. Rev.
Drug Discov. 14 (2015) 165.
[30] B.S. Berlett, E.R. Stadtman, Protein oxidation in aging, disease, and oxidative
stress, J. Biol. Chem. 272 (1997) 20313e20316.
[31] E.R. Stadtman, Protein oxidation and aging, Free Radical Research 40 (2006)
1250e1258.
[4] D.-W. Shen, L.M. Pouliot, M.D. Hall, M.M. Gottesman, Cisplatin resistance: a
cellular self-defense mechanism resulting from multiple epigenetic and ge-
netic changes, Pharmacol. Rev. 64 (2012) 706e721.
[5] L. Galluzzi, I. Vitale, J. Michels, C. Brenner, G. Szabadkai, A. Harel-Bellan,
M. Castedo, G. Kroemer, Systems biology of cisplatin resistance: past, present
and future, Cell Death & Disease 5 (2014) e1257.
[6] F. Lentz, A. Drescher, A. Lindauer, M. Henke, R.A. Hilger, C.G. Hartinger,
M.E. Scheulen, C. Dittrich, B.K. Keppler, U. Jaehde, Pharmacokinetics of a novel
anticancer ruthenium complex (KP1019, FFC14A) in a phase I dose-escalation
study, Anti Canc. Drugs 20 (2009) 97e103.
[32] T. Kosakowska-Cholody, J. Lin, S. Srideshikan, L. Scheffer, N. Tarasova,
J. Acharya, HKH40A downregulates GRP78/BiP expression in cancer cells, Cell
Death & Disease 5 (2014) e1240.
[7] R. Trondl, P. Heffeter, C.R. Kowol, M.A. Jakupec, W. Berger, B.K. Keppler, NKP-
1339, the first ruthenium-based anticancer drug on the edge to clinical
application, Chem. Sci. 5 (2014) 2925e2932.
[33] L. Zhang, S. Wang, Wangtao, Y. Wang, J. Wang, L. Jiang, S. Li, X. Hu, Q. Wang,
Upregulation of GRP78 and GRP94 and its function in chemotherapy resis-
tance to VP-16 in human lung cancer cell line SK-MES-1, Canc. Invest. 27
(2009) 453e458.
[8] L. Chen, G. Li, F. Peng, X. Jie, G. Dongye, K. Cai, R. Feng, B. Li, Q. Zeng, K. Lun, The
induction of autophagy against mitochondria-mediated apoptosis in lung
cancer cells by a ruthenium (II) imidazole complex, Oncotarget 7 (2016)
80716.
[34] N. Al Nakouzi, C.K. Wang, E. Beraldi, W. Jager, S. Ettinger, L. Fazli, L. Nappi,
J. Bishop, F. Zhang, A. Chauchereau, Clusterin knockdown sensitizes prostate
cancer cells to taxane by modulating mitosis, EMBO Molecular Medicine
(2016), e201506059.
[35] C. Hoeller, B. Pratscher, C. Thallinger, D. Winter, D. Fink, B. Kovacic, V. Sexl,
V. Wacheck, M.E. Gleave, H. Pehamberger, Clusterin regulates drug-resistance
in melanoma cells, J. Invest. Dermatol. 124 (2005) 1300e1307.
[36] M. Kawasumi, B. Lemos, J.E. Bradner, R. Thibodeau, Y.-s. Kim, M. Schmidt,
E. Higgins, S.-w. Koo, A. Angle-Zahn, A. Chen, Protection from UV-induced skin
carcinogenesis by genetic inhibition of the ataxia telangiectasia and Rad3-
related (ATR) kinase, Proc. Natl. Acad. Sci. Unit. States Am. 108 (2011)
13716e13721.
[9] L. Gu, X. Li, Q. Ran, C. Kang, C. Lee, J. Shen, Antimetastatic activity of novel
ruthenium (III) pyridine complexes, Cancer Med. 5 (2016) 2850e2860.
[10] V. Pierroz, T. Joshi, A. Leonidova, C. Mari, J. Schur, I. Ott, L. Spiccia, S. Ferrari,
G. Gasser, Molecular and cellular characterization of the biological effects of
ruthenium (II) complexes incorporating 2-pyridyl-2-pyrimidine-4-carboxylic
acid, J. Am. Chem. Soc. 134 (2012) 20376e20387.
[11] A. Weiss, R.H. Berndsen, M. Dubois, C. Müller, R. Schibli, A.W. Griffioen,
P.J. Dyson, P. Nowak-Sliwinska, In vivo anti-tumor activity of the organome-
tallic ruthenium (ii)-arene complex [Ru (h 6-p-cymene) Cl (pta)](RAPTA-C)
2
in human ovarian and colorectal carcinomas, Chem. Sci. 5 (2014) 4742e4748.
[12] M.V. Babak, S.M. Meier, K.V. Huber, J. Reynisson, A.A. Legin, M.A. Jakupec,
A. Roller, A. Stukalov, M. Gridling, K.L. Bennett, Target profiling of an anti-
metastatic RAPTA agent by chemical proteomics: relevance to the mode of
action, Chem. Sci. 6 (2015) 2449e2456.
[37] C. Yang, L.M. Fu, Y. Wang, J.P. Zhang, W.T. Wong, X.C. Ai, Y.F. Qiao, B.S. Zou,
L.L. Gui,
A highly luminescent europium complex showing visible-light-

B. Purushothaman et al. / European Journal of Medicinal Chemistry 156 (2018) 747e759
759
sensitized red emission: direct observation of the singlet pathway, Angew.
Chem. 116 (2004) 5120e5123.
[38] V.S. Padalkar, V.S. Patil, N. Sekar, Synthesis and photo-physical properties of
fluorescent 1, 3, 5-triazine styryl derivatives, Chem. Cent. J. 5 (2011) 77.
[39] S. Ding, C. Li, N. Cheng, X. Cui, X. Xu, G. Zhou, Redox regulation in cancer stem
cells, Oxidative Med. Cell. Longev. 2015 (2015).
[55] R.N. Kitsis, J.D. Molkentin, Apoptotic cell death “Nixed” by an
ERemitochondrial necrotic pathway, Proc. Natl. Acad. Sci. Unit. States Am. 107
(2010) 9031e9032.
[56] S. Rangasamy, H. Ju, S. Um, D.-C. Oh, J.M. Song, Mitochondria and DNA tar-
geting of 5, 10, 15, 20-tetrakis (7-sulfonatobenzo [b] thiophene) porphyrin-
induced photodynamic therapy via intrinsic and extrinsic apoptotic cell
death, J. Med. Chem. 58 (2015) 6864e6874.
[57] Y. Kushnareva, A.Y. Andreyev, T. Kuwana, D.D. Newmeyer, Bax activation
initiates the assembly of a multimeric catalyst that facilitates Bax pore for-
mation in mitochondrial outer membranes, PLoS Biol. 10 (2012), e1001394.
[58] L. Große, C.A. Wurm, C. Brüser, D. Neumann, D.C. Jans, S. Jakobs, Bax assem-
bles into large ring-like structures remodeling the mitochondrial outer
membrane in apoptosis, EMBO J. 35 (2016) 402e413.
[40] O. Herault, K.J. Hope, E. Deneault, N. Mayotte, J. Chagraoui, B.T. Wilhelm,
ꢀ
S. Cellot, M. Sauvageau, M.A. Andrade-Navarro, J. Hebert, A role for GPx3 in
activity of normal and leukemia stem cells, J. Exp. Med. 209 (2012) 895e901.
[41] S.J. Dougan, A. Habtemariam, S.E. McHale, S. Parsons, P.J. Sadler, Catalytic
organometallic anticancer complexes, Proc. Natl. Acad. Sci. Unit. States Am.
105 (2008) 11628e11633.
[42] E.B. Kurutas, The importance of antioxidants which play the role in cellular
response against oxidative/nitrosative stress: current state, Nutr. J. 15 (2016)
71.
[59] F. Ciardiello, G. Tortora, Inhibition of bcl-2 as cancer therapy, Ann Oncol. 13
(2002) 501e502.
[43] P.T. Schumacker, Reactive oxygen species in cancer: a dance with the devil,
Canc. Cell 27 (2015) 156e157.
[60] N.N. Danial, BCL-2 family proteins: critical checkpoints of apoptotic cell death,
Clin. Canc. Res. 13 (2007) 7254e7263.
[44] E. Panieri, M. Santoro, ROS homeostasis and metabolism: a dangerous liason
in cancer cells, Cell Death & Disease 7 (2016) e2253.
[61] M. Chami, A. Prandini, M. Campanella, P. Pinton, G. Szabadkai, J.C. Reed,
R. Rizzuto, Bcl-2 and Bax exert opposing effects on Ca2þ signaling, which do
not depend on their putative pore-forming region, J. Biol. Chem. 279 (2004)
54581e54589.
[62] L. Scorrano, S.A. Oakes, J.T. Opferman, E.H. Cheng, M.D. Sorcinelli, T. Pozzan,
S.J. Korsmeyer, BAX and BAK regulation of endoplasmic reticulum Ca2þ: a
control point for apoptosis, Science 300 (2003) 135e139.
[45] S. Prasad, S.C. Gupta, A.K. Tyagi, Reactive oxygen species (ROS) and cancer:
role of antioxidative nutraceuticals, Canc. Lett. 387 (2017) 95e105.
[46] D. Trachootham, J. Alexandre, P. Huang, Targeting cancer cells by ROS-
mediated mechanisms: a radical therapeutic approach? Nat. Rev. Drug Dis-
cov. 8 (2009) 579e591.
[47] O. Nagano, S. Okazaki, H. Saya, Redox regulation in stem-like cancer cells by
CD44 variant isoforms, Oncogene 32 (2013) 5191e5198.
[63] W.-X. Zong, C. Li, G. Hatzivassiliou, T. Lindsten, Q.-C. Yu, J. Yuan,
C.B. Thompson, Bax and Bak can localize to the endoplasmic reticulum to
initiate apoptosis, J. Cell Biol. 162 (2003) 59e69.
[64] A. Ruiz-Vela, J.T. Opferman, E.H.Y. Cheng, S.J. Korsmeyer, Proapoptotic BAX
and BAK control multiple initiator caspases, EMBO Reports 6 (2005) 379e385.
[65] C. Chiu, L. Lee, Y. Li, Y. Chen, Y. Lu, Y. Li, H. Wang, J. Chang, A. Cheng, Grp78 as a
therapeutic target for refractory headeneck cancer with CD24ꢁ CD44þ
stemness phenotype, Canc. Gene Ther. 20 (2013) 606e615.
[48] A.T. Dharmaraja, Role of reactive oxygen species (ROS) in therapeutics and
drug resistance in cancer and bacteria, J. Med. Chem. 60 (2017) 3221e3240.
[49] A. Sznarkowska, A. Kostecka, K. Meller, K.P. Bielawski, Inhibition of cancer
antioxidant defense by natural compounds, Oncotarget 8 (2017) 15996.
[50] J. Chen, F. Peng, Y. Zhang, B. Li, J. She, X. Jie, Z. Zou, M. Chen, L. Chen, Synthesis,
characterization, cellular uptake and apoptosis-inducing properties of two
highly cytotoxic cyclometalated ruthenium (II)
Med. Chem. 140 (2017) 104e117.
b
-carboline complexes, Eur. J.
[66] Y.-Y. Huang, L.-J. Pu, L.-L. Song, L.-Y. Ma, H. Liu, C.-C. Jiang, Knockdown of
GRP78 enhances cell death by cisplatin and radiotherapy in nasopharyngeal
cells, Anti Canc. Drugs 27 (2016) 726e733.
[67] H. Ju, P. Arumugam, J. Lee, J.M. Song, Impact of environmental pollutant
cadmium on the establishment of a cancer stem cell population in breast and
hepatic cancer, ACS Omega 2 (2017) 563e572.
[68] Y.K. Tak, P.K. Naoghare, E. Han, J.M. Song, VEGF inhibitor (Iressa) arrests
histone deacetylase expression: single-cell cotransfection imaging cytometry
for multi-target-multi-drug analysis, J. Cell. Physiol. 226 (2011) 2115e2122.
[69] J. Ahn, T. Xia, H. Konno, K. Konno, P. Ruiz, G.N. Barber, Inflammation-driven
carcinogenesis is mediated through STING, Nat. Commun. 5 (2014) 5166.
[70] P. Arumugam, A. Samson, J. Ki, J.M. Song, Knockdown of clusterin alters
mitochondrial dynamics, facilitates necrosis in camptothecin-induced cancer
stem cells, Cell Biol. Toxicol. 33 (2017) 307e321.
[51] D. Mekahli, G. Bultynck, J.B. Parys, H. De Smedt, L. Missiaen, Endoplasmic-
reticulum calcium depletion and disease, Cold Spring Harbor Perspect. Biol. 3
(2011) a004317.
[52] G.G. Johnson, M.C. White, J.-H. Wu, M. Vallejo, M. Grimaldi, The deadly
connection between endoplasmic reticulum, Ca2þ, protein synthesis, and the
endoplasmic reticulum stress response in malignant glioma cells, Neuro
Oncol. 16 (2014) 1086e1099.
[53] B. Bhandary, A. Marahatta, H.-R. Kim, H.-J. Chae, An involvement of oxidative
stress in endoplasmic reticulum stress and its associated diseases, Int. J. Mol.
Sci. 14 (2012) 434e456.
[54] M.P. Mattson, S.L. Chan, Calcium orchestrates apoptosis, Nat. Cell Biol. 5
(2003) 1041e1043.