Quaternary ammonium oxidative demethylation: X-ray crystallographic, resonance raman, and uv-visible spectroscopic analysis of a Rieske-type demethylase

Article abstract of DOI:10.1021/ja2111898

Herein, the structure resulting from in situ turnover in a chemically challenging quaternary ammonium oxidative demethylation reaction was captured via crystallographic analysis and analyzed via single-crystal spectroscopy. Crystal structures were determined for the Rieske-type monooxygenase, stachydrine demethylase, in the unliganded state (at 1.6 A resolution) and in the product complex (at 2.2 A resolution). The ligand complex was obtained from enzyme aerobically cocrystallized with the substrate stachydrine (N,N-dimethylproline). The ligand electron density in the complex was interpreted as proline, generated within the active site at 100 K by the absorption of X-ray photon energy and two consecutive demethylation cycles. The oxidation state of the Rieske iron-sulfur cluster was characterized by UV-visible spectroscopy throughout X-ray data collection in conjunction with resonance Raman spectra collected before and after diffraction data. Shifts in the absorption band wavelength and intensity as a function of absorbed X-ray dose demonstrated that the Rieske center was reduced by solvated electrons generated by X-ray photons; the kinetics of the reduction process differed dramatically for the liganded complex compared to unliganded demethylase, which may correspond to the observed turnover in the crystal.

Full text of DOI:10.1021/ja2111898

Article
pubs.acs.org/JACS
Quaternary Ammonium Oxidative Demethylation: X-ray
Crystallographic, Resonance Raman, and UV−Visible Spectroscopic
Analysis of a Rieske-Type Demethylase
Kelly D. Daughtry,† Youli Xiao,‡ Deborah Stoner-Ma,§ Eunsun Cho,‡ Allen M. Orville,*,§ Pinghua Liu,*,‡
and Karen N. Allen*,†,‡
†Department of Physiology and Biophysics, Boston University School of Medicine, Boston, Massachusetts 02218, United States
‡Department of Chemistry, Boston University, Boston, Massachusetts 02215, United States
§Biology Department, Brookhaven National Laboratory, Upton, New York 11973, United States
S
* Supporting Information
ABSTRACT: Herein, the structure resulting from in situ turnover in a
chemically challenging quaternary ammonium oxidative demethylation reaction
was captured via crystallographic analysis and analyzed via single-crystal
spectroscopy. Crystal structures were determined for the Rieske-type
monooxygenase, stachydrine demethylase, in the unliganded state (at 1.6 Å
resolution) and in the product complex (at 2.2 Å resolution). The ligand
complex was obtained from enzyme aerobically cocrystallized with the substrate
stachydrine (N,N-dimethylproline). The ligand electron density in the complex
was interpreted as proline, generated within the active site at 100 K by the
absorption of X-ray photon energy and two consecutive demethylation cycles.
The oxidation state of the Rieske iron−sulfur cluster was characterized by UV−
visible spectroscopy throughout X-ray data collection in conjunction with
resonance Raman spectra collected before and after diffraction data. Shifts in the
absorption band wavelength and intensity as a function of absorbed X-ray dose
demonstrated that the Rieske center was reduced by solvated electrons generated by X-ray photons; the kinetics of the reduction
process differed dramatically for the liganded complex compared to unliganded demethylase, which may correspond to the
observed turnover in the crystal.
The first histone demethylase type, lysine-specific demethylase
(LSD1), is an FAD-dependent oxidase that catalyzes the
demethylation of mono- or dimethylated lysine 4 on histone 3
(Scheme 1A) with formation of formaldehyde.11 After the
discovery of LSD1, a second type of histone-demethylase, the
α-ketoglutarate-dependent mononuclear iron oxygenases, was
discovered;1,12−14 these enzymes can demethylate both di- and
trimethylated lysine (Scheme 1B). DNA N-dealkylation from
the N1-position of adenine and the N3-position of cytosine
using a similar type of mechanism has also been reported.15,16
These proteins normally have multiple domains, e.g., the
catalytic domain, substrate recognition domain, and other
domains used for DNA binding or protein complex formation.
Structural studies have revealed that the identity of the cofactor
dictates the reaction mechanism, whereas the catalytic domain
in combination with other domains controls substrate
specificity.17−22 Thus, the discovery of new N-demethylases
through bioinformatics may uncover other types of novel
chemical demethylation mechanisms.10
INTRODUCTION
■
Biological methylation has been a subject of intense study since
the 1970s.1 Earlier studies were focused on the role of
methylation in metabolism, e.g., mechanistic studies of enzymes
in the one-carbon cycle.2,3 In the post genomic era, there is
renewed interest in chemical transformations with emphasis on
chemical modifications of DNA, RNA, and post-translational
protein modifications (e.g., acetylation, ADP-ribosylation,
lipidation, methylation, phosphorylation, proteolytic protein
processing, sumoylation, sulfonation, and ubiquitination),
which can further expand the information encoded by the
genome by at least 1−2 orders of magnitude.4,5 Among these
modifications, methylation of macromolecules (e.g., protein
and DNA) has been known for decades.1
Unlike most other modifications, which are known to be
reversible processes, protein N-methylation (e.g., histone N-
methylations) was originally proposed to be an irreversible
process because of the stability of the C−N bond.6,7 For
example, the biological half-life of a histone methyl group
approximately equals that of the histone itself.8,9 With the
discovery of two types of histone demethylases in the past few
years,10 the dynamic nature of N-methylation was recognized
and mechanistic studies in this area have grown exponentially.
Received: December 13, 2011
Published: January 8, 2012
© 2012 American Chemical Society
2823
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
Scheme 1. Oxidative Demethylation Reactions (R = H or CH3): (A) LSD1 (a Flavoprotein)-Catalyzed Demethylation of Mono-
or Dimethylated Lysine Residues on Histone Tails; (B) α-Ketoglutarate-Dependent Demethylation of Di- or Trimethylated
Lysine Residues on Histone Tails; and (C) Stc2 (Rieske-Type Mononuclear Non-Heme Enzyme)-Catalyzed Oxidative
Demethylation of Quaternary Ammonium
meliloti 1021 genomic DNA using the following two primers: forward
GGGAATTCGACAGCTAACCCGACC and reverse CTCGAGT-
CACTCCGCAGCCAC. The amplified Stc2 DNA fragment was
subcloned into the EcoRI and XhoI sites of the pASK-IBA5+ vector
from IBA Biotechnology Inc., which contains an N-terminal strep-tag.
The identity of the resulting construct was confirmed by DNA
sequencing (at GeneWiz, Inc.) and transformed into BL21(DE3)-
pDB1281 competent cells for Stc2 protein overexpression.
Expression and Purification. A single colony of Stc2-pASK-
IBA5+/BL21(DE3)/pDB1281 (pDB1281 is a cassette containing E.
coli isc iron−sulfur cluster synthetic operon to ensure proper iron−
sulfur cluster maturation (kindly provided by Dr. Dennis R. Dean at
Virginia Polytechnic Institute)) was selected to inoculate 50 mL of LB
medium supplemented with ampicillin (100 μg/L) and kanamycin (50
μg/L) and grown overnight at 37 °C with shaking at 170 rpm. The
overnight culture was used to inoculate (in 1:200 dilution) 2 L of LB-
broth supplemented with ampicillin, kanamycin, and 0.1 mM ferric
chloride. The culture was incubated at 37 °C with shaking at 170 rpm
and monitored by absorbance at 600 nm. Once the OD600 reached 0.1,
0.2 g of L-arabinose was added to induce isc protein production. When
OD600 reached 0.5−0.6, the temperature of the cell culture was
reduced to 25 °C, and Stc2 protein production was induced by
anhydrotetracycline at a final concentration of 200 ng/mL. The
induced cells were cultured for an additional 20−24 h with shaking at
170 rpm. The cells were harvested and stored at −80 °C.
The study of small-molecule quaternary ammonium
demethylases can lend insight into the potential folds and
chemistries capable of supporting demethylation reactions. For
this reason, we undertook the analysis of the enzyme
stachydrine demethylase (Stc2), from Sinorhizobium meliloti
1021. Nitrogen-fixing soil bacteria such as S. meliloti can live in
symbiosis within root nodules of legumes. Quaternary
ammonium solutes such as glycine betaine and proline betaine
(also known as N,N-dimethylproline or stachydrine, 1, Scheme
1C) are secreted from the roots and taken up by S. meliloti,
where they can serve as carbon and nitrogen sources in
conditions of low osmotic strength, and additionally as
osmoprotective compounds in conditions of high osmotic
stress.23−27 Under catabolic conditions, stachydrine is con-
verted to proline in two demethylation steps with the first step
dependent on stc2, stc3, and stc4 genes and the second requiring
a distinct stcD2 gene, which is positioned on a separate
locus.28−30 Stc2 is a putative Rieske-type oxygenase, and stc4 is
proposed to serve as the reductase in the system.31 On the basis
of these findings, it is proposed that the Stc2 complex
oxidatively demethylates stachydrine to monomethylproline
(2), which is then demethylated by StcD2 to proline (3,
Scheme 1C), a flavin-dependent oxygenase. Herein, we present
the chemical, structural, and spectroscopic characterization of
stachydrine demethylase (Stc2) from S. meliloti 1021.
Protein was purified in a Coy-anaerobic chamber. Cells (15 g) were
resuspended in 50 mL of buffer (100 mM Tris-HCl, 150 mM NaCl,
pH 7.5). Lysozyme (50 mg) and 10 μL of 100 Units/μL DNase I were
added and the mixture was incubated at room temperature with gentle
agitation for 15 min. The mixture was then cooled by incubating on ice
for 30 min. The cells were disrupted by sonication (20 cycles; 30 s on
and 1−2 min off). The supernatant and the cell debris were separated
EXPERIMENTAL SECTION
■
Cloning. DNA for the Rieske dioxygenase subunit (Stc2) of
stachydrine demethylase was amplified by PCR reaction from S.
2824
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
by centrifugation (38000g) for 10 min at 4 °C. Streptomycin sulfate
was added to the supernatant to a final concentration of 2% (w/v).
After the mixture was incubated on ice for 30 min, the DNA
precipitate was removed by centrifugation at 38000g for 40 min. The
supernatant was mixed with the Strep-Tactin resin (5 mL, pre-
equilibrated in 100 mM Tris-HCl, 150 mM NaCl, pH 7.5 buffer) and
incubated on ice for 30 min. The protein−resin mixture was loaded
into a column, and the column was washed with the same buffer until
OD260 was lower than 0.01. The desired Stc2 holo-enzyme was eluted
with eluting buffer (10 mL of 2.5 mM desthiobiotin in 5 mM Tris-HCl
buffer, pH 7.5). The elution process was repeated once following the
same procedure. The purification was monitored by SDS-PAGE, and
Stc2-containing fractions were combined and concentrated by
ultrafiltration to ∼2 mL (30−40 psi, 30 kDa/44.5 mm membrane).
The protein product was aliquoted into 200−400 μL fractions, flash
frozen with liquid nitrogen, and stored at −80 °C. The concentration
of the protein was determined by Bradford reagent. The yield of pure
protein was 10−15 mg/g wet cell paste.
calculated with the coefficients |Fo| − |Fc| with electron-density
acceptance criteria of F ≥ 3σ(F).
Crystals of Stc2 and its proline complex were obtained by
cocrystallizing 30 mg/mL Stc2 protein with 10 mM stachydrine (1)
in a 1:1:0.2 μL drop ratio (protein:well:stachydrine) aerobically.
Hanging drops were equilibrated against 100 mM Hepes buffer, pH
7.0, 10% PEG 3350, 10% glycerol, and 25 mM hexamine cobalt. Small
trapezoidal crystals appeared within 10 min and grew to a final size of
0.2 mm × 0.1 mm × 0.02 mm within 1 day. After 24 h, crystals were
moved to a drop of mother liquor containing 20% glycerol for 5 min
and then either flash-cooled directly or moved into paratone to
remove surface solvent before flash-cooling by plunging the loop into
liquid nitrogen. X-ray data collection was performed at the NSLS,
Brookhaven National Laboratory, on the X26C beamline equipped
with a ADSC Q210 X-ray detector, single-crystal visible optical
absorption, and resonance Raman spectroscopies. X-ray diffraction
(XRD) data were collected at a wavelength of 1.0 Å. Because paratone-
N gives a large background absorbance in the UV−vis region of the
optical spectrum, it was omitted from all the spectroscopy studies, and
a cryoprotectant of 20% glycerol in mother liquor was used. The
microspectrophotometer allowed for direct characterization of the
Rieske [2Fe-2S] cluster.38 Upon reduction, there is a characteristic
shift of absorption from 550 nm in the oxidized form to an absorption
feature at 525 nm in the reduced form. To test if reduction occurred
due to X-ray exposure, the data set was parsed into a separate oxidized
and reduced data set, using the first 100 images (50°) for structure
determination. Data were processed to 2.2 Å resolution using
HKL2000.32
Activity Assays. The substrates N,N-dimethylproline, also known
as stachydrine (1), and N-methylproline (2) were synthesized as
described in Supporting Information. A Stc2 protein anaerobic
solution (0.4 mM in 50 mM Tris, pH 7.5) was mixed with 1.0 mM
Fe(II). The mixture was reduced with 1.0 mM dithionite in an
anaerobic Coy-chamber. The protein mixture was mixed with an
aerobic 0.4 mM stachydrine solution and incubated at room
temperature aerobically for 20 h. The formation of monomethylated
1
1
proline was monitored by H NMR. The H NMR chemical shifts of
the two methyl groups of stachydrine are 3.16 and 2.97 ppm,
1
respectively. The H NMR chemical shift for the methyl group of
The structure of the Stc2−ligand complex was solved by
isomorphous phasing using the Stc2 protomer (vide supra). The
ligand was modeled as proline in the final stages of refinement, after
placement of water. Positioning and refinement with N,N-
dimethylproline or N-monomethylproline resulted in strong (<3σ)
peaks in the |Fo| − |Fc| difference map when contoured at negative
values centered on the N-methyl group(s), suggesting the density does
not support either mono- or dimethylated product. Proline was
therefore unambiguously modeled and refined into the density
corresponding to ligand.
UV−Vis Spectroscopy. The beamline at X26C is equipped with a
microspectrophotometer (350−800 nm) with an approximately 25 μm
diameter optical focal point coincident with that of the X-ray beam.
Absorption spectra are collected from protein crystals in conjunction
with XRD data as previously described.39,40 The source objective that
focuses the light from a 75 W Xe arc lamp (Newport) onto the sample
was mounted above the sample. The collection lens, located below the
sample, was attached to a motorized x,y,z translation stage (under
EPICS software control) adjacent to the optical components for
Raman spectroscopy as previously described.41,42
For concurrent spectroscopy collection, we typically oriented the
flat face of the crystal normal to the spectroscopy photons. Spectra
were measured at 5° intervals over a 360° rotation, and the
characteristic spectral peaks determined in solution for Stc2 (460
and 550 nm) were analyzed with respect to the crystal orientation.
Electronic absorption and XRD data collection were integrated into
the XRD data collection software (CBASS). For example, during the
X-ray detector readout, the crystal was rotated to the optimum crystal
orientation angle, a spectrum was collected, and the crystal was
returned to the correct orientation for X-ray data collection. Thus, all
spectra collected for a particular crystal were from the same orientation
of the crystal. We estimated the absorbed X-ray dose via a Java tool
that uses the program RADDOSE.41,43
Resonance Raman Spectroscopy. Native, oxidized, and reduced
crystals were used for resonance Raman spectroscopy. Oxidized
crystals were obtained by adding 5% hydrogen peroxide directly to the
crystallization drop and incubating at room temperature for 5 min
before freezing in liquid nitrogen. Native crystals were grown in
atmospheric oxygen. Reduced crystals were obtained using the X-ray
source at X26-C of NSLS to reduce the iron−sulfur cluster. Crystals
were monitored for reduction by UV−vis spectroscopy by following
monomethylated proline is at 2.80 ppm.
Stc2 Crystallization. Stc2 crystals were grown under anaerobic
conditions in a Coy-chamber using the hanging drop method.
Crystallization conditions were obtained from sparse matrix screening
using the Index Screen (Hampton Research) and optimized using the
Additive Screen (Hampton Research). Drops were equilibrated against
a reservoir solution containing 15% poly(ethylene glycol) (PEG)
3350, 20% glycerol, 100 mM succinic acid buffer, pH 7.0, and 10 mM
hexamine cobalt at 22 °C. The hanging drops contained equal volumes
(1 μL) of the reservoir solution and protein solution (35 mg/mL in 10
mM Tris buffer, pH 7.5, 2.5 mM biotin). Small crystals (0.1 mm × 0.1
mm × 0.05 mm) appeared in 2 days. The crystals belonged to the
space group P6322 with cell dimensions a = b = 97.8 Å, c = 179.4 Å.
There was one protomer in the asymmetric unit, and the solvent
comprised 54% of the cell.
For data collection, crystals were flash-cooled directly in liquid
nitrogen and transferred to a stream of N2 gas cooled to 100 K. A
single-wavelength anomalous dispersion (SAD) data set was collected
at the X12C beamline of the National Synchrotron Light Source
(NSLS, Brookhaven National Laboratory, Upton, NY) equipped with
an ADSC Q210 detector. To measure the maximum f ′′ contribution
from the Fe atoms, a wavelength of 1.738 Å was chosen on the basis of
the X-ray fluorescence spectrum at the iron K absorption edge. A
“native” data set was also collected on the same crystal at a wavelength
of 1.00 Å. Data collected to 1.9 (SAD) and 1.6 Å (native) were
processed with the program DENZO.32
For phase determination, HKL2MAP33 was used to navigate the
SHELX programs.34 SHELXD was used to identify heavy-atom sites
using Fe-S-SAD, utilizing inherent Fe and S atoms. SHELXE was used
to calculate phases based on three Fe and eight S heavy-atom sites.
The program ARP/wARP was used for model building from initial
phases, resulting in placement of 7−403 out of 412 residues.35 Iterative
rounds of refinement and rebuilding using Phenix36 consisted of a
single energy minimization molecular dynamics cycle followed by a
simulated annealing molecular dynamics cycle at 5000 K, which was
then followed by alternating cycles of positional and individual
temperature factor refinement with manual inspection/rebuilding in
COOT.37 The structure of Stc2 was determined at 1.6 Å resolution by
isomorphous phasing using the protomer from the 1.9 Å structure of
Stc2 (vide supra). In the later stages of refinement, water molecules
were added to the model using an electron-density difference map
2825
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
the disappearance of the 460 nm peak and the peak shift from 550 to
525 nm.
with phases determined via Fe-S-SAD. These coordinates were
then used for isomorphous phasing of a higher resolution data
set collected to 1.6 Å resolution (at λ = 1.0 Å) (Table 1). The
Raman spectra were collected from the identical region of the
crystal as was probed by absorption spectroscopy. Alignment of the
Raman probe head (Horiba Jobin-Yvon) utilized the same motorized
x,y,z translation stage as controlled the positioning of the lower
absorption objective. The experimental setup has been fully described
elsewhere.42 For the experiments reported herein, a 300 mW, 532 nm
diode laser (Laser Quantum) was used as the excitation source. Power
levels at the sample were kept below 7 mW, although levels at or
below 3 mW were determined to be preferable. The spectrometer used
a 1 μm entrance slit and a 600 lines/mm grating. Resolution is
estimated at 6 cm−1. The system was calibrated using the laser line and
the Hg line from ambient light. Total collection times ranged from 5
to 10 min. LabSpec (provided by Horiba Jobin-Yvon) is the collection
software; data analysis utilizes GramsAI (Thermo Scientific) and
Origin 6.0 (Microcal Software). Pre- versus post-X-ray-exposure
spectra, as well as spectra from exposed versus unexposed regions of
a single crystal, were compared.
Table 1. X-ray Data Collection and Refinement Statistics for
Holoenzyme Stc2 and Proline-Bound Stc2
Stc2 SAD
P6322
a = b = 97.859, c = 179.372
Stc2
Stc2/proline
P6322
space group
P6322
cell dimens (Å)
a = b = 97.140,
c = 180.08
protomer/ASU
wavelength (Å)
resolution (Å)
1
1
1
1.738
1.0
1.0
50−1.9 (1.97− 28.2−1.6
39.7−2.2 (2.32−2.2)
1.9)
(1.66−1.6)
obsd reflns
1 589 393
40 656
2 886 811
143 238
unique reflns
68 467
25 766
completeness
(%)
99.2 (93.8)
99.9 (100.0)
98.7 (99.56)
Accession Codes. The coordinates, structure factors, and single-
crystal spectroscopy of the oxidized Stc2 holoenzyme, and Stc2
cocrystallized aerobically with stachydrine but interpreted as proline
bound, have been deposited in the PDB under accession codes 3VCA
and 3VCP, respectively.
Rmerge (%)
⟨I/σ⟩
9.8 (55.7)
44.5 (1.89)
39.4 (5.6)
17.8/20.9
8.0 (53.7)
40.78 (6.2)
16.3 (18.0)
17.8/20.9
17.1 (60)
6.9 (2.9)
redundancy
5.6 (5.8)
R/Rfree
18.74 (24.22)
average temperature factors (Å2)
RESULTS AND DISCUSSION
protein/
solvent
27.6/37.8
18.7/32.1
11.9/17.3
23.12/24.5
15.8/23.2
■
Activity of Stc2. In order to enable the identification of
novel demethylases, it is essential to have examples of each
structural/chemical class that can carry out this reaction.
Toward this goal, we undertook the structural and functional
characterization of a predicted Rieske-type mononuclear non-
heme iron demethylase, stachydrine demethylase.30
cluster/
mono Fe
24.4/32.8
ligand
na
na
34.4
rmsd bonds/
angles
0.007/1.091
0.005/1.042
0.008/1.157
a
Rmerge = ∑hkl ∑i|Ihkl,i − ⟨Ihkl⟩I|/∑hkl∑i|Ihkl,i|, where ⟨Ihkl⟩ is the mean
intensity of the multiple Ihkl,i observations for symmetry-related
reflections. Numbers in parentheses indicate highest resolution shell.
The activity of Stc2 as a quaternary ammonium oxidative
demethylase with dithionite as the reductant was measured
1
directly using a H NMR assay (see Experimental Section and
1
overall protomeric structure is similar to that of other Rieske-
type oxygenases consisting of all α-subunits, such as 2-
oxoquinoline 8-monooxygenase44 and phthalate dioxygenase,45
in contrast to 2,4-dinitrotoluene dioxygenase,46 naphthalene
1,2-dioxygenase (NDO),47 benzoate 1,2-dioxygenase,48 and
others that are α-β trimers. The Stc2 protomer comprises a
Rieske [2Fe-2S] domain (residues 45−153) and a catalytic
domain (residues 1−44 and 154−412) (Figure 1; Figure S2
and Table S1). The Rieske domain contains 11 β-strands which
position the iron−sulfur liganding residues. In the Rieske [2Fe-
2S] cluster, one iron is coordinated by His88 and His109, and
the second iron is coordinated by Cys86 and Cys106 (Figure
2A). The catalytic domain consists of a seven-stranded
antiparallel β-sheet, with loops and α-helices connecting the
β-strands. The mononuclear non-heme iron is coordinated by a
2-His-1-carboxylate facial triad49 (His204, His209, and
Asp360). A well-ordered loop (residues 200−210) provides
His204 and His209 (2.1 Å Fe−N distance for both His
residues). An α-helix spanning the length of the catalytic
domain contributes the iron-coordinating residues Asp360 (2.0
Å Fe−O distance). In addition, the mononuclear iron
coordinates two solvent ligands (W1 and W2 with 2.1 and
2.4 Å Fe−O distances, respectively); a third water (W3) is
nearby (2.7 Å Fe−O distance), although it is a long metal−
ligand distance for a water forming a coordinate bond to Fe
(Figure 3A). Although the density corresponding to W3 is
elongated, the center of highest density is at the center of the
ellipsoid and is inconsistent with refinement with two solvent
molecules at half occupancy. Thus, the coordination geometry
is five-coordinate in a square pyramidal shape or distorted
Supporting Information). The H NMR chemical shifts of the
two stachydrine methyl groups are at 3.16 and 2.97 ppm,
respectively (Figure S1). In the presence of dithionite-reduced
Stc2 and molecular oxygen, stachydrine was oxidatively
demethylated to monomethylated proline as suggested by the
1H NMR spectrum (Figure S1), in which a new peak with a
chemical shift of 2.80 ppm was assigned as the methyl group of
monomethylated proline. This conclusion was substantiated by
comparison to a chemically synthesized monomethylproline
standard (Figure S1).
The FAD-dependent demethylase LSD1 can demethylate
tertiary and secondary amines but cannot utilize quaternary
ammonium compounds (e.g., trimethylated lysine in histone
tails) as substrates.11 In contrast, α-ketoglutarate-dependent
mononuclear iron oxygenases can demethylate either quater-
nary ammonium or tertiary amines, but some secondary amines
do not act as substrates (e.g., monomethylated lysine in histone
tails).11−15 In solution, Stc2 can oxidatively demethylate
quaternary ammonium to tertiary amines (Scheme 1C), but
it does not catalyze the demethylation of either tertiary amine
1
or secondary amine substrates based on the results from H
NMR assays using N,N-dimethylglycine, N-methylglycine, and
N-methylproline as substrates (with a detection limit of 10 μM,
Figure S1). Consistent with the conclusions reached in previous
histone demethylase studies, demethylases have differing
substrate methylation state preferences, and their active-site
structures and cofactor chemistries play key roles in such
selectivity.10
X-ray Crystal Structure of Stc2 as Isolated. The initial
structure of the Stc2 holoenzyme was solved to 1.9 Å resolution
2826
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
Figure 1. Structures of the Stc2 holoenzyme protomer and the α3 trimer. (A) Protomer in the asymmetric unit depicted as a ribbon diagram colored
from blue (N-terminal) to red (C-terminal). (B) Ribbon diagram of the holoenzyme with each protomer colored by subunit. The Rieske cluster (Fe,
orange; S, yellow) and the mononuclear iron site are rendered as CPK spheres. All structural figures were rendered with Molscript91 and POVRAY
(www.povray.org).
Figure 2. Rieske mononuclear iron cluster. (A) Depicted as ball-and stick with electron density (gray cages) calculated with coefficients 2Fo − Fc;
contoured at 1σ. (B) Interface between two Stc2 subunits (carbons of neighboring subunits in gray and brown) showing the hydrogen bond bridge
between the mononuclear non-heme iron site and the Rieske [2Fe-2S] cluster. Hydrogen bonds are shown as dashed lines.
Figure 3. Mononuclear Fe active site of Stc2 with electron density (gray cages) calculated with coefficients 2Fo − Fc and contoured at 1σ. (A) Active
site of the unliganded holoenzyme. (B) Holoenzyme cocrystallized with substrate N,N-dimethylproline (proline, gray ball-and-stick, observed after in
situ turnover). Coordination bonds to Fe (orange sphere) are shown.
octahedral by including the solvent with the long, 2.7 Å bond as
a ligand (Figure 3A).
surface area ∼570 Å2 at the subunit−subunit interface51 of the
catalytic and Rieske domains with 17 hydrogen bonds and 9
salt bridges.50 Rieske-type oxygenases structurally similar to
Stc2 were identified via the Dali server (see Figure S2 for
sequence alignment).52 These included the putative aromatic
ring hydroxylating dioxygenase (PDB 3N0Q), toluene 2,3-
dioxygenase (PDB 3EN1),53 naphthalene 1,2-dioxyggenase
Within one protomer, the distance between the Rieske [2Fe-
2S] cluster and the mononuclear iron site is ∼46 Å (Figure 1),
which is too long for the efficient electron transfer necessary for
catalysis. The holoenzyme exists as a homotrimer, similar to
that observed in other Rieske-type oxygenases50 with a buried
2827
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
(PDB 1NDO),47 biphenyl dioxygenase (PDB 1ULI),54 cumene
dioxygenase (PDB 1WQL),55 nitrobenzene dioxygenase (PDB
2BMO),56 PAH-hydroxylating dioxygnease (PDB 2CKF),57
carbazole 1,9α-dioxygenase (PDB 3GKQ), 2-oxoquinoline 8-
monooxygenase (PDB 1ZO1),58 and dicamba demethylase
(PDB 3GOB).59 Overall, analysis of the rmsd values (Table S1,
Supporting Information) shows higher structural similarity
between the Rieske domains than between the catalytic
domains, perhaps reflecting changes in specificity determinants
necessary to support the differing chemistry catalyzed by these
enzymes. Notably, dicamba demethylase is an O-demethylase
that shares less sequence identity (14%) with Stc2 than many of
the other Rieske oxygenases (Figure S2, Table S1).59−61 Thus,
though both these enzymes catalyze demethylation reactions,
they are not closely related by sequence and probably represent
distinct evolutionary pathways from a common progenitor. The
distance between the Rieske domain of one subunit and the
mononuclear iron site in an adjacent subunit catalytic domain is
∼12 Å (Figure 1B). Glu201 bridges the two sites from two
adjacent subunits, directly forming a hydrogen bond to His109
of the Rieske [2Fe-2S] cluster (2.8 Å) on one subunit and
His204 of the mononuclear iron (2.8 Å) from another subunit
(Figure 2B). Studies from other Rieske-type oxygenases reveal
that the homologous bridging Asp/Glu residue is essential, and
ablation via mutagenesis completely abolishes activity (as seen
with NDO for the Asp to Gln mutation),62 leading to the
proposal that it acts as a conduit of electrons between the two
cofactors. It is very likely that Glu201 plays a similar role in
Stc2.
We note several unique features within the structure of
resting Stc2. First, in the loop after Glu201 and spanning two of
the mononuclear iron ligands (His204 and His209), a disulfide
bond between Cys202 and Cys205 is present (Figure 3A). This
disulfide bond is only ∼4.6 Å from the mononuclear iron. It
also forms one side of the putative substrate binding cavity,
which in the resting state contains several solvent molecules
and is adjacent to the iron-bound solvent ligands (Figure S3A).
The occurrence of a disulfide bond adjacent to Rieske [2Fe-2S]
clusters has been shown to structurally stabilize the cluster in
cytochrome bc1 with minimal effect on its reduction potential,63
however, no such cysteine moieties have previously been
documented to be adjacent to a mononuclear non-heme iron
center.
Assignment of Orthologues via Bioinformatic Anal-
ysis. The enzyme most similar to Stc2, ABF62193 from
Silicibacter sp. TM1040 (PDB 3N0Q), is annotated as a
putative aromatic ring dioxygenase. Little variation is seen in
the catalytic domain structure between Stc2 and ABF62193
(rmsd 0.7 Å), and the distinctive disulfide bond (between
Cys202 and Cys205) proximal to the active site in Stc2 is also
present. Bioinformatic analysis shows the Silicibacter sp.
TM1040 oxygenase gene sequence is adjacent to that of a
ferredoxin reductase domain (ABF62192). Therefore, we
propose that 3N0Q is an orthologue to Stc2 and probably
performs a similar metabolic function. A simple BLAST
search64 using Stc2 as the query sequence retrieves 148
sequences (with overall sequence identity (24−98%) which
conserve the CxHC signature for the disulfide bond as well as
mononuclear active-site residues (Figure S4). Sequences were
found mainly within the Proteobacteria phylum (alphaproteo-
bacteria, betaproteobacteria, and gammaproteobacteria) as well
as the Chloroflexi, Cyanobacteria, Firmicutes, and Plantomy-
cetes phyla. Based on this bioinformatic analysis, numerous
orthologues and homologues of Stc2 exist that may be capable
of oxidative demethylation.
X-ray Crystal Structure of Stc2 Cocrystallized with
Stachydrine. In order to observe the Michaelis complex, Stc2
was aerobically cocrystallized with the substrate stachydrine and
the X-ray structure was determined via isomorphous phasing
with the unliganded holoenzyme model. In the 2.2 Å liganded
Stc2 structure obtained, rather than the expected Stc2−
substrate complex, the electron density at the mononuclear
iron site was consistent with bound proline (Figure 3B). This
was confirmed by examination of a Fo − Fc omit electron
density map with stachydrine modeled into the density (Figure
S5), which showed density with negative contours at greater
than 3σ at both N-methyl positions. Notably, the proline-
binding mode observed for Stc2 differs from substrate
complexes previously characterized for other Rieske-type
mononuclear non-heme iron oxygenases (e.g., NDO,65,66
Figure S6A). To our knowledge, there is no documented
instance of iron forming a direct coordination bond to substrate
in a Rieske-type oxygenase. However, in the homologues
delineated above, most of the substrates are hydrophobic and
devoid of chemical moieties capable of iron coordination. In
contrast, stachydrine and the products of these homologues
frequently include groups that can coordinate to iron (e.g.,
NDO in complex with product; PDB 1O7P, Figure S6B).66 In
the Stc2-product structure, proline is observed to bind to the
mononuclear iron as a monodentate carboxylate ligand. One of
the proline carboxylate oxygens (Fe−O distance 2.4 Å) binds in
the coordination site occupied by the weakly interacting solvent
(with the long coordination bond), W3, in the holoenzyme
structure. The second proline carboxylate oxygen (3.0 Å from
Fe) is located at the position occupied by W2 in the
holoenzyme structure. The electron density is consistent with
one solvent molecule as a ligand to the mononuclear iron, W1
(Fe−O distance 2.1 Å), which also occurs in this position in the
unliganded holoenzyme. In Stc2, the bound proline appears to
form two hydrogen bond interactions between its amine moiety
and the carboxylate oxygen of Glu201 and the iron-bound
solvent ligand. Thus, the mononuclear iron in the proline
complex exhibits a distorted square pyramidal coordination
geometry. To the extent that the observed ligand complex
reflects features of a catalytically competent substrate complex,
such five-coordinate geometry leaves one site open for oxygen
binding and activation. Alternatively, the single solvent ligand
could be displaced by oxygen binding. Thus, molecular oxygen
could bind in either an end-on mode or a side-on bidentate
fashion.
Stc2 retains the hydrophobic pocket used as the substrate
binding site in the “classic” Rieske dioxygenases.65 For example,
the active sites of NDO and Stc2 are compared in Figure S7.
Residues comprising the hydrophobic pocket are Leu212,
Phe216, Ala223, Tyr273, Leu297, Trp305 Phe316, and Trp353.
Close to the mononuclear iron site, only two polar residues are
found, Asn199 and His307, and neither forms a hydrogen bond
to proline in the Stc2−product complex. We note that Arg200
and Arg260 residues form the outer border of the substrate
binding cavity (Figure S3A), close to the channel that provides
access to bulk solvent, and that these residues are conserved in
two-thirds of the proposed Rieske demethylases (vide infra,
Figure S4).
Single-Crystal UV−Vis Spectroscopy Correlated with
X-ray Diffraction. To assess the origin of the reducing
electrons necessary to support two consecutive oxidative
2828
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
demethylation reactions as observed in the Stc2-proline
complex, correlated single-crystal spectroscopy was undertaken.
More than 90% of the X-ray photons that do interact with the
sample do not yield a diffraction pattern, but rather deposit
energy into the crystal.68,69 For example, X-ray photons
absorbed by the sample liberate two electrons from biological
elements (photoelectric effect). They have sufficient energy to
induce several hundred further ionization events that can
propagate for up to 4 μm70 and, consequently, may reduce
samples in the X-ray beam.41,65 We have measured electronic
absorption spectra as a function of absorbed X-ray dose (Figure
4), which correlate well with solution UV−vis spectroscopy for
a [2Fe-2S]2+ state in Stc2. This spectroscopic analysis does not
provide information related to the redox state of the
mononuclear iron center. After the X-ray exposure required
for each diffraction image, the intensity of the peak at 460 nm
decreased, and the peak at 550 nm was reduced in intensity and
shifted to 525 nm. This observation was further supported by
plotting the change in absorption at 460 and 550 nm as a
function of absorbed X-ray dose (Figure 4B). The observed
changes in absorbance can be fit reasonably well either to a
power-law series or to several exponential processes. The
majority of the observed spectral change occurred with
exposure to only 0.5 MGray (roughly 25° or 50 frames of
XRD data (∼50% of a data set)). The absorption spectrum
collected after the diffraction data set was complete was very
similar to that obtained by chemical reduction of the Stc2
Rieske cluster to the [2Fe-2S]+ state in solution (Figure S8).
Although the crystal started in the oxidized state, it was rapidly
reduced in the X-ray beam; therefore, we conclude that a better
electronic description for the unliganded and liganded
holoenzyme structures described (vide supra) is that the
majority of the Rieske center is reduced.
Single-Crystal Resonance Raman Spectroscopy be-
fore and after X-ray Diffraction. To further address the
redox state of the Rieske cluster within Stc2, we used a 532 nm
excitation laser to collect resonance Raman spectra from the
same single crystals at 100 K.42 We used enzyme crystals poised
in several redox states using 5% H2O2 or dithionite, before and
after XRD data collection, and correlated these results with
optical absorption spectroscopy (Figure 5, Table 2). Compar-
ison of the results with published solution Raman spectra of
other Rieske-type [2Fe-2S] proteins allowed us to assign the
majority of the observed features.71−73 The hydrogen peroxide-
treated, oxidized crystals have several strong Raman features in
the region from 250 to 500 cm−1 (Table 2). Peaks at 321, 335,
and 360 cm−1 were assigned to Fe−S(Cys) stretching with
weak contributions from Fe−N(His) stretching. Peaks
observed at 376, 405, and 429 cm−1 are characteristic of Fe−
S(bridge) stretching. The band observed at 268 cm−1 in the
oxidized spectra is consistent with Fe(III)−N(His) stretch-
ing.71
We also collected resonance Raman spectra from Stc2
crystals after X-ray data collection or an X-ray dose equivalent
to that used to obtain the high-resolution structures. In every
case, the optical absorption spectrum for the crystals was
bleached, and the resonance Raman peaks from this region of
the crystal showed significant changes in the 250−500 cm−1
low-frequency region (Table 2, Figure 5C). In particular, the
changes included a reduction in number and a shift of the Fe−
S(bridge) stretching modes from 376, 405, and 429 cm−1 to
377 and 411 cm−1. The peak at 314 cm−1 was assigned to the
Fe−S(Cys) stretch mode. A new peak at 292 cm−1 was also
observed when the crystal was reduced by X-ray exposure.
Comparison of the results to those reported for other
reduced Rieske iron−sulfur cluster-containing proteins in
solution was performed.50,71,73 Overall our data are consistent
with the reduction of Rieske [2Fe-2S]2+ to [2Fe-2S]+ upon X-
ray exposure. Thus, by comparison to literature values, the
Raman data presented here are consistent with the histidine-
liganded iron in the ferrous state, whereas the cysteine-liganded
iron remains in the ferric state. The electrophilic nature of the
imidazole makes the histidine-liganded iron more susceptible to
reduction compared to that coordinated by the electron-
Figure 4. Optical absorption spectra of oxidized Stc2 collected
between XRD images demonstrate that the Rieske cluster is reduced
by solvated electrons. (A) After every XRD image (1−15) or after
every 10th image (21−291), the crystal was rotated back to the
perpendicular orientation (inset image) from which the single-crystal
absorption spectra were collected. Each spectrum in the family has
been normalized to the initial absorbance value at 750 nm. The crystal
rotation axis (horizontal, y) as well as the spectroscopy (vertical, z)
and the X-ray (horizontal, x) photon axes intersect at the white dashed
cross-hairs. The crystal was held at 100 K; it measured ∼300 μm × 325
μm × 130 μm; the X-ray beam was 100 μm × 100 μm; and the
spectroscopy beam was focused to ∼25 μm diameter. (B) Change in
absorption at either 460 or 550 nm as a function of X-ray image or
absorbed X-ray dose (solid lines) fitted to a power-law series (dashed
lines).
4) using crystals grown under the same conditions as the ligand
complex with 20% glycerol as the cryo-protectant to test for
reduction of the samples.
Prior to X-ray exposure, in crystals oxidized with 5% H2O2,
two absorption peaks were observed at 460 and 550 nm (Figure
2829
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
Table 2. Observed Raman Peaks for Stc2 Crystals and
Selected Rieske Proteins (cm−1)
Stc2
crystal,
oxidized
T4MOC
putiredoxin,
Stc2 assignments by comparison
with T4MOC and Putiredoxin
c
ferredoxin,
oxidized
a
b
oxidized
268
265
291
Fe−N(His); contributions from
Fe−S(Cys); His protonation state
undetermined
321
335
358
321
332
350
320
338
350
Fe−S(Cys) stretch; contributions
from Fe−N(His), Cys ligand
deformation, and Fe-bridge S
375
406
430
362
410
433
370
400
426
Fe-bridge S stretch
Stc2 crystal,
T4MOC ferredoxin,
putiredoxin,
d
b
c
reduced
reduced
reduced
292
297
315
307
319
undetermined
314
335
377
411
Fe-bridge S
stretch
377
408
381
406
a
H2O2-treated Stc2 crystals with 532 nm excitation; sample held at
b
100 K. Data from ref 78 with 514 nm excitation; samples held at 15
K. Data from ref 92 with 406.7, 457.9, or 530.9 nm excitation;
samples held at 17 K. Stc2 crystals after XRD with 532 nm excitation;
c
d
sample held at 100 K. Some weak peaks from the oxidized form are
also present.
part, by other components in the system.79−82 This ensures that
a reactive oxygen species is not generated unless all of the
reagents needed for catalysis are present. By extension, to the
catalytic cycle of similar enzymes, stachydrine binding to
oxidized Stc2 should not result in catalysis until electrons are
provided. Therefore, we crystallized oxidized Stc2 in the
presence of 1 mM substrate stachydrine under aerobic
conditions to trap the Michaelis complex. As described above,
the electron density observed in the structure (vide supra) was
consistent with proline (3) bound and may derive from two
demethylation steps.
Figure 5. Resonance Raman spectra collected from single crystals of
Stc2 at 100 K using a 532 nm excitation laser, 600 lines/mm
monochromator grating, and 1 mm entrance slit to the spectrometer.
(A) Raman spectrum of an H2O2-treated Stc2 crystal prior to exposure
to X-rays. The spectrum is the average of 240 spectra, each having a 5 s
acquisition time. Laser power at the sample was set at 3 mW. (B) An
expanded view of the low-frequency region of the spectrum of a H2O2-
treated Stc2 crystal. (C) The low-frequency region of the Raman
spectrum of Stc2-stachydrine complex following collection of XRD
data. The spectrum is the average of 10 spectra, each having a 40 s
acquisition time. Laser power at the sample was set at 4.5 mW.
The single-crystal optical absorption spectrum of Stc2
cocrystallized with stachydrine (identical to crystals used for
data collection of the complex) is shown in Figure 6A.
Resonance Raman spectra collected from these crystals also
indicate that the majority of the Rieske clusters before data
collection are in the oxidized state. However, upon exposure to
X-ray photons at 100 K, as is necessary for crystallographic
analysis, the Rieske cluster is reduced by the X-ray beam (vide
supra). The kinetics of the reduction process for the enzyme−
substrate crystals as a function of X-ray dose reveals a
dramatically different reduction profile compared to unliganded
Stc2 (Figure 6B). The absorption peak at 460 nm is quickly
partially reduced then exhibits a more stable phase between
∼0.33 and 1.25 MGr. The latter phase is followed by a second
rapid phase that subsequently tapers off. The plateau between
∼0.33 and 1.25 MGr may be due to the consumption of
electrons in the demethylation process. This curve shape is very
different from that observed for unliganded or fully oxidized
Stc2 (Figure 4B), which fits to a normal power-law series. The
kinetic trace and the final optical spectrum suggest that full
reduction of the Rieske cluster was achieved by the end of the
diffraction data set. Resonance Raman spectra collected from
donating thiolate.71,74−77 Thus, the two irons form a spin-
localized Fe(II)/Fe(III) cluster in the reduced state. Many of
the characteristic Raman spectral changes which have been
noted in the solution studies of Rieske-containing proteins are
also observed with nearly identical spectra in our X-ray exposed
Stc2 crystals. In other cases, the matches are not as
straightforward. For example, our feature at 292 cm−1 may
correspond to the Raman peak at 297 cm−1 noted in the
spectrum of the dithionite-reduced Rieske protein toluene-4-
monooxygenase from Pseudomonas mendocina.78 The 297 cm−1
peak was assigned to a Fe−S(bridge) stretch mode, based on
comparisons with reduced adrenodoxin and “red paramagnetic
protein” from Clostridium pasteurianum.73
X-ray Crystallographic and Spectroscopic Analysis of
the Stc2-Stachydrine Complex. Catalysis by Stc2 is an O2-
dependent process and also requires two electrons (see Scheme
1C). Moreover, in most members of the multicomponent
Rieske oxygenase family, it is likely that O2 reactivity at the
mononuclear iron site is gated by both organic substrate
binding and by reduction of the Rieske cluster as dictated in
2830
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
formation of proline in the proline-Stc2 complex is enzyme-
dependent.
1
Our results from the H NMR assays indicate that Stc2 in
solution can use quaternary ammonium compounds (e.g.,
stachydrine, 1) as a substrate but does not appear to catalyze
turnover of tertiary amines (e.g., N-monomethylproline, 2).
These results are also consistent with genetic studies of S.
meliloti, discussed above and illustrated in Scheme 1C. The
results from the X-ray structure determination of Stc2
cocrystallized with stachydrine suggest that Stc2 is capable of
demethylating both N,N-dimethylstachydrine and N-methyl-
proline. One possible explanation for the discrepancy between
the solution studies and crystallographic results is that, in the
crystalline state, N-monomethylproline (2) cannot be released
from the active site and proceeds through a second round of
demethylation. Indeed, in the structure of the Stc2−proline
complex, the active site is closed from bulk solvent by a loop
(residues 215−233; residues 225−229 within the loop are
disordered; see Figure S3A,B). B-factors in the loop are
considerably higher than the average for the protein atoms in
the structure (43.9 Å2 for loop vs 16.1 Å2 for protein),
consistent with the hypothesis that it is more flexible.
Movement of the homologous gating loop has been
demonstrated in dicamba demethylase, in which open and
closed gate conformations are observed.59 It appears that the
loop plays a role in controlling access to or dissociation from
the active site by solvent, substrates, and product molecules.
Thus, the effective concentration of the N-methylproline in the
crystal is much higher than that achieved in the single-turnover
assays performed in solution. Notably, the bound conformation
of substrate need not change for the second demethylation of
N-monomethylproline to occur since enantiomers of amines
interconvert rapidly by inversion of the nitrogen unshared
electron pair.83
Another possible explanation for the second turnover
observed in the crystallographic results could derive from the
X-ray-dependent photoelectric effect. Our results suggest a
substrate−iron complex that also includes a solvent molecule in
the coordination sphere. The ejection of an electron from the
iron complex will likely occur with an energy of approximately
7100 eV.84,85 The XRD data were collected with 1 Å X-ray
photons (12 398 eV). The incident X-ray photons have
sufficient energy to eject a core electron from the iron to
yield oxidized Fe−O(H)x species directly. Thus, it is possible
that conversion of stachydrine to proline within the active site
may also be driven, in part, by core electron ejection from the
iron−ligand complex.
Figure 6. (A) Optical absorption spectra of the aerobic Stc2−
stachydrine complex (Stc2-Subst) collected between XRD frames (see
legend to Figure 4 for conditions). The crystal was held at 100 K; the
size of the crystal was ∼623 μm × 500 μm × 150 μm; the X-ray beam
was 100 μm × 100 μm; and the spectroscopy beam was focused to
∼25 μm diameter. (B) Change in absorption at 460 nm as a function
of X-ray image or absorbed X-ray dose (blue solid lines) fitted to a
polynomial series (green dashed lines). For comparison, the change in
absorbance as a function of dose for oxidized Stc2 in the absence of
substrate (Stc2-ox, from Figure 4) is shown with the solid red line and
power-law fitted (the dashed black line).
this crystal after XRD were consistent with those of the fully
reduced cluster (Figure 5B).
The results above suggest turnover in the crystal that may be
initiated by solvated electrons resulting from the absorption of
X-ray photons. Consequently, the XRD data set was re-
examined with respect to absorbed dose. When the first 100
images (50°) of diffraction data were used for the structure
factors, the negative features associated with stachydine N-
methyl groups remained. The amount of X-ray dose after 100
images of data collection is approximately 0.9 MGray, which
falls within the plateau region observed (Figure 6B) between
0.3 and 1.2 MGray. Thus, the reactivity indicated by the plateau
region is consistent with the observation of the proline-Stc2
complex. The solvated electrons created by the X-ray photons
circumvent the need for the reducing protein components in
the natural Stc2 system or for dithionite in the in vitro assay.
Control experiments in which solutions of stachydrine in the
absence of enzyme were exposed to a 10 times greater X-ray
dose did not show any loss of methyl groups as analyzed by
mass spectrometry (Figure S9), which suggests that the
Proposed Stc2 Reaction Mechanism. For α-ketogluta-
rate-dependent histone demethylases,1,11−14 N-demethylation
is achieved by the oxidative hydroxylation of the N-methyl
group. The resulting N-methoxyl group is unstable and
decomposes spontaneously to form formaldehyde as the
oxidative demethylation byproduct. On the basis of these N-
demethylation precedents and general properties of Rieske-type
oxygenases,86 we propose a mechanistic model for Stc2-
catalyzed oxidative demethylation of stachydrine (Scheme 2).
The reaction cycle starts with oxidized Rieske cluster and
substrate binding to the mononuclear Fe(II) site. In the
structure of the Stc2−proline complex, proline binds to the
mononuclear iron site through its carboxylate moiety by
displacing one iron solvent ligand observed in the substrate free
Stc2 structure (Figures 3A and 4). The proline observed in this
structure is proposed to be generated in situ through X-ray-
2831
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
Scheme 2. Proposed Stc2 Oxidative Demethylation Mechanism
derived photoelectric effects and two consecutive demethyla-
tion cycles (Scheme 2). Therefore, the structure observed
might also reflect a potential binding mode for stachydrine to
Stc2. The binding order of O2 to the Fe(II) and the injection of
an electron through the Rieske cluster is not well established in
the Stc2 reaction cycle as it is in NDO.87 Based on known
mononuclear iron enzyme models in the literature, the reaction
likely goes through the oxidative hydroxylation of the
stachydrine methyl group by high-valent iron−oxo species.88,89
The hydroxylated product spontaneously decomposes to
produce formaldehyde.1,11−14 In solution studies via NMR,
only a single demethylation cycle occurs, but in the crystal a
second demethylation cycle occurs, resulting in proline
production. In the crystalline state, the dissociation of the N-
methylproline may be blocked by crystal packing and the loop
covering the substrate binding/product release path. Therefore,
in the aerobic crystal we propose a second round of
hydroxylation and formaldehyde release to yield proline.
(e.g., cytochrome bc1 and b6f complexes) and eukaryotes (e.g.,
cytochrome bc1, choline monooxygenase, CMP-Neu5Ac
hydroxylase).90 Although the homotrimeric, α3 type of
structure found in Stc2 is common, the presence of many
Rieske-type oxygenases in the form α3β3, which suggests that
recruiting other domains to achieve more complex functions,
might be possible.90 Due to the importance of N-methylations
in epigenetic and post-translational control, in the future it is
essential to uncover the possible scaffolds and chemistries that
can support the N-demethylation reactions.
ASSOCIATED CONTENT
* Supporting Information
■
S
Synthesis of stachydrine and accompanying NMR spectra,
structural homology analysis, sequence alignments of homo-
logues and orthologues, table of rmsd values of structural
homologues, figures showing active site, electron density maps,
and overlay with NDO, solution spectra of Stc2, and mass
spectrometry data. This material is available free of charge via
the Internet at http://pubs.acs.org.
CONCLUSIONS
■
In this work, we demonstrated that Stc2 is a demethylase,
which is capable of oxidatively demethylating a quaternary
ammonium. Notably, the correlation of X-ray data collection
with UV−vis and resonance Raman spectroscopy was key to
defining the redox state and ligand identity observed in the
crystal structure. The formation of product in the crystal was
consistent with the dose-dependence of the reduction of the
Rieske center by the X-ray beam. The product-bound complex
showed significant differences at the catalytic site compared to
classic Rieske-type oxygenases, in which substrates do not
directly interact with the mononuclear iron site. Instead, we
propose on the basis of the structure of the Stc2 product
complex that the substrate of Stc2, stachydrine, directly
coordinates to the mononuclear non-heme iron center. How
such a coordination mode modulates the activities of the non-
heme iron center to meet the challenges of such a unique
transformation, demethylation of a quaternary ammonium,
awaits further elucidation.
AUTHOR INFORMATION
Corresponding Author
amorv@bnl.gov; pinghua@bu.edu; drkallen@bu.edu
■
ACKNOWLEDGMENTS
■
The authors thank Dr. Alexei S. Soares for assistance in initial
phase determination of the apo structure. This work was
supported by NSF Grant CHE 0748504 (to P.L.). E.C. was
supported by the Boston University Undergraduate Research
Opportunities Program. Data for this study were measured at
Beamline X12C and X26C of the National Synchrotron Light
Source (NSLS). Support for A.M.O. and D.S.-M. was from the
US Department of Energy (DOE) Office of Biological and
Environmental Research (FWP BO-70) and from the National
Center for Research Resources of the National Institutes of
Health (2-P41-RR012408). The NSLS was supported by the
DOE Office of Basic Energy Sciences (DE-AC02-98CH10886).
In addition to prokaryotic examples of Rieske demethylases
such as Stc2, phylogenetic analysis of Rieske and Rieske-type
proteins suggests that they are conserved in both prokaryotes
REFERENCES
(1) Cantoni, G. L. Annu. Rev. Biochem. 1975, 44, 435.
■
2832
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
(2) Benkovic, S. J. Annu. Rev. Biochem. 1980, 49, 227.
(3) Banerjee, R.; Ragsdale, S. W. Annu. Rev. Biochem. 2003, 72, 209.
(4) Biel, M.; Wascholowski, V.; Giannis, A. Angew. Chem., Int. Ed.
2005, 44, 3186.
(5) Walsh, C. T. Posttranslational modification of proteins: Expanding
Nature’s inventory; Roberts and Co. Publishers: Greenwood Village,
2006.
(6) Chinenov, Y. Trends Biochem. Sci. 2002, 27, 115.
(7) Bannister, A. J.; Schneider, R.; Kouzarides, T. Cell 2002, 109, 801.
(8) Byvoet, P.; Shepherd, G. R.; Noland, B. J.; Hardin, J. M. Arch.
Biochem. Biophys. 1972, 148, 558.
(38) Elsen, N. L.; Moe, L. A.; McMartin, L. A.; Fox, B. G.
Biochemistry 2007, 46, 976.
(39) Yi, J.; Orville, A. M.; Skinner, J. M.; Skinner, M. J.; Richter-
Addo, G. B. Biochemistry 2010, 49, 5969.
(40) Orville, A. M.; Lountos, G. T.; Finnegan, S.; Gadda, G.;
Prabhakar, R. Biochemistry 2009, 48, 720.
(41) Orville, A. M.; Buono, R.; Cowan, M.; Heroux, A.; Shea-
McCarthy, G.; Schneider, D. K.; Skinner, J. M.; Skinner, M. J.; Stoner-
Ma, D.; Sweet, R. M. J. Synchrotron Radiat. 2011, 18, 358.
(42) Stoner-Ma, D.; Skinner, J. M.; Schneider, D. K.; Cowan, M.;
Sweet, R. M.; Orville, A. M. J. Synchrotron Radiat. 2011, 18, 37.
(43) Paithankar, K. S.; Garman, E. F. Acta Crystallogr. D: Biol.
Crystallogr. 2010, 66, 381.
(9) Thomas, G.; Hempel, K.; Lange, H. W. Hoppe-Seylers Z. Physiol.
Chem. 1972, 353, 1423.
(44) Martins, B. M.; Svetlitchnaia, T.; Dobbek, H. Structure 2005, 13,
817.
(45) Tarasev, M.; Kaddis, C. S.; Yin, S.; Loo, J. A.; Burgner, J.; Ballou,
D. P. Arch. Biochem. Biophys. 2007, 466, 31.
(46) Parales, R. E.; Emig, M. D.; Lynch, N. A.; Gibson, D. T. J.
(10) Mosammaparast, N.; Shi, Y. Annu. Rev. Biochem. 2010, 79, 155.
(11) Shi, Y.; Lan, F.; Matson, C.; Mulligan, P.; Whetstine, J. R.; Cole,
P. A.; Casero, R. A. Cell 2004, 119, 941.
(12) Whetstine, J. R.; Nottke, A.; Lan, F.; Huarte, M.; Smolikov, S.;
Chen, Z.; Spooner, E.; Li, E.; Zhang, G.; Colaiacovo, M.; Shi, Y. Cell
2006, 125, 467.
Bacteriol. 1998, 180, 2337.
(47) Kauppi, B.; Lee, K.; Carredano, E.; Parales, R. E.; Gibson, D. T.;
Eklund, H.; Ramaswamy, S. Structure 1998, 6, 571.
(48) Yamaguchi, M.; Fujisawa, H. J. Biol. Chem. 1982, 257, 12497.
(49) Hegg, E. L.; Que, L. Jr. Eur. J. Biochem. 1997, 250, 625.
(50) Ferraro, D. J.; Gakhar, L.; Ramaswamy, S. Biochem. Biophys. Res.
Commun. 2005, 338, 175.
(51) Krissinel, E.; Henrick, K. J. Mol. Biol. 2007, 372, 774.
(52) Holm, L.; Kaariainen, S.; Rosenstrom, P.; Schenkel, A.
Bioinformatics 2008, 24, 2780.
(53) Friemann, R.; Lee, K.; Brown, E. N.; Gibson, D. T.; Eklund, H.;
Ramaswamy, S. Acta Crystallogr. D 2009, 65, 24.
(54) Furusawa, Y.; Nagarajan, V.; Tanokura, M.; Masai, E.; Fukuda,
M.; Senda, T. J. Mol. Biol. 2004, 342, 1041.
(55) Dong, X.; Fushinobu, S.; Fukuda, E.; Terada, T.; Nakamura, S.;
Shimizu, K.; Nojiri, H.; Omori, T.; Shoun, H.; Wakagi, T. J. Bacteriol.
2005, 187, 2483.
(13) Fodor, B. D.; Kubicek, S.; Yonezawa, M.; O’Sullivan, R. J.;
Sengupta, R.; Perez-Burgos, L.; Opravil, S.; Mechtler, K.; Schotta, G.;
Jenuwein, T. Genes Dev. 2006, 20, 1557.
(14) Cloos, P. A.; Christensen, J.; Agger, K.; Maiolica, A.; Rappsilber,
J.; Antal, T.; Hansen, K. H.; Helin, K. Nature 2006, 442, 307.
(15) Trewick, S. C.; Henshaw, T. F.; Hausinger, R. P.; Lindahl, T.;
Sedgwick, B. Nature 2002, 419, 174.
(16) Falnes, P. O.; Johansen, R. F.; Seeberg, E. Nature 2002, 419,
178.
(17) Ng, S. S.; Kavanagh, K. L.; McDonough, M. A.; Butler, D.; Pilka,
E. S.; Lienard, B. M.; Bray, J. E.; Savitsky, P.; Gileadi, O.; von Delft, F.;
Rose, N. R.; Offer, J.; Scheinost, J. C.; Borowski, T.; Sundstrom, M.;
Schofield, C. J.; Oppermann, U. Nature 2007, 448, 87.
(18) Couture, J. F.; Collazo, E.; Ortiz-Tello, P. A.; Brunzelle, J. S.;
Trievel, R. C. Nat. Struct. Mol. Biol. 2007, 14, 689.
(19) Chen, Z.; Zang, J.; Whetstine, J.; Hong, X.; Davrazou, F.;
Kutateladze, T. G.; Simpson, M.; Mao, Q.; Pan, C. H.; Dai, S.;
Hagman, J.; Hansen, K.; Shi, Y.; Zhang, G. Cell 2006, 125, 691.
(20) Chen, Z.; Zang, J.; Kappler, J.; Hong, X.; Crawford, F.; Wang,
Q.; Lan, F.; Jiang, C.; Whetstine, J.; Dai, S.; Hansen, K.; Shi, Y.; Zhang,
G. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 10818.
(56) Friemann, R.; Ivkovic-Jensen, M. M.; Lessner, D. J.; Yu, C. L.;
Gibson, D. T.; Parales, R. E.; Eklund, H.; Ramaswamy, S. J. Mol. Biol.
2005, 348, 1139.
(57) Jakoncic, J.; Jouanneau, Y.; Meyer, C.; Stojanoff, V. Biochem.
Biophys. Res. Commun. 2007, 352, 861.
(58) Allen, G. S.; Zavialov, A.; Gursky, R.; Ehrenberg, M.; Frank, J.
Cell 2005, 121, 703.
(21) Stavropoulos, P.; Blobel, G.; Hoelz, A. Nat. Struct. Mol. Biol.
2006, 13, 626.
(59) D’Ordine, R. L.; Rydel, T. J.; Storek, M. J.; Sturman, E. J.;
Moshiri, F.; Bartlett, R. K.; Brown, G. R.; Eilers, R. J.; Dart, C.; Qi, Y.;
Flasinski, S.; Franklin, S. J. J. Mol. Biol. 2009, 392, 481.
(60) Wang, X.; Li, B.; Herman, P. L.; Weeks, D. P. Appl. Environ.
Microbiol. 1997, 63, 1623.
(61) Dumitru, R.; Jiang, W. Z.; Weeks, D. P.; Wilson, M. A. J. Mol.
Biol. 2009, 392, 498.
(62) Parales, R. E.; Parales, J. V.; Gibson, D. T. J. Bacteriol. 1999, 181,
1831.
(63) Leggate, E. J.; Hirst, J. Biochemistry 2005, 44, 7048.
(64) McGinnis, S.; Madden, T. L. Nucleic Acids Res. 2004, 32, W20.
(65) Karlsson, A.; Parales, J.; Parales, R.; Gibson, D.; Eklund, H.;
Ramaswamy, S. J. Biol. Inorg. Chem. 2005, 10, 483.
(66) Karlsson, A.; Parales, J. V.; Parales, R. E.; Gibson, D. T.; Eklund,
H.; Ramaswamy, S. Science 2003, 299, 1039.
(67) Quaye, O.; Lountos, G. T.; Fan, F.; Orville, A. M.; Gadda, G.
Biochemistry 2008, 47, 243.
(68) Garman, E. F. Acta Crystallogr. D: Biol. Crystallogr. 2010, 66,
339.
(69) Neutze, R.; Wouts, R.; van der Spoel, D.; Weckert, E.; Hajdu, J.
(22) Yang, M.; Gocke, C. B.; Luo, X.; Borek, D.; Tomchick, D. R.;
Machius, M.; Otwinowski, Z.; Yu, H. Mol. Cell 2006, 23, 377.
(23) Phillips, D. A.; Joseph, C. M.; Maxwell, C. A. Plant Physiol. 1992,
99, 1526.
(24) Fougere, F.; Le Rudulier, D. J. Gen. Microbiol. 1990, 136, 157.
(25) Amin, U. S.; Lash, T. D.; Wilkinson, B. J. Arch. Microbiol. 1995,
163, 138.
(26) Trinchant, J. C.; Boscari, A.; Spennato, G.; Van de Sype, G.; Le
Rudulier, D. Plant Physiol. 2004, 135, 1583.
(27) Zahran, H. H. J. Biotechnol. 2001, 91, 143.
(28) Goldmann, A.; Boivin, C.; Fleury, V.; Message, B.; Lecoeur, L.;
Maille, M.; Tepfer, D. Mol. Plant-Microbe Interact. 1991, 4, 571.
(29) Phillips, D. A.; Sande, E. S.; Vriezen, J. A. C.; de Bruijn, F. J.; Le
Rudulier, D.; Joseph, C. M. Appl. Environ. Microbiol. 1998, 64, 3954.
(30) Burnet, M. W.; Goldmann, A.; Message, B.; Drong, R.; El
Amrani, A.; Loreau, O.; Slightom, J.; Tepfer, D. Gene 2000, 244, 151.
(31) Mason, J. R.; Cammack, R. Annu. Rev. Microbiol. 1992, 46, 277.
(32) Otwinowski, Z.; Minor, W. Methods Enzymol. 1997, 276, 307.
(33) Pape, T.; Schneider, T. R. J. Appl. Crystallogr. 2004, 37, 2.
(34) Sheldrick, G. M. Acta Crystallogr. A 2008, 64, 112.
(35) Morris, R. J.; Perrakis, A.; Lamzin, V. S. Methods Enzymol. 2003,
374, 229.
Nature 2000, 406, 752.
(70) Sanishvili, R.; Yoder, D. W.; Pothineni, S. B.; Rosenbaum, G.;
Xu, S.; Vogt, S.; Stepanov, S.; Makarov, O. A.; Corcoran, S.; Benn, R.;
Nagarajan, V.; Smith, J. L.; Fischetti, R. F. Proc. Natl. Acad. Sci. U.S.A.
2011, 108, 6127.
(36) Adams, P. D.; et al. Acta Crystallogr. D: Biol. Crystallogr. 2010,
66, 213.
(37) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Acta
Crystallogr. D: Biol. Crystallogr. 2010, 66, 486.
(71) Kuila, D.; Schoonover, J. R.; Dyer, R. B.; Batie, C. J.; Ballou, D.
P.; Fee, J. A.; Woodruff, W. H. Biochim. Biophys. Acta 1992, 1140, 175.
2833
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834

Journal of the American Chemical Society
Article
(72) Kuila, D.; Fee, J. A.; Schoonover, J. R.; Woodruff, W. H.; Batie,
C. J.; Ballou, D. P. J. Am. Chem. Soc. 1987, 109, 1559.
(73) Rotsaert, F. J.; Pikus, J. D.; Fox, B. G.; Markley, J. L.; Sanders-
Loehr, J. J. Biol. Inorg. Chem. 2003, 8, 318.
(74) Cline, J. F.; Hoffman, B. M.; Mims, W. B.; LaHaie, E.; Ballou, D.
P.; Fee, J. A. J. Biol. Chem. 1985, 260, 3251.
(75) Fee, J. A.; Findling, K. L.; Yoshida, T.; Hille, R.; Tarr, G. E.;
Hearshen, D. O.; Dunham, W. R.; Day, E. P.; Kent, T. A.; Munck, E. J.
Biol. Chem. 1984, 259, 124.
(76) Kuila, D.; Fee, J. A. J. Biol. Chem. 1986, 261, 2768.
(77) Zu, Y.; Couture, M. M.; Kolling, D. R.; Crofts, A. R.; Eltis, L. D.;
Fee, J. A.; Hirst, J. Biochemistry 2003, 42, 12400.
(78) Rotsaert, F. J.; Pikus, J. D.; Fox, B. G.; Markley, J. L.; Sanders-
Loehr, J. J. Biol. Inorg. Chem. 2003, 8, 318.
(79) Gassner, G. T.; Ballou, D. P.; Landrum, G. A.; Whittaker, J. W.
Biochemistry 1993, 32, 4820.
(80) Yang, T. C.; Wolfe, M. D.; Neibergall, M. B.; Mekmouche, Y.;
Lipscomb, J. D.; Hoffman, B. M. J. Am. Chem. Soc. 2003, 125, 2034.
(81) Wolfe, M. D.; Altier, D. J.; Stubna, A.; Popescu, C. V.; Munck,
E.; Lipscomb, J. D. Biochemistry 2002, 41, 9611.
(82) Tarasev, M.; Rhames, F.; Ballou, D. P. Biochemistry 2004, 43,
12799.
(83) Wade, L. G. Organic chemistry, 6th ed.; Pearson Prentice Hall:
Upper Saddle River, Nj, 2006.
(84) de Groot, F. Chem. Rev. 2001, 101, 1779.
(85) Westre, T. E.; Kennepohl, P.; DeWitt, J. G.; Hedman, B.;
Hodgson, K. O.; Solomon, E. I. J. Am. Chem. Soc. 1997, 119, 6297.
(86) Kovaleva, E. G.; Lipscomb, J. D. Nat. Chem. Biol. 2008, 4, 186.
(87) Karlsson, A.; Parales, J. V.; Parales, R. E.; Gibson, D. T.; Eklund,
H.; Ramaswamy, S. Science 2003, 299, 1039.
(88) Price, J. C.; Barr, E. W.; Hoffart, L. M.; Krebs, C.; Bollinger, J.
M. Biochemistry 2005, 44, 8138.
(89) Galonic, D. P.; Barr, E. W.; Walsh, C. T.; Bollinger, J. M.; Krebs,
C. Nat. Chem. Biol. 2007, 3, 113.
(90) Schmidt, C. L.; Shaw, L. J. Bioenerg. Biomembr. 2001, 33, 9.
(91) Kraulis, P. J. J. Appl. Crystallogr. 1991, 24, 946.
(92) Fu, W.; Drozdzewski, P. M.; Davies, M. D.; Sligar, S. G.;
Johnson, M. K. J. Biol. Chem. 1992, 267, 15502.
2834
dx.doi.org/10.1021/ja2111898 | J. Am. Chem.Soc. 2012, 134, 2823−2834