Identification and characterization of a novel (?)-vibo-quercitol 1-dehydrogenase from Burkholderia terrae suitable for production of (?)-vibo-quercitol from 2-deoxy-scyllo-inosose

Article abstract of DOI:10.1007/s00253-017-8483-2

(?)-vibo-Quercitol is a deoxyinositol (1l-1,2,4/3,5-cyclohexanepentol) that naturally occurs in oak species, honeydew honey, wines aged in oak barrels, and Gymnema sylvestre and is a potential intermediate for pharmaceuticals. We found that (?)-vibo-quercitol is stereoselectively synthesized from 2-deoxy-scyllo-inosose by the reductive reaction of a novel (?)-vibo-quercitol 1-dehydrogenase found in the proteomes of Burkholderia, Pseudomonas, and Arthrobacter. Among them, Burkholderia terrae sp. AKC-020 (40-1) produced a (?)-vibo-quercitol 1-dehydrogenase appropriate for synthesizing (?)-vibo-quercitol with a high diastereomeric excess. The enzyme was strongly induced in Bu. terrae cells when quercitol or 2-deoxy-scyllo-inosose was used as carbon source in the culture medium. The enzyme is NAD(H)-dependent and shows highly specific activity for (?)-vibo-quercitol and myo-inositol among the substrates tested. The enzyme gene (qudh) was obtained by PCR using degenerate primers based on the N-terminal and internal amino acid sequences of the purified enzyme, followed by thermal asymmetric interlaced PCR. The qudh gene showed homology with inositol 2-dehydrogenase (sharing 49.5% amino acid identity with IdhA from Sinorhizobium meliloti 1021). We successfully produced several recombinant (?)-vibo-quercitol 1-dehydrogenases and related enzymes identified by genome database mining using an Escherichia coli expression system. This revealed that scyllo-inositol dehydrogenase (IolX) in Bacillus subtilis can catalyze the reduction of 2-deoxy-scyllo-inosose to yield scyllo-quercitol, a stereoisomer of (?)-vibo-quercitol. Thus, we successfully identified two enzymes to produce both stereoisomers of deoxyinositols that are rare in nature.

Full text of DOI:10.1007/s00253-017-8483-2

Appl Microbiol Biotechnol (2017) 101:7545–7555
DOI 10.1007/s00253-017-8483-2
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Identification and characterization of a novel (−)-vibo-quercitol
1-dehydrogenase from Burkholderia terrae suitable for production
of (−)-vibo-quercitol from 2-deoxy-scyllo-inosose
Nobuya Itoh1 & Junji Kurokawa1 & Hiroshi Toda1 & Kazunobu Konishi2
Received: 23 May 2017 /Revised: 17 July 2017 /Accepted: 9 August 2017 /Published online: 13 September 2017
#
Springer-Verlag GmbH Germany 2017
Abstract (−)-vibo-Quercitol is a deoxyinositol (1L-1,2,4/3,5-
cyclohexanepentol) that naturally occurs in oak species, hon-
eydew honey, wines aged in oak barrels, and Gymnema
sylvestre and is a potential intermediate for pharmaceuticals.
We found that (−)-vibo-quercitol is stereoselectively synthe-
sized from 2-deoxy-scyllo-inosose by the reductive reaction of
a novel (−)-vibo-quercitol 1-dehydrogenase found in the
proteomes of Burkholderia, Pseudomonas, and
Arthrobacter. Among them, Burkholderia terrae sp. AKC-
020 (40-1) produced a (−)-vibo-quercitol 1-dehydrogenase
appropriate for synthesizing (−)-vibo-quercitol with a high
diastereomeric excess. The enzyme was strongly induced in
Bu. terrae cells when quercitol or 2-deoxy-scyllo-inosose was
used as carbon source in the culture medium. The enzyme is
NAD(H)-dependent and shows highly specific activity for
(−)-vibo-quercitol and myo-inositol among the substrates test-
ed. The enzyme gene (qudh) was obtained by PCR using
degenerate primers based on the N-terminal and internal ami-
no acid sequences of the purified enzyme, followed by ther-
mal asymmetric interlaced PCR. The qudh gene showed ho-
mology with inositol 2-dehydrogenase (sharing 49.5% amino
acid identity with IdhA from Sinorhizobium meliloti 1021).
We successfully produced several recombinant (−)-vibo-
quercitol 1-dehydrogenases and related enzymes identified
by genome database mining using an Escherichia coli expres-
sion system. This revealed that scyllo-inositol dehydrogenase
(IolX) in Bacillus subtilis can catalyze the reduction of 2-de-
oxy-scyllo-inosose to yield scyllo-quercitol, a stereoisomer of
(−)-vibo-quercitol. Thus, we successfully identified two en-
zymes to produce both stereoisomers of deoxyinositols that
are rare in nature.
Keywords (−)-vibo-Quercitol 1-dehydrogenase
.
.
(2-deoxy-scyllo-inosose reductase) (−)-vibo-Quercitol
.
.
scyllo-Quercitol Burkholderia terrae scyllo-Inositol
.
dehydrogenase (IolX) Enzymatic synthesis
Introduction
(−)-vibo-Quercitol (1L-1,2,4/3,5-cyclohexanepentol) is a
deoxyinositol that naturally occurs in Quercus (oak) species
(Anderson 1972), honeydew honey (Sanz et al. 2004), wines
aged in oak barrels (Carlavilla et al. 2006), and Gymnema
sylvestre (Asclepiadaceae), which is popularly known as
BGurmar^ (Potawale et al. 2008). It is a deoxy analog of
myo-inositol (1,2,3,5/4,6-cyclohexanehexol), the most abun-
dant cyclohexanehexol in nature. This compound is partly
converted into hexaphosphate of inositol (phytic acid) in
plants and is an essential compound that serves as a
phosphatidylinositol moiety in eukaryotic cell membranes
and as a secondary messenger. myo-Inositol catabolism has
been well studied in microorganisms such as Bacillus
subtilis by Yoshida et al. (2008), and the iolABCDEFGHIJ
operon is responsible for myo-inositol degradation. myo-
Inositol 2-dehydrogenases (EC 1.1.1.18), including IolG from
Ba. subtilis, have been characterized in several
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s00253-017-8483-2) contains supplementary
material, which is available to authorized users.
* Nobuya Itoh
nbito@pu-toyama.ac.jp
1
Biotechnology Research Center and Department of Biotechnology,
Toyama Prefectural University, 5180 Kurokawa, Imizu,
Toyama 939-0398, Japan
2
Asahi Kasei Corp., 1-105 Kanda Jinbocho, Chiyoda-ku,
Tokyo 101-8101, Japan

7546
Appl Microbiol Biotechnol (2017) 101:7545–7555
microorganisms (Walker 1975; Ramaley et al. 1979; Jiang
et al. 2001; Yoshida et al. 2012). To our knowledge, however,
there have been no detailed reports concerning the catabolism
of deoxyinositol, (−)-vibo-Quercitol and its stereoisomers, in-
cluding (+)-proto-quercitol (1L-1,3,4/2,5-cyclohexanepentol)
and scyllo-quercitol (2-deoxy-myo-inositol, 1,3,5/2,4-
cyclohexanepentol), which are potential chiral synthons for
drug candidates (Ogawa et al. 1999; Ogawa and Kanto
2007; Wacharasindhu et al. 2009; Kuno et al. 2011).
Takahashi et al. (1999) reported the biotransformation
of myo-inositol using Salmonella typhimurium and pro-
duced three quercitols from fermentation broth by using
a combination of ion-exchange chromatography and re-
crystallization. The major products were (−)-vibo-
quercitol (35% yield), (+)-epi-quercitol (11%), and (+)-
proto-quercitol (5%). They proposed the following bio-
transformation mechanism: initial oxidation from myo-
inositol to scyllo-inosose, followed by dehydration and
reduction to quercitols. However, it has remained difficult
to obtain pure chiral quercitols as a raw material for
pharmaceuticals.
Yamauchi and Kakinuma (1995) reported on 2-deoxy-
scyllo-inosose synthase (BtrC), which has a key role in the
biosynthetic pathway of the aminoglycoside antibiotic
butirosin from Bacillus circulans (Dion et al. 1972). This
research group also identified the gene cluster (btrA-X) for
butirosin biosynthesis in Ba. circulans (Ota et al. 2000;
Kudo et al. 2005). The enzyme BtrC catalyzes the multi-
step carbocycle-forming reaction of glucose-6-phosphate
in the presence of NAD+ and Co2+ as cofactors, which
enables the microbial production of 2-deoxy-scyllo-
inosose (DOI) from D-glucose (Kogure et al. 2007;
Miyazawa and Matsumoto 2015). Recently, DOI has been
identified as a carbohydrate for green chemistry, for exam-
ple, in the syntheses of catechol via reductive dehydration
(Kakinuma et al. 2000) and of some carbasugar derivatives
(Ogawa and Kanto 2007). Thus, we have focused on the
biosynthesis of useful deoxyinositols from DOI by micro-
bial or enzymatic reduction.
In this study, we describe the isolation of quercitol-
assimilating microorganisms by enrichment culture and iden-
tification of a novel (−)-vibo-quercitol 1-dehydrogenase (2-
deoxy-scyllo-inosose reductase) (QUDH) from Burkholderia
terrae AKC-020 (40-1), which is suitable for (−)-vibo-
quercitol production from DOI. This research included the
characterization, cloning, and heterologous expression of the
qudh gene in Escherichia coli. Moreover, we clarified that one
of the QUDH orthologs, scyllo-inositol dehydrogenase (IolX;
Morinaga et al. 2010), can catalyze the reduction of DOI to
give scyllo-quercitol (1,3,5/2,4-cyclohexanepentol), a stereo-
isomer of (−)-vibo-quercitol (Fig. 1). Thus, we present a series
of possible enzymatic processes for producing two chiral
quercitols.
Materials and methods
Screening of microbial strains for the assimilation
of quercitol as a carbon source
The medium of the agar plates for screening microorgan-
isms able to assimilate quercitol consisted of a 0.3% (w/v)
(−)-vibo- and scyllo-quercitol mixture, 0.3% (NH4)2SO4,
0.3% KH2PO4, 0.1% NaCl, 0.02% MgSO4⋅7H2O, and
1.5% agar in tap water (pH 7.0; medium A). The (−)-
vibo- and scyllo-quercitol mixture was added to the medi-
um after sterile filtration. Soil samples collected from fer-
tile fields in Toyama were mixed with 10 mL of saline
solution, and then 0.1 mL of the mixture was spread onto
agar plates. The quercitol-assimilating microorganisms
that were able to form colonies on the agar plate were
aerobically cultivated at 30 °C for 1–2 days. The bacterial
cultures obtained by monocolony isolation on LB agar
medium containing 1% tryptone, 0.5% yeast extract, and
0.5% NaCl (pH 7.0) were maintained at 4 °C on a LB-
quercitol agar medium consisting of a 0.3% (w/v) (−)-
vibo- and scyllo-quercitol mixture, 0.5% tryptone, 0.25%
yeast extract, and 0.25% NaCl (pH 7.0; medium B).
Each strain isolated as described above was cultured in
medium B in a test tube that was constantly shaken for
1 day at 30 °C in a total volume of 2 mL. The cells grown
in the 2-mL culture were collected by centrifugation
(20,000×g, 1 min), suspended in 1 mL of 50 mM potas-
sium phosphate buffer (KPB; pH 7.0), and then disrupted
with an ultrasonic oscillator (Ultra Sonic Disrupter UD-
200; Tomy Corp., Tokyo, Japan) for 150 s in total (five
disruptions of 30 s each, followed by a 30-s interval for
cooling). After centrifugation (10,000×g, 5 min), the su-
pernatant was used as a crude enzyme solution.
Enzyme assay
QUDH activity was assayed spectrophotometrically at
25 °C as a reductive reaction of DOI by measuring the
decrease in the absorbance of NADH (or NADPH) at
340 nm (ε = 6.22 mM−1 cm−1). The reaction mixture
consisted of 5 μmol of DOI, 0.3 μmol of NADH,
50 μmol of KPB (pH 7.0), and 10 μL of enzyme solution,
in a total reaction volume of 1.0 mL. The oxidative reac-
tion of QUDH was also measured at 340 nm in 1.0 mL of
reaction mixture containing 5 μmol of (−)-vibo-quercitol
or other polyols as a substrate, 1 μmol of NAD+,
100 μmol of glycine-NaOH buffer (pH 9.0), and 10 μL
of enzyme solution. The blank contained buffer instead of
substrate. One unit of enzyme was defined as the amount
that converted 1 μmol of NADH in 1 min under these
conditions.

Appl Microbiol Biotechnol (2017) 101:7545–7555
7547
Fig. 1 Bioreduction of 2-deoxy-
scyllo-inosose (DOI) to (−)-
D-glucose
vibo-quercitol or its stereoisomer
scyllo-quercitol and their chemi-
cal structures, including naturally
abundant myo-inositol. The gray
box denotes the simple scheme of
DOI biosynthesis from D-glucose
OH
2
D-glucose 6-phosphate
DOI synthase (BtrC)
(-)-vibo-quercitol 1-
dehydrogenase (QUDH)
3
OH
OH
OH
1
4
OH
2
OH
OH
5
6
3
OH
OH
OH
1
OH
4
NAD+
O
NADH + H+
(-)-vibo-quercitol
OH
5
6
OH
OH
OH
OH
OH
scyllo-inositol
dehydrogenase
(IolX)
OH
OH
myo-inositol
2-deoxy-scyllo-inosose
(DOI)
OH
scyllo-quercitol
Purification and physicochemical characterization
of QUDH from Bu. terrae AKC-020 (40-1)
TSK-Gel3000SW gel filtration column (21.5 × 300 mm;
Tosoh) that had been equilibrated with sodium phosphate
buffer containing 0.3 M NaCl (pH 6.0) and eluted at a flow
rate of 1.0 mL/min.
Bu. terrae sp. AKC-020 (40-1) was deposited for a patent
application as NITE P-01745 at the National Institute of
Technology and Evaluation (NITE), Kisarazu, Chiba, Japan.
The strain was grown in LB medium in a test tube at 30 °C for
24 h with shaking. Then, 1 mL of culture broth was transferred
into 100 mL of fresh medium consisting of 0.5% (w/v) DOI,
0.4% tryptone, and 0.2% yeast extract (pH 7.0) in a 500-mL
shaking flask and aerobically cultured at 30 °C for 24 h with
shaking. The cells collected from the 100-mL culture were
resuspended in 20 mL of buffer and disrupted on ice with an
ultrasonic oscillator (Ultra Sonic Disruptor UD-200) for 300 s
(in five disruptions of 30 s each followed by a 30-s interval for
cooling). After centrifugation (at 15,000×g for 10 min), the
supernatant was used as a crude enzyme solution. All the
purification procedures were carried out at 0–4 °C in 20 mM
sodium phosphate buffer (pH 7.0) unless otherwise stated.
Solid ammonium sulfate was added to the crude enzyme so-
lution to reach 30% saturation, and the precipitate was re-
moved by centrifugation (at 15,000×g for 10 min). The super-
natant was applied to a Butyl-Toyopearl 650 M column
(25 × 65 mm; Tosoh Corp., Tokyo, Japan) that had been
equilibrated using the same buffer. The enzyme was eluted
with a linear 30–0% aqueous ammonium sulfate gradient in
buffer. Fractions with high enzyme activity were dialyzed
against a 20-mM 3-(N-morpholino)propanesulfonic acid-
NaOH (MOPS) buffer (pH 7.0) and applied to a
RESOURCE Q 1 mL column (GE Healthcare Japan, Tokyo,
Japan) equipped with an ÄKTA purifier (GE Healthcare). The
enzyme was eluted using a linear 0–0.5-M aqueous NaCl
gradient in MOPS buffer. Fractions with high enzyme activity
were concentrated using a Centriprep YM-30 filter unit
(30,000 Da molecular weight cutoff; Merck Millipore,
Darmstadt, Germany). The enzyme solution was applied to a
The purified enzyme was subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
using an ATTO AE-6530 mini-slab size electrophoresis sys-
tem with an e-PAGEL E-T10L 10% precast gel (ATTO Corp.,
Tokyo, Japan), which was performed at 20 mA according to
the method described by Laemmli (1970). After electrophore-
sis, the gel was stained with Coomassie brilliant blue G-250.
The N-terminal and internal amino acid sequences were deter-
mined by APRO Life Science Institute (Tokushima, Japan).
The molecular mass of the enzyme was determined by
analytical high-performance liquid chromatography (HPLC)
with a TSK-Gel G3000SW column (7.5 × 300 mm; Tosoh) at
a flow rate of 0.5 mL/min with 50 mM Tris-HCl (pH 7.0)
containing 0.1 M NaCl. The molecular mass of the native
enzyme was determined by comparing the retention time of
QUDH with that of the MW-Marker (Oriental Yeast Co.,
Tokyo, Japan).
Protein concentration was estimated using the Bradford
method calibrated with bovine serum albumin as a standard
(Bio-Rad Protein Assay Kit; Bio-Rad, Hercules, CA).
HPLC analysis of deoxyinositols
The reaction mixture for evaluating the DOI reduction
consisted of 10 μmol of DOI, 1.0 μmol of NAD+, 100 μmol
of sodium formate, 200 μmol of KPB (pH 7.0), 0.2 units of
formate dehydrogenase (Wako Pure Chemicals, Osaka,
Japan), and 0.1 unit of QUDH, in a total reaction volume of
1.0 mL. The reaction was performed at 30 °C with incubation
in a 2.0-mL tube for 2 h. After filtration, the solution was
subjected to HPLC analysis using a Shimadzu Prominence
HPLC (Shimadzu Corp, Kyoto, Japan) equipped with a

7548
Appl Microbiol Biotechnol (2017) 101:7545–7555
Shodex SUGAR KS-801 ligand exchange column
(8 × 300 mm; Showa Denko, Tokyo, Japan) and a SUGAR
KS-G guard column, with a Shodex RI-71 refractive index
detector (Showa Denko) at 70 °C using distilled water as the
mobile phase following degassing. The flow rate was 1.0 mL/
min with retention times of 8.7 min for scyllo-quercitol,
9.3 min for (−)-vibo-quercitol, and 9.8 min for DOI.
(Takara Bio, Kyoto, Japan) was used as the host cell. The
transformants possessing pETduet-QUDH were grown on
MagicMedia™ (Thermo Fisher Scientific Inc., Yokohama,
Japan) containing 50 μg/mL of ampicillin at 30 °C.
Genome database mining and the construction
of expression vectors
Cloning and DNA sequencing of the qudh gene
A database homology search was performed using BLAST
(National Center for Biotechnology Information, Bethesda,
MD). Microbial genes that shared 36–79% amino acid se-
quence identity with Bu. terrae QUDH were selected from
databases and chemically synthesized to optimize translation-
al codon usage in E. coli. The initiation codon of GTG in Ba.
subtilis iolX was substituted with ATG. Each synthesized
DNA fragment was digested with BamHI and HindIII and
cloned into the same sites of plasmid pET21b (+) (Merck) to
generate each expression vector. E. coli BL21(DE3)
transformant cells possessing each vector were grown in
MagicMedia™ containing 50 μg/mL of ampicillin at 30 °C
in the same manner as E. coli BL21(DE3) (i.e., pETduet-
QUDH).
Genomic DNA was prepared from Bu. terrae AKC-020 (40-1)
cells grown in LB medium using standard techniques for DNA
manipulation (Sambrook and Russell 2001) to obtain partial frag-
ments of the QUDH-coding gene. PCR was performed using
genomic DNA as a template. The combination of the degenerate
primers for amplifying qudh fragments was designed from the N-
terminal and internal amino acid sequences of QUDH and se-
quences conserved among inositol dehydrogenases in microor-
ganisms. This approach was selected because the N-terminal
amino acid sequence (MIRIAVLGAG) was highly similar to
those of bacterial inositol dehydrogenases and glycerol-3-
phosphate dehydrogenases. All oligonucleotide primers used to
clone the QUDH-coding gene are shown in Table S1, and all
nucleotide sequences were determined using a Capillary DNA
Sequencer 3130 (Applied Biosystems, Tokyo, Japan) to perform
Sanger DNA sequencing of both strands. We were able to am-
plify an approximately 900-bp DNA fragment using the primers
DOIRdgnF1 (ATGATHMGNATHGCNGT) and DOIRdgnR8
(GCRTCNACRAANGCYTC). We then amplified an approxi-
mately 700-bp DNA fragment, which was similar to the inositol
dehydrogenase gene by nested PCR using this 900-bp DNA
fragment as a template with the primers DOIRdgnF1 and
DOIRdgnR7Q (CKYTGRTCRTANCCRTA). To obtain the
neighboring regions of the QUDH-coding gene, thermal asym-
metric interlaced PCR (TAIL-PCR; Liu and Whittier 1995) was
performed using the primers based on the deduced partial nucle-
otide sequences and arbitrary primers. The full length of the
DNA fragment of qudh was finally amplified by PCR using
the genomic DNA as a template and the primers DOIRtopF2
(TACGGCGTGGAACTCATC) and DOIRbotR2
(TGAGTGATACCAAGACATGCC). The sequence of the
PCR fragment was confirmed. Then, to construct the expression
vector, the DNA fragment of qudh was amplified by PCR using
the genomic DNA as a template and the primers DOIRexF1Bam
(AGAGGATCCAATGATTCGAATCGCCGTACT, where
GGATCC is a BamHI site) and DOIRexR1Hind
(AGAGAAGCTTCACCTTGACGGCTTTGC, where
AAGCTT is a HindIII site). The amplified fragments were
digested with BamHI and HindIII and cloned into the corre-
sponding sites of plasmid pETduet-1 (Merck Japan, Tokyo,
Japan) to generate the pETduet-QUDH vector. The qudh gene
of this vector was under the control of the T7 promoter and was
fused to a His × 6-tag at the N-terminus. E. coli BL21(DE3)
Chemicals
2-Deoxy-scyllo-inosose (DOI), (−)-vibo-quercitol, and (−)-
vibo- and scyllo-quercitol mixtures were acquired from
Asahi Kasei Chemicals Corp. (Tokyo, Japan), and (+)-proto-
quercitol (1L-1,3,4/2,5-cyclohexanepentol), scyllo-inositol
(1,3,5/2,4,6-cyclohexanehexol), and 2-deoxy-D-glucose were
purchased from Tokyo Kasei Corp. (Tokyo, Japan). All other
chemicals were purchased from Wako Pure Chemical
Industries.
Nucleotide sequence accession number
The qudh sequence was registered at the DNA Data Bank of
Japan (DDBJ) under accession number LC259984.
Results
Screening of microbial strains for QUDH production
Several microorganisms that were able to assimilate the (−)-
vibo- and scyllo-quercitol mixture as a sole carbon source
were easily obtained from the soil samples. We observed that
42 of the 109 cultural microorganisms isolated were able to
rapidly grow in a (−)-vibo- and scyllo-quercitol-containing
liquid medium. Most of these quercitol-assimilating microor-
ganisms demonstrated varying levels of DOI-reducing activity
using NADH or NAPDH. Many of these strains exhibited
high QUDH (i.e., DOI reducing) activity and high

Appl Microbiol Biotechnol (2017) 101:7545–7555
7549
diastereomeric excess of the produced quercitol. These includ-
ed strains AKC-020 (40-1), 40-42, 81-8, 83-4, 85-1, 85-4, 86-
4, 93-1, 96-3, and 97-1, which were selected for preliminary
taxonomic identification based on 500 bp of their 16S ribo-
somal DNA (rDNA) sequences. As Table 1 indicates, strains
AKC-020 (40-1), 40-42, 89-3, and 97-1 belong to the genus
Burkholderia; strains 81-8, 83-4, 85-1, 85-4, 86-4, and 96-3 to
Pseudomonas; and strain 93-1 to Arthrobacter. Moreover, all
the QUDHs found in these microorganisms exhibited the
stereoselectivity to generate (−)-vibo-quercitol but not scyllo-
quercitol from DOI (Fig. 1, Table 1).
and physiological features, but they were not classified to the
species level.
Production and purification of QUDH from Bu. terrae
The enzyme production by Bu. terrae AKC-020 (40-1) was
strongly induced by the addition of DOI or quercitol and
slightly induced by myo-inositol in the culture media. DOI
was chosen as a carbon source for Bu. terrae culture because
it was available at a relatively low cost. QUDH was strongly
produced under the optimized culture medium containing
DOI and negligibly produced in the absence of DOI or
quercitol (Fig. S1). Thus, the enzyme production was induc-
ible, and the combination of DOI (0.5–1.0%), tryptone
(0.4%), and yeast extract (0.2%) in the medium was the most
suitable for generating QUDH in the culture.
The enzyme was stable throughout the purification proce-
dures. Therefore, the process of purifying QUDH from the
crude extract was conducted by standard methods including
ammonium sulfate fractionation and a combination of chro-
matographic procedures, including hydrophobic, anion ex-
change, and gel filtration techniques (Table 2). The enzyme
was purified by 24.6-fold, and the yield was 4.5%.
Identification of the isolated microorganism
The AKC-020 (40-1) strain inferred to be Burkholderia sp.
was a rod-shaped Gram-negative bacterium (0.8–0.9 × 1.2–
2.0 μm) with the following physiological features: pale yellow
colonies on LB agar, growth at 37 °C (−), positive for motility,
negative for oxidase activity, positive for catalase activity, no
spore formation, (−/−) for acid and gas formation from glu-
cose, and (−/−) in the O-F test. In addition, an analysis of the
16S rDNA sequence (1000 bp) from AKC-020 (40-1) per-
formed by Techno Suruga Lab (Shizuoka, Japan) showed that
the sequence from the strain was a perfect match with 16S
rDNA from Bu. terrae. This sequence result combined with
the physiological properties of the culture confirmed the iden-
tity of the microorganism as Bu. terrae strain AKC-020 (40-
1). The genera of the preliminarily identified strains
Pseudomonas sp. 86-4 and Arthrobacter sp. 93-1 were also
confirmed to be correct by 16S rDNA sequencing (1000 bp)
SDS-PAGE indicated that the purified enzyme was homo-
geneous (Fig. 2a). The N-terminal and internal peptide se-
quences of QUDH were MIRIAVLGAGRI and
AELEAFVDALNTN, respectively, which indicated that the
sequence of the enzyme was quite similar to those of the
previously reported inositol dehydrogenase and glycerol-3-
phosphate dehydrogenase enzymes.
Table 1 2-Deoxy-scyllo-inosose reducing activity of various quercitol-assimilating microorganisms
Strain
Culture mediuma
Activity
(U/mL culture)
Conversion yield
(%)b
Absolute
configuration
Diastereomeric excess
(% de)
Burkholderia terrae AKC-020 (40-1)
Burkholderia terrae 40-4-2
Burkholderia sediminicola 89-3
Burkholderia sp. 97-1
A
A
A
B
0.41
0.59
0.94
0.55
1.73
0.16
0.50
1.08
0.69
1.05
0.16
42.0
68.5
49.2
35.6
54.7
70.7
53.9
54.5
75.4
57.6
41.9
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
(−)-vibo
90.7
79.4
74.0
88.6
83.4
82.5
84.0
82.6
87.7
85.3
82.0
Pseudomonas sp. 81-8
A
A
A
A
A
A
YA
Pseudomonas sp. 83-4
Pseudomonas sp. 85-1
Pseudomonas sp. 85-4
Pseudomonas sp. 86-4
Pseudomonas sp. 96-3
Arthrobacter sp. 93-1
a Refer to BMaterials and methods^; medium YA is supplemented with 0.5% (w/v) yeast extract to medium A
b Conversion yield = quercitol (mM)/2-deoxy-scyllo-inosose (mM) × 100 in the reaction mixture after incubation. The modified reaction mixture consists
of 60 μmol of DOI, 1.0 μmol of NAD+ , 200 μmol of sodium formate, 200 μmol of KPB (pH 7.0), 0.2 units of formate dehydrogenase, and 0.5 units of
QUDH, in a total reaction volume of 1.0 mL for a 3-h incubation at 30 °C

7550
Appl Microbiol Biotechnol (2017) 101:7545–7555
Table 2 Summary of purification of QUDH from Burkholderia terrae AKC-020 (40-1)
Step
Total protein (mg)
Total activity (U)
Specific activity (U/mg)
Purification factor (fold)
Yield (%)
Culture extract
37.6
18.6
0.4
78.7
74.7
15.8
11.2
3.6
2.09
4.02
39.5
46.7
51.4
1
100
95
(NH4)2SO4 precipitation (30%)
Butyl TOYOPEARL650M
RESORCE Q
1.9
18.9
22.3
24.6
20
0.24
0.07
14
TSK-Gel G3000SW
4.6
Enzymatic properties of QUDH
KPB (pH 6.0–8.0), Tris-HCl buffer (pH 7.5–9.0), glycine-
NaOH buffer (pH 8.5–10.0), and CAPS (N-cyclohexyl-3-
aminopropanesulfonic acid)-NaOH buffer (pH 10.0–11.5).
The maximum activity of the reductive reaction of DOI was
100% at pH 8.0 and 60% at both pH 7.0 and 9.5 (Fig. 3a). In
contrast, the optimal pH for the oxidative reaction of (−)-vibo-
quercitol was 9.5 (Fig. 3b).
Molecular mass and subunit structure
The molecular mass of native QUDH was estimated to be
130.9 kDa according to analytical HPLC with a TSK-Gel
G3000SW column. SDS-PAGE revealed a single band corre-
sponding to a molecular mass of 37.0 kDa (Fig. 2a). This sug-
gested that QUDH is a homotetrameric enzyme. As described
later, QUDH consists of 330 amino acids, and its molecular
mass was estimated to be 36.2 kDa. Therefore, the theoretical
molecular mass of native QUDH was inferred to be 144.8 kDa.
a
Effect of pH on enzyme activity
The effect of pH on enzyme activity at a final buffer concen-
tration of 0.2 M was measured in citrate buffer (pH 5.0–6.0),
a
b
M
1
210
140
b
100
70
57
43
36.5
28
Fig. 3 Effect of pH on the activity of purified QUDH on a the reductive
reaction of DOI and b the oxidative reaction of (−)-vibo-quercitol. In a,
closed squares indicate citrate buffer (pH 5.0–6.0), open squares indicate
KPB (pH 6.0–8.0), closed circles indicate Tris-HCl buffer (pH 7.5–9.0),
and open circles indicate glycine-NaOH buffer (pH 8.5–10.0), while in b,
open circles indicate KPB (pH 6.0–8.0), closed squares indicate Tris-HCl
buffer (pH 7.5–9.0), open squares indicate glycine-NaOH buffer (pH 8.5–
10.0), and closed circles indicate CAPS (N-cyclohexyl-3-
aminopropanesulfonic acid)-NaOH buffer (pH 10.0–11.5). The bars in-
dicate the standard deviations from three measurements
Fig. 2 SDS-PAGE analysis of a purified and b recombinant QUDH and
its homologous enzymes, which were expressed in E. coli BL21(DE3). In
a, lane M contained molecular weight standards (prestained XL-Ladder,
APRO Science, Tokushima, Japan), and lane 1 contained the purified
QUDH from Burkholderia terrae; in b, lane M contained molecular
weight standards, and lanes 1–6 contained the following crude enzyme
solutions from recombinant E. coli cells: (1) QUDH/B. terrae, (2)
IolG/Burkholderia sp., (3) Idh/Pantoea sp., (4) Idh/Pseudomonas
synxantha, (5) Idh/Sinorhizobium fredii, and (6) IolX/Bacillus subtilis

Appl Microbiol Biotechnol (2017) 101:7545–7555
7551
Effect of temperature on enzyme activity and stability
and D-xylose (Ramaley et al. 1979; Daniellou et al. 2005),
but QUDH never catalyzed the oxidation of either compound.
Moreover, (+)-proto-quercitol, a stereoisomer of (−)-vibo-
quercitol and scyllo-inositol, did not serve as a substrate.
Thus, QUDH was identified as a novel NAD+-dependent
(−)-vibo-quercitol 1-dehydrogenase, which was supported by
its ability to efficiently reduce DOI into (−)-vibo-quercitol
(Fig. 1).
The optimal temperature of the QUDH reaction was measured
using the purified enzyme for 1 min at temperatures ranging
from 20 to 70 °C. The enzyme assay indicated a maximum
activity at 50 °C, with 50 and 6% of this maximum activity
achieved at 40 and 60 °C, respectively (Fig. S2).
The thermal stability of the enzyme was measured by in-
cubating the purified enzyme at each tested temperature for
30 min in 50 mM KPB (pH 7.0). The enzyme was stable after
incubations below 30 °C, with 53 and 11% of the original
activity maintained after incubations at 35 and 40 °C,
respectively.
Cloning the qudh gene
The qudh gene was successfully amplified from the geno-
mic DNA of Bu. terrae AKC-020 (40-1) and cloned into
E. coli cells according to the procedures described in the
BMaterials and methods.^ The PCR-based amplification
procedures utilized the N-terminal amino acid sequence
of QUDH and the conserved regions of inositol dehydro-
genases followed by TAIL-PCR. The amplified DNA
fragment was 3012 bp and contained an open reading
frame that consisted of 993 nucleotides corresponding to
330 amino acid residues with a calculated molecular mass
of 36,195 Da (Fig. 4). A comparison of the qudh sequence
revealed that it contains the N-terminal and internal amino
acid sequences confirmed in native QUDH (i.e.,
MIRIAVLGAGRI and AELEAFVDALNTN). The theo-
retical pI of QUDH was calculated to be 5.45. QUDH
shared relatively high amino acid identities with bacterial
inositol dehydrogenases from Sinorhizobium meliloti
(idhA; 49.5% identity; accession number, Q68965;
Kohler et al. 2010), Sinorhizobium fredii (idhA; 48.9%
identity; accession number, Q9EZV8; Jiang et al. 2001),
Lactobacillus casei (iolG; 24.3% identity; accession num-
ber, A5YBJ7; Yebra et al. 2007), and Ba. subtilis (iolG;
24.0% identity; accession number, P26935; Fujita et al.
1991). Motif analysis with Motif Search (GenomeNet,
http://www.genome.jp/tools/motif/) indicated that QUDH
contains an NAD/P(H)-binding Rossmann fold domain (at
amino acid positions 2–119) with the well-known glycine-
rich phosphate binding loop (GXGXXG, at amino acid
positions 8–13) and C-terminal α/β domain (at amino
acid positions 133–220) observed within the oxidoreduc-
tase family.
Substrate specificity and kinetic parameters
The activities and kinetic parameters of the purified enzyme
were measured for various substrates and coenzymes
(Table 3). QUDH used NADH as a coenzyme, and 28.5% of
this activity level was observed when NADH was substituted
with NADPH. Therefore, QUDH is an NADH-dependent ox-
idoreductase. The Km values of QUDH toward DOI and
NADH in the reductive reaction were calculated from the
Lineweaver-Burk plot to be 0.41 and 0.04 mM, respectively.
The Km values of the enzyme toward (−)-vibo-quercitol and
NAD+ in the oxidative reaction were 1.60 and 0.11 mM, re-
spectively. In all cases, regular saturation curves of the activity
versus the substrate concentration were observed. As summa-
rized in Table 3, the kcat value of QUDH toward DOI
(70.1 s−1) was sufficient to catalyze the reduction of DOI to
produce (−)-vibo-quercitol.
Table 4 shows the specific activity for the oxidative reac-
tion of QUDH with NAD+ for some cyclitols, which are
cycloalkanes containing a hydroxyl group on each of three
or more ring atoms, as well as cyclohexanepolyols, sugars,
and alcohols. Among the various substrates tested, QUDH
catalyzed the oxidation of only (−)-vibo-quercitol and myo-
inositol, the latter at 41% of the activity for (−)-vibo-quercitol;
these somewhat similar activity levels are probably due to the
structural similarity of myo-inositol with (−)-vibo-quercitol
(Fig. 1). The substrate specificity of QUDH was very strict,
with limited cyclitols serving as a substrate. myo-Inositol de-
hydrogenase generally catalyzes the oxidation of D-glucose
Table 3 Kinetic parameters of
QUDH from Burkholderia terrae
Substrate
Km (mM)
V
max (U mg−1
)
k
cat (s−1 a
)
k )
cat/Km (s−1 mM−1
AKC-020 (40-1)
2-Deoxy-scyllo-inosose (DOI) (pH 7.0) 0.41 0.02
116.3 8.0
70.1 4.8 171.0 12.0
NADH (pH 7.0)
0.04 0.003
1.60 0.08
0.11 0.004
–
–
–
(−)-vibo-Quercitol (pH 9.0)
NAD+ (pH 9.0)
16.5 0.8
9.9 0.5
6.2 0.38
–
–
–
a Value per subunit

7552
Appl Microbiol Biotechnol (2017) 101:7545–7555
Table 4 Substrate specificity of QUDH compared with myo-inositol 2-dehydrogenase and scyllo-inositol dehydrogenase
Substrate
QUDH (U/mg)
myo-Inositol dehydrogenasea
scyllo-Inositol dehydrogenase (IolX; U/mg)b
(−)-vibo-Quercitol
(+)-proto-Quercitol
myo-Inositol
13.9
ND
5.7
–
ND
–
ND
34.4
–
0.07
0.39 (6.4)c
ND
scyllo-Inositol
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
1,2,3-Cyclohexanetriol (cis-,trans-mixture)
trans-1,2-Cyclohexanediol
1,3-Cyclohexanediol
Cyclohexanol
–
–
ND
–
ND
–
ND
8.6
< 0.1
4.3
–
0.32
ND
D-Glucose
2-Deoxy-D-glucose
0.25
ND
D-Xylose
Sorbitol
1,2-Propanediol
2-Propanol
–
ND
–
ND
ND not detected
a Data from Ramaley et al. (1979)
b Activities were measured using the crude extract of recombinant IolX in E. coli cells. The control experiment was performed using a crude extract of
E. coli cells without the plasmid expressing iolX
c Vmax value reported by Morinaga et al. (2010)
Genome mining and synthesis of quercitol stereoisomers
by QUDH and IolX
inferred amino acid sequence identity with Bu. terrae QUDH,
including putative genes, were selected and chemically syn-
thesized to optimize the translational codon usage in E. coli.
The corresponding genes were inositol 2-dehydrogenase or its
related genes from Burkholderia sp. SJ98, Pantoea sp. At-9b
CGD2M, Pseudomonas synxantha BG33R, and
We performed genome mining based on the QUDH sequence
to confirm whether QUDH homologs can produce (−)-vibo-
quercitol from DOI. The microbial genes that shared 36–79%
Fig. 4 Nucleotide and amino
acid sequences of QUDH. The
amino acid sequence (N-terminal
and internal) within the shaded
areas is identical to those
determined by protein
sequencing. The asterisk indicates
the qudh termination codon. The
box denotes the glycine-rich
phosphate binding loop in the
Rossmann fold of the NAD/P(H)-
binding domain

Appl Microbiol Biotechnol (2017) 101:7545–7555
7553
Sinorhizobium fredii USDA191 as well as iolX from Ba.
subtilis 168. These genes were successfully expressed in
E. coli with the pET21b (+) vector except iolX (Fig. 2b).
The expression level of IolX was insufficient to be detected
by SDS-PAGE, although enzymatic activity was observed in
the cell-free extract.
The production of (−)-vibo-quercitol from DOI was tested
using recombinant QUDH orthologs as a biocatalyst with an
NADH-regenerating system using formate dehydrogenase.
As summarized in Table 5, three QUDH homologs from
Burkholderia sp., Pantoea sp., and P. synxantha were able to
stereoselectively reduce DOI into (−)-vibo-quercitol with high
conversion yields and with almost the same diastereomeric
excess (de) of products (89–91%) as exhibited by Bu. terrae
QUDH. Notably, scyllo-inositol dehydrogenase (IolX) from
Ba. subtilis (Morinaga et al. 2010) exhibited the opposite
stereoselectivity for DOI, yielding scyllo-quercitol with an
excellent de value of more than 99%.
We successfully purified the QUDH enzyme from Bu.
terrae AKC-020 (40-1) cells grown on DOI and characterized
it in detail. DOI and quercitol strongly induced QUDH pro-
duction. Under the optimal culture conditions, the enzyme
activity level reached more than 0.7 units/mL culture broth
(Fig. S1). The purified enzyme catalyzed the reduction of
DOI to yield (−)-vibo-quercitol with 90.7% de. The de value
of the product (89.0%) of the recombinant QUDH (Table 5)
was slightly lower than that of the native purified enzyme
(90.7%). This small discrepancy might be caused by the
His-tag of the recombinant enzyme. Table 4 shows the sub-
strate specificity of the oxidative reaction of the enzyme com-
pared with that of Ba. subtilis inositol 2-dehydrogenase
(Ramaley et al. 1979; Daniellou et al. 2005) and scyllo-inosi-
tol dehydrogenase (IolX; Morinaga et al. 2010). The substrate
specificity of the enzyme indicated that it has high activity for
(−)-vibo-quercitol, although it possesses less activity for myo-
inositol and no activity for D-glucose, D-xylose, and other
quercitol stereoisomers tested. These results suggested that
the isolated QUDH enzyme is different from inositol 2-
dehydrogenase and should be defined as a novel NAD+-de-
pendent (−)-vibo-quercitol 1-dehydrogenase. The low Km val-
ue of 0.41 mM and high kcat value of 70.1 s−1 for DOI reduc-
tion as well as the Km value of 1.60 mM and kcat value of
9.9 s−1 for (−)-vibo-quercitol oxidation supported our enzyme
identification.
We cloned the qudh gene by PCR amplification from ge-
nomic DNA based on the N-terminal and internal amino acid
sequences as well as the conserved sequences of inositol 2-
dehydrogenase-related enzymes. Such sequences were con-
firmed in the amino acid sequence of the cloned qudh gene
(Fig. 4). A protein similarity BLAST search using the QUDH
sequence showed that the highest identity shared was 79%
with a putative inositol dehydrogenase in Burkholderia sp.
Therefore, we speculated that these enzymes that have been
tentatively annotated as inositol dehydrogenase might more
accurately be designated as (−)-vibo-quercitol 1-
dehydrogenases like QUDH. As shown in Table 5, some qudh
Discussion
Various bacterial strains able to grow on quercitol as the sole
carbon and energy source were screened for the production of
enzymes suitable for the bioreduction of DOI into chiral
quercitols. DOI-reducing activity that yielded quercitol was
observed for 42 isolates among the total 109 strains of micro-
organisms isolated, suggesting that our approach was a suit-
able screening method. Eleven strains were selected as candi-
date producers of DOI-reducing enzymes. We confirmed that
these isolates belong to the genera Burkholderia,
Pseudomonas, and Arthrobacter. By comparing the enzyme
activity, cofactor dependency, and diastereomeric excess of
the produced (−)-vibo-quercitol, we selected Bu. terrae
AKC-020 (40-1) for the production of a DOI-reducing en-
zyme (i.e., DOI reductase). The initial results also suggested
that many soil microorganisms have the ability to assimilate
not only inositol but also deoxyinositols.
Table 5 Production of quercitol by recombinant QUDH and its homologs originating from several microorganisms
Enzyme/origin
Amino acid identity
shared with QUDH (%)
Molecular weight of
subunit/
(−)-vibo-Quercitol
conc. (mM)
Conversion
yield (%)
Diastereomeric
excess (% de)
accession no.
QUDH/Burkholderia
terrae
100
36,195/LC259984
9.9
99
89.0
IolG/Burkholderia sp.
79
68
36,308/ZP_10026200.1
36,618/ZP_10145400.1
9.9
9.9
99
99
90.3
90.8
Idh/Pseudomonas
synxantha
Idh/Pantoea sp.
58
49
36,160/YP_004119064.1
34,648/AAG44816.1
9.9
2.8
99
28
89.1
81.7
Idh/Sinorhizobium
fredii
IolX/Bacillus subtilis
36
37,483/NP_388965.1
9.6 (scyllo-quercitol)
96
> 99

7554
Appl Microbiol Biotechnol (2017) 101:7545–7555
the use of 2-deoxy-scyllo-inosose synthase. Tetrahedron Lett 41:
1935–1938
homologs that share amino acid sequence identities of 79–
46% with qudh indicated QUDH activity and produced (−)-
vibo-quercitol from DOI. These data support the hypothesis
that these qudh homologs have been inappropriately identified
as inositol dehydrogenases. Moreover, we confirmed that
scyllo-inositol dehydrogenase (IolX), which shares an amino
acid sequence identity of 38% with QUDH, possesses the
opposite stereoselectivity with QUDH and yields scyllo-
quercitol with an excellent de (> 99%). Thus, we identified
two useful biocatalysts to produce (−)-vibo-quercitol and
scyllo-quercitol from DOI via a coupling reaction of a
NADH-regenerating system such as formate dehydrogenase
and formate, which suggests a promising bioprocess for pro-
ducing pure chiral quercitols for pharmaceuticals. In addition,
it should be possible to directly produce quercitol stereoiso-
mers from D-glucose by using E. coli as a cell factory, in which
2-deoxy-scyllo-inosose synthase (BtrC) or its homologs with
high activity (Konishi and Imazu 2010) can effectively pro-
duce DOI from glucose-6-phosphate, in combination with
QUDH or scyllo-inositol dehydrogenase (IolX). This process
would be useful for supplying chiral quercitols for pharma-
ceuticals because it permits skipping the step of purifying DOI
from the fermentation broth.
Kogure T, Wakisaka N, Takaku H, Takagi M (2007) Efficient production
of 2-deoxy-scyllo-inosose from D-glucose by metabolically
engineered Escherichia coli. J Biotechnol 129:502–509
Kohler PRA, Zheng JY, Schoffers E, Rossbach S (2010) Inositol catabo-
lism, a key pathway in Sinorhizobium meliloti for competitive host
nodulation. Appl Environ Microbiol 76:7972–7980
Konishi K, Imazu S (2010) Novel 2-deoxy-scyllo-inosose synthase.
Patent application WO2010109916A1 (PCT/JP2010/00210)
Kudo F, Numakura M, Tamegai H, Yamamoto H, Eguchi T, Kakinuma K
(2005) Extended sequence and functional analysis of the butirosin
biosynthetic gene cluster in Bacillus circulans SANK 72073. J
Antibiot 58:373–379
Kuno S, Takahashi A, Ogawa S (2011) Transformation of quercitols into
4-methylenecyclohex-5-ene-1,2,3-triol derivatives, precursors for
the chemical chaperones N-octyl-4-epi-β-valienamine (NOEV)
and N-octyl-β-valienamine (NOV). Bioorg Med Chem Lett 21:
7185–7188
Laemmli UK (1970) Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227:680–685
Liu YG, Whittier RF (1995) Thermal asymmetric interlaced PCR: auto-
matable amplification and sequencing of insert end fragments from
P1 and YAC clones for chromosome walking. Genomics 25:674–
981
Morinaga T, Ashida H, Yoshida K (2010) Identification of two scyllo-
inositol dehydrogenases in Bacillus subtilis. Microbiol 156:1538–
1546
Miyazawa D, Matsumoto K (2015) Method for producing 2-deoxy-
scyllo-inosose. Patent application WO2015005451 A1 (PCT/
JP2014/068497)
Compliance with ethical standards
Ogawa S, Kanto M (2007) Synthesis of valiolamine and some precursors
for bioactive carbaglycosylamines from (−)-vibo-quercitol produced
by biogenesis of myo-inositol. J Nat Prod 70:493–497
Ogawa S, Uetsuki S, Tezuka Y, Morikawa T, Takahashi A, Sato K (1999)
Synthesis and evaluation of glucocerebrosidase inhibitory activity of
anhydro deoxyinositols from (+)-epi- and (−)-vibo-quercitols.
Bioorg Med Chem Lett 9:1493–1498
Conflict of interest The authors declare that they have no conflict of
interest.
Ethical approval This article does not contain any studies with human
participants or animals performed by any of the authors.
Ota Y, Tamegai H, Kudo F, Kuriki H, Kioke-Takeshita A, Eouchi T,
Kakinuma K (2000) Butirosin-biosynthetic gene cluster from
Bacillus circulans. J Antibiot 53:1158–1167
Potawale SE, Shinde VM, Anandi L, Borade S, Dhalawat H, Deshmukh
RS (2008) Gymnema sylvestre: a comprehensive review.
Pharmacologyonline 2:144–157
Sambrook J, Russell WD (2001) Molecular cloning: a laboratory manual,
3rd ed, vol 1, 2 and 3. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor
Sanz ML, Sanz J, Martínez-Castro I (2004) Presence of some cyclitols in
honey. Food Chem 84:133–135
References
Anderson L (1972) The cyclitols. In: Pigman W, Horton D (eds) The
carbohydrates, chemistry and biochemistry. Academic, London, pp
520–579
Carlavilla D, Villamiel M, Martínez-Castro I, Moreno-Arribas V (2006)
Occurrence and significance of quercitol and other inositols in wines
during oak wood aging. Am J Enol Vitic 57:468–473
Daniellou R, Phenix CP, Tam PH, Laliberte MC, Palmer DRJ (2005)
Stereoselective oxidation of protected inositol derivatives catalyzed
by inositol dehydrogenase from Bacillus subtilis. Org Biomol Chem
3:401–403
Dion HW, Woo PWK, Willmer NE, Kern DL, Onaga J, Fusari SA (1972)
Butirosin, a new aminoglycosidic antibiotic complex: isolation and
characterization. Antimicrob Ag Chemther 2:84–88
Fujita Y, Shindo K, Miwa Y, Yoshida K (1991) Bacillus subtilis inositol
dehydrogenase-encoding gene (idh): sequence and expression in
Escherichia coli. Gene 108:121–125
Jiang G, Krishnan HA, Kim YW, Wacek TJ, Krishnan HB (2001) A
functional myo-inositol dehydrogenase gene is required for efficient
nitrogen fixation and competitiveness of Sinorhizobium fredii
USDA191 to nodulate soybean (Glycine max [L.] Merr.) J
Bacteriol 183:2595–2604
Takahashi A, Kanbe K, Tamamura T, Sato K (1999) Bioconversion of
myo-inositol to rare cyclic sugar alcohols. Anticancer Res 19:3807
Ramaley R, Fujita Y, Freese E (1979) Purification and properties of
Bacillus subtilis inositol dehydrogenase. J Biol Chem 254:7684–
7690
Walker JB (1975) myo-Inositol: NAD+ 2-oxidoreductase. In: Hash JH
(ed) Methods in enzymology vol.43. Academic, London, pp 433–
439
Wacharasindhu S, Worawalai W, Rungprom W, Phuwapraisirisan P
(2009) (+)-proto-Quercitol, a natural versatile chiral building block
for the synthesis of the α-glucosidase inhibitors, 5-amino-1,2,3,4-
cyclohexanetetrols. Tetrahedron Lett 50:2189–2192
Yamauchi N, Kakinuma K (1995) Enzymic carbocycle formation in mi-
crobial secondary metabolism. The mechanism of the 2-deoxy-
scyllo-inosose synthase reaction as a crucial step in the 2-
deoxystreptamine biosynthesis in Streptomyces fradiae. J Org
Chem 60:5614–5619
Kakinuma K, Nango E, Kudo F, Matsushima Y, Eguchi T (2000) An
expeditious chemo-enzymatic route from glucose to catechol by

Appl Microbiol Biotechnol (2017) 101:7545–7555
7555
Yebra MJ, Zúniga M, Beaufils S, Perez-Martínez G, Deutscher J,
Monedero V (2007) Identification of a gene cluster enabling
Lactobacillus casei BL23 to utilize myo-inositol. Appl Environ
Microbiol 73:3850–3858
Yoshida K, Sanbongi A, Murakami A, Suzuki H, Takenaka S, Takami H
(2012) Three inositol dehydrogenases involved in utilization and
interconversion of inositol stereoisomers in a thermophile,
Geobacillus kaustophilus HTA426. Microbiology 158:1942–1952
Yoshida K, Yamaguchi M, Morinaga T, Kinehara M, Ikeuchi M, Ashida
H, Fujita Y (2008) myo-Inositol catabolism in Bacillus subtilis. J
Biol Chem 283:10415–10424