An allomaltol derivative triggers distinct death pathways in luminal a and triple-negative breast cancer subtypes

Article abstract of DOI:10.1016/j.bioorg.2020.104403

Breast cancer is the most common cancer in women that shows a predisposition to metastasize to the distant organs. Kojic acid is a natural fungal metabolite exhibiting various biological activities. Compounds derived from kojic acid have been extensively studied and proved to demonstrate anti-neoplastic features on different cancer types. In the present study, allomaltol-structural analog of kojic acid and its seven derivatives including four novel compounds, have been synthesized, characterized and their possible impact on breast cancer cell viability was investigated. It was discovered that compound 5, bearing 3,4-dichlorobenzyl piperazine moiety, could decrease the viability of both MCF-7 and MDA-MB-231 cell lines distinctively. To ascertain the death mechanism, cells were subjected to different tests following the application of IC₅₀ concentration of compound 5. Data obtained from lactate dehydrogenase activity and gene expression assays pointed out that necrosis had taken place predominantly in MDA-MB-231. On the other hand, in MCF-7 cells, the p53 apoptotic pathway was activated by overexpression of the pro-apoptotic TP53 and Bax genes and suppression of the anti-apoptotic Mdm-2 and Bcl-2 genes. Furthermore, Bax/Blc-2 ratio was escalated by 3.5 fold in the study group compared to the control. Compound 5 did not provoke drug resistance in MCF-7 cells since the Mdr-1 gene expression, drug efflux, and H₂O₂ content remained unaltered. As for MDA-MB-231 cells, only a 1.4 fold increase in the Mdr-1 gene expression was detected. These results indicate the advantage of the allomaltol derivative over the chemotherapeutic agents conventionally used for breast cancer treatment that can be highly toxic and mostly lead to drug resistance. Thus, this specific allomaltol derivative offers an alternative therapeutic approach for breast cancer which needs further investigation.

Full text of DOI:10.1016/j.bioorg.2020.104403

Bioorganic Chemistry 105 (2020) 104403
Contents lists available at ScienceDirect
Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg
An allomaltol derivative triggers distinct death pathways in luminal a and
triple-negative breast cancer subtypes
,c,*
A. Ercana, S. Oncula, G. Karakayab, M. Aytemirb
a Hacettepe University, Faculty of Pharmacy, Department of Biochemistry, Ankara, Turkey
b Izmir Katip Çelebi University, Faculty of Pharmacy, Department of Pharmaceutical Chemistry, Izmir, Turkey
c Hacettepe University, Faculty of Pharmacy, Department of Pharmaceutical Chemistry, Ankara, Turkey
A R T I C L E I N F O
A B S T R A C T
Keywords:
Breast cancer is the most common cancer in women that shows a predisposition to metastasize to the distant
organs. Kojic acid is a natural fungal metabolite exhibiting various biological activities. Compounds derived from
kojic acid have been extensively studied and proved to demonstrate anti-neoplastic features on different cancer
types. In the present study, allomaltol-structural analog of kojic acid and its seven derivatives including four
novel compounds, have been synthesized, characterized and their possible impact on breast cancer cell viability
was investigated. It was discovered that compound 5, bearing 3,4-dichlorobenzyl piperazine moiety, could
decrease the viability of both MCF-7 and MDA-MB-231 cell lines distinctively. To ascertain the death mechanism,
cells were subjected to different tests following the application of IC50 concentration of compound 5. Data ob-
tained from lactate dehydrogenase activity and gene expression assays pointed out that necrosis had taken place
predominantly in MDA-MB-231. On the other hand, in MCF-7 cells, the p53 apoptotic pathway was activated by
overexpression of the pro-apoptotic TP53 and Bax genes and suppression of the anti-apoptotic Mdm-2 and Bcl-2
genes. Furthermore, Bax/Blc-2 ratio was escalated by 3.5 fold in the study group compared to the control.
Compound 5 did not provoke drug resistance in MCF-7 cells since the Mdr-1 gene expression, drug efflux, and
H2O2 content remained unaltered. As for MDA-MB-231 cells, only a 1.4 fold increase in the Mdr-1 gene
expression was detected. These results indicate the advantage of the allomaltol derivative over the chemother-
apeutic agents conventionally used for breast cancer treatment that can be highly toxic and mostly lead to drug
resistance. Thus, this specific allomaltol derivative offers an alternative therapeutic approach for breast cancer
which needs further investigation.
Breast cancer
Kojic acid
Allomaltol
Apoptosis
Multidrug resistance
1. Introduction
overexpression of certain transmembrane proteins such as adenosine
triphosphate (ATP) binding cassette (ABC) transporter family members
Breast cancer is the second leading cause of death from cancer among
women worldwide [1]. Treatment options for breast cancer comprise
surgical debulking, radiation, chemotherapy, hormone therapy, and
targeted therapies. To design an effective treatment strategy, it is
essential to determine the specific features of the cancer cells such as
possession of receptors like progesterone receptor (PR), estrogen re-
ceptor (ER) and human epidermal growth factor receptor 2 (HER2),
drug resistance potential and response to chemotherapy [2]. Chemo-
therapy is the main approach to target the rapid and uncontrolled tumor
cell proliferation regardless of the subtype of cancer cells. However, the
hereditary or acquired multiple drug resistance (MDR) where the cells
become resistant to a chemotherapeutic agent(s), particularly due to
limit their expediency [3,4]. Therefore, numerous studies have been
conducted to overcome chemotherapy-related MDR while targeting
cancer cells selectively.
5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4-one (Kojic acid, KA) is a
natural secondary metabolite produced by certain Aspergillus, Aceto-
bacter, and Penicillium species. It is a potent tyrosinase inhibitor, there-
fore capable of suppressing melanogenesis as the first and the rate-
limiting step of melanogenesis that is catalyzed by tyrosinase enzyme
[5,6]. It is used as a food additive to prevent enzymatic discoloration as
well as in the cosmetic industry to alleviate hyperpigmentation of the
skin by its tyrosinase inhibition property caused primarily by sunburn,
UV light, and scars [7,8]. KA is also proven to exhibit anti-inflammatory,
* Corresponding author at: Hacettepe University, Faculty of Pharmacy, Department of Pharmaceutical Chemistry, 06100 Sihhiye - Ankara, Turkey.
E-mail address: mutlud@hacettepe.edu.tr (M. Aytemir).
https://doi.org/10.1016/j.bioorg.2020.104403
Received 26 July 2020; Received in revised form 24 September 2020; Accepted 18 October 2020
Available online 21 October 2020
0045-2068/© 2020 Elsevier Inc. All rights reserved.

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
anti-bacterial, and anti-neoplastic activities [9,10]. Due to its instability
during long term storage as well as its capacity to provoke skin irritation
in high concentrations, studies have focused on synthesizing KA de-
rivatives with less harmful effects [11–15].
groups, respectively. As the chlorine in the structure of CKA readily
undergoes nucleophilic substitution, it is a crucial compound from the
chemical point of view. ALM has also been reported to be a non-toxic
and potential ligand for the chelation of metals [17]. CKA is produced
at room temperature via chlorination of the 2-hydroxymethyl moiety of
KA by thionyl chloride, with the ring hydroxyl being unaffected. Later
CKA is reduced to ALM harnessing zinc dust in concentrated hydro-
chloric acid [8].
2-Chloromethyl-5-hydroxy-4H-pyran-4-one (chlorokojic acid, CKA)
and 5-hydroxy-2-methyl-4H-pyran-4-one (allomaltol, ALM) are struc-
tural analogs of KA and can be synthesized from commercially available
KA [8]. ALM and its derivatives draw attention due to their advanta-
geous activities including anticancer [16], antidiabetic [17] and anti-
malarial [18].
The one-pot Mannich reaction of ALM with appropriately substituted
benzylpiperazine derivatives in the presence of formalin occurred with
good yields. Because of phenol-like properties, aminomethylation ortho
to the enolic hydroxyl group was constructed in a short time. The
mechanism of this reaction relies on the enhanced activity in the basic
medium due to increased electronegativity at the 6th position of the
hydroxypyrone ring [21]. The resulting precipitate as Mannich bases
was collected by filtration and washed with cold methanol.
Mannich bases that are derivatives of the KA scaffold were shown to
suppress inflammation, infection, and cancer cell proliferation [8,12].
Recently, we have reported the synthesis of new KA derivatives and
examined their cytotoxic effects on A375 human malignant melanoma,
HGF-1 human gingival fibroblasts, and MRC-5 human lung cell lines
[15,19]. We have found that most of the compounds were not harmful to
the healthy cell lines while representing cytotoxic action on cancerous
A375 cells significantly higher than the drugs used for the treatment of
malignant melanoma such as dacarbazine, temozolomide, and lenali-
domide. Especially, compounds bearing 3,4-dichlorobenzyl piperazine
moiety which one is also included in the context of this study as an ALM
derivative showed greater inhibition against A375 human malign mel-
anoma cells compared to the reference drugs [19].
The characterization of the novel compounds was supported by FT-
1
IR, MS, H, and 13C NMR spectroscopy techniques and the elemental
analysis data. The selected diagnostic bands of IR spectra of the com-
pounds provide useful information to determine the structures in terms
of absorption bands that are about 1620 cmꢀ 1 due to (C O) stretching
–
–
1
of the pyranone ring. The assignment of the signals from the H NMR
spectra was based on the chemical shifts and intensity pattern. The
singlet peaks owing to –CH3 group at the 6th position of the pyrone ring
exhibited signals between 2.24 and 2.41 ppm. The spectrums showed
broad singlet peaks for -CH2- of piperazine between 2.39 and 2.62 ppm.
The aromatic protons of the phenyl rings appeared in the range of 7.20
and 7.53 ppm. Characteristic H5 proton of the 4H-pyran-4-one ring was
determined as singlet peaks at about 6.5 ppm. The 13C NMR signals of
the compounds were in accordance with the proposed structures.
Carbonyl carbons of the 4H-pyran-4-one ring were found around 173
ppm. The distinctive signals of compounds were observed in the mass
spectra which followed a similar fragmentation pattern. The entire
spectrums showed characteristic molecular ion peaks equivalent to their
molecular formulae, M++23 (Na) peaks, and M++1 isotope peaks owing
to chlorine and bromine atoms with the ratio of 1:1 and 3:1,
respectively.
Based on our previous studies [19,20] and as a part of our continuing
interest in developing new anticancer agents, we reported the synthesis
of seven ALM derivatives having a structure of 2-substituted-6-methyl-3-
hydroxy-4H-pyran-4-one, using the methodology shown in Fig. 1. In this
study, we explored the contribution of the compounds on the viability of
MCF-7 and MDA-MB-231 breast cancer cell lines for the first time. After
stating the most effective compound, the mechanism of the cell death
and the drug resistance were studied. Data for the synthesis of the
effective compound and its activity on A375 malignant melanoma cell
line have already been established [19] and have been applied to the
Turkish Patent and Trademark Office (TR2017/20155). Physical prop-
erties of the compounds including their molecular formula, yields, and
melting points are given in Table 1.
2. Results
2.2. Biological screening
2.1. Chemistry
Compounds synthesized in this study (Table 1, Fig. 1) were screened
for their in vitro cytotoxic activities against breast cancer cell lines MCF-
7 and MDA-MB-231 using sulforhodamine B (SRB) assay upon 24, 48, or
72 h of exposure. ALM and its seven derivatives were tested, where all
compounds of this subset had weak cytotoxicity against two breast
cancer cell lines, except for compound 5. This compound has a 3,4-
dichloro group at R position and showed the highest toxicity on MCF-
7 (96.95 µM) and MDA-MB-231 (47.79 µM) at 48 h. The cytotoxic ac-
tivity of the compound was evaluated against the human gingival
fibroblast cell line (HGF-1) as a representative of normal (non-
cancerous) cells and was found to be 410.4 µM (data not shown). The in
vitro cytotoxic selectivity of compound 5 on the HGF-1 cell line was
used to detect the selectivity index (SI), by the equation stated as
follows:
3-Hydroxy-4H-pyran-4-ones comprising KA, CKA, and ALM are
important classes of the structural motif of many compounds both nat-
ural and synthetic, possessing high biological activity profile. Therefore,
their synthesis is of great importance to medicinal chemists, and studies
have been ongoing for years to come up with more effective and safer
agents. CKA and ALM have a structure very close to that of KA wherein
the hydroxymethyl group is replaced with the chloromethyl and methyl
/
nonꢀ cancerous cell line
cancer cell line
IC
50
SI = IC
50
The selectivity index for MCF-7 and MDA-MB-231 cell lines were
calculated to be 4.2 and 8.6, respectively. This compound was harmless
over non-cancerous HGF-1 but was cytotoxic on both of the breast
cancer cell lines. To highlight the advantage of compound 5, we
compared its SI values with Doxorubicin (DOX), which is widely used in
the treatment regimens of breast cancer. Being a very potent chemo-
therapy agent, DOX binds to the DNA, disturbs membrane permeability,
and generates a large amount of reactive oxygen species (ROS) [22].
However, DOX is known to be very toxic on non-cancerous cells as well
Fig. 1. The basic synthesis process of the ALM derivatives.
2

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
Table 1
Physicochemical properties of the compounds 1–7.
Comp.
Structure
Molecular formula
Molecular weight (g/mol)
Yield
M.p. (◦C)
O
OH
R
N
N
H3C
O
R
1a
2
4-fluoro
C18H21FN2O3
19H21F3N2O3
C18H20F2N2O3
332.37
382.38
350.36
383.27
383.27
366.81
411.27
126.11
66
71
70
60
60
20
47
63
168–70
171–2
163–5
165–6
160–2
153–5
180–1
153–5
4-trifluoromethyl
2,5-difluoro
C
3a
4
2,6-dichloro
C18H20Cl2N2O3
5b
6
3,4-dichloro
C18H20Cl2N2O3
C18H20ClFN2O3
2-chloro-6-fluoro
4-bromo-2-fluoro
7
C18H20BrFN2O3
ALM
C6H6O3
a
: [20].
b
:[19].
and is associated with congestive heart failure and cardiomyopathy
[23]. Therefore, the search for a compound that exerts no/less cyto-
toxicity over non-cancerous cells is crucial at this point. The IC50 values
of DOX at 48 h for MCF-7 and MDA-MB-231 were detected previously by
our team to be 8.3 µM and 6.6 µM, respectively [24]. The non-cancerous
cell line to be tested for DOX was chosen to be HEK293 and IC50 was
calculated as 0.37 µM. The SI values for DOX in MCF-7 and MDA-MB-
231 were 0.044 and 0.056, respectively. These data indicate that
although DOX is very effectively used in breast cancer cell treatment, its
cytotoxic effect on non-cancerous cells is intimidating. Compound 5,
therefore is effective in breast cancer cell lines MCF-7 and MDA-MB-231
and safe for the non-cancerous cells.
2.4. ALM derivative-induced lactate dehydrogenase (LDH) leakage
Toxicity rates of the IC50 values (of 48 h) of compound 5 were also
examined in terms of LDH leakage from the cells, which is an assessment
of cellular membrane integrity, and hence a marker for necrotic cell
death. The percentages of the cytotoxicity based on LDH leakage were
calculated abiding by the equation given in the materials and methods
section. It was witnessed that the LDH activity in the media of both of the
cells was increased significantly when the caspase inhibitor Z-VAD-FMK
was applied to the breast cancer cells alone or in combination with
compound 5 for 6 h. LDH activity remained unchanged with the
treatment of MCF-7 cells with compound 5 (A) although; the activity
was increased by ~ 30% when MDA-MB-231 cells were exposed to the
derivative (B) (Fig. 4). These results indicated that the treatment
schedule with compound 5 led MDA-MB-231 cells to necrosis mean-
while, it triggered a programmed cell death mechanism in MCF-7 cells.
The novel Mannich Base derivative that showed the highest cyto-
toxicity and SI value (compound 5) was tested for further in vitro ex-
periments to explore the mechanism of cell death. IC50 concentrations of
the compound at 48 h for each cell line were given in Table 2. Dose-
dependent changes in the proliferation of MCF-7 and MDA-MB-231
cells exposed to compound 5 for 24, 48, or 72 h were shown in Fig. 2.
2.5. Measurement of hydrogen peroxide (H2O2) level
2.3. Assessment of the stability of compound 5
Changes in H2O2 intracellular concentrations cause responses that
vary greatly but they frequently lead to cell death. Thus, the internal
H2O2 level upon administration of compound 5 was investigated to
understand whether a ROS and mitochondria-based cell death mecha-
nism takes place or not. Based on the data of 48 h, the H2O2 level was
observed to be attenuated distinctly in MCF-7 cells when exposed to the
compound, compared to the control. In opposite, H2O2 production was
detected to be slightly increased in MDA-MB-231 upon treatment
(Fig. 5). Taking into consideration cell cytotoxicity and LDH leakage
experiments, this can be explained by that compound 5 surprisingly
does not generate intracellular H2O2 in MCF-7 cells. Moreover, the
compound suppressed the internal ROS production meanwhile exerting
its cytotoxic effect on the cell. The slight stimulation of the H2O2 pro-
duction in MDA-MB-231 cells can be attributed to the increased sensi-
tivity of the cells to metabolites such as reactive nitrogen species (NOS)
which is a hypothesis that needs to be confirmed in the future studies.
The UV–visible absorption spectrum of compound 5 was measured
at three time-points (0 h, 24 h, 48 h) and the maximum absorbance of
the derivative was determined to be 246–262 nm and within the UV
range. Compound 5 was proved to be stable for at least 48 h at 37 ◦C
since the optical properties of the ALM derivative were intact
throughout the measurement schedule. The graphic regarding the
maximum absorbance and the stability over time was given in Fig. 3.
Table 2
IC50 values of ALM and compounds 1–7 for MCF-7 and MDA-MB-231 breast
cancer cell lines (n = 3 ± SD).
Compounds
IC50 (µM)
MCF-7
MDA-MB-231
ALM
396.4
424
358.6
155.6
42.48
416.9
122.5
47.79
159.1
145.5
2.6. Alterations in caspase 8 and 9 activity upon treatment of the cells
with compound 5
1
2
3
4
5
6
7
105
234.4
150.7
96.95
204.4
182.1
Following the assessments of cytotoxicity, LDH leakage, and H2O2
generation; caspase activity was investigated to determine whether the
compound triggers the breast cancer cell lines to undergo apoptosis.
According to the results, the activity of caspases 8 and 9 was provoked
3

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
Fig. 2. The evaluation of the cytotoxic effect of compound 5 on (A) MCF-7 and (B) MDA-MB-231 cells at 24, 48, or 48 h (n = 3 ± SD).
Fig. 3. UV–visible spectra of the ALM derivative, compound 5 at 0 h, 24 h, and 48 h. The maximum absorbance of compound 5 was measured to be 246–262 nm
and the molecule was stable for at least 48 h at 37 ◦C.
Fig. 4. The relative toxicity of (A) MCF-7 and (B) MDA-MB-231 cells exposed
to the IC50 concentration (48 h) of compound 5. The cells were treated with
Fig. 5. The concentration of H2O2 released to the medium from MCF-7 and
MDA-MB-231 treated with IC50 dosage of compound 5 for 48 h (n = 3 ± SD;
**p < 0.01).
compound 5, Z-VAD-FMK, or both for 6 h to examine the LDH activity in media
(n = 3 ± SD; ***p < 0.001 vs. compound 5).
4

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
Fig. 6. The caspase 8 and 9 activity levels in (A and B) MCF-7 and (C and D) MDA-MB-231 cells following the incubation of the cells with compound 5 for 6 h. (A
and B) Caspase 8 and 9 activity rates were triggered with the subjection of MCF-7 cells to IC50 concentration (for 48 h) of compound 5. Z-VAD-FMK inhibited the
augmentation of the caspase 8 activity (C and D) The caspase levels did not differ in MDA-MB-231 cells when they were treated with the ALM derivative for 6 h (n =
3 ± SD; *p < 0.05 vs. negative control, **p < 0.01, ***p < 0.001).
significantly with the incubation of MCF-7 cells with IC50 dosage (at 48
h) of compound 5 for 6 h, indicating that apoptosis was triggered and
the caspase inhibitor Z-VAD-FMK reversed the activation (Fig. 6 (A and
B)). Compound 5 application to MDA-MB-231 cells did not provoke the
activity levels of caspase 8 or 9, which along with increased LDH activity
point out to necrosis rather than apoptosis (Fig. 6 (C and D)).
were given in Fig. 7.
2.8. Gene expression analysis
Quantitative real-time polymerase chain reaction (qRT-PCR) was
carried out to identify expression levels of multidrug resistance gene
Mdr-1 and particular genes of the apoptotic pathway. Upon subjection of
MCF-7 cells to the IC50 concentration of compound 5, the pro-apoptotic
TP53 gene was found to be overexpressed and the Bax/Bcl-2 ratio was
highly upregulated. On the contrary, the p53-antagonist Mdm-2 gene
was diminished (Fig. 8). Evaluating with previous findings, results
indicated that compound 5 triggered the extrinsic apoptotic pathway by
activating both caspase 8 and p53 gene and decreasing its negative
regulator, Mdm-2. As MDA-MB-231 cells carry the mutant TP53 gene,
the p53 apoptotic pathway is greatly impaired. In that case, all relevant
genes assessed in this study were seen to be inhibited significantly
(Fig. 9). Accordingly, MDA-MB-231 cell death was caspase-independent
and clearly escaped from p53 regulation, pointing out a diverse cell
2.7. Drug efflux from ALM derivative-treated cells
To investigate the role of compound 5 on chemoresistance of MCF-7
and MDA-MB-231 cells, drug efflux was evaluated. In MCF-7 cells, cal-
cein retention was noticed to be unaffected in comparison with the
control, suggesting that compound 5 faced the prolonged retention
inside MCF-7 cells. Without being excluded from the cell, compound 5
executed more of its cytotoxic damage in MCF-7 cells. On the other
hand, the fluorescent signal of calcein slightly decreased in MDA-MB-
231 treated with compound 5 which may be attributed to necrosis
the cells experienced. Graphics regarding the drug efflux assay results
5

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
Fig. 8 and Fig. 9, Mdr-1 was inhibited in MCF-7 cells whilst it was
activated in MDA-MB-231 cells. As explained previously, the suppres-
sion of the Mdr-1 gene was a surplus for the prolonged retention of
compound 5 inside MCF-7 cells allowing the prolongation of the cyto-
toxic effect that led the cells to death. Similarly, the triggered Mdr-1
gene in MDA-MB-231 cells was consistent with the drug efflux assay
where compound 5 application resulted in lowered calcein AM reten-
tion, hence increased drug efflux.
3. Discussion
Despite improvements in the early detection and following treatment
approaches, breast cancer remains a major health issue in both devel-
oped and developing countries. This is partly the consequence of the
disorganization of multiple signaling mechanisms such as apoptotic
pathways. Additionally, acquired MDR following chemotherapy con-
stitutes another obstacle against successful treatment [25]. That being
the case, the pursuit of novel agents to inhibit the proliferation of breast
cancer cells without causing drug resistance is of interest of the recent
studies [26,27]. Being responsible for the leading cause of death among
women worldwide, breast cancer has different subtypes with various
genetic, morphologic, and histopathologic features. The immune-
histological markers and pathological variables help to diagnose the
subtype to treat the disease meticulously [28].
Fig. 7. Changes in calcein AM retention of MCF-7 and MDA-MB-231 cells after
being subjected to the IC50 concentration of compound 5 for 48 h (n = 3 ± SD;
*p < 0.05).
Wild-type p53 is a transcription factor and tumor suppressor protein
that is encoded by the TP53 gene. p53 protein strictly controls plenty of
cellular processes such as cell cycle regulation and DNA repair mecha-
nisms. Under normal conditions, the p53 level is maintained depressed
by Mdm2 protein through proteasomal degradation. In the case of acute
stress like DNA damage, oncogene activation, hypoxia, ribosome, and/
or endoplasmic reticulum stress; Mdm2 is inactivated. Then, p53 is
upregulated to arrest the cell cycle until stress stimuli are eliminated or
to initiate the apoptotic pathway when the DNA damage is irreversible
[29–36]. Several proteins (BAX, BID, PUMA, NOXA, etc.) are induced by
p53 which in turn activate caspases to degrade specific regulatory and
structural proteins, hence cell death occurs [37]. The interactions be-
tween these pro-apoptotic proteins and the survival proteins (BCL-2,
BCL-xL, MCL-1, etc.) determine the fate of the cell. Any obstruction to
this balance may cause cancer and impinge on the efficacy of cancer
treatment [38].
Fig. 8. Expression levels of pro-apoptotic (p53 and Bax), pro-survival (Mdm-2
and Bcl-2) and multidrug resistance (Mdr-1) genes compared to the control in
MCF-7 cells in response to treatment with IC50 concentration of compound 5
for 48 h (n = 3 ± SD).
The process of drug discovery and development mandates accurate
evaluation of the pharmacokinetic properties of the compounds
including absorption, distribution, metabolism, excretion, and toxicity
(ADMET) [39]. Unsuitable pharmacokinetic characteristics of a mole-
cule including inadequate absorption, short half-life, rapid clearance,
low bioavailability, and high toxicity lead to the failure of a drug
candidate to proceed to the next stages of the drug development [40].
Besides, lipophilicity should be considered since it is a critical factor for
the passive influx of the compound by the cell through the membrane
[41]. The partition coefficient in octanol/water (calculated log P, clog P)
value is evaluated as an indicator of the lipophilicity and hence, tar-
geting the efficiency of the drug candidate [42]. It is well known that,
compared to the membrane of healthy cells, the tumor cell membrane is
comprised of more lipid-enriched microdomains [43]. It is at least partly
due to the fast proliferation rate of cancer cells and their requirement of
extra supplements such as nutrients and growth factors [44,45]. Thus, a
certain level of lipophilicity of the drug candidate may be beneficial to
target the cancer cells. Breast cancer cell lines including MCF-7 was
proved to possess an elevated content of cholesterol, cholesterol esters,
and phospholipids [46,47]. In the present study, the KA analog ALM and
its Mannich bases were synthesized by our team, and their cytotoxic
effect on the ER and PR-positive MCF-7 and the metastatic triple-
negative MDA-MB-231 breast cancer cell lines were inspected. The re-
sults showed that compound 5 hindered cell viability of both MCF-7
(96.95 µM) and MDA-MB-231 (47.79 µM) in a time and dose-
dependent manner and has shown a very low harmful effect on HGF-1
Fig. 9. qRT-PCR results for the pro-apoptotic (p53 and Bax), anti-apoptotic
(Mdm-2 and Bcl-2), and multidrug resistance (Mdr-1) genes in MDA-MB-231
cells exposed to IC50 value of compound 5 for 48 h. The expression levels
were compared to the untreated control values and given as fold change (n = 3
± SD; *p < 0.05, **p < 0.01, ***p < 0.001).
death mechanism other than apoptosis. Considering LDH activity and
the highly metastatic characteristic of triple-negative breast cancer
(TNBC) cell line MDA-MB-231, the results manifest necrosis. The Mdr-1
gene expression profiles of MCF-7 and MDA-MB-231 cells were consis-
tent with the drug efflux assay data explained in Fig. 7. As can be seen in
6

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
healthy cells (410 µM) [19]. Since compound 5 is lipophilic with a high
clog P value; it was hypothesized that the ALM derivative can penetrate
through the membrane of breast cancer cell lines via passive transport.
Additionally, the newly synthesized compound 2, bearing 4-trifluor-
omethyl-benzylpiperazine moiety, also showed a remarkable cytotoxic
influence on both MCF-7 and MDA-MB-231 cells, where the IC50 values
for 48 h were calculated to be 105 and 42.48 µM, respectively. However,
the morphological observations of both compounds revealed that
compound 5 had a more peculiar effect on both of the cell lines sug-
gesting that distinct cell death mechanisms may be triggered upon
administration. Hence, from this point on in this study, compound 5
was chosen for further detailed exploration.
4. Conclusion
Overall, in this study, we aspired to explore the anti-proliferative
effects of the ALM derivatives in the structure of Mannich bases, on
two different breast cancer cell lines for the first time. As observed from
the aforementioned experiments based on gene expression studies, it can
be concluded that highly lipophilic compound 5 which is foreseen to
penetrate the cell membrane via passive transport could kill breast
cancer cells dominantly via a p53-dependent and p53-independent
mechanism dependent on the characteristics of the cells. Unlike
widely used chemotherapeutics such as DOX, the derivative compound
was shown to be relatively harmless to the healthy cell lines since it
inhibited proliferation of both of the breast cancer cell lines and it did
not trigger drug efflux even in TNBC cell line MDA-MB-231 that is a
resistant sub-type of breast cancer by nature. Further tests are in need to
enlighten the exact mechanism of action, however, based on the potency
of the compound in breast cancer cells, it appears that this compound
could be a promising candidate for therapeutic purposes on both ER/PR-
possessing and triple-negative breast cancer cells.
TNBC cell line MDA-MB-231 bears one allele of mutant TP53 which
carries lysine (AAA) instead of arginine (AGA) on codon 280 of exon 8,
which is situated on the specific DNA-binding domain and the evolu-
tionarily conserved region [48,49]. Thus, the p53 apoptotic pathway is
not triggered in MDA-MB-231 cells in response to many antineoplastic
agents [24,50,51]. Accordingly, the findings obtained from this study
indicated that compound 5 provoked necrosis in MDA-MB-231 cells
given that the treatment of the cells caused increased LDH activity in cell
media meanwhile not stimulating neither the activity of caspases 8 and 9
nor the expression of the pro-apoptotic genes examined. It was
concluded that the ALM derivative directed MDA-MB-231 cells to ne-
crosis rather than a highly pre-orchestrated death. Interestingly, a
totally different phenomenon was observed in MCF-7 cells indicating
apoptosis. The subjection of the cells to compound 5 did not escalate
LDH leakage from the cells although the inhibition of the caspases by Z-
VAD-FMK guided the cell towards necrosis proved by the augmented
LDH activity in the media. The activity of both caspase 8 and 9 was
triggered following the incubation of MCF-7 cells with the derivative
molecule, not to mention the pro-apoptotic genes TP53 and Bax were
overexpressed whereas the negative regulator TP53, Mdm2, was
diminished.
5. Experimental
5.1. Chemistry
Entire chemicals used for the synthesis of the ALM derivatives were
purchased from Merck (Germany) and Aldrich Chemical Co. (Germany).
Melting points were ascertained with the aid of Thomas Hoover Capil-
lary Melting Point Apparatus (USA) and uncorrected. IR spectra were
recorded on a Perkin Elmer FT-IR-420 System, Spectrum BX spectrom-
eter. 1H- 13C NMR spectra were attained with a Varian Mercury 400
MHz spectrophotometer in deuterochloroform (CDCl3) and dimethyl
sulfoxide (DMSO‑d6). Tetramethylsilane (TMS) was used as an internal
standard (chemical shift in d, ppm). Mass spectrometry analysis was
achieved with a Micromass ZQ LC-MS with Masslynx Software Version
4.1 by adopting the electrospray ionization (ESI+) method. The
elemental analysis was carried out with a Leco CHNS-932 analyzer
(Leco, St. Joseph, MI, USA) in the Central Laboratory of Ankara Uni-
versity, Faculty of Pharmacy. The purity of the compounds was inves-
tigated by thin-layer chromatography (TLC) on Kieselgel 60 F254
(Merck, Germany) chromatoplates.
In the literature, the internal ROS level is controversial however, it is
known that induced internal H2O2 leads most cells to cell death and
apoptosis may be stimulated by inhibiting ROS with antioxidants
[52,53]. ROS accumulation is considered to cause genomic instability,
inhibit caspase activation, and therefore endorse malignancy [54,55].
ROS production due to prolonged usage of chemotherapeutic agents can
also initiate survival pathways such as PI3K/Akt, NF-КB, and MDR
[56–60]. According to the results, the internal H2O2 level was signifi-
cantly reduced, stating that compound 5 helped to suppress the internal
ROS level of MCF-7 cells. Not so similarly, MDA-MB-231 cells exhibited
slightly ascended levels of H2O2, a consistent and expected result taken
together with previous experiments.
5.2. Synthesis of CKA and ALM
CKA and ALM were synthesized by adapting a previous method [8].
CKA: Yield 76%, mp 166–7 ◦C (lit. 166–7 ◦C). ALM: Yield 63%, mp
152–3 ◦C (lit. 152–3 ◦C).
Another obstacle in the treatment of cancer is multidrug resistance
which is distinguished by excessive drug efflux from the cells, via the P-
glycoprotein (P-gp) situated on the cell membrane. Defeating the func-
tion P-gp is the major focus to overcome drug resistance triggered by
chemotherapeutical agents, including DOX [61,62]. Therefore, to sum
up, to succeed in chemotherapeutical applications, it is highly important
to find a molecule that is effective enough to activate cell death without
stimulating resistance in cancer cells and having no cytotoxic effect on
healthy cells. In this study, we showed that compound 5 was able to
meet the criteria mentioned above in MCF-7 cells by directing the cells
toward p53-dependent apoptosis, and by suppressing multidrug resis-
tance at least partially caused by the Mdr-1 gene without harming
healthy cells. In MDA-MB-231 cells, the derivative compound acted
independently from the p53 pathway, slightly generated oxidative stress
that led to cell death, and failed to stimulate the efflux of the agent from
the cells, although expression of the Mdr-1 gene was upregulated by 1.4
fold in comparison to the untreated control. Taken together, compared
to the conventionally used chemotherapeutics which cause systematic
toxicity such as DOX, compound 5 was shown to cause significant
toxicity on both breast cancer cell lines by leading them to cell death
without disturbing healthy cells.
5.3. Synthesis of Mannich bases (Compounds 1–7)
Mannich bases were produced by the reaction of substituted piper-
azine derivatives and ALM in MeOH with 37% formalin. The solution
was stirred vigorously for 15 to 25 min. The resulting precipitate was
collected by filtration and washed with cold MeOH. All crude products
were recrystallized with the appropriate solvents. The basic scheme of
the synthesis process was displayed in Fig. 1. The characteristics of the
ALM and its derivatives were exhibited in Table 1.
2-((4-(4-(Trifluoromethyl)benzyl)piperazin-1-yl)methyl)-3-hy-
droxy-6-methyl-4H-pyran-4-one (compound 2) C19H21F3N2O3 (M.W.:
382.38 g/mol), yield: 71%, mp: 171–2 ◦C, clog P: 3.013. %CHN Found
(Calculated): C 59.30 (59.68), H 5.58 (5.54), N 7.41 (7.33). IR
ν
(cmꢀ 1):
–
–
–
–
–
–
2820 (C H (aliphatic)), 1621 (C O), 1453 (C C), 1321 (C N), 1198
1
–
(C O). H NMR (CDCl3, 400 MHz) δ ppm: 2.26 (3H; s; -CH3); 2.49 (4H;
brs; piperazine); 2.62 (4H; brs; piperazine); 3.53 (2H; s; pyrane-CH2-
piperazine); 3.63 (2H; s; –CH2-Ar); 6.18 (1H; s; pyrane-H5); 7.41 (2H; d;
Ar- H2′,6′); 7.53 (2H; d; Ar- H3′,5′). 13C NMR (CDCl3, 100 MHz) 20.12;
52.82; 55.18; 62.22; 111.31; 120.14; 122.84; 125.14; 128.25; 129.18;
7

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
142.25; 145.28; 165.22; 173.97. ESI-MS (m/z) 382 (100%, (M)+). HRMS
calcd [(M + H)+] 383.1583, measured [(M + H)+] 383.1586.
with the application 1% (v/v) acetic acid (Sigma Aldrich, USA). Finally,
tris base (10 mM, pH 10.5) (Sigma Aldrich, USA) was added and the
optical density (OD) was measured at 510 nm. Cells not treated with the
compounds were considered as the negative control and to be 100%
viable. The percentage of absorbance values compared to control were
assessed to determine the changes in cell viability. The ALM derivative
that caused the highest toxicity on cells was chosen to perform the
following experiments.
2-((4-(2,6-Dichlorobenzyl)piperazin-1-yl)methyl)-3-hydroxy-6-
methyl-4H-pyran-4-one (compound 4) C18H20Cl2N2O3 (M.W.: 383.27
g/mol), yield: 60%, mp: 165–6 ◦C, clog P: 3.436. %CHN Found
(Calculated): C 56.22 (56.41), H 5.19 (5.26), N 7.57 (7.31). IR
ν
(cmꢀ 1):
–
–
–
–
–
2829 (C H (aliphatic)), 1618 (C O), 1435 (C C), 1196 (C N), 1002
–
1
–
(C O). H NMR (DMSO, 400 MHz) δ ppm: 2.41 (3H; s; -CH3); 2.51 (4H;
brs; piperazine); 2.51 (4H; m; piperazine); 3.48 (2H; s; pyrane-CH2-
piperazine); 3.66 (2H; s; -CH2-Ar); 6.21 (1H; s; pyrane-H5); 7.30–7.34
(1H; m; Ar-H4′); 7.45 (2H; d; Ar- H3′,5′).13C NMR (DMSO, 100 MHz)
19.38; 52.36; 52.50; 53.51; 55.87; 111.16; 128.56; 129.83; 133.62;
136.08; 143.29; 146.52; 164.66; 173.50. ESI-MS (m/z) 383 (100%,
(M)+); 385 (M + 2)+. HRMS calcd [(M + H)+] 383.0929, measured [(M
+ H)+] 383.0931.
5.6. Evaluation of the stability of ALM derivative
The UV–visible absorption spectrum of the selected ALM derivative
was evaluated to determine the wavelength for the maximum absor-
bance of the molecule and its stability over time. Three time-points (0 h,
24 h, and 48 h) were selected to test whether the derivative would be
stable within this time course. The vial of derivative was 20 mM of
2-((4-(2-Chloro-6-fluorobenzyl)piperazin-1-yl)methyl)-3-hy-
droxy-6-methyl-4H-pyran-4-one (compound 6) C18H20CFN2O3 (M.W.:
366.81 g/mol), yield: 20%, mp: 153–5 ◦C, clog P: 2.986. %CHN Found
◦
concentration and kept at 37 C until the end of the experiment. The
optical characteristics were measured between the wavelengths of 230
nm and 890 nm.
(Calculated): C 58.61 (58.94), H 5.73 (5.50), N 7.70 (7.64). IR
ν
(cmꢀ 1):
–
–
–
–
3222 (O H), 2938, 2811 (C H (aliphatic)), 1612 (C O), 1449 (C C),
–
–
1
–
–
1317 (C N), 1212 (C O). H NMR (DMSO, 400 MHz) δ ppm: 2.24 (3H;
s; -CH3); 2.43 (4H; brs; piperazine); 2.50 (4H; m; piperazine); 3.47 (2H;
s; pyrane-CH2-piperazine); 3.58 (2H; s; -CH2-Ar); 6.20 (1H; s; pyrane-
H5); 7.20 (1H; m; Ar-H3′); 7.31–7.40 (2H; m; Ar-H4′,5′). 13C NMR
(DMSO, 100 MHz) 19.29; 51.77; 52.24; 53.39; 111.06; 114.11; 114.33;
123.22; 123.40; 125.41; 125.44; 129.90; 130.00; 135.50; 135.56;
143.18; 146.43; 160.15; 162.61; 164.56; 173.40. ESI-MS (m/z) 367
(100%, (M)+). HRMS calcd [(M + H)+] 367.1225, measured [(M + H)+]
367.1222.
5.7. LDH activity assay
The breast cancer cells were seeded into 6-well plates (1 × 105 cells/
well). When confluent, cells were subjected to 1% of Triton X-100
(positive control group), or IC50 concentration (at 48 h) of the ALM
derivative alone or in combination with the caspase inhibitor Z-VAD-
FMK (Sigma-Aldrich, USA). The cells that were not treated with an agent
was considered as the negative control group. After 6 h-incubation, the
media of each group was collected and the LDH activity assay was
carried out by using the ab102526 colorimetric LDH assay kit (Abcam,
USA) according to the protocol of the manufacturer. The OD values were
measured at 450 nm kinetically and the percentage of the cytotoxicity
was calculated according to the equation as follows:
2-((4-(4-Bromo-2-fluorobenzyl)piperazin-1-yl)methyl)-3-hy-
droxy-6-methyl-4H-pyran-4-one (compound 7) C18H20BrFN2O3. ½
CH3OH (M.W.: 427.29 g/mol), yield: 47%, mp: 180–1 ◦C, clog P: 3.136.
%CHN Found (Calculated): C 51.84 (52.00), H 5.05 (5.19), N 7.00
–
–
–
–
(6.56). IR
ν
(cmꢀ 1): 2818 (C H (aliphatic)), 1626 (C O), 1460 (C C),
–
%Cytotoxicity = (A sam ple ꢀ A negative control)/(A positive control
ꢀ A negative control) × 100
1
–
–
1233 (C N), 999 (C O). H NMR (DMSO, 400 MHz) δ ppm: 2.24 (3H;
s; -CH3); 2.39 (4H; brs; piperazine); 2.51 (4H; brs; piperazine); 3.32 (2H;
s; pyrane-CH2-piperazine); 3.49 (2H; d; -CH2-Ar); 6.21 (1H; s; pyrane-
H5); 7.33–7.40 (2H; m; Ar-H5′,6′); 7.48 (1H; d; Ar-H3′). 13C NMR (DMSO,
100 MHz) 19.29; 52.15; 52.28; 53.44; 53.83; 111.06; 118.27; 118.52;
120.06; 120.16; 124.10; 124.24; 127.22; 127.25; 132.87; 132.92;
143.18; 146.46; 159.30; 161.78; 164.56;173.40. ESI-MS (m/z) 411
(100%, (M)+), 413 (M + 2)+. HRMS calcd [(M)+] 411.0720, measured
[(M)+] 411.0722, [(M + 2)+] 413.0724.
5.8. Determination of H2O2 level
ROS levels of the derivative-treated cells were analyzed through the
H2O2 content released to the media using the colorimetric OxiSelect™
H2O2 assay kit (Cell Biolabs Inc., USA). According to the manufacturer’s
suggestions, cells were seeded into 6-well plates (1 × 105 cells/well).
When confluent, cells were received IC50 concentration of the specific
compound and incubated for 48 h. Next, the medium in each well was
collected and centrifuged at 10,000 × g for 5 min at room temperature to
get rid of insoluble particles, and the supernatant obtained was regarded
5.4. Cell lines and culture conditions
MCF-7 (ATCC® HTB-22™) and MDA-MB-231 (ATCC® HTB-26™)
breast cancer cell lines were obtained from American Type Culture
Collection (ATCC, USA). Cells were cultured in Dulbecco’s Modified
Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal
bovine serum, 1% 200 mM L-glutamine, 100 U/mL penicillin, and 100
as a sample. The standards (0 – 200 μM) and the supernatant of the
samples were transferred to a 96-well plate and the working solution
comprised of 1:100 xylenol orange, 1:40 sorbitol, and 1:100 AFS reagent
was added. The plate was incubated for 30 min at room temperature, OD
values were measured at 595 nm and the hydrogen peroxide level of
each sample was determined from the standard curve.
μ
g/mL streptomycin which were all bought from Gibco (USA). Cells
were incubated at 37 ◦C in a humidified atmosphere of 5% CO2.
5.5. Cell viability assay
5.9. Measurement of the caspase 8 and 9 activity
Cytotoxic properties of seven ALM derivatives were evaluated with
SRB (Santa Cruz Biotechnology, USA) assay. MCF-7 and MDA-MB-231
cells were seeded in 96-well plates at a concentration of 5 × 103 cells/
To examine the activity of caspase 8 and 9 after the treatment of
MCF-7 and MDA-MB-231 cells with the compound-of-interest, the cells
were seeded into 6-well plates (1 × 105 cells/well) and incubated until
they reach 70% confluency. The cells were subjected to IC50 concen-
tration of the ALM derivative for 48 h and the activity levels of the
caspases were investigated by employing the ab39700 colorimetric
caspase 8 and ab65608 caspase 9 assay kits (both purchased from
Abcam, USA) according to the specifications of the kit. The protein
concentration was measured using the BCA protein assay kit (Thermo
Fischer Scientific, USA) and normalized for each sample. The caspase 8
well. When confluent, cells were exposed to 6.25–150 μM of ALM or its
analogs, which were dissolved in sub-toxic volumes of DMSO before
treatment. After 24, 48, or 72 h of incubation, cells were fixed to the
wells with 10% (w/v) trichloroacetic acid (Sigma Aldrich, USA). After
cells were washed with dH2O, 0.06% (w/v) SRB dye was applied to each
well, and incubation at room temperature for 30 min was ensured.
Following the incubation, the excess dye was removed from the wells
8

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
activity was assessed based on the principle of the enzyme cleaving its
specific substrate, the Ile-Glu-Thr-Asp (IETD)-p-nitroanilide, and cas-
pase 9 activity was determined by quantifying the ratio of the cleavage
of Leu-Glu-His-Asp (LEHD)-p-nitroanilide by the enzyme. The absor-
bance for each enzyme was measured at 400 nm and compared to the
control to evaluate the relative enzymatic activity ratio.
Acknowledgment
The authors wish to thank Hacettepe University Scientific Research
Projects Coordination Unit for financial support of this study (Project ID:
THD-2016-11528) and the Central Laboratory of Ankara University
Faculty of Pharmacy for providing the instrumental facility used in this
work.
5.10. Drug efflux assay
Appendix A. Supplementary material
The attribution of the novel compound to stimulate MDR in MCF-7
and MDA-MB-231 cells were investigated by using the Vybrant®
multidrug resistance assay kit (Thermo Fischer, ABD). Briefly, IC50
values of the compound were applied to MCF-7 and MDA-MB-231 cells
in 96-well plates (initial concentration of 5 × 103 cells/well). Following
48 h of incubation, cells were treated with calcein acetoxymethyl ester
(AM) at a final concentration to be 0.25 µM for 30 min at 37 ◦C. Calcein
AM is known to be not fluorescent yet when it penetrates the cell, it is
converted to calcein by endogen esterases which are steeply fluorescent
[63]. In this manner, the fluorescence signal will be higher if drug
resistance is low in contrast to the low signal when drug resistance is
present. The formation of the calcein was judged after measurement at
λex of 485 nm and the λem of 520 nm using FLUOstar® Omega plate
reader (BMG LabTech, Germany).
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.bioorg.2020.104403.
References
[1] Q.K. Song, X.L. Wang, X.N. Zhou, H.B. Yang, Y.C. Li, J.P. Wu, J. Ren, H.K. Lyerly,
Breast cancer challenges and screening in china: lessons from current registry data
and population screening studies, Oncologist 20 (2015) 773–779.
[2] D.L. Holliday, V. Speirs, Choosing the right cell line for breast cancer research,
Breast Cancer Res. 13 (2011) 215.
[3] J.M. Ford, W.N. Hait, Pharmacology of drugs that alter multidrug resistance in
cancer, Pharmacol. Rev. 42 (1990) 155–199.
[4] L. Zinzi, E. Capparelli, M. Cantore, M. Contino, M. Leopoldo, N.A. Colabufo, Small
and innovative molecules as new strategy to revert MDR, Front. Oncol. 4 (2014) 2.
[5] B.-W. Liu, P.-C. Huang, J.-F. Li, F.-Y. Wu, Colorimetric detection of tyrosinase
during the synthesis of kojic acid/silver nanoparticles under illumination, Sens.
Actuators, B 251 (2017) 836–841.
[6] R. Saruno, F. Kato, T. Ikeno, Kojic acid, a tyrosinase inhibitor from Aspergillus
albus, Agric. Biol. Chem. 43 (1979) 1337–1338.
[7] M. Aytemir, B. Ozcelik, I.E. Orhan, G. Karakaya, F.S. Senol, Kojic acid-derived
mannich bases with biological effect, Google Patents (2018).
5.11. Investigation of gene expression levels
[8] M.D. Aytemir, G. Karakaya, Kojic acid derivatives, D. Ekinci (Ed.), Medicinal
Chemistry and Drug Design, Intech Open, Rijeka, 2012, pp. 1-26.
Total RNA was isolated from the compound-treated cells employing
the NucleoSpin® RNA isolation kit (Macherey-Nagel, Germany). RNA
samples were used as templates for cDNA synthesis achieved with the
cDNA synthesis kit (New England BioLabs, USA). cDNA samples were
then handled to investigate expressions of TP53, Mdm2, Bax, Bcl-2
apoptotic pathway genes, Mdr-1 gene which ultimately expresses P-
gp, an important ABC transporter protein, and GAPDH as the reference
housekeeping gene. Primers for TP53 (forward: CACCATGAGCGCTGCC
TCA GATAGC, reverse: ACAGGCACAAACACGCACCTCAAA), Mdm2
(forward: AGGTCACTC CGATGAAAGGT, reverse: GTTGTCTAGTAC-
CATTAACC), Bax (forward: TTTCATCCAG GATCGAGCAG, reverse:
AAAGTAGAAAAGGGCGACAA), Bcl-2 (forward: GTGTGTG GAGA
GCGTCAACCGG, reverse: TCAAACAGAGGCCGCATGCTGG), Mdr-1
(forward: TTCAACTATCCCACCCGACCGGAC, reverse: ATGCTGCAGT-
[9] J. Chaudhary, S. Lakhawat, A.N. Pathak, Elucidation on enhanced application of
synthesised kojic acid immobilised magnetic and chitosan tri-polyphosphate
nanoparticles as antibacterial agents, IET Nanobiotechnol. 9 (2015) 375–380.
[10] J.-F. Hsieh, S.-T. Chen, S.-L. Cheng, Molecular Profiling of A375 Human Malignant
Melanoma Cells Treated with Kojic Acid and Arbutin, Y. Tanaka (Ed.)
Breakthroughs in Melanoma Research, InTech Open, 2011, pp. 533-558.
[11] S.M. Ahn, H.S. Rho, H.S. Baek, Y.H. Joo, Y.D. Hong, S.S. Shin, Y.H. Park, S.N. Park,
Inhibitory activity of novel kojic acid derivative containing trolox moiety on
melanogenesis, Bioorg. Med. Chem. Lett. 21 (2011) 7466–7469.
¨
[12] M.D. Atemir, B. Ozçelik, Synthesis and biological activities of new Mannich bases
of chlorokojic acid derivatives, Med. Chem. Res. 20 (2011) 443–452.
[13] M.D. Aytemir, B. Ozcelik, G. Karakaya, Evaluation of bioactivities of chlorokojic
acid derivatives against dermatophytes couplet with cytotoxicity, Bioorg. Med.
Chem. Lett. 23 (2013) 3646–3649.
[14] G. Karakaya, M.D. Aytemir, B. Ozcelik, U. Calis, Design, synthesis and in vivo/in
vitro screening of novel chlorokojic acid derivatives, J. Enzyme Inhib. Med. Chem.
28 (2013) 627–638.
¨
[15] G. Karakaya, A. Ercan, S. Oncül, M.D. Aytemir, Kojic acid derivatives as potential
CAAACAGGATGGGC),
and
GAPDH
(forward:
GTCGTATTG
anticancer agents: Synthesis and cytotoxic evaluation on A375 human malignant
GGCGCCTGGTCAC, reverse: GCCAGCATCGCCCCAC TTGATT) were
designed taking into account of National Center for Biotechnology In-
formation (NCBI). Gene expression levels were measured utilizing SYBR
green master mix (Thermo Fischer, USA) by Applied Biosystems ViiA™
7 (USA) device. The qRT-PCR conditions were as follows: 95 ◦C for 10
min, followed by 40 cycles of 95 ◦C for 15 sec and 60 ◦C for 1 min. The
relative alterations in the transcriptional levels of the genes between the
untreated cells and cells treated with IC50 concentration of the com-
pound were measured using the comparative Ct method (2ꢀ ΔΔCt).
melanoma cells, J. Res. Pharm. 23 (2019) 596–607.
´
¨
¨ ¨
[16] E.A. Enyedy, O. Domotor, E. Varga, T. Kiss, R. Trondl, C.G. Hartinger, B.K. Keppler,
Comparative solution equilibrium studies of anticancer gallium (III) complexes of
8-hydroxyquinoline and hydroxy (thio) pyrone ligands, J. Inorg. Biochem. 117
(2012) 189–197.
[17] K. Saatchi, K.H. Thompson, B.O. Patrick, M. Pink, V.G. Yuen, J.H. McNeill,
C. Orvig, Coordination chemistry and insulin-enhancing behavior of vanadium
complexes with maltol C6H6O3 structural isomers, Inorg. Chem. 44 (2005)
2689–2697.
[18] W. Kandioller, A. Kurzwernhart, M. Hanif, S.M. Meier, H. Henke, B.K. Keppler, C.
G. Hartinger, Pyrone derivatives and metals: From natural products to metal-based
drugs, J. Organometal Chem. 696 (2011) 999–1010.
[19] G. Karakaya, A. Ercan, S. Oncul, M.D. Aytemir, Synthesis and cytotoxic evaluation
of kojic acid derivatives with inhibitory activity on melanogenesis in human
melanoma cells, Anti-Cancer Agents Med. Chem. 18 (2018) 2137–2148.
[20] G. Karakaya, A. Türe, A. Ercan, S. Oncul, M.D. Aytemir, Synthesis, computational
molecular docking analysis and effectiveness on tyrosinase inhibition of kojic acid
derivatives, Bioorg. Chem. (2019), 102950.
5.12. Statistical analysis
All tests were conducted to be at least three replicates (n = 3). Dif-
ferences between groups were analyzed with a two-sided paired or un-
paired t-test by use of GraphPad Prism 5.3 software. Results were
considered to be statistically significant when p < 0.05.
[21] I. Ichimoto, H. Ueda, C. Tatsumi, K. Fujii, F. Sekido, S. Nonomura, Studies on kojic
acid and its related γ-pyrone compounds: Part VII. The alkylation of kojic acid and
pyromeconic acid through their mannich base (Synthesis of maltol-(1)) Part VIII.
Synthesis of comenic acid from kojic acid (Synthesis of maltol (2)), Agric. Biol.
Chem. 29 (1965) 94–103.
[22] F. Yang, S.S. Teves, C.J. Kemp, S. Henikoff, Doxorubicin, DNA torsion, and
chromatin dynamics, BBA 2014 (1845) 84–89.
Declaration of Competing Interest
[23] E.R. Hayek, E. Speakman, E. Rehmus, Acute doxorubicin cardiotoxicity, New Eng.
J. Med. 352 (2005) 2456–2457.
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
[24] S. Oncul, A. Ercan, Discrimination of the effects of doxorubicin on two different
breast cancer cell lines on account of multidrug resistance and apoptosis, Ind. J.
Pharm. Sci. 79 (2017).
9

A. Ercan et al.
Bioorganic Chemistry 105 (2020) 104403
´
´
´
[25] R. Saxena, G. Gupta, M. Manohar, U. Debnath, P. Popli, Y.S. Prabhakar, R. Konwar,
S. Kumar, A. Kumar, A. Dwivedi, Spiro-oxindole derivative 5-chloro-4’,5’-
diphenyl-3’-(4-(2-(piperidin-1-yl) ethoxy) benzoyl) spiro[indoline-3,2’-pyrrolidin]-
2-one triggers apoptosis in breast cancer cells via restoration of p53 function, Int. J.
Biochem. Cell Biol. 70 (2016) 105–117.
[44] V. Llado, D.J. Lopez, M. Ibarguren, M. Alonso, J.B. Soriano, P.V. Escriba,
X. Busquets, Regulation of the cancer cell membrane lipid composition by
NaCHOleate: Effects on cell signaling and therapeutical relevance in glioma,
Biochim. Biophys. Acta (BBA) – Biomembr. 1838 (2014) 1619–1627.
[45] N. Bernardes, A.M. Fialho, Perturbing the dynamics and organization of cell
membrane components: a new paradigm for cancer-targeted therapies, Int. J. Mol.
Sci. 19 (2018) 3871.
[26] P. Gilson, F. Josa-Prado, C. Beauvineau, D. Naud-Martin, L. Vanwonterghem,
F. Mahuteau-Betzer, A. Moreno, P. Falson, L. Lafanechere, V. Frachet, J.L. Coll,
J. Fernando Diaz, A. Hurbin, B. Busser, Identification of pyrrolopyrimidine
derivative PP-13 as a novel microtubule-destabilizing agent with promising
anticancer properties, Sci. Rep. 7 (2017) 10209.
[46] I.N. Todor, N.Y. Lukyanova, V.F. Chekhun, The lipid content of cisplatin- and
doxorubicin-resistant MCF-7 human breast cancer cells, Exp. Oncol. 34 (2012)
97–100.
¨
[27] N. Takegawa, Y. Nonagase, K. Yonesaka, K. Sakai, O. Maenishi, Y. Ogitani,
T. Tamura, K. Nishio, K. Nakagawa, J. Tsurutani, DS-8201a, a new HER2-targeting
antibody-drug conjugate incorporating a novel DNA topoisomerase I inhibitor,
overcomes HER2-positive gastric cancer T-DM1 resistance, Int. J. Cancer 141
(2017) 1682–1689.
[47] G. Varan, S. Oncül, A. Ercan, J.M. Benito, C. Ortiz Mellet, E. Bilensoy, Cholesterol-
targeted anticancer and apoptotic effects of anionic and polycationic amphiphilic
cyclodextrin nanoparticles, J. Pharm. Sci. 105 (2016) 3172–3182.
[48] Y. Li, S. Upadhyay, M. Bhuiyan, F.H. Sarkar, Induction of apoptosis in breast cancer
cells MDA-MB-231 by genistein, Oncogene 18 (1999) 3166–3172.
[49] M. Simon, F. Mesmar, L. Helguero, C. Williams, Genome-wide effects of MELK-
inhibitor in triple-negative breast cancer cells indicate context-dependent response
with p53 as a key determinant, PLoS ONE 12 (2017) e0172832.
[50] L. Hui, Y. Zheng, Y. Yan, J. Bargonetti, D.A. Foster, Mutant p53 in MDA-MB-231
breast cancer cells is stabilized by elevated phospholipase D activity and
contributes to survival signals generated by phospholipase D, Oncogene 25 (2006)
7305.
[28] A.H. Sims, A. Howell, S.J. Howell, R.B. Clarke, Origins of breast cancer subtypes
and therapeutic implications, Nat. Clin. Pract. Oncol. 4 (2007) 516–525.
[29] H. Brito, A.C. Martins, J. Lavrado, E. Mendes, A.P. Francisco, S.A. Santos, S.
A. Ohnmacht, N.S. Kim, C.M. Rodrigues, R. Moreira, S. Neidle, P.M. Borralho,
A. Paulo, Targeting KRAS oncogene in colon cancer cells with 7-carboxylate indolo
[3,2-b]quinoline tri-alkylamine derivatives, PLoS ONE 10 (2015) e0126891.
[30] H.A. Ceja-Rangel, P. Sanchez-Suarez, E. Castellanos-Juarez, R. Penaroja-Flores, D.
J. Arenas-Aranda, P. Gariglio, L. Benitez-Bribiesca, Shorter telomeres and high
telomerase activity correlate with a highly aggressive phenotype in breast cancer
cell lines, Tumour Biol. 37 (2016) 11917–11926.
[51] E. Pozo-Guisado, A. Alvarez-Barrientos, S. Mulero-Navarro, B. Santiago-Josefat, P.
M. Fernandez-Salguero, The antiproliferative activity of resveratrol results in
apoptosis in MCF-7 but not in MDA-MB-231 human breast cancer cells: cell-specific
alteration of the cell cycle, Biochem. Pharmacol. 64 (2002) 1375–1386.
[52] Y. Ibuki, M. Akaike, T. Toyooka, T. Mori, T. Nakayama, R. Goto, Hydrogen
peroxide is critical for UV-induced apoptosis inhibition, Redox Rep. 11 (2006)
53–60.
[31] H.T. Wang, T.Y. Chen, C.W. Weng, C.H. Yang, M.S. Tang, Acrolein preferentially
damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells,
Oncotarget 7 (2016) 80450–80464.
[32] R. Jakhar, S. Paul, M. Bhardwaj, S.C. Kang, Astemizole-Histamine induces Beclin-1-
independent autophagy by targeting p53-dependent crosstalk between autophagy
and apoptosis, Cancer Lett. 372 (2016) 89–100.
[53] H.U. Simon, A. Haj-Yehia, F. Levi-Schaffer, Role of reactive oxygen species (ROS)
in apoptosis induction, Apoptosis 5 (2000) 415–418.
[33] V.E. Ghouzzi, F.T. Bianchi, I. Molineris, B.C. Mounce, G.E. Berto, M. Rak, S. Lebon,
L. Aubry, C. Tocco, M. Gai, A.M. Chiotto, F. Sgro, G. Pallavicini, E. Simon-Loriere,
S. Passemard, M. Vignuzzi, P. Gressens, F. Di Cunto, ZIKA virus elicits P53
activation and genotoxic stress in human neural progenitors similar to mutations
involved in severe forms of genetic microcephaly and p53, Cell Death Dis. 7 (2016)
e2440.
[54] K. Prabhakaran, L. Li, J.L. Borowitz, G.E. Isom, Caspase inhibition switches the
mode of cell death induced by cyanide by enhancing reactive oxygen species
generation and PARP-1 activation, Toxicol. Appl. Pharmacol. 195 (2004) 194–202.
[55] M. Takahashi, M. Higuchi, H. Matsuki, M. Yoshita, T. Ohsawa, M. Oie, M. Fujii,
Stress granules inhibit apoptosis by reducing reactive oxygen species production,
Mol. Cell. Biol. 33 (2013) 815–829.
[34] B.C. Cheng, J.T. Chen, S.T. Yang, C.C. Chio, S.H. Liu, R.M. Chen, Cobalt chloride
treatment induces autophagic apoptosis in human glioma cells via a p53-dependent
pathway, Int. J. Oncol. 50 (2017) 964–974.
[56] J. Hou, A. Cui, P. Song, H. Hua, T. Luo, Y. Jiang, Reactive oxygen species-mediated
activation of the Src-epidermal growth factor receptor-Akt signaling cascade
prevents bortezomib-induced apoptosis in hepatocellular carcinoma cells, Mol.
Med. Rep. 11 (2015) 712–718.
[35] P. Subash-Babu, D.K. Li, A.A. Alshatwi, In vitro cytotoxic potential of friedelin in
human MCF-7 breast cancer cell: Regulate early expression of Cdkn2a and pRb1,
neutralize mdm2-p53 amalgamation and functional stabilization of p53, Exp.
Toxicol. Pathol. 69 (2017) 630–636.
[57] F. Khan, I. Khan, A. Farooqui, I.A. Ansari, Carvacrol induces reactive oxygen
species (ROS)-mediated apoptosis along with cell cycle arrest at G0/G1 in human
prostate cancer cells, Nutr. Cancer (2017) 1–13.
[36] L. Hauck, S. Stanley-Hasnain, A. Fung, D. Grothe, V. Rao, T.W. Mak, F. Billia,
Cardiac-specific ablation of the E3 ubiquitin ligase Mdm2 leads to oxidative stress,
broad mitochondrial deficiency and early death, PLoS ONE 12 (2017) e0189861.
[37] L.N. Zhang, J.Y. Li, W. Xu, A review of the role of Puma, Noxa and Bim in the
tumorigenesis, therapy and drug resistance of chronic lymphocytic leukemia,
Cancer Gene Ther. 20 (2013) 1–7.
[58] A. Tebbi, F. Levillayer, G. Jouvion, L. Fiette, G. Soubigou, H. Varet, N. Boudjadja,
S. Cairo, K. Hashimoto, A.M. Suzuki, P. Carninci, A. Carissimo, D. di Bernardo,
Y. Wei, Deficiency of multidrug resistance 2 contributes to cell transformation
through oxidative stress, Carcinogenesis 37 (2016) 39–48.
[59] Y.Y. Wu, J.H. Zhang, J.H. Gao, Y.S. Li, Aloe-emodin (AE) nanoparticles suppresses
proliferation and induces apoptosis in human lung squamous carcinoma via ROS
generation in vitro and in vivo, Biochem. Biophys. Res. Commun. 490 (2017)
601–607.
[38] J. Deng, How to unleash mitochondrial apoptotic blockades to kill cancers? Acta
Pharm. Sin. B 7 (2017) 18–26.
[39] J.T. Dalton, Pharmacokinetics and Metabolism in Drug Design. Methods and
Principles in Medicinal Chemistry. Volume 31. Second Revised Edition By Dennis
A. Smith, Han van de Waterbeemd, and Don K. Walker. Wiley-VCH, Weinheim,
Germany. 2006. xix + 187 pp. 17.5 × 24.5 cm. ISBN 3527313680. $125.00, J Med
Chem, 49 (2006) 7556-7557.
[60] L. Yuan, S. Wei, J. Wang, X. Liu, Isoorientin induces apoptosis and autophagy
simultaneously by reactive oxygen species (ROS)-related p53, PI3K/Akt, JNK, and
p38 signaling pathways in HepG2 cancer cells, J. Agric. Food Chem. 62 (2014)
5390–5400.
[61] M. Calvani, A. Dabraio, G. Bruno, V. De Gregorio, M. Coronnello, C. Bogani,
S. Ciullini, G. Marca, M. Vignoli, P. Chiarugi, M. Nardi, A.M. Vannucchi, L. Filippi,
C. Favre, β3-Adrenoreceptor blockade reduces hypoxic myeloid leukemic cells
survival and chemoresistance, Int. J. Mol. Sci. 21 (2020).
[40] H. Rosen, T. Abribat, The rise and rise of drug delivery, Nat. Rev. Drug Discov. 4
(2005) 381–385.
[41] X. Liu, B. Testa, A. Fahr, Lipophilicity and its relationship with passive drug
permeation, Pharm. Res. 28 (2011) 962–977.
[62] C.C. Hung, C.Y. Chen, Y.C. Wu, C.F. Huang, Y.C. Huang, Y.C. Chen, C.S. Chang,
Synthesis and biological evaluation of thiophenylbenzofuran derivatives as
potential P-glycoprotein inhibitors, Eur. J. Med. Chem. 201 (2020), 112422.
[63] F.L. Miles, J.E. Lynch, R.A. Sikes, Cell-based assays using calcein acetoxymethyl
ester show variation in fluorescence with treatment conditions, J. Biol. Methods 2
(2015) e29.
[42] E. Milanetti, D. Raimondo, A. Tramontano, Prediction of the permeability of
neutral drugs inferred from their solvation properties, Bioinformatics 32 (2016)
1163–1169.
[43] Y.C. Li, M.J. Park, S.-K. Ye, C.-W. Kim, Y.-N. Kim, Elevated levels of cholesterol-
rich lipid rafts in cancer cells are correlated with apoptosis sensitivity induced by
cholesterol-depleting agents, Am. J. Pathol. 168 (2006) 1107–1118.
10