Graphene oxide enhanced specificity at aptamer and its application to multiplexed enzymatic activity sensing

Article abstract of DOI:10.1039/c5ra25481g

We explore the effect of sufficient GO on the property of a dye labeled adenosine 5′-triphosphate (ATP) aptamer (P) which shows similar affinity and specificity for ATP and its analogues including adenosine 5′-diphosphate (ADP), adenosine 5′-monophosphate (AMP), and adenosine (AD). It is found that ATP and its analogues give rise to fluorescence recovery of GO-quenched P to a different extent (in the order of ATP > AD > ADP > AMP), and the difference becomes larger when increasing the concentration of GO in a certain range, implying an improvement of specificity of the ATP aptamer. Based on this finding, a fluorescence turn-on assay for alkaline phosphatase (ALP) and creatine kinase (CK) is proposed, by using AMP and ADP as the substrate, respectively. Specifically, the GO-quenched P system containing substrate shows low fluorescence intensity. In the presence of target enzyme, the substrate is converted into either AD or ATP which have higher affinity with P, resulting in stronger fluorescence of the mixture of P and GO. The entire assay is sensitive and selective. More importantly, the ability of GO with suitable concentration to improve the specificity of aptamers not only offers an exciting new way to detect protease, but also is valuable for developing the application of GO and aptamers in the biosensing field and is expected to be used in aptamer screening systems, to improve the specificity of screened aptamers.

Full text of DOI:10.1039/c5ra25481g

View Article Online
View Journal
RSC Advances
This article can be cited before page numbers have been issued, to do this please use: X. Xing, X. Liu, Y.
Zhou, D. Xu, D. Pang and H. Tang, RSC Adv., 2016, DOI: 10.1039/C5RA25481G.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. This Accepted Manuscript will be replaced by the edited,
formatted and paginated article as soon as this is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/advances

Please do not adjust margins
RSC Advances
Page 1 of 8
View Article Online
DOI: 10.1039/C5RA25481G
Journal Name
ARTICLE
Graphene oxide enhanced specificity at aptamer and its
application to multiplexed enzymatic activity sensing
Xiaojing Xing,ab Xueguo Liu,c Ying Zhou,a Dangdang Xu,a Daiwen Panga and Hongwu Tanga*
Received 00th January 20xx,
Accepted 00th January 20xx
We explore the effect of sufficient GO on the property of dye labeled adenosine 5´ꢀtriphosphate (ATP) aptamer (P) which
shows similar affinity and specificity for ATP and its analogues including adenosine 5´ꢀdiphosphate (ADP), adenosine 5´ꢀ
monophosphate (AMP), and adenosine (AD). It is found that ATP and its analogues give rise to fluorescence recovery of
GOꢀquenched P to a different extent (in the order of ATP>AD>ADP>AMP), and the difference becomes larger when
increasing the concentration of GO in a certain range, implying the improvement of specificity of ATP aptamer. Based on
this finding, a fluorescence turnꢀon assay for alkaline phosphatase (ALP) and creatine kinase (CK) is proposed, by using
AMP and ADP as the substrate, respectively. Specifically, the GOꢀquenched P system containing substrate shows low
fluorescence intensity. In the existence of target enzyme, the substrate is converted into either AD or ATP which have
higher affinity with P, resulting in stronger fluorescence of the mixture of P and GO. The entire assay is sensitive and
selective. More importantly, the ability of GO with suitable conentration improving the specificity of the aptamers not only
offers an exciting new way to detect protease, but also is valuable for developing the application of GO and aptamer in
biosensing field and is expected to be used in aptamer screening system, to improve the specificity of screened aptamers.
DOI: 10.1039/x0xx00000x
www.rsc.org/
small molecules sensing.12ꢀ14 Furthermore, GO was reported to
possess the enzymatic cleavage protection effect on DNA. For
example, Lin’s group15 reported that ssDNA absorbed on GO
1 Introduction
Graphene oxide (GO), an atomic sheet of graphite decorated by
several oxygenated functional groups on its basal planes
(phenol hydroxyl and epoxide groups) and at its edges
(carboxylic acid),1 has attracted increasing interest in biological
applications owing to its unique characteristics including good
waterꢀsolubility,2 versatile surface modification and superior
fluorescence quenching ability.3 It has been reported that GO
can quench and bind with dyeꢀlabelled singleꢀstranded DNA
(ssDNA) via hydrophobic and πꢀstacking interactions between
the nucleobases and GO, while it has less affinity toward
doubleꢀstranded DNA (dsDNA) or secondary and tertiary
structured ssDNA. Therefore, GO has been employed to
develop sensing systems for detection of DNA,4ꢀ6 proteins,7
enzyme activity8 and other small molecules.9 Later, Zhang’s
group10 and Liu’s group11 reported that ssDNA containing a
different number of bases in length also exhibit different
affinity to GO and proved that short ssDNA exhibit weaker
affinity to GO than that of long ssDNA. These phenomena have
been widely utilized in various strategies for biomolecules and
surfaces can be effectively protected from enzymatic cleavage
by DNase I. Zhang’s group16 and Li’s group17 found that in the
presence of sufficient GO, dsDNA can also be adsorbed and
exhibit enhanced resistance to several types of nucleases. The
excellent protective property of GO against DNA nuclease
digestion has, thus, further extended the applications of DNA
probes both in vivo and in vitro.12,18 However, until recently,
there have been no studies exploring the effects of sufficient
GO on the property of ssDNA, which is necessary to
understand the behaviour of DNA–GO complex and apply GO
in developing novel biomedical and bioassay platforms.
Aptamers are originated from random sequence DNA or
RNA libraries by SELEX (systematic evolution of ligands by
exponential enrichment)19,20 and possess the ability to form
defined threeꢀdimensional structure for specific target
binding.21 Aptamers have received tremendous attention in
biosensing applications in recent years, because of their
unprecedented advantages such as simple synthesis, easy
labeling, longꢀterm stability and excellent target recognition
properties.22 However, for some aptamers, their ability to bind
specifically to their targets is not satisfactory, such as adenosine
5´ꢀtriphosphate (ATP) aptamer. Huizenga and Szostak23
reported that ATP aptamer also shows similar affinity and
specificity for adenosine 5´ꢀmonophosphate (AMP) and
adenosine (AD). Moreover, Li’s group24 found that the
structureꢀswitching ATP reporter registered almost similar
signaling magnitude after incubating adenosine 5´ꢀdiphosphate
a.Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of
Education), College of Chemistry and Molecular Sciences, Wuhan Institute of
Biotechnology, Wuhan University, Wuhan 430072, China. E-mail:
hwtang@whu.edu.cn; Fax: +86 27 68754067; Tel: +86 27 68756759
b.College of Chemistry and Pharmaceutical Engineering, Nanyang Normal
University, Nanyang 473061, China.
c. Department of Biology and Chemical Engineering, Nanyang Institute of
Technology, Nanyang 473004, China.
† Electronic Supplementary Information (ESI) available: other supplementary data
as noted in text. See DOI: 10.1039/x0xx00000x
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 2 of 8
View Article Online
DOI: 10.1039/C5RA25481G
ARTICLE
Journal Name
(ADP) or AD at the same concentration levels, and substantial the sample at 480 nm and measuring the emission at 520 nm.
fluorescence intensity increase was still obtained for the same The slits for excitation and emission were set at 5 nm and 10
concentrations of ATP and AMP (10ꢀfold vs 13ꢀfold for 1 mM nm respectively.
ATP). This less ability to distinguish ATP from its analogues 2.3 Effect of GO concentration on fluorescence recovery by ATP
may be owing to the fact that functional groups on both the or its analogues
base and the sugar of ATP are involved in the ligand/aptamer
Different concentrations of GO were added to 20 µL of 1.0 µM
interaction, and negatively charged triphosphate does not
P solution and incubated for 10 min with gentle shake at room
temperature. Then 500 µM of ATP or its analogues were
respectively added to the above P/GO mixture and incubated
interact with aptamer.23
In this work, we investigate the interaction between the ATP
aptamer and different concentrations of GO. Surprisingly, for
for 60 min with gentle shake at room temperature. Finally, the
the first time we found that the addition of ATP and its
fluorescence intensity was measured at 520 nm with excitation
analogues individually into the mixture containing dye labeled
at 480 nm.
ATP aptamer (P) and GO gave rise to fluorescence recovery to
2.4 Procedure of structure-switching based ATP detection
a different extent (in the order of ATP>AD>ADP>AMP), and
the difference became larger when increasing the concentration
1.0 µM QDNA was firstly incubated for 30 min with gentle
of GO in a certain range. These observations led us speculate
that the specificity of ATP aptamers is improved in the
ATP or its analogues was added into above mixture, and
presence of rational GO. On the basis of this finding, we also
propose an effective way to design robust GOꢀbased biosensors
fluorescence emission spectra were recorded at 520 nm with
for the fluorescent assay of multiplexed protease, which can
A solution containing 20 µL of 1.0 µM FDNA and 20 µL of
shake at room temperature. Then different concentrations of
incubated for 30 min at room temperature. Finally, the
excitation at 480 nm.
2.5 ALP and CK detection
remove the negatively charged phosphate group from the
substrate, or add the negatively charged phosphate group to the
substrate. The entire assay is sensitive and selective, and more In ALP detection experiment, the P/GO complex solution was
importantly, the ability of excessive GO to improve the prepared by adding 20 µL of 1.0 µM P to 40 µL of 500 µg/mL
specificity of the aptamers not only offers an exciting new GO solution and incubating for 10 min at room temperature.
approach to detect protease, but also is valuable for developing Then, the fixed concentration of AMP (500 µM) was treated
the application of GO and aptamer for biosensing.
with different concentrations of ALP in ALP reaction buffer
and was shaken gently 20 min at 37ºC. After that, the solutions
were added to P/GO complex and then incubated 60 min with
gentle shake at room temperature. Finally, the fluorescence
intensity was measured at 520 nm with excitation at 480 nm.
Similar process was applied for CK detection.
2 Experimental
2.1 Materials and reagents
Graphite oxide was synthesized from natural graphitic powder
according to Hummer’s method and our previous report.25,26
Creatine kinase (CK), creatine phosphate (CrP), αꢀthrombin
(Thr), ADP, and AMP were purchased from SigmaꢀAldrich, Inc.
(St. Louis, MO, USA). ATP was purchased from Biosharp Co.,
Ltd. (USA). Adenosine was purchased from Amresco Co., Ltd.
3 Results and discussion
3.1 Effect of GO concentration on the fluorescence recovery
by ATP or its analogues.
(USA). Alkaline phosphatase (ALP), lysozyme (Lys), adenylate To investigate the effect of GO concentration on the
kinase (ADK) and the oligonucleotides were purchased from fluorescence recovery of P/GO complex solution by ATP or its
Sangon Biological Engineering Technology and Services Co., analogues, GO was synthesized. Then, the fluorescence
Ltd. (Shanghai, China). The sequences of the nucleic acids used intensity of P was measured at different concentrations of GO
in the study are as follows:
in the absence and presence of ATP and its analogues with the
same concentration, respectively. As shown in Fig. 1A, upon
increasing the concentration of GO, a noticeable decrease in the
fluorescence intensity of P is observed, and over 97.26 %
fluorescence is quenched in the presence of 20.0 µg/mL GO in
P: 5'ꢀFAMꢀACCTGGGGGAGTATTGCGGAGGAAGGTꢀ3'
FDNA: 5'ꢀCCCAGGTCAGTGꢀFAMꢀ3'
QDNA:5'ꢀBHQꢀTCACTGACCTGGGGGAGTATTGCGGꢀ
AGGAAGGTꢀ3'
MilliꢀQ126 purified water was used for the preparation of all less than 10 min (curve a, Fig. S1), resulting from the strong
aqueous solutions. The buffer solutions used in this work are as binding of P with GO and the high quenching ability of GO.
follows: ALP buffer consisted of 50 mM TrisꢀHCl (pH 9.0) and However, the fluorescence recovery efficiency of GOꢀquenched
1 mM MgCl2, and TrisꢀHCl buffer used in this experiment P (F/F0, where F0 and F are the fluorescence intensities in the
consisted of 20 mM Tris (pH 7.4) and 100 mM NaCl.
2.2 Apparatus
absence and presence of ATP, ADP, AMP or AD with the same
concentration) by ADP, AMP or AD is very close to that of
ATP at this concentration (Fig. S2), which suggests that ATP
aptamer adsorbed on GO surface still cannot effectively
distinguish ATP from its analogues under this concentration,
which are consistent with the affinity profiles observed by
A Fꢀ4600 fluorescence spectrophotometer (Hitachi, Tokyo,
Japan) was used to record the fluorescence spectra and measure
the fluorescence intensity. The sample cell was a 700 µL quartz
cuvette. The luminescence intensity was monitored by exciting
2 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 3 of 8
View Article Online
DOI: 10.1039/C5RA25481G
Journal Name
ARTICLE
Huizenga et al.22 By increasing the concentration of GO, we to the formation of the duplex structure and associated
found that the difference of fluorescence recovery efficiency by fluorescence quenching. Adding the target into the above
ATP, ADP, AMP or AD gradually increases, and the largest mixture will trigger the release of the QDNA, which should
distinction (FATP/FAnalogue, where FATP is the fluorescence result in a turnꢀon fluorescent signal. Fig. S3BꢀS3D show the
intensities in the presence of ATP, and FAnalogue is the fluorescence spectra of the above detection system in the
fluorescence intensities in the presence of ADP, AMP or AD) is presence of different concentrations of ATP, ADP, AMP and
obtained at [GO]
= 40.0 µg/mL (Fig. 1B). When the AD, respectively, and the corresponding data is listed in Table
concentration of GO is higher than 40.0 µg/mL, the difference 1. It distinctly indicates that both ATP and its analogues at the
decreases with a further increasing concentration of GO, which same concentration can produce a considerable fluorescent
might be ascribed to the strong binding of P with GO at a high signal, indirectly implying the specificity of ATP aptamer does
concentration decreasing the probability and tendency of the increase in the presence of GO.
binding between
P and ATP or its analogues. These
Table 1 Fluorescence intensities at different concentrations of ATP or
observations reveal that the specificity of the aptamers is
influenced by GO and it can be improved by the addition of
suitable GO. This feature may be due to the conformational
change of the aptamers upon their binding to GO.
its analogues.
[ATP or its
FATP
FADP
FAMP
FAD
analogues]
0
191.99
254.90
292.22
358.32
430.47
523.25
559.26
660.16
731.36
182.64
259.68
291.30
437.02
467.23
554.73
561.32
564.25
718.30
191.99
218.62
333.12
352.06
387.62
396.56
438.79
489.95
593.90
182.64
216.11
336.56
474.68
526.11
611.20
685.73
711.74
717.35
0.05
0.1
0.2
0.3
0.4
0.5
0.7
1.0
A
2500
Blank
Adding ATP
Adding ADP
Adding AMP
2000
Adding AD
1500
1000
500
0
The concentration unit of ATP or its analogues is mM
.
3.2 Assay of ALP activity
Taking advantage of the enhanced specificity derived from the
addition of aptamer into appropriate GO solution, we proposed
a simple and effective strategy to design GOꢀbased biosensors
for sensitive and selective protease assay. As a proofꢀofꢀ
concept, we first designed a GOꢀbased aptasensor for the
detection of ALP using AMP as the substrate. ALP is an
important enzyme of clinical chemistry and analytical
chemistry and it is also one of a common marker enzyme in
enzyme immunoassay.27 It exists at various levels in human
organs, more in the liver and bones, and less in placenta,
intestines and kidneys.28,29 Recent studies have shown that
underꢀexpressed levels of serum ALP is a rare form of rickets,
and overexpressed levels of serum ALP are commonly
correlated to several diseases of liver and bone, including
Paget's disease (inflammation of the bone), osteomalacia
(softening of the bone), hepatitis and obstructive jaundice.30
Therefore, it is necessary to develop a simple, rapid, and
sensitive method for ALP assay.
0
10
20
30
40
50
60
[GO]
µ
g/mL
B
7
6
5
4
3
2
1
FATP/FADP
FATP/FAMP
FATP/FAD
0
10
20
30
40
50
60
[GO] (µg/mL)
Fig.1 (A) Effect of GO concentration on the fluorescence intensity of P
without and with ATP or its analogues. (B) Relative fluorescence intensity
Scheme 1 illustrates the principle of this strategy, which
depends on the different fluorescence recovery efficiency of
P/GO complex by AD and AMP. Specifically, the mixture of P
and GO shows weak fluorescence owing to the strong binding
of GO with P via the π–π stacking attraction and super
fluorescence quenching ability of GO. Upon the addition of the
substrateꢀAMP, the mixture of P/GO maintains its fluorescent
“off” state, resulting from the less affinity of AMP to P
adsorbed on GO surface. Addition of ALP to AMP solution, the
dephosphoryꢀlation reaction producing AD occurs, and the
quenched fluorescence of P by GO is recovered resulting from
between FATP and its analogues versus concentration of GO. FATP/FAnalogue
,
where FATP is the fluorescence intensities in the presence of ATP, and FAnalogue
is the fluorescence intensities in the presence of ADP, AMP or AD. [P] = 40
nM; [ATP] = [ADP] = [AMP] = [AD] = 500 µM.
To demonstrate this phenomenon, a structureꢀswitching
based strategy for ATP detection is constructed according to
Liʼs report,24 and the principle is shown in Fig. S3A. Without
the target, the aptamer labeled with a fluorophore (FDNA)
hybridizes with its complementary oligonucleotide with a
quencher (QDNA), and a low fluorescent state is obtained due
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 4 of 8
View Article Online
DOI: 10.1039/C5RA25481G
ARTICLE
Journal Name
the higher recovery efficiency by AD (Fig. 1A). Thus, ALP above results, 500 µM AMP and 60 min were used in the
activity is signaled by the fluorescence switching from the “off” following experiment.
state to the “on” state.
A
720
600
480
360
240
120
0
Adding AD
Adding AMP
0.0
0.2
0.4
0.6
0.8
1.0
[AD] or [AMP] (mM)
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
B
Scheme 1 (A) Enzymatic reaction with ALP. (B) Schematic illustration of
fluorescent assay of ALP based on the different fluorescence recovery
efficiency of P/GO complex by AD and AMP.
To prove the feasibility of the proposed method, the
fluorescence intensity of the assay system under different
conditions were measured. As shown in Fig. S4, the initial
fluorescence from P (curve a) is greatly quenched to 2.9 % in
the presence of 40 µg/mL GO (curve b), resulting from the
strong binding of P with GO and the high quenching ability of
GO. After the introduction of 500 µM AMP, slight signal was
observed (curve c), while obvious enhancement is obtained for
the addition of AD (curve d), indicating that P adsorbed on GO
surface shows more affinity for AD than that of AMP. When
AMP is firstly incubated with ALP, a strong signal occurs upon
the addition of P/GO complex (curve d). The enhanced
fluorescence is due to the formation of AD, which is directly
related to the fluorescence intensity change of P/GO complex in
this system. These observations confirm that this GOꢀbased
platform can be used for the assay of ALP.
In an attempt to obtain an optimal assay condition, the
concentration of AMP and the reaction time between AD and
P/GO complex were investigated. The concentration of AMP is
an important aspect involved in the detection system. Lower
concentration of AMP could result in a low background but
may decrease the response range of the measurement. However,
higher background signal is present at higher concentration, and
decreasing the sensitivity (Fig. 2A). Fig. 2A illustrates the
fluorescence recovery of P/GO complex as a function of the
concentration of AD or AMP. We can see that with the
increasing of the concentration, AD gives rise to a higher
recovery compared with that of AMP in the same concentration
range. The best FAD/FAMP (where FAD and FAMP are the
fluorescence intensities in the presence of AD and AMP,
respectively) is acquired when 500 µM AMP is added (Fig. 2B).
The kinetic behavior of P/GO complex in the presence of AD
reveals that at least 60 min is needed for the reaction between
P/GO complex and AD (curve b, Fig. S1). According to the
0.0
0.2
0.4
0.6
0.8
1.0
[AD] or [AMP] (mM)
Fig. 2 (A) Comparison of fluorescence intensity increase of P/GO complex
upon addition of AD or AMP, respectively. (B) Relative fluorescence
intensity in the presence of AD or AMP as
concentrations. [P] = 40 nM, [GO] = 40 µg/mL.
a function of different
On the basis of the above standard procedures and optimized
assay conditions, the fluorescence intensities under different
ALP concentrations were measured. As shown in Fig. 3A, in
the absence of ALP, the system generates very weak
background signal, indicating the fluorescence of P is still
efficiently quenched by GO in the presence of 500 µM AMP.
With the addition of ALP, enhanced fluorescence intensity is
observed, and the enhanced extent increases with the increase
of ALP concentration, because a high concentration of ALP
will convert a large quantity of AMP to AD, leading the
increase of AD concentration which is directly related to the
fluorescence intensity change of GOꢀquenched P. Fig. 3B
depicts the linear relationship between the fluorescence
intensity and the concentration of ALP in the range of 4.5ꢀ21.0
U/L. The linear regression equation for ALP is
93.24, with the correlation coefficient of 0.9894. The limit of
detection (LOD) based on the 3 calculation ( is the standard
deviation for the blank solution, and is the slop of the
calibration curve), is 2.17 U/L, an improved sensitivity
compared to the reported colorimetric,31,32 fluorescent33ꢀ35 and
electrochemical36,37 sensors.
y = 3.56 x +
σ
/
S
σ
S
4 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 5 of 8
View Article Online
DOI: 10.1039/C5RA25481G
Journal Name
ARTICLE
To evaluate the specificity property of the detection method,
a control experiment using Lys, ADK and Thr, none of which
has a specific dephosphorylation reaction with AMP, were
respectively tested with the procedures of ALP assay at the
same concentration (30.0 U/L). The results are shown in Fig. 4.
It is found that only ALP caused a dramatic fluorescence
enhancement, and there is almost no change in the fluorescence
intensity for other proteins compared with that of the blank
solution. These results clearly indicate that the proposed
strategy has good selectivity for ALP detection.
A 245
45.0 U/L
30.0 U/L
22.5 U/L
21.0 U/L
15.0 U/L
13.5 U/L
10.5 U/L
7.5 U/L
4.5 U/L
0 U/L
210
175
140
105
70
35
0
In order to evaluate the applicability of the sensing system,
we conducted analyses of ALP in human serum, a kind of fluid
sample with complicated biological matrix. The interaction
between P and different concentrations of GO without and with
AD or AMP in serum was firstly examined as outlined above.
As can be seen from Fig. S6, different fluorescence response of
GOꢀquenched P by AD or AMP is still obtained in this case,
and the best difference is obtained at [GO] = 50 µg/mL. The
detection process of ALP in 2% human serum is the same as in
the clean buffer, and the corresponding fluorescence spectrum
is shown in Fig. S7. As can be seen from it, a good linear
relationship between the fluorescence intensity and the
concentration of ALP is still obtained, indicating the potential
of this method for applications in complicated real samples.
3.3 Assay of CK activity
500
525
550
575
600
625
650
Wavelength (nm)
B 180
165
y = 3.56 x + 93.24
R = 0.9894
150
135
120
105
90
0
5
10
[ALP] (U/L)
15
20
25
Creatine kinase (CK), an important kinase, plays a key role in
muscle contraction, cellular energy transport.38 It catalyzes the
reversible transphosphorylation of creatine by ATP (Scheme
2A), thereby maintaining energy balance. Many investigations
have pointed up the usefulness of this enzymatic test in the
diagnosis of skeletal muscle and myocardium.39,40 Several CK
assays have been developed based on spectrophotometry,
bioluminescence,41 and chromatographic separation,42 among
which the chromatographic separation has higher sensitivity
and better reproducibility. It is costly and in need of
complicated operation, and therefore it is not widely used.
Fig. 3 (A) Fluorescence spectra of P/GO complex at different concentrations
of ALP. (B) Linear relationship between the fluorescence intensity and ALP
concentrations.
To eliminate the possibility that the enhancement
fluorescence results from the nonspecific adsorption between
ALP and GO, the fluorescent response of P/GO complex in the
presence of the inactive ALP heated at 65 °C for 10 min was
also investigated. As can be seen from Fig. S5, only slight
fluorescence change is obtained even at higher concentration of
inactive ALP. These results reveal that the enhanced
fluorescence with active ALP is attributed to the
dephosphorylation reaction generating AD, which has higher
affinity with P compared with AMP.
180
150
120
90
60
Scheme 2 (A) Enzymatic reactions with CK; (B) Schematic illustration of
fluorescent ALP assay based on the different fluorescence recovery
efficiency of P/GO complex by ADP and ATP.
30
0
ALP
ADK
Lys
Thr
Blank
Based on the different fluorescence recovery efficiency of
GOꢀquenched P by ATP and ADP, we herein establish a
fluorescent sensor for CK activity using ADP as the substrate.
Fig. 4 Fluorescence intensity of P/GO complex in the presence of ALP,
ADK, Lys and Thr, respectively.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 6 of 8
View Article Online
DOI: 10.1039/C5RA25481G
ARTICLE
Journal Name
The basic principle is shown in Scheme 2B. In the absence of were applied to the determination of ALP and CK in human
CK, the addition of ADP having less affinity with P is adsorbed serum with satisfactory results, which suggests that these
on GO surface, results in less fluorescenceꢀsignal change of the methods have great potential for diagnostic purpose. The
P/GO complex. Oppositely, when the ADP is phosphorylated finding that GO enhances specificity of ATP aptamer not only
by CK, the yielded ATP shows strong interaction with P and P is valuable for developing the application of GO and aptamer in
is released from GO surface. As a result, the system displays biosensor field, but also has potential in aptamer screening
strong fluorescence signal. By monitoring the change of the system to improve the specificity of screening aptamers.
fluorescence signal, CK activity detection could be easily However, having studied only one aptamer, there is not enough
realized.
experimental evidence for us to make a general conclusion that
Under the optimized conditions, the assay shows a good GO could enhance the specificity of all aptamers. More
linear relationship with a calibration equation
y
= 11.37
x
+
aptamers would be examined in future experiments.
101.20 (R = 0.9703) (Fig. 5A and 5B), and has the calculated
detection limit of 0.73 U/L, which is superior to the methods
based on highꢀperformance liquid chromatography42 and
capillary electrophoresis.43 Compared with the traditional
method, this method still possesses other advantages, such as
simple, fast, lowꢀcost, as well as no require of expensive
equipment. Moreover, a satisfactory result was also obtained by
testing 2% human serum containing a series of concentrations
of CK (Fig. 5C and 5D), demonstrating the reliability of this
sensor for detecting CK in real samples.
Acknowledgements
We gratefully acknowledge the support of the National Natural
Science Foundation of China (21275110, 81572086,
21505080), the Fundamental Research Funds for the Central
Universities (2042014kf0246), and the Financial support from
the Foundation of He’nan Educational Committee
(15A150066).
400
B 400
A
350
300
250
200
150
100
50
Notes and references
30.0 U/L
21.0 U/L
15.0 U/L
9.0 U/L
3.0 U/L
0 U/L
y = 11.37 x + 101.20
R = 0.9703
350
300
250
200
150
100
1
A. K. Geim and K. S. Novoselov, Nat. Mater., 2007, 6,
183−191.
2
Z. Liu, J. T. Robinson, X. M. Sun and H. J. Dai, J. Am. Chem.
Soc., 2008, 130, 10876–10877.
3
4
N. Mohanty and V. Berry, Nano Lett., 2008, 8, 4469–4476.
H. F. Dong, W. C. Gao, F. Yan, H. X. Ji and H. X. Ju, Anal.
Chem., 2010, 82, 5511–5517.
0
500
525
550
575
600
625
650
0
5
10
15
20
25
Wavelength (nm)
[CK] (U/mL)
640
560
480
400
320
240
160
80
5
S. J. He, B. Song, D. Li, C. F. Zhu, W. P. Qi, Y. Q. Wen, L.
H. Wang, S. P. Song, H. P. Fang and C. H. Fan, Adv. Funct.
Mater., 2010, 20, 453–459.
C. H. Lu, H. H. Yang, C. L. Zhu, X. Chen and G. N. Chen,
Angew. Chem. Int. Ed., 2009, 48, 4785–4787.
H. X. Chang, L. H. Tang, Y. Wang, J. H. Jiang and J. H. Li,
Anal. Chem., 2010, 82, 2341–2346.
H. Jang, Y. K. Kim, H. M. Kwon, W. S. Yeo, D. E. Kim and
D. H. Min, Angew. Chem. Int. Ed., 2010, 49, 5703–5707.
C. H. Lu, J. A. Li, M. H. Lin, Y. W. Wang, H. H. Yang, X.
Chen and G. N. Chen, Angew. Chem. Int. Ed., 2010, 49,
8454–8457.
C
D650
y =4.77 x + 317.58
R = 0.9820
600
550
500
450
400
350
300
60.0 U/L
45.0 U/L
21.0 U/L
15.0 U/L
9.0 U/L
3.0 U/L
0 U/L
6
7
8
9
0
500
520
540
560
580
600
620
640
0
10
20
30
40
50
60
Wavelength (nm)
[CK] (U/L)
Fig. 5 (A) Fluorescence spectra of P/GO complex at different concentrations
of CK. (B) Linear relationship between fluorescence intensity and CK
concentrations. (C) Fluorescence spectra of P/GO complex in the presence of
different concentrations of CK in 2% human serum. (D) Linear relationship
between fluorescence intensity and CK concentrations in 2% human serum.
10 X. H. Zhao, R. M. Kong, X. B. Zhang, H. M. Meng, W. N.
Liu, W. H. Tan, G. L.Shen and R. Q. Yu, Anal. Chem., 2011,
83, 5062–5066.
11 P. J. J. Huang and J.W. Liu, Small, 2012, 8, 977–983.
12 C. H. Lu, J. Li, M. H. Lin, Y. W. Wang, H. H. Yang, X. Chen
and G. N. Chen, Angew. Chem. Int. Ed. 2010, 49, 8454ꢀ8457.
13 D. Feng, Y. Zhang, T. Feng, W. Shi, X. Li and H. Ma, Chem
Commun., 2011, 47, 10680ꢀ10682.
4 Conclusions
In summary, we explore the fluorescence recovery of GOꢀ
quenched ATP aptamer by ATP and its analogues (ADP, AMP
and AD). At the same concentration level, the recovery
efficiency increases in the order of ATP>AD>ADP>AMP, and
the difference became larger by increasing the concentration of
GO in a certain range, suggesting the improvement of
specificity for ATP aptamers. Taking advantage of the different
fluorescence recovery, a fluorescence turnꢀon assay for ALP
and CK is proposed, using AMP and ADP as the substrate,
respectively. Under the optimal conditions, ALP and CK could
be detected specifically and sensitively with a limit of 2.17 U/L
and 0.73 U/L, respectively. Meanwhile, the proposed sensors
14 X. Q. Liu, R. Aizen, R. Freeman, O, Yehezkeli, I. Willner,
ACS Nano., 2012, 6, 3553ꢀ3563.
15 Z. Tang, H. Wu, J. R. Cort, G. W. Buchko, Y. Zhang, Y.
Shao, I. A. Aksay, J. Liu and Y. Lin, Small, 2010, 6,
1205−1209.
16 H. Lei, L. Mi, X. Zhou, J. Chen, J. Hu, S. Guo and Y. Zhang,
Nanoscale, 2011, 3, 3888−3892.
17 L. Tang, H. Chang, Y. Liu and J. Li, Adv. Funct. Mater.,
2012, 22, 3083−3088.
18 Y. Wang, Z. Li, D. Hu, C. T. Lin, J. Li and Y. Lin, J. Am.
Chem. Soc,. 2010, 132, 9274−9276.
19 A. D. Ellington and J. W. Szostak, Nature, 1990, 346, 818–
822.
6 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
RSC Advances
Page 7 of 8
View Article Online
DOI: 10.1039/C5RA25481G
Journal Name
ARTICLE
20 S. E. Osborne and A. D. Ellington, Chem. Rev., 1997, 97,
349–370.
21 M. Famulok, G. Mayer and M. Blind, Accounts. Chem. Res.
2000, 33, 591–599.
22 I. German, D. D. Buchanan, and R. T Kennedy, Anal. Chem.,
1998, 70, 4540–4545.
23 [22] D. E. Huizenga and J. W. Szostak, Biochemistry, 1995,
34, 656ꢀ665.
24 R. Nutiu and Y. F. Li, J. Am. Chem. Soc., 2003, 125, 4771ꢀ
4778.
25 W. S. Hummers, R. E. Offeman, J. Am. Chem. Soc., 1958, 80,
1339–1339.
26 X. J. Xing, X. G. Liu, Y. He. Q. Y. Luo, H. W. Tang and D.
W. Pang, Biosens. Bioelectron., 2012, 37, 61ꢀ67.
27 I. Bronstein, C. S. Martin, J. J. Fortin, E. M. Olesen, Olesen
and C. V. John, Clin. Chem., 1996, 42, 1542–1546.
28 R. E. Gyurcsanyi, A. Bereczki, G. Nagy, M. R. Neuman and
E. Lindner, Analyst, 2002, 127, 235–240.
29 S. K. Hartwell, D. Somprayoon, P. Kongtawelert, S. W
Ongchai, O. Arppornchayanon, L. Ganranoo, S.
Lapanantnoppakhun and K. Grudpan, Anal.Chim. Acta., 2007,
600,188–193.
30 R. E. Gyurcsanyi, A. Bereczki, G. Nagy, M. R. Neuman and
E. Lindner, Analyst, 2002, 127, 235ꢀ240.
31 C. M. Li, S. J. Zhen, J. Wang, Y. F. Li and C. Z. Huang,
Biosens. Bioelectron., 2013, 43, 366ꢀ371.
32 H. Wei, C. G. Chen, B. Y. Han and E. K. Wang, Anal. Chem.,
2008, 80, 7051ꢀ7055.
33 Y. Liu and K. S. Schanze, Anal. Chem., 2008, 80, 8605ꢀ8612.
34 Z. W. Zhao, W. P. Zhu, Z. Li, J. H. Jiang, G. L. Shen and R.
Q. Yu, Anal. Sci., 2012, 28, 881ꢀ886.
35 R. Freeman, T. Finder, R. Gill, I. Willner. Nano Lett., 2010,
10, 2192ꢀ2196.
36 P. Miao, L. M. Ning, X. X. Li, Y. Q. Shu and G. X. Li,
Biosens. Bioelectron., 2011, 27, 178ꢀ182.
37 H. Jiang and X. M. Wang, Anal. Chem., 2012, 84, 6986ꢀ6993
38 V. A. Saks, A. V. Kuznetsov, V. V. Kupriyanov, M. V.
Miceli and W. E. Jacobus, J. Biol. Chem., 1985, 260, 7757ꢀ
7764.
39 A. S. Jaffe, H. Serota, A. Grace and B. E. Sobel, Circulation
,
1986, 74, 105ꢀ109.
40 H. Somer, M. Kaste, H. Troupp and A. Konttinen, J. Neurol.
Neuro. Ps., 1975, 38, 572ꢀ576.
41 M. Deluca and W. D. Mcelroy, Biochemistry, 1974, 13, 921ꢀ
925.
42 N. D. Danielson and J. A. Huth, J. Chromatogr., 1980, 221,
39ꢀ48.
43 J. M. Fujima and N. D. Danielson, Anal. Chim. Acta, 1998,
375, 233ꢀ241.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 7
Please do not adjust margins

RSC Advances
Page 8 of 8
View Article Online
DOI: 10.1039/C5RA25481G
Graphical Abstract
Based on the finding that sufficient GO could enhance the specificity of ATP aptamer,
we proposed a fluorescence assay for alkaline phosphatase and creatine kinase.