Mechanistic studies of 1-aminocyclopropane-1-carboxylate deaminase: Characterization of an unusual pyridoxal 5′-phosphate-dependent reaction

Article abstract of DOI:10.1021/bi101927s

1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase (ACCD) is a pyridoxal 5′-phosphate (PLP)-dependent enzyme that cleaves the cyclopropane ring of ACC, to give α-ketobutyric acid and ammonia as products. The cleavage of the C_α-C_β bond of an amino acid substrate is a rare event in PLP-dependent enzyme catalysis. Potential chemical mechanisms involving nucleophile- or acid-catalyzed cyclopropane ring opening have been proposed for the unusual transformation catalyzed by ACCD, but the actual mode of cyclopropane ring cleavage remains obscure. In this report, we aim to elucidate the mechanistic features of ACCD catalysis by investigating the kinetic properties of ACCD from Pseudomonas sp. ACP and several of its mutant enzymes. Our studies suggest that the pK_a of the conserved active site residue, Tyr294, is lowered by a hydrogen bonding interaction with a second conserved residue, Tyr268. This allows Tyr294 to deprotonate the incoming amino group of ACC to initiate the aldimine exchange reaction between ACC and the PLP coenzyme and also likely helps to activate Tyr294 for a role as a nucleophile to attack and cleave the cyclopropane ring of the substrate. In addition, solvent kinetic isotope effect (KIE), proton inventory, and ¹³C KIE studies of the wild type enzyme suggest that the C_α-C _β bond cleavage step in the chemical mechanism is at least partially rate-limiting under k_cat/K_m conditions and is likely preceded in the mechanism by a partially rate-limiting step involving the conversion of a stable gem-diamine intermediate into a reactive external aldimine intermediate that is poised for cyclopropane ring cleavage. When viewed within the context of previous mechanistic and structural studies of ACCD enzymes, our studies are most consistent with a mode of cyclopropane ring cleavage involving nucleophilic catalysis by Tyr294.

Full text of DOI:10.1021/bi101927s

1950 Biochemistry 2011, 50, 1950–1962
DOI: 10.1021/bi101927s
Mechanistic Studies of 1-Aminocyclopropane-1-carboxylate Deaminase: Characterization
of an Unusual Pyridoxal 50-Phosphate-Dependent Reaction†
Christopher J. Thibodeaux and Hung-wen Liu*
Division of Medicinal Chemistry, College of Pharmacy, Department of Chemistry and Biochemistry, and Institute for Cellular and
Molecular Biology, University of Texas, Austin, Texas 78712, United States
Received December 2, 2010; Revised Manuscript Received January 17, 2011
ABSTRACT: 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase (ACCD) is a pyridoxal 50-phosphate
(PLP)-dependent enzyme that cleaves the cyclopropane ring of ACC, to give R-ketobutyric acid and ammonia
as products. The cleavage of the CR-Cβ bond of an amino acid substrate is a rare event in PLP-dependent
enzyme catalysis. Potential chemical mechanisms involving nucleophile- or acid-catalyzed cyclopropane ring
opening have been proposed for the unusual transformation catalyzed by ACCD, but the actual mode of
cyclopropane ring cleavage remains obscure. In this report, we aim to elucidate the mechanistic features of
ACCD catalysis by investigating the kinetic properties of ACCD from Pseudomonas sp. ACP and several of its
mutant enzymes. Our studies suggest that the pKa of the conserved active site residue, Tyr294, is lowered by a
hydrogen bonding interaction with a second conserved residue, Tyr268. This allows Tyr294 to deprotonate
the incoming amino group of ACC to initiate the aldimine exchange reaction between ACC and the PLP
coenzyme and also likely helps to activate Tyr294 for a role as a nucleophile to attack and cleave the
cyclopropane ring of the substrate. In addition, solvent kinetic isotope effect (KIE), proton inventory, and 13C
KIE studies of the wild type enzyme suggest that the CR-Cβ bond cleavage step in the chemical mechanism is
at least partially rate-limiting under kcat/Km conditions and is likely preceded in the mechanism by a partially
rate-limiting step involving the conversion of a stable gem-diamine intermediate into a reactive external
aldimine intermediate that is poised for cyclopropane ring cleavage. When viewed within the context of
previous mechanistic and structural studies of ACCD enzymes, our studies are most consistent with a mode of
cyclopropane ring cleavage involving nucleophilic catalysis by Tyr294.
1-Aminocyclopropane-1-carboxylate deaminase (ACCD)1 is a
Scheme 1: Reaction Catalyzed by ACC Deaminase
pyridoxal 50-phosphate (PLP)-dependent enzyme expressed in
certain soil bacteria and fungi that catalyzes the conversion of
1-aminocyclopropane-1-carboxylic acid (ACC, 1) to R-ketobu-
tyrate (R-KB, 2) and ammonia (Scheme 1) (1). In plants, ACC is
the immediate biosynthetic precursor to ethylene, an important
plant hormone that regulates fruit ripening, seed germination,
leaf senescence, responses to environmental stress, and many
ethylene biosynthesis, and ACCD expression in plant tissues can
other physiological events (2). In the soil-dwelling organisms that
lead to significant delays in fruit ripening, helping to increase the
express ACCD, the function of ACCD may be to salvage useful
shelf life of fruits and vegetables (3).
The catalytic cycles of most PLP-dependent enzymes begin
with the formation of an external aldimine (such as 4 in Scheme 2)
sources of carbon and nitrogen for metabolic needs. Bacterial
ACCDs have been incorporated into transgenic plants to regulate
between the amino group of the substrate and the PLP
†This work was supported in part by a grant from the National
Institutes of Health (GM040541) and a fellowship from the Graduate
School of the University of Texas to C.J.T.
coenzyme (4-6). In the vast majority of PLP-dependent en-
zymes, a CR anion species (such as 5) is then generated either by
the deprotonation of the CR-H bond or by decarboxylation of
the R-carboxyl group of the substrate. In this respect, the reaction
catalyzed by ACCD is unusual, because the amino acid substrate,
ACC, contains no CR proton and the carboxylate group is
retained in the R-KB product. In ACCD, the CR anion equivalent
could be generated by cleavage of one of the two CR-Cβ bonds of
ACC. However, CR-Cβ bond cleavage is a rare event in PLP-
dependent enzyme catalysis and has been observed in only one
other enzyme, serine hydroxymethyltransferase (SHMTase) (7, 8).
In this enzyme, the CR-Cβ bond of the serine-PLP external
aldimine is believed to be cleaved either by a retro-aldol type
reaction or as a result of direct nucleophilic attack by the
*To whom correspondence should be addressed. Phone: (512) 232-
7811. Fax: (512) 471-2746. E-mail: h.w.liu@mail.utexas.edu.
1Abbreviations: R-KB, 2-keto-1-butanoic acid; ACC, 1-aminocyclo-
propane-1-carboxylic acid; ACCD, 1-aminocyclopropane-1-carboxy-
late deaminase; ACP, 1-aminocyclopropane 1-phosphonate; CAPSO,
3-(cyclohexylamino)-2-hydroxy-1-propanesulfonic acid; EPPS, 4-(2-hy-
droxyethyl)-1-piperazinepropanesulfonic acid; HMP, 4-hydroxyl-N-
methylpiperidine; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfo-
nic acid; KIE, kinetic isotope effect; LDH, L-lactate dehydrogenase;
MES, 2-(N-morpholino)ethanesulfonic acid; MOPS, 3-(N-morpholi-
no)propanesulfonic acid; MSR, mean-square residual of the fit; NADH,
nicotinamide adenine dinucleotide (reduced form); NMR, nuclear mag-
netic resonance; PLP, pyridoxal 50-phosphate; SHMTase, serine hydro-
xymethyltransferase; TAPS, N-tris(hydroxymethyl)methyl-3-aminopro-
panesulfonic acid; wt, wild type.
r
pubs.acs.org/biochemistry
Published on Web 01/18/2011
2011 American Chemical Society

Article
Biochemistry, Vol. 50, No. 11, 2011 1951
Scheme 2: Putative Chemical Mechanisms for ACCD Involving Nucleophile- and Base-Catalyzed Ring Scission (paths A and B,
respectively)
˚
tetrahydrofolate cosubstrate on the Cβ atom of the serine sub-
strate.
of Tyr294 (Pseudomonas sp. ACP numbering) is located only 3 A
from the pro-S Cβ of the ACC cyclopropane ring (Figure 1). As
such, it appears to be positioned appropriately to serve as a
nucleophile to attack the pro-S Cβ and cleave the pro-S Cβ-CR
bond of the ACC cyclopropane ring. In support of this proposed
catalytic role, the Y294F mutant is completely inactive, and no
Several possible mechanisms can be envisioned for the CR-Cβ
bond cleavage event catalyzed by ACCD (9). As shown in route
A in Scheme 2, following conversion of the internal aldimine (3)
to the ACC-PLP-external aldimine complex (4), an active site
nucleophile could attack and trigger the cleavage of the ACC
cyclopropane ring (10, 11) to yield the CR anion equivalent (or
quinonoid, 5). This mechanism is conceivable because cyclopro-
pane rings bearing electron-withdrawing substituents are known
to be susceptible to nucleophilic addition reactions (12-15).
Removal of a proton at Cβ of the quinonoid (5) (9, 16) by an
active site base (B1) could then eliminate the nucleophile to afford
the vinylglycyl-PLP quinonoid intermediate (6). Support for the
intermediacy of 6 in the catalytic cycle of ACCD is derived from
1
consumption of ACC was detected by H NMR spectroscopy
after a 24 h incubation period (20). A putative hydrogen bonding
interaction between Tyr268 and Tyr294 (2.5 A) could lower the
pKa of Tyr294, enhancing its role as a catalytic nucleophile. Ser78
is also located close to the ACC-PLP adduct in the active site,
where it forms a hydrogen bond with the carboxylate group of
˚
˚
ACC (2.8 A) and could help mediate proton transfers during
turnover (22). Finally, Glu295 appears to form an ion pair
interaction with the pyridinium group of PLP. Such interactions
are common in PLP enzymes and are generally believed to
increase the pKa of the pyridine ring to maximize the electrophilic
properties of the coenzyme.
mechanistic studies with D-vinylglycine (7, Scheme 2), which can
also be converted to R-KB (2) and ammonia by ACCD (9).
Subsequent Cγ protonation of 6 by a separate active site residue
(B2) (16) could give the PLP-aminocrotonate species (8).
Aldimine exchange and hydrolysis of 9 could then regenerate
the internal aldimine (3) and yield the reaction products, R-KB
(2) and ammonia. A variety of stereochemical studies have
suggested that the Cβ-CR bond cleavage is pro-S stereospecific
(10), that Cβ deprotonation (5 f 6, pro-R dominant) and proton-
ation (9 f 2, pro-R dominant) are mediated by a single base (B1),
and that both B1 and B2 are located on the si face of the alkene
moiety of 6 (16). A second potential mechanism that has been
proposed for the ACC ring scission step involves deproton-
ation of one of the two Cβ-methylene carbons of the ACC-
PLP-external aldimine complex (4) to generate the extended
quinonoid intermediate (6) directly (Scheme 2, route B) (9).
However, the pKa of ∼46 for the ring hydrogens of cyclopro-
pane (17) seems prohibitively high for this mechanism to be
feasible.
An unusual feature of the wild type (wt) ACCD-ACC
cocrystal structure is the apparent accumulation of a gem-
diamine species (10, Scheme 3) in the active site, where the amino
groups of ACC and the Schiff base-forming lysine residue
(Lys51) are both covalently linked to the C40 atom of the
coenzyme (Figure 1) (20, 21). In most PLP-dependent enzymes,
the gem-diamine is a transient species during the aldimine
exchange reaction (see the 3 f 4 reaction in Scheme 2). The
observation of this unusual gem-diamine species in the wt
ACCD-ACC cocrystal structure prompted us to consider an
alternative mechanistic possibility for ACCD, in which Tyr294
acts as an active site acid to facilitate the cleavage of the
cyclopropane ring directly from the gem-diamine intermediate
(Scheme 3) (21). After formation of the gem-diamine intermedi-
ate (10), a “push” by the electron pair of the ACC amine and a
“pull” by the concomitant protonation at the pro-S Cβ of ACC by
Tyr294 could facilitate the cleavage of the CR-Cβ bond to
generate 11. Stereospecific Cβ deprotonation of 11 could give
12, and the aldimine exchange reaction could release the amino-
crotonate (9) and regenerate the internal aldimine (3). Subse-
quent tautomerization of 9 and hydrolysis of the resulting
imine would eliminate ammonia to give R-KB (2). Although this
The X-ray crystal structures of ACCD enzymes from both
yeast and bacterial sources have been reported previously
(18-21) and, together with the stereochemical studies discussed
above (9, 10, 16), have provided important insight into the
putative roles of several active site amino acid residues in the
ACCD-catalyzed reaction. Specifically, the phenoxyl side chain

1952 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
purchased from Sigma-Aldrich (St. Louis, MO). All protein con-
centrations were determined by the Bradford method using bovine
serum albumin as the standard (28). All curve fitting was performed
with GraFit 5 (Erithacus Software, Horley, Surrey, U.K.).
pH Dependence of the Steady State Kinetic Parameters.
Steady state kinetic measurements were taken with a continuous
coupled enzyme assay in which the R-KB (2) produced by ACCD
turnover is reduced with NADH to 2-hydroxybutanoic acid by
lactate dehydrogenase (LDH) (9, 22). A typical 500 μL reaction
mixture contained 100 units of LDH, 200 μM NADH, 1.68 μM
wt ACCD, and variable concentrations of ACC (0.1-50 mM) in
assay buffer (25 mM MOPS, 25 mM MES, and 50 mM HMP)
adjusted to the appropriate pH with 10 M HCl or 10 M NaOH.
After the buffer pH had been adjusted, the final ionic strength
was increased to 100 mM by the addition of NaCl. Upon addition
of ACC to initiate the reaction, the rate of NADH consumption
at 340 nm was monitored (ε340 = 6220 M-1 cm-1) at 25 °C. For
Y268F, E295D, and wt ACCD in D2O, the concentration of
enzyme was increased to 15.4, 4.95, and 3.36 μM, respectively.
For assays performed in D2O, the assay buffer components were
mixed directly in D2O (99.9 at. % D, Sigma-Aldrich) and were
adjusted to the appropriate pD (pD = pH meter reading þ 0.4)
with 10 M HCl or 10 M NaOH. This solution was used to make
the NADH, LDH, ACC, and enzyme stock solutions. The final
mole fraction of protium in these reaction mixtures was calcu-
lated to be <5%.
F
ACP in complex with ACC (1). Distances are given in angstroms.
IGURE 1: Active site of wild type ACCD from Pseudomonas sp.
proposal represents an unprecedented catalytic cycle for a PLP-
dependent enzyme in that the electron sink properties of
the coenzyme are not used, it provides a rationale for the
accumulation of the gem-diamine (10) in the wt ACCD-ACC
cocrystal structure. Furthermore, the acid-catalyzed electrophilic
cleavage of cyclopropanes is well-documented in model
studies (23-27).
The choice of ACC concentrations used depended on the
enzyme and the Km value at the particular pH being assayed, but
in all cases, at least three or four different substrate concentra-
tions both above and below the Km value were used. The initial
velocity at each substrate concentration was measured in tripli-
cate, and the substrate concentration dependence of the initial
velocities was fit with the Michaelis-Menten equation for the
determination of kcat and Km. The kcat and kcat/Km values
determined at each pH [kcat,app and (kcat/Km)app] were normalized
by the enzyme concentration, and the log values of these kinetic
constants were plotted versus pH and fit with eqs 1-3. The
log(kcat/Km)app data were fit with eq 1 or 2, each describing
inverse bell-shaped profiles with slopes of þ1 and -1 at low and
high pH, respectively. In these equations, kcat/Km is the pH-
independent value of kcat/Km, pK1 and pK2 (eq 1) are the
apparent pKa values of titratable groups in the free enzyme
and free substrate, respectively, and pK0 (in eq 2) is the average of
two closely spaced apparent pKa values. Equation 3 describes a
profile that increases to a maximal value (kcat) at high pH with a
slope of þ1 and the apparent dissociation constant, pK3.
In this study, we investigate the kinetic and spectroscopic
properties of wt ACCD from Pseudomonas sp. ACP and several
of its active site mutants in an attempt to distinguish among the
possible chemical mechanisms for ACCD catalysis involving
either nucleophile or acid-catalyzed cyclopropane ring opening.
Kinetic-pH profiles are used to assess the involvement of
acid-base chemistry in catalysis and to help define the proton-
ation states of groups that are important to substrate binding and
catalysis. Pre-steady state stopped-flow absorption spectroscopy
of wt ACCD and its mutants is used to provide insight into the
PLP-linked intermediates that form during turnover. Finally,
solvent kinetic isotope effects, proton inventory studies, viscosity
variation experiments, and 13C KIE studies of the wt enzyme help
to define the sequence of chemical events involved in catalysis and
to characterize the nature of the steps that limit steady state
turnover.
MATERIALS AND METHODS
General. Wild type (wt) ACCD from Pseudomonas sp. ACP
and its Y268F and Y294F mutants were expressed in Escherichia
coli as N-His6 fusion proteins as described previously (21). The wt
ACCD gene in the pET28b(þ) construct (Stratagene, La Jolla,
CA) was used as a template to generate the Glu295 f Asp295
mutation using the QuikChange site-directed mutagenesis kit
(Amersham, Arlington Heights, IL) with the forward primer (50-
GCTGACCGATCCCGTCTACGATGGCAAATCGATGCA-
CGGCA) and the reverse primer (50-TGCCGTGCATCGA-
TTTGCCATCGTAGACGGGATCGGTCAGC) (mutation in
bold). The mutation was confirmed by DNA sequencing per-
formed by the Institute of Cellular and Molecular Biology Core
Laboratories of the University of Texas. The E295D protein was
expressed and purified in a fashion similar to those of the other
1 - pH
logðkcat=KmÞapp ¼ log½ðkcat=KmÞ=ð1 þ 10pK
þ 10pH - pK Þꢀ
2
ð1Þ
0
0
logðkcat=KmÞapp ¼ log½ðkcat=KmÞ=ð2 þ 10pK - pH þ 10pH - pK Þꢀ
ð2Þ
3 - pH
logðkcat appÞ ¼ logðkcat þ 10pK
Þ
ð3Þ
,
Spectrophotometric pH Titrations of the Internal Aldi-
mine. To monitor the pH dependence of the tautomerization
between the enolimine and ketoenamine forms of the internal
aldimine, enzymes [stored in 50 mM Na2HPO4 and 10% glycerol
(pH 7.5)] were diluted to 50 μM in 100 mM buffer (specified
below), and following a 1 min incubation, the absorbance of each
enzymes used in this study (21). L-Lactic dehydrogenase from
rabbit muscle, β-nicotinamide adenine dinucleotide (NADH),
ACC (1), and all buffer components used in this study were

Article
Biochemistry, Vol. 50, No. 11, 2011 1953
Scheme 3: Putative Chemical Mechanism for ACCD Involving Acid-Catalyzed Ring Scission
sample was recorded from 200 to 900 nm on a Beckman DU 650
spectrophotometer at 25 °C. The following buffers were used:
HEPES (pH 6.8-7.5), EPPS (pH 7.3-8.2), TAPS (pH 8.0-9.0),
and CAPSO (pH 9.2-10.2). The spectra were normalized by
setting the average absorbance values from 850 to 900 nm to zero.
Viscosity Variation Experiments. Viscosity variation ex-
periments were performed under pseudo-first-order conditions
with wt ACCD using glycerol as the viscogen. The reaction
mixtures contained 1.2 μM ACCD, 30 mM ACC, and variable
concentrations of glycerol [0, 10, 16, 20, 24, 30, and 32% (w/v)] in
25 mM MOPS, 25 mM MES, and 50 mM HMP (pH 7.5) at
25 °C. The coupled LDH reporter assay described above was
used to detect the formation of the R-KB product. Each reaction
was performed in triplicate, and the dependence of the initial
velocity on the relative viscosity of the solution was determined
by fitting the data to eq 4
for each water mixture was corrected to account for the different
molar volumes of H2O and D2O (30), and also for solvent
exchangeable protons derived from TAPS, NaOH, ACC, and
the components of the stock enzyme solution. The enzyme
was preincubated in each water mixture for approximately
30 min prior to the addition of ACC to start the reaction.
Following a 4 min incubation period, the production of R-KB
was monitored over a 4 min period by the increase in A329. Under
these conditions, the formation of R-KB was a linear function of
time for all reactions. In each water mixture, replicate measure-
ments of the initial velocity were taken under pseudo-first-order
substrate concentrations (as an estimate of kcat), and the data
were fitted with several different forms of the Gross-Butler
equation (eq 5)
Vj
Vi
Y
Y
kn=ko
¼
ð1 - n þ nΦTSÞi=
ð1 - n þ nΦRÞj
ð5Þ
i
j
ko=kη ¼ Sðηrel - 1Þ þ 1
ð4Þ
where ko and kn are the kcat values in buffers of deuterium atom
fraction 0 and n, respectively, and ΦTS and ΦR are fractionation
factors for exchangeable hydrogen sites in the transition and
reactant states, respectively (30).
where ko, kη, and ηrel are the initial velocity in buffer with no
added viscogen, the initial velocity in buffer with relative viscosity
η, and the relative viscosity of the solution, respectively. The slope
of the plot, S, is unity for a reaction that is completely diffusion
controlled, zero for a reaction that is not diffusion controlled, and
between zero and one for a reaction that is partially diffusion
controlled. The relative viscosities of the solutions containing
variable concentrations of glycerol were taken from ref 29.
Proton Inventory Study of wt ACCD. For these studies,
the production of R-KB was monitored directly by following the
increase in absorbance at 329 nm (ε329 = 0.0176 mM-1 cm-1 for
R-KB). The reactions were performed at pL 8.0, where the kcat in
both 100% H2O and 100% D2O is relatively independent of pL.
TAPS buffer (50 mM) was prepared with a 0, 20, 40, 60, 80, or
100% (v/v) D2O/H2O mixture. The pL was adjusted to 8.0 using
10 and 1 M solutions of NaOH, and the ionic strength was
adjusted to 100 mM with NaCl. In each separate D2O/H2O
mixture, 10 μL of the wt ACCD stock (in H2O, 1.19 mM) and
30 μL of a 500 mM ACC solution (dissolved in the appropriate
D2O/H2O mixture) were added to a total reaction volume of
500 μL, giving wt ACCD and ACC at final concentrations of
23.8 μM and 30 mM, respectively. The mole fraction of deuterium
13C KIE Studies of the wt ACCD-Catalyzed Reaction.
13C kinetic isotope effects on kcat/Km for the wt ACCD-catalyzed
reaction were measured by a competition experiment using the
methodology developed by Singleton (31), wherein the 13C
enrichemnt at each carbon atom of the substrate (R/RO) is
measured by 13C NMR spectroscopy and is used along with
the fractional conversion of reactants (F) to calculate the 13(kcat
Km) at each carbon atom via eq 6 (31-35)
/
KIEcalc ¼ lnð1 - FÞ=ln½ð1 - FÞR=ROꢀ
ð6Þ
For our purposes, RO is the relative enrichment of 13C (defined
relative to the carboxyl carbon of ACC) at a specific carbon
atom of an ACC sample prior to the reaction, R is the relative
enrichment of 13C at the same carbon atom in residual ACC
recovered from a large-scale ACCD reaction mixture, and F is the
fraction of reaction. Detailed descriptions of the large-scale
reaction mixtures, purification protocols for residual ACC, 13C
NMR spectroscopy conditions, and the measurement of the
fraction of reaction are all given in the Supporting Information,

1954 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
F
IGURE 2: pH dependence of the steady state kinetic parameters for wt ACCD and its mutants (pL = pH or pD, pD = pH meter reading þ 0.4):
(white) wtACCD inH2O, (blue) wt ACCD inD2O, (red) E295D inH2O, and (green) Y268F inH2O. The valuesof kcat and Km at eachpH for each
enzyme were determined by nonlinear regression of the initial velocity data using the Michaelis-Menten equation and are listed in Table S1 of the
Supporting Information.
Table 1: Summary of the pH Dependence of the Steady State Kinetic Parameters for wt ACCD and Its Mutantsa
enzyme
equation
kcat/Km (M-1 s-1
)
pK1
pK2
pK0
kcat (s-1
)
pK3
MSR
wt (H2O)
wt (D2O)
E295D
1
1
1
2
3
1.5(7) ꢁ 104
9(5) ꢁ 103
2(1) ꢁ 103
3.3(2) ꢁ 10
-
7.3(2)
7.9(3)
6.9(2)
8.7(2)
9.8(3)
9.3(2)
-
-
-
8.7(3)
1.32(8)b
0.22(2)b
-
-
-
-
0.0134
0.0112
0.0076
0.0029
0.0011
0.132(4)b
Y268F
-
-
-
-
-
-
0.028(1)
7.79(3)
aSee Materials and Methods for definitions of eqs 1-3. The standard errors in the last digit of each parameter estimate were obtained from the nonlinear fits
to eqs 1-3 and are given in parentheses. MSR is the mean-square residual of the nonlinear fit. bDetermined by averaging the kcat values at each pH.
along with descriptions for calculating the standard error asso-
ciated with the KIE measurement (31).
for wt ACCD, E295D, and Y268F over the pH range of 6.5-9.8
(Figure 2 and Table S1 of the Supporting Information). The
initial velocity data were fit with eqs 1-3 to extract estimates for
the apparent pKa values of groups that contribute to substrate
binding and catalysis, and estimates for the pH-independent
values of the kinetic constants (Table 1). The kcat/Km profiles for
each enzyme were fit with both eqs 1 and 2, and the fit that gave
the lowest mean-square residual is reported. For wt ACCD and
for E295D in H2O, the fits to eq 1 give similar values for pK1
(6.9-7.3) and pK2 (8.7-9.3) as well as similar pH optima (8.0 and
8.1 for wt ACCD and E295D, respectively). For the wt ACCD
reaction in D2O, the apparent pK1 and pK2 values in the kcat/Km
profile are both shifted to more basic pL, an expected result in
100% D2O (30). For Y268F, the best fits were obtained with eq 2,
which contains only a single apparent dissociation constant
(pK0 = 8.7). This pK0 parameter is the average of two closely
spaced apparent pKa values. The relatively large errors associated
with the kcat/Km parameter in each of the fits are likely due to the
close separation of the apparent pKa values governing the shape
of the profiles.
Inspection of the kcat-pH profiles reveals that this parameter
is relatively independent of pH in the wt and E295D enzymes
across the pH range tested. This indicates that if acid/base
catalysis is involved in the rate-limiting step, the catalytic acid/
base functional groups are not accessible to protonation and
deprotonation in the enzyme-substrate/intermediate complexes.
The kcat parameter for E295D is reduced roughly 10-fold relative
to that of wt ACCD across the pH range studied, and this
accounts for the majority of the reduction in catalytic efficiency
Stopped-Flow Absorption Measurements. Pre-steady state
absorbance changes in the PLP chromophore were measured
with a HI-TECH Scientific SF-61 double-mixing stopped-flow
system equipped with a diode array detector for monitoring time-
dependent changes in the PLP spectrum. The pH of all stock
solutions was adjusted to the appropriate value immediately
prior to conducting the experiments at 25 °C. The ionic strength
of the final reaction mixtures was 150 mM. All concentrations
given below correspond to those after mixing in the stopped flow.
For wt ACCD, the reaction mixtures contained 100 μM enzyme
and 50 mM ACC in 100 mM EPPS (pH 7.5). For Y268F, the
reaction mixtures contained 96.5 μM enzyme and 50 mM ACC in
100 mM TAPS (pH 8.8). For E295D, the reaction mixtures
contained 60 μM enzyme and 50 mM ACC and the reactions
were performed in 100 mM MOPS (pH 7.5). For Y294F, the
reaction mixtures contained 50 μM enzyme and 50 mM ACC and
the reactions were performed in 100 mM MOPS (pH 7.5). The
pre-steady state kinetic data were fit with exponential equations
(of the form shown by eq 7) to estimate the amplitudes and rates
associated with each observable kinetic phase
n
X
n
At ¼
½Anð1 - e- k tÞꢀ þ C
ð7Þ
1
where At is the absorbance at a particular wavelength at time t
after mixing, An and kn are the observed amplitude and first-order
rate constant, respectively, of kinetic phase n, and C is an offset
that accounts for the absorbance at time zero.
for the E295D mutant. Similar modest reductions in kcat and kcat
/
RESULTS
Km have been observed in other PLP-dependent enzymes when
the conserved Glu and Asp residues that interact with the
pyridine N atom of the coenzyme are interchanged (36-39).
Steady State Kinetic Studies. The pH dependence of the
steady state kinetic parameters (kcat and kcat/Km) was determined

Article
Biochemistry, Vol. 50, No. 11, 2011 1955
Scheme 4: Common Protonation States and Tautomeric Forms of Internal Schiff Bases
These data suggest an important catalytic function for Glu295. In
contrast to those of wt ACCD and E295D, kcat increases at high
pH for the Y268F mutant, and fits of the data to eq 3 suggest that
an active site group with a pKa of ∼7.8 needs to be deprotonated
for catalysis. In this mutant, kcat does not appear to level off at
lower pH, suggesting that while there may be two forms of the
Y268F-ACC Michaelis complex (one protonated and one
unprotonated), only the unprotonated enzyme form is active.
These results, along with the ∼50-fold decrease in kcat for the
Y268F mutant, suggest that Tyr268 also plays an important role
in catalysis.
play an important role in ACCD catalysis, and that bonds
involving solvent exchangeable protons are likely breaking in
the step(s) that limit steady state turnover. The larger magnitude
D2O
2
of
k
cat
relative to D Okcat/Km suggests that there may be solvent
kinetic isotope effects on steps following the first irreversible step
in the mechanism, which is assumed to be the ACC cyclopropane
ring cleavage step. Inspection of both of the putative mechanisms
for ACCD catalysis (Schemes 2 and 3) shows that there are
several possible steps following the CR-Cβ bond cleavage that
could potentially exhibit solvent KIEs.
Because the relative viscosity of 100% D2O solutions is higher
than that of 100% H2O solutions (49), it is possible that the
apparent solvent KIEs may actually be due to the variation in
solvent viscosity when H2O is replaced with D2O. It is known that
increasing the solvent viscosity can lower the diffusion coefficient
of solutes which, in turn, can slow the rates of bimolecular
association and dissociation processes (50-52). In the case of
enzyme catalysis, viscosity effects are often manifested on steps in
the kinetic mechanism involving substrate-product binding or
release, or when large-scale unimolecular enzyme conformational
changes occur (52-58). To assess the dependence of the wt
ACCD-catalyzed reaction on solvent viscosity, the effect of
glycerol concentration on the reaction rate under pseudo-first-
order conditions was analyzed (Figure S2 of the Supporting
Information). Fitting the kinetic data to eq 4 gives a slope that is
not significantly different than zero (S = 0.05 ( 0.05), demon-
strating that kcat is not limited by product dissociation or large-
pH Dependence of Internal Aldimine Absorption. The pH
dependence of the electronic absorption of the internal aldimine
was studied for the wt ACCD, Y268F, Y294F, and E295D
enzymes. Protonated internal aldimines typically exhibit absorp-
tion bands near 330 and 420 nm, which correspond to the
enolimine (13) and ketoenamine (14) tautomers of the proto-
nated Schiff base (Scheme 4) (40). In contrast, deprotonated
Schiff bases (15) typically exhibit an absorption maximum near
380 nm (41, 42). In the resting state of each enzyme, absorption
maxima are observed near 330 and 420 nm, consistent with the
presence of both enolimine (13) and ketoenamine (14) forms of
the internal aldimine (Figure 3 and Figure S1 of the Supporting
Information), which coexist in many PLP enzymes at physiolog-
ical pH (38, 43-48). As the pH is increased, the ketoenamine
tautomer (14) is converted to the enolimine tautomer (13).
Importantly, there is no red shift in the λmax of the ∼330 nm
peak at high pH in any of the enzymes, suggesting that the
internal aldimine is not deprotonated (to 15) as the pH is
increased. Thus, the internal aldimine of ACCD and its mutants
is likely protonated in the free enzyme form across the pH range
assayed in this study. Correspondingly, the pK1, pK2, and pK3
values determined from the kinetic-pH profiles likely corre-
spond to other groups: either to active site amino acid side chains
or to ionizable groups on the substrate. The pH dependence of
the internal aldimine absorption may result from an enzyme
conformational change that serves to alter the distribution
between the ketoenamine and enolimine tautomers, but further
investigation will be required to substantiate this claim.
scale enzyme conformational changes under these conditions.
D2O
These results indicate that the
k
cat
is a legitimate solvent KIE
and is not the result of increasing the relative viscosity of the
solvent.
Proton Inventory for the wt ACCD-Catalyzed Reaction.
A proton inventory study was conducted to further explore the
large solvent KIE measured on kcat for the wt ACCD reac-
tion (30). The kcat versus pL profiles for the wt ACCD reaction
indicated that kcat is relatively independent of pL over the entire
pL range assayed (Figure 2). Hence, we chose to perform the
proton inventory studies at pL 8.0 with 30 mM ACC, which is
well above the Km for ACC in both 100% H2O and 100% D2O at
pL 8.0 (see Table S1 of the Supporting Information). The
nonlinear fits of the proton inventory data to several different
forms of eq 5 are shown in Figure 4 along with the residual plots.
The definitions of the various forms of eq 5 used to fit the data
and a summary of the fitted parameters are listed in Table 2. The
best fits, as evidenced by the residual plots (Figure 4) and lack of
fit F tests (Table S2 of the Supporting Information), were
obtained with models where multiple transition state protons
are moving in the step(s) that limit turnover under pseudo-first-
order conditions (the T2 and T1S models). The simple linear
Effects of Solvent Kinetic Isotopes and Viscosity on the
wt ACCD-Catalyzed Reaction. To assess the involvement of
solvent exchangeable protons in the reaction catalyzed by wt
ACCD, we performed solvent KIE and viscosity variation studies
with the wt enzyme. From the kinetic data reported in Table 1,
D2O
significant solvent kinetic isotope effects [
k
cat
= kcat,H O
/
2
D2O
kcat,D O = 5.7, and
k
cat
/Km = (kcat/Km)H O/(kcat/Km)D O
=
2
2
2
2.5] were calculated for the wt enzyme using the data collected
at the pL optimum in each solvent (8.1 in H2O and 8.8 in D2O).
This result clearly suggests that solvent exchangeable protons

1956 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
model (T1) did not exhibit any significant lack of fit at the 95%
confidence interval (Table S2 of the Supporting Information).
However, from the residual plot for the fit to this model
(Figure 4), there appear to be systematic deviations between
the fitted curve and the mean value of the data points. Because of
this, the T2 and T1S models appear to be more appropriate
models for fitting the proton inventory data.
following cyclopropane ring cleavage (and is expressed only
on kcat).
13C Kinetic Isotope Effects. To determine if the step in the
ACCD-catalyzed reaction involving the cleavage of the cyclo-
propane ring of ACC contributes to steady state rate limitation
under kcat/Km conditions, a 13C KIE study of the wt ACCD-
catalyzed reaction was conducted using the method developed by
Singleton, which allows for the simultaneous determination of
13(kcat/Km) at each carbon atom of the substrate (31). As the wt
ACCD-catalyzed reaction approaches completion, any residual
ACC starting material in the reaction mixture will be enriched in
The slightly bowl-shaped curvature of the proton inventory
D2O
plots suggests that
k
cat
is composed of at least two, normal
solvent KIEs (30). In both the T2 and T1S models, one exchange-
able site (Φ1) is predicted to be responsible for the majority of the
solvent KIE on kcat (Φ1 = 0.3-0.33; KIE = 3.0-3.3), while a
second site (Φ2) or set of sites (ΦS) contributes a smaller normal
effect (KIE ∼ 1.4-1.5). On the basis of the measured differences
13C at the CR and pro-S Cβ positions if there is a 13C KIE on kcat
/
Km. This is because ACC molecules containing 13C at the scissile
pro-S Cβ-CR bond will react more slowly than ACC mole-
cules containing 12C at the scissile bond. The relative 13C
enrichment of unreacted and residual samples of ACC (RO and
R, respectively) is measured by 13C NMR spectroscopy and is
used to calculate the enrichment ratio (R/RO). This value is then
used, along with the fraction of reaction (F), to calculate the KIE
at each carbon atom via eq 6 (35).
D2O
2
in
k
cat
(5.7) and D Okcat/Km (2.5) discussed above, our hypo-
thesis is that one of the two normal solvent KIEs is expressed on a
step prior to or concomitant with cyclopropane ring cleavage
D2O
D2O
(thus contributing to both
k
cat
and
k /Km), while the
cat
other normal solvent KIE is expressed on a step (or steps)
A typical 13C NMR spectrum for ACC acquired under the
NMR conditions reported in the Supporting Information is
shown in Figure S3. The 13C peak integrations from each of
the replicate NMR spectra of each ACC sample and the replicate
measurements of the fraction of reaction are listed in Tables S3
and S4 of the Supporting Information, respectively. The R/RO
and F observables and their standard errors calculated from these
data for each of the two replicate large-scale reactions are listed in
Table 3, along with the calculated KIEs on CR and pro-S Cβ.
Equation 6 was used to calculate the KIE at CR. However, the 13
C
NMR signals for the pro-R and pro-S β-carbons of ACC are
Table 2: Summary of Fits of the Proton Inventory Data to Various Forms
of the Gross-Butler Equation (eq 5)
F
IGURE 3: UV-visible absorption spectra of the low-pH (blue
model
equation (kn/ko =)
ko
Φ1
Φ2
ΦS
MSR
spectra) and high-pH (fuscia spectra) forms of the internal aldimine
(3) of wt ACCD. The pH dependence of the absorption at 419 nm is
shown in the inset to the panel. Similar pH-dependent absorption
changes were also seen with the E295D, Y268F, and Y294F mutant
enzymes (see Figure S1 of the Supporting Information).
T1
T2
1 - n þ nΦ1
0.60(1) 0.19(1)
-
-
-
0.00043
0.00024
(1 - n þ nΦ1)(1 - n þ nΦ2) 0.61(1) 0.33(7) 0.7(1)
n
T1S (1 - n þ nΦ1)ΦS
0.61(1) 0.30(4)
-
0.7(1) 0.00023
FIGURE 4: Proton inventory data for wt ACCD. See Table 2 for the definition of each model (T1, T2, and T1S) and for the values of the fitted
parameters.

Article
Biochemistry, Vol. 50, No. 11, 2011 1957
Table 3: Summary of 13kcat/Km Data for the wt ACCD Reactiona
reaction
R/RO(CR)
ΔR/RO(CR)
R/RO(Cβ)
ΔR/RO(Cβ)
F
ΔF
13(kcat/Km)CR
13(kcat/Km)Cβ
1
1.031
1.030
0.017
0.010
1.000b
1.031
0.005
0.006
0.906
0.834
0.006
0.006
1.013(7)
1.017(6)
1.015(5)
1.000(5)b
1.034(3)
1.017(17)
2
average
aR/RO and its standard error (ΔR/RO) were calculated from the NMR data in Table S3 of the Supporting Information. F and its standard error (ΔF) were
calculated from the LDH reporter assay data in Table S4 of the Supporting Information. 13(kcat/Km)CR and 13(kcat/Km)Cβ were then calculated from R/RO and F
using eqs 6 and 8, respectively, and the standard errors in the final digit of the KIE measurements (in parentheses) were calculated using eqs S2-S4 of the
Supporting Information. The arithmetic average (and its standard error) of the two replicate measurements for each 13C KIE was then calculated to determine
the reported KIE. bThe R/RO of unity yields no error in eqs S2 and S3 of the Supporting Information. For calculation of the average value of 13(kcat/Km)Cβ, we
assumed a relative error of 0.5% on 13(kcat/Km)Cβ for reaction 1 (the average relative error of the other KIE measurements).
F
IGURE 5: Multiwavelength stopped-flow studies of wt ACCD and its mutants. The times in each panel indicate the time after mixing with 50 mM
ACC. For eachenzyme, time-dependentabsorptionchanges inthe ∼430 nm regionwerealsofit with the appropriate exponential expression (eq 8)
to extract estimates for rates and amplitudes of each observable kinetic phase (see Figure S4 and Table S6 of the Supporting Information).
indistinguishable, yielding an observed, combined enrichment (Rβ
=Rpro-S þ Rpro-R) versus the reference. If the initial enrichment at
each β-carbon is the same, then the values of Rpro-S and Rpro-R
reactions (59-64) and suggests that the CR-Cβ bond cleavage
step in ACCD catalysis is at least partially rate-limiting under
kcat/Km conditions.
pro-R
prior to reaction are both given by the equation ROpro-S=RO
Multiwavelength Stopped-Flow Studies. In an attempt to
identify and characterize the PLP-linked intermediates that form
during turnover under saturating ACC concentrations, absorp-
tion spectra for wt ACCD and its E295D, Y268F, and Y294F
mutants were collected with a stopped-flow apparatus using a
diode array detector (Figure 5). In the fast reaction phase for the
wt enzyme, the ketoenamine tautomer of the internal aldimine
(λmax = 419 nm) is converted into a new species (λmax = 329 nm)
with an apparent rate constant k1 of 260 s-1 (Figure S4 and Table
S5 of the Supporting Information). This species is most likely
either the enolimine form of an external aldimine or the gem-
diamine species that is observed in the crystal structure (21) and
that also has an absorption maximum in the 330 nm region (65).
Following the fast phase, there is a slower phase occurring at a
catalytically competent observed rate [k2 = 2.3 s-1 (Figure S4 of
the Supporting Information)], during which the 329 nm absorp-
tion band decreases in intensity and is broadened slightly.
In contrast to that of the wt enzyme, the λmax values of both of
the internal aldimine peaks (λmax=331 and 421 nm) in the E295D
mutant shift slightly upon mixing with ACC to values of 329 and
=ROβ/2, where ROβ is the observed, combined enrichment prior
to reaction. Next, if we assume that only the pro-S β-carbon
exhibits a nonunit isotope effect, then the observed, combined
enrichment at some fraction of reaction F will be given by the
pro-R
equation Rβ = Rpro-S þ RO
(or Rβ = Rpro-S þ ROβ/2)
because Rpro-R remains equal to its initial value. Therefore, the
ratio of interest for computing the isotope effect associated with
the pro-S β-carbon alone, i.e., Rpro-S/ROpro-S, can be calculated as
2Rβ/ROβ - 1:
KIEβ ¼ lnð1 - FÞ=ln½ð1 - FÞð2Rβ=ROβ - 1Þꢀ
ð8Þ
The calculated 13(kcat/Km) values on the CR and pro-S Cβ
atoms of ACC from the two replicate measurements were then
averaged together to give 13C KIEs of 1.015 ( 0.005 on CR and of
1.017 ( 0.017 on pro-S Cβ. Unfortunately, while 13(kcat/Km)R
appeared to be significantly larger than unity in both reactions,
the average 13(kcat/Km)β was within error of unity. Nevertheless,
the 1.5% isotope effect at CR (Table 3) compares favorably with
13
k /Km isotope effects measured for other enzyme-catalyzed
cat

1958 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
∼428 nm, respectively, at an observed first-order rate constant k1
of ∼150 s-1 (Figure S4 of the Supporting Information). The
spectral shifts are associated with a slight decrease in the
absorption intensity in the ∼420 nm region and a corresponding
increase in the ∼330 nm region. Similar rapid spectral shifts have
been observed in other PLP-dependent enzymes and are usually
attributed to the formation of an external aldimine intermediate,
whose absorption properties often differ slightly from those of
the internal aldimine (66). In the Y268F mutant, a species with a
λmax at 431 nm forms upon mixing with ACC at an observed
rate k1 of 70 s-1. As in the E295D mutant, the λmax of this
intermediate is red-shifted relative to the λmax of the ketoenamine
tautomer of the internal aldimine [419 nm (see Figure S1 of
the Supporting Information)], suggesting that the external aldi-
mine is likely accumulating upon binding of ACC to Y268F. The
absorbance changes at 431 nm are triphasic, and interestingly,
the intensity of the 431 nm absorption band increases during
the fast phase (k1 ∼ 70 s-1), decreases over the next ∼200 ms (k2
∼ 15 s-1), and then increases again over the next several seconds
in a slow phase [k3 ∼ 0.5 s-1 (Figure S4 of the Supporting
Information)]. All three kinetic phases are fast enough to be
kinetically competent (see Tables S1 and S6 of the Supporting
Information). In the catalytically inactive Y294F mutant (20), the
ketoenamine form of an external aldimine (λmax = 431 nm) also
appears to accumulate upon ACC binding. Support for this
assignment is provided by the crystal structure of the yeast Y295F
enzyme (analogous to the Pseudomonas sp. ACP Y294F mutant)
determined in the presence of ACC, where an external aldimine
species was detected (19). Like the Y268F reaction, the absor-
bance changes in the Y294F mutant at 431 nm upon ACC
binding were multiphasic. However, in the case of Y294F, the 431
nm absorption increased in the fast phase (k1 = 6.1 s-1) and then
charged ACC amino group could engage in favorable electro-
static interactions with the deprotonated, negatively charged
Tyr294 to facilitate ACC binding. Alternatively, if Ser78 is
responsible for pK2, Ser78 would likely need to be protonated
to form a hydrogen bond to the ACC carboxylate group (see
Figure 1). The pKa of the hydroxyl side chain of Ser78 may be
lowered by hydrogen bonding interactions with the backbone
amide groups of Gln80 and Thr81 and/or through a putative
helix-dipole interaction. Similar helix--dipole interactions
have been shown to lower the pKa of Cys residues in model
peptides (68) and in enzyme active sites (69, 70) by nearly two
units. The lowering of the pKa of Ser78 could also serve a catalytic
function, as this residue has been implicated in acid/base chem-
istry during turnover, perhaps serving to mediate proton trans-
fers at C3 of the substrate-PLP adduct following cyclopropane
ring scission (22). Finally, spectroscopic studies of the internal
aldimines of wt ACCD, Y268F, Y294F, and E295D demonstrate
that the Schiff base remains protonated across the pH range
studied, suggesting that the deprotonation of PLP is not respon-
sible for pK2.
Analysis of the kinetic properties of the ACCD mutant
enzymes provides insight into the chemical mechanism for
cyclopropane ring cleavage. PLP species consistent with the
ketoenamine tautomer of an external aldimine (4, Scheme 5)
form in the pre-steady state fast phases of the E295D- and
Y268F-catalyzed reactions. Because the external aldimine is an
essential intermediate in nucleophile-induced ring scission but is
not required in acid-catalyzed ring cleavage, the detection of 4
suggests that the acid-catalyzed strategy shown in Scheme 3 is
probably not employed in the mutant enzymes. Stronger evidence
of a nucleophile-induced ring scission is provided by the kcat-pH
profile for the Y268F mutant, where an active site group in the
Michaelis complex with a pKa of ∼7.8 must be deprotonated for
activity. The most likely candidate for this important catalytic
group is the side chain of Tyr294. This conclusion is supported by
the conservation of the Tyr268-Tyr294 pair in ACCD homo-
logues, the close proximity of the phenoxyl groups of Tyr294 and
continued to increase in an intermediate phase (k2 = 0.5 s-1
)
before decaying in a slow phase [k3 = 0.1 s-1 (Figure S4 of the
Supporting Information)].
DISCUSSION
˚
Tyr268 (2.5 A), the position of the Tyr294 phenoxyl group near
˚
the pro-S Cβ of ACC in the cocrystal structure (3.0 A), and the
On the basis of the kinetic characterization of wt ACCD and
its mutants reported in this study, a working model for the pH
dependence of the steady state kinetic parameters and the
protonation states of the important active site residues can be
proposed (Scheme 5). The group responsible for pK1 is assigned
to the phenoxyl group or Tyr294, which likely needs to be
deprotonated for ACC binding. Support for this conclusion is
derived from the similarity of pK1 in the wt and E295D mutant
enzymes and from the increase in pK1 of ∼1.5 units in the Y268F
enzyme. In this model, the pKa of Tyr294 is lowered by its
complete inactivity of the Y294F mutant (18, 19, 21). The 10-fold
reduction in kcat for the E295D mutant and the reported
inactivity of the E295Q mutant (19) are also most consistent
with the nucleophile-induced ring cleavage mechanism. The
weakened ion pair interaction between the carboxylate group
of Glu295 and the pyridinium nitrogen of PLP in the E295D
mutant may increase the energy of the transition state for the ring
scission step if the liberated cyclopropane ring electrons cannot
be delocalized efficiently into the coenzyme.
Interestingly, a clearly definable ketoenamine tautomer of an
external aldimine species cannot be detected in the presteady state
of the wt ACCD reaction. Instead, a species consistent with either
an enolimine tautomer of an internal/external aldimine or a gem-
diamine (10, Scheme 5) accumulates rapidly at an observed rate
constant of ∼260 s-1 at saturating ACC concentrations. Although
the observed PLP intermediate is spectroscopically indistinguish-
able from the enolimine tautomer of the internal aldimine resting
state, the attack of the incoming ACC amino group on the C40
atom of PLP to initiate the aldimine exchange is expected to be fast
in the wt enzyme, in light of the observations that the Y268F and
E295D mutant enzymes quickly catalyze the aldimine exchange
reaction. Thus, the observable species in the stopped-flow studies
of the wt enzyme is tentatively assigned as the gem-diamine that is
˚
hydrogen bonding interaction with Tyr268 [2.5 A (Figure 1)],
which allows ACC to bind and Tyr294 to deprotonate the amino
group of ACC, facilitating the aldimine exchange reaction. A role
for Tyr294 in ACC deprotonation was first proposed on the basis
of structural studies by Ose et al. (19) and is also supported by our
stopped-flow studies of the Y294F mutant, in which the rate of
the aldimine exchange reaction to form an external aldimine is
significantly reduced.
The pK2 values determined from the kcat/Km-pH profiles are
relatively invariant, suggesting that this apparent ionization
constant likely corresponds either to the amino group of ACC
or to the side chain of Ser78. The pKa of cyclopropylamine is ∼8.7
in aqueous solution (67), which is very similar to the kinetic pK2
values (∼9) measured in our studies. A protonated, positively

Article
Biochemistry, Vol. 50, No. 11, 2011 1959
Scheme 5: Revised Chemical Mechanism for ACCDa
aPutative hydrogen bonds are shown as dashed lines.
˚
observed in the X-ray crystal structure of the wt ACCD enzyme in
the presence of ACC (20, 21).
gem-diamine form of the ACP-ACCD complex (2.3 A) is
shortened relative to the distance between Tyr294 and the
According to our model for substrate binding and catalysis
(Scheme 5), the side chain of Tyr294 is protonated in the gem-
diamine state of the wt ACCD-ACC complex, allowing it to
ACC carboxylate group in the gem-diamine form of the AC-
C-ACCD complex (2.7 A) (21). It is tempting to speculate that
˚
this shortened hydrogen bond distance could help to trap the
ACP-ACCD complex in an unreactive gem-diamine state,
perhaps accounting for the slow, tight binding inhibition proper-
ties of ACP (65). At present, it is still unclear why the aldimine
exchange reaction in wt ACCD is halted in the gem-diamine state
while both the Y268F and E295D mutants can apparently move
quickly through this intermediate to generate the external
aldimine rapidly in the presteady state. On the basis of this
unusual observation and the fact that the ACP inhibitor also
forms a gem-diamine complex when bound to wt ACCD, it is
possible that the gem-diamine species detected in the wt ACCD-
catalyzed reaction is an off-pathway species.
˚
form a hydrogen bond with the ACC carboxylate group (2.7 A).
It is possible that deprotonation of Tyr294 in the Michaelis
complex and the collapse of the gem-diamine into the external
aldimine (10 f 4) are energetically demanding, allowing the gem-
diamine species to accumulate in the presteady state. A similar
gem-diamine intermediate also accumulates in incubations of wt
ACCD with 1-aminocyclopropane 1-phosphonate (ACP) which,
despite its stereoelectronic properties being similar to those of
ACC, is not turned over into any products (21, 65). Interestingly,
the internuclear distance between the oxygen atom of the
Tyr294 side chain and the phosphonate oxygen of ACP in the

1960 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
Scheme 6: Putative Mechanism for ACCD Catalysis Involving Concerted Deprotonation and Nucleophilic Addition
The proposed mechanism for ACCD catalysis involving
nucleophilic addition of Tyr294 to the cyclopropane ring of
ACC (Scheme 5) can be rationalized on the basis of the solvent
and 13C kinetic isotope effects determined in this study. The
interpretation of the KIEs depends on whether the putative gem-
diamine species (10) is a catalytically competent intermediate. If
10 is a species on the reaction pathway, the steps leading from
gem-diamine decay to the external aldimine (10 f 4) and from
the external aldimine to the quinonoid species (4 f 5) may both
for C-C bond cleavage would be expected for the exothermic
cyclopropane ring opening event.
Following cleavage of the ACC cyclopropane ring, transient
protonation at C40 of PLP to form the ketimine species (16) may
help to activate the Cβ proton (at C3) by lowering the anionic
character at CR (Scheme 5), in analogy to the reaction catalyzed
by cystathionine γ-synthase (72). The tyrosine nucleophile could
then be eliminated from 16 by deprotonation of the pro-R proton
at C3, yielding the β,γ-unsaturated ketimine intermediate (17).
On the basis of stereochemical (9, 16), structural (18-21), and
biochemical studies (22), Ser78 is the most likely candidate for
catalyzing this deprotonation. Most notably, the catalytic effi-
ciency of the S78A mutant is significantly reduced; Ser78 is
covalently modified by the electrophilic ACC analogue, 2-methy-
lene-ACC, and Ser78 is required for CR deprotonation of ACCD-
be partially rate-limiting during steady state turnover under kcat
/
D2O
Km conditions. Here, the normal
k /Km of 2.5 could be a
cat
result of the decay of the gem-diamine species. Deprotonation of
Tyr294 and/or protonation of the amino side chain of Lys51
during its elimination from the gem-diamine intermediate could
potentially generate the normal solvent KIE on kcat/Km. The
13(kcat/Km) isotope effect of 1.5% on CR of ACC would arise from
the partially rate-limiting conversion of the reactive external
aldimine intermediate to the quinonoid (4 f 5). The magnitude
of 13(kcat/Km) on the wt ACCD-catalyzed reaction is modest
when compared to the ∼4-6% KIEs measured for enzymatic
PLP-dependent decarboxylation reactions when the decarbox-
ylation step is fully rate-limiting (62, 63). The modest 13(kcat/Km)
on the wt ACCD-catalyzed reaction would be consistent with a
stepwise mechanism in which the 13C KIE is attenuated by a
preceding and partially rate limiting gem-diamine decay step.
Alternatively, if the gem-diamine species (10) that accumulates
in the wt ACCD-catalyzed reaction is an off-pathway intermedi-
ate, the solvent and 13C KIEs could be reporting on the same step
in the mechanism. Here, the external aldimine would be gener-
ated rapidly upon ACC binding to the wt enzyme (Scheme 6) but
may represent an only minor fraction of the total enzyme present
in the reaction mixtures with ACC (with the major enzyme form
being a nonproductive gem-diamine state). As such, the external
aldimine could elude detection by stopped-flow absorption
spectroscopy. In this concerted mechanism, Tyr294 deprotona-
tion could occur concomitantly with nucleophilic attack and
bound -amino acid-PLP adducts (22). Protonation at Cγ of the
D
quinonoid species (17) to give the PLP-aminocrotonate species
(8), followed by aldimine exchange (8 f 3), and hydrolysis of the
aminocrotonate (9 f 2) would complete the catalytic cycle. The
groups responsible for mediating these transformations are not
clear, but they likely involve some level of participation by
Tyr268, Tyr294, Ser78, Lys51, and the PLP. Because these steps
follow the irreversible cyclopropane ring cleavage step, one or
more of them is likely responsible for the additional portion of the
normal solvent KIE that is measured on only kcat. At this point,
the irreversibility of the ACCD-catalyzed reaction and our
inability to conclusively detect species 5, 16, 17, and 8 in the wt
ACCD reaction using stopped-flow spectroscopy have made
characterization of the late stages of the reaction mechanism
difficult.
Taken together, the accumulated evidence strongly favors a
mechanism for ACCD catalysis involving nucleophilic cleavage
of the cyclopropane ring. However, the unusual stability of the
gem-diamine intermediate in the wt ACCD-ACC complex
prompted us to propose an alternative mechanism (Scheme 3)
in which Tyr294 acts as a general acid to facilitate the opening of
the cyclopropane ring of ACC (20). Precedence for a similar
mode of electrophilic cyclopropane ring cleavage has been
provided by Jencks and co-workers in their model studies of
the reactivity of phenylcyclopropanols (23). Though this mecha-
nism cannot be rigorously excluded at the moment, it is at odds
with several experimental observations. First, for the E295D and
Y268F enzymes, an external aldimine intermediate accumulates
in the presteady state, which is not predicted to form along the
putative reaction coordinate for the acid-catalyzed ring opening
Cβ-CR bond cleavage. The magnitude of the solvent KIE for wt
D2O
ACCD (
k /Km = 2.5) is consistent with solvent KIE values
cat
measured for enzymatic reactions in which deprotonation of
oxygen nucleophiles is concerted with nucleophilic attack (71). In
this scenario, the 1.5% 13(kcat/Km) on the ACCD-catalyzed
reaction could indicate an early (or late) transition state for
C-C bond cleavage, rather than a stepwise mechanism in which
the C-C bond cleavage step is only partially rate-limiting.
According to the Hammond Postulate, an early transition state

Article
Biochemistry, Vol. 50, No. 11, 2011 1961
mechanism. Second, incorporation of a solvent proton into Cγ
of the R-KB product is not fully stereospecific (16), which is
unlikely if Tyr294 is serving as a general acid to initiate ring
cleavage from the gem-diamine intermediate. Third, the E295Q
mutant is inactive (19), and the activity of the E295D mutant is
substantially decreased. These observations suggest that electron
delocalization into the pyridinium ring (a hallmark of normal
PLP catalysis that would not be required for turnover in the acid-
catalyzed mechanism) is an important feature of wt ACCD
catalysis. Finally, in addition to the deamination of ACC, wt
ACCD catalyzes a variety of CR deprotonation and Cβ elimina-
tion reactions with other amino acid substrates (9, 11, 22). These
reactions most likely proceed via quinonoid species that are
common to many other PLP-dependent enzyme mechanisms.
Thus, the wt ACCD enzyme is at least capable of accommodating
these typical PLP intermediates, which would not be employed in
the acid-catalyzed ring opening mechanism.
13. Yates, P., Helferty, P. H., and Mahler, P. (1983) Nucleophilic and
acid-catalyzed cleavage of the cyclopropane rings of β,γ-unsaturated
R-spirocyclopropyl ketones. Can. J. Chem. 61, 71–85.
14. Danishefsky, S. (1979) Electrophilic cyclopropanes in organic syn-
thesis. Acc. Chem. Res. 12, 66–72.
15. Cleland, W. W. (1982) The use of pH studies to determine chemical
mechanisms of enzyme-catalyzed reactions. Methods Enzymol. 87,
390–405.
16. Liu, H.-w., Auchus, R., and Walsh, C. T. (1984) Stereochemical studies
on the reactions catalyzed by the PLP-dependent enzyme 1-aminocyclo-
propane-1-carboxylate deaminase. J. Am. Chem. Soc. 106, 5335–5348.
17. Battiste, M. A., and Coxon, J. M. (1987) Acidity and basicity of
cyclopropanes. In The chemistry of the cyclopropyl group. Part 1
(Rappoport, Z., Ed.) pp 255-305, John Wiley & Sons, Chichester, U.K.
18. Yao, M., Ose, T., Sugimoto, H., Horiuchi, A., Nakagawa, A.,
Wakatsuki, S., Yokoi, S., Murakami, T., Honma, M., and Tanaka,
I. (2000) Crystal structure of 1-aminocyclopropane-1-carboxylate
deaminase from Hansenula saturnus. J. Biol. Chem. 275, 34557–34565.
19. Ose, T., Fujino, A., Yao, M., Watanabe, N., Honma, M., and
Tanaka, I. (2003) Reaction intermediate structures of 1-aminocyclo-
propane-1-carboxylate deaminase: Insight into PLP-dependent cyclo-
propane ring-opening reaction. J. Biol. Chem. 278, 41069–41076.
20. Karthikeyan, S., Zhao, Z., Kao, C.-L., Zhou, Q., Tao, Z., Zhang, H.,
and Liu, H.-w. (2004) Structural analysis of 1-aminocyclopropane-
1-carboxylate deaminase: Observation of an aminyl intermediate and
identification of Tyr 294 as the active-site nucleophile. Angew. Chem.,
Int. Ed. 43, 3425–3429.
21. Karthikeyan, S., Zhou, Q., Zhao, Z., Kao, C.-L., Tao, Z., Robinson, H.,
Liu, H.-w., and Zhang, H. (2004) Structural analysis of Pseudomonas
1-aminocyclopropane-1-carboxylate deaminase complexes: Insight
into the mechanism of a unique pyridoxal-50-phosphate dependent
cyclopropane ring-opening reaction. Biochemistry 43, 13328–13339.
22. Zhao, Z., Chen, H., Li, K., Du, W., He, S., and Liu, H.-w. (2003)
Reaction of 1-amino-2-methylenecyclopropane-1-carboxylate with
1-aminocyclopropane-1-carboxylate deaminase: Analysis and mecha-
nistic implications. Biochemistry 42, 2089–2103.
ACKNOWLEDGMENT
We thank Dr. Mark Ruszczycky and Professor Christian P.
Whitman for their critical reading of the manuscript, Professor
Paul Cook for his helpful discussions, Dr. Zhihua Tao for
constructing some of the mutant enzymes employed in this study,
and Steve Sorey for his assistance with the NMR experiments.
SUPPORTING INFORMATION AVAILABLE
Steady state kinetic data, error analysis for the proton
inventory studies, raw data used for the calculation of the 13C
KIEs, and nonlinear fits of the stopped-flow data. This material
is available free of charge via the Internet at http://pubs.acs.org.
23. Thibblin, A., and Jencks, W. P. (1979) Unstable carbanions. General
acid catalysis of the cleavage of 1-phenylcyclopropanol and 1-phenyl-
2-arylcyclopropanol anions. J. Am. Chem. Soc. 101, 4963–4973.
24. Wiberg, K. B., and Kass, S. R. (1985) Electrophilic cleavage of
cyclopropanes. Acetolysis of alkylcyclopropanes. J. Am. Chem. Soc.
107, 988–995.
25. Baird, R. L., and Aboderin, A. A. (1964) Concerning the role of
protonated cyclopropane intermediates in solvolytic reactions. The
solvolysis of cyclopropane in deuteriosulfuric acid. J. Am. Chem. Soc.
86, 252–255.
26. McKinney, M. A., Smith, S. H., Hempelman, S., Gearen, M. M., and
Pearson, L. (1971) Proteolytic cleavage of cyclopropanes: The struc-
ture of the transition state in the protonation of arylcyclopropanes.
Tetrahedron Lett., 3657–3660.
27. McKinney, M. A., and So, E. C. (1972) Protolytic cleavage of
cyclopropanes. The two mechanisms for the acid-catalyzed cleavage
of 1-phenylcyclopropylmethyl ether. J. Org. Chem. 37, 2818–2822.
28. Bradford, M. M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal. Biochem. 72, 248–254.
29. St. Maurice, M., and Bearne, S. L. (2002) Kinetics and thermody-
namics of mandelate racemase catalysis. Biochemistry 41, 4048–4058.
30. Schowen, K. B., and Schowen, R. L. (1982) Solvent isotope effects on
enzyme systems. Methods Enzymol. 87, 551–606.
31. Singleton, D. A., and Thomas, A. A. (1995) High-precision simulta-
neous determination of multiple small kinetic isotope effects at
natural abundance. J. Am. Chem. Soc. 117, 9357–9358.
32. Northrop, D. B. (1975) Steady-state analysis of kinetic isotope effects
in enzymic reactions. Biochemistry 14, 2644–2651.
33. Simon, H., and Palm, D. (1966) Isotope effects in organic chemistry
and biochemistry. Angew. Chem., Int. Ed. 5, 920–933.
34. Cleland, W. W. (2005) The use of isotope effects to determine enzyme
mechanisms. Arch. Biochem. Biophys. 433, 2–12.
REFERENCES
1. Honma, M., and Shimomura, T. (1978) Metabolism of 1-aminocy-
clopropane-1-carboxylic acid. Agric. Biol. Chem. 42, 1825–1831.
2. Kende, H. (1993) Ethylene biosynthesis. Annu. Rev. Plant Physiol.
Plant Mol. Biol. 44, 283–307.
3. Klee, H. J., Hayford, M. B., Kretzmer, K. A., Barry, G. F., and
Kishore, G. M. (1991) Control of ethylene synthesis by expression of a
bacterial enzyme in transgenic tomato plants. Plant Cell 3, 1187–1193.
4. Eliot, A. C., and Kirsch, J. F. (2004) Pyridoxal phosphate enzymes:
Mechanistic, structural, and evolutionary considerations. Annu. Rev.
Biochem. 73, 383–415.
5. Dunathan, H. C. (1966) Conformation and reaction specificity in
pyridoxal phosphate enzymes. Proc. Natl. Acad. Sci. U.S.A. 55, 712–
716.
6. Toney, M. D. (2005) Reaction specificity in pyridoxal phosphate
enzymes. Arch. Biochem. Biophys. 433, 279–287.
7. Matthews, R. B., and Drummond, J. T. (1990) Providing one-carbon
units for biological methylations: Mechanistic studies on serine hydroxy-
methyltransferase, methylenetetrahydrofolate reductase, and methyl-
tetrahydrofolate-homocysteine methyltransferase. Chem. Rev. 90,
1275–1290.
8. Schirch, V., and Szebenyi, D. M. E. (2005) Serine hydroxymethyl-
transferase revisited. Curr. Opin. Chem. Biol. 9, 482–487.
9. Walsh, C. T., Pascal, R. A., Jr., Johnston, M., Raines, R., Dikshit, D.,
Krantz, A., and Honma, M. (1981) Mechanistic studies on the
pyridoxal phosphate enzyme 1-aminocyclopropane-1-carboxylate
deaminse from Pseudomonas sp. Biochemistry 20, 7509–7519.
10. Hill, R. K., Prakash, S. R., Wiesendanger, R., Angst, W., Martinoni,
B., Arigoni, D., Liu, H.-w., and Walsh, C. T. (1984) Stereochemistry
of the enzymatic ring opening of 1-aminocyclopropanecarboxylic
acid. J. Am. Chem. Soc. 106, 795–796.
35. Bigeleisen, J., and Wolfsberg, M. (1958) Theoretical and experi-
mental aspects of isotope effects in chemical kinetics. Adv. Chem.
Phys. 1, 15–76.
36. Yano, T., Kuramitsu, S., Tanase, S., Morino, Y., and Kagamiyama,
H. (1992) Role of Asp222 in the catalytic mechanism of Escherichia
coli aspartate aminotransferase: The amino acid residue which en-
hances the function of the enzyme-bound coenzyme pyridoxal 50-
phosphate. Biochemistry 31, 5878–5887.
11. Li, K., Du, W., Que, N. L. S., and Liu, H.-w. (1996) Mechanistic
studies of 1-aminocyclopropane-1-carboxylate deaminase: Unique
covalent catalysis by coenzyme B6. J. Am. Chem. Soc. 118, 8763–8764.
12. Stewart, J. M., and Westberg, H. H. (1965) Nucleophilic ring-opening
additions to 1,1-disubstituted cyclopropanes. J. Org. Chem. 30, 1951–
1955.
37. Yano, T., Hinoue, Y., Chen, V. J., Metzler, D. E., Miyahara, I.,
Hirotsu, K., and Kagamiyama, H. (1993) Role of an active site residue

1962 Biochemistry, Vol. 50, No. 11, 2011
Thibodeaux and Liu
analyzed by combination of mutagenesis and coenzyme analog. J.
Mol. Biol. 234, 1218–1229.
38. Gong, J., Hunter, G. A., and Ferreira, G. C. (1998) Aspartate-279 in
aminolevulinate synthase affects enzyme catalysis through enhancing
the function of the pyridoxal 50-phosphate cofactor. Biochemistry 37,
3509–3517.
39. Momany, C., Levdikov, V., Blagova, L., Lima, S., and Phillips, R. S.
(2004) Three-dimensional structure of kynureninase from Pseudomo-
nas fluorescens. Biochemistry 43, 1193–1203.
40. Morozov, Y. V. (1986) Spectroscopic properties, electronic structure,
and photochemical behavior of vitamin B6 and analogs. In Vitamine
B6 pyridoxal phosphate: Chemical, biochemical, and medical aspects
(Dolphin, D., Poulson, R., and Avramovic, O., Eds.) Part A, pp 131-222,
John Wiley & Sons, New York.
41. Eliot, A. C., and Kirsch, J. F. (2002) Modulation of the internal
aldimine pKa’s of 1-aminocyclopropane-1-carboxylate synthase and
aspartate aminotransferase by specific active site residues. Biochem-
istry 41, 3836–3842.
42. Li, Y., Feng, L., and Kirsch, J. F. (1997) Kinetic and spectroscopic
investigations of wild-type and mutant forms of apple 1-aminocyclo-
propane-1-carboxylate synthase. Biochemistry 36, 15477–15488.
43. Zhou, X., and Toney, M. D. (1999) pH studies on the mechanism of
the pyridoxal phosphate-dependent dialkylglycine decarboxylase.
Biochemistry 38, 311–320.
56. Wood, B. M., Chan, K. K., Amyes, T. L., Richard, J. P., and
Gerlt, J. A. (2009) Mechanism of the orotidine 50-monophosphate
decarboxylase-catalyzed reaction: Effect of solvent viscosity on
kinetic constants. Biochemistry 48, 5510.
57. Raber, M. L., Freeman, M. F., and Townsend, C. A. (2009) Dissec-
tion of the stepwise mechanism to β-lactam formation and elucidation
of a rate-determining conformational change in β-lactam synthetase.
J. Biol. Chem. 284, 207–217.
58. Francis, K., and Gadda, G. (2006) Probing the chemical steps of
nitroalkane oxidation catalyzed by 2 nitropropane dioxygenase with
solvent viscosity, pH, and substrate kinetic isotope effects. Biochem-
istry 45, 13889–13898.
59. Scharschmidt, M., Fisher, M. A., and Cleland, W. W. (1984) Varia-
tion of transition-state structure as a function of the nucleotide in
reactions catalyzed by dehydrogenases. 1. Liver alcohol dehydrogen-
ase with benzyl alcohol and yeast aldehyde dehydrogenase with
benzaldehyde. Biochemistry 23, 5471–5478.
60. Hess, R. A., Hengge, A. C., and Cleland, W. W. (1998) Isotope effects
on enzyme-catalyzed acyl transfer from p-nitrophenyl acetate: Con-
certed mechanisms and increased hyperconjugation in the transition
state. J. Am. Chem. Soc. 120, 2703–2709.
61. Lee, J. K., Bain, A. D., and Berti, P. J. (2004) Probing the transition
states of four glucoside hydrolyses with 13C kinetic isotope effects
measured at natural abundance by NMR spectroscopy. J. Am. Chem.
Soc. 126, 3769–3776.
62. Swanson, T., Brooks, H. B., Osterman, A. L., O’Leary, M. H., and
Phillips, M. A. (1998) Carbon-13 isotope effect studies of Trypanoso-
ma brucei ornithine decarboxylase. Biochemistry 37, 14943–14947.
63. O’Leary, M. H. (1988) Transition-state structures in enzyme-cata-
lyzed decarboxylations. Acc. Chem. Res. 21, 450–455.
64. O’Leary, M. H., Richards, D. T., and Hendrickson, D. W. (1970)
Carbon isotope effects on the enzymic decarboxylation of glutamic
acid. J. Am. Chem. Soc. 92, 4435–4440.
65. Erion, M. D., and Walsh, C. T. (1987) 1-Aminocyclopropanepho-
sphonate: Time-dependent inactivation of 1-aminocyclopropanecar-
boxylate deaminase and Bacillus stearothermophilus alanine racemase
by slow dissociation behavior. Biochemistry 26, 3417–3425.
66. Woehl, E. U., Tai, C.-H., Dunn, M. F., and Cook, P. F. (1996)
Formation of the R-aminoacrylate intermediate limits the overall
reaction catalyzed by O-acetylserine sulfhydrylase. Biochemistry 35,
4776–4783.
67. Tidwell, T. T. (1987) Conjugative and substitutive properties of the
cyclopropyl group. In The chemistry of the cyclopropyl group
(Rappoport, Z., Ed.) Vol. 1, pp 565-632, John Wiley & Sons, New York.
68. Kortemme, T., and Creighton, T. E. (1995) Ionization of cysteine
residues at the termini of model R-helical peptides. Relevance to
unusual thiol pKa values in proteins of the thioredoxin family. J. Mol.
Biol. 253, 799–812.
44. Osterman, A. L., Brooks, H. B., Rizo, J., and Phillips, M. A. (1997)
Role of Arg-277 in the binding of pyridoxal 50-phosphate to Trypa-
nosoma brucei ornithine decarboxylase. Biochemistry 36, 4558–4567.
45. Hayashi, H., Mizuguchi, H., and Kagamiyama, H. (1993) Rat liver
aromatic L-amino acid decarboxylase: Spectroscopic and kinetic
analysis of the coenzyme and reaction intermediates. Biochemistry
32, 812–818.
46. Metzler, C. M., Viswanath, R., and Metzler, D. E. (1991) Equilibria
and absorption spectra of tryptophanase. J. Biol. Chem. 266, 9374–
9381.
47. Karsten, W. E., Ohshiro, T., Izumi, Y., and Cook, P. F. (2005)
Reaction of serine-glyoxylate aminotransferase with the alternative
substrate ketomalonate indicates rate-limiting protonation of a qui-
nonoid intermediate. Biochemistry 44, 15930–15936.
48. Karsten, W. E., Ohshiro, T., Izumi, Y., and Cook, P. F. (2001) Initial
velocity, spectral, and pH studies of the serine-glyoxylate aminotrans-
ferase from Hyphomicrobium methylovorum. Arch. Biochem. Biophys.
388, 267–275.
49. Grinnell, J., and Fornwalt, H. J. (1936) The viscosity of
deuterium oxide and its mixtures with water at 25 °C. J. Chem. Phys.
4, 30–33.
50. Cerjan, C., and Barnett, R. E. (1972) Viscosity dependence of a
putative diffusion-limited reaction. J. Phys. Chem. 76, 1192–1195.
51. Nakatani, H., and Dunford, H. B. (1979) Meaning of diffusion-
controlled association rate constants in enzymology. J. Phys. Chem.
83, 2662–2665.
52. Brouwer, A. C., and Kirsch, J. F. (1982) Investigation of diffusion-
limited rates of chymotrypsin reactions by viscosity variation. Bio-
chemistry 21, 1302–1307.
53. Hardy, L. W., and Kirsch, J. F. (1984) Diffusion-limited component
of reactions catalyzed by Bacillus cereus β-lactamase. Biochemistry 23,
1275–1282.
54. Kurz, L. C., Weitkamp, E., and Frieden, C. (1987) Adenosine
deaminase: Viscosity studies and the mechanism of binding of sub-
strate and of ground- and transition-state analogue inhibitors. Bio-
chemistry 26, 3027–3032.
55. Adams, J. A., and Taylor, S. S. (1992) Energetic limits of phospho-
transfer in the catalytic subunit of cAMP dependent protein kinase as
measured by viscosity experiments. Biochemistry 31, 8516–8522.
69. Davies, C., Heath, R. J., White, S. W., and Rock, C. O. (2000) The 1.8
˚
A crystal structure and active-site architecture of β-ketoacyl-acyl
carrier protein synthase III (FabH) from Escherichia coli. Structure
8, 185–195.
70. Snook, C. F., Tipton, P. A., and Beamer, L. J. (2003) Crystal structure
of GDP-mannose dehydrogenase: A key enzyme of alginate biosyn-
thesis in P. aeruginosa. Biochemistry 42, 4658–4668.
71. Anderson, V. E., Ruszczycky, M. W., and Harris, M. E. (2006)
Activation of oxygen nucleophiles in enzyme catalysis. Chem. Rev.
106, 3236–3251.
72. Brzovic, P., Holbrook, E. L., Greene, R. C., and Dunn, M. F. (1990)
Reaction mechanism of Escherichia coli cystathionine γ-synthase:
Direct evidence for a pyridoxamine derivative of vinylglyoxylate as
a key intermediate in pyridoxal phosphate dependent γ-elimination
and γ-replacement reactions. Biochemistry 29, 442–451.