The: In vivo anti-tumor effect of curcumin derivative (2 E,6 E)-2,6-bis(4-hydroxy-3-methoxybenzylidene)cyclohexanone (BHMC) on 4T1 breast cancer cells

Article abstract of DOI:10.1039/c7ra06580a

Curcumin is one of the promising natural products extracted from the rhizomes of curcuma longa and has been extensively investigated by researchers to explore its potential as a chemopreventive and therapeutic agent against several chronic diseases. To further enhance the cytotoxic potential of curcumin, its derivative (2E,6E)-2,6-bis(4-hydroxy-3-methoxybenzylidene)cyclohexanone (BHMC) has been synthesized and investigated, and its antitumor effect on tested on 4T1 challenged mice. BHMC was recorded with in vitro cytotoxicity on murine 4T1 breast cancer cells with IC₅₀ value 13.66 μM, which was 2 times lower than curcumin after 72 hours of treatment. An in vivo study indicated that BHMC possessed antitumor effect on the 4T1 cells of the challenged mice by induction of apoptosis, antiproliferation, anti-inflammation and antimetastasis. This effect is better compared to curcumin treatment at the same evaluated concentration. Thus, BHMC is a potential antitumor agent against breast cancer.

Full text of DOI:10.1039/c7ra06580a

RSC Advances
View Article Online
View Journal | View Issue
PAPER
The in vivo anti-tumor effect of curcumin derivative
(2E,6E)-2,6-bis(4-hydroxy-3-methoxybenzylidene)
cyclohexanone (BHMC) on 4T1 breast cancer cells
Cite this: RSC Adv., 2017, 7, 36185
Nursyamirah Abd Razak,a M. Nadeem Akhtar,b Nadiah Abu,c Wan Yong Ho,d
e
Sheau Wei Tan,a Seema Zareen,b Saiful Nizam bin Taj-ud-din,b Kamariah Long,
f
ag
*
*
Noorjahan Banu Alitheen and Swee Keong Yeap
Curcumin is one of the promising natural products extracted from the rhizomes of curcuma longa and has
been extensively investigated by researchers to explore its potential as a chemopreventive and therapeutic
agent against several chronic diseases. To further enhance the cytotoxic potential of curcumin, its derivative
(2E,6E)-2,6-bis(4-hydroxy-3-methoxybenzylidene)cyclohexanone (BHMC) has been synthesized and
investigated, and its antitumor effect on tested on 4T1 challenged mice. BHMC was recorded with in
vitro cytotoxicity on murine 4T1 breast cancer cells with IC50 value 13.66 mM, which was 2 times lower
than curcumin after 72 hours of treatment. An in vivo study indicated that BHMC possessed antitumor
effect on the 4T1 cells of the challenged mice by induction of apoptosis, antiproliferation, anti-
inflammation and antimetastasis. This effect is better compared to curcumin treatment at the same
evaluated concentration. Thus, BHMC is a potential antitumor agent against breast cancer.
Received 13th June 2017
Accepted 14th July 2017
DOI: 10.1039/c7ra06580a
rsc.li/rsc-advances
a need to discover potential treatment for TNBC.2 Natural
compound has been proposed as safe and potential agent
against TNBC.3 Among the natural compounds, curcumin that
present in the spice turmeric has been reported with antitumor
effect on TNBC.4,5 Resolving cancer challenged by natural
product hold better potential with the introduction of chemical
synthesis, which resolve the availability of the compounds of
interest.6 On the other hand, synthetic compounds also help to
improve the drug sensitivity and specicity while reduce the
toxicity via chemical modication.7
1. Introduction
Cancer is still among the leading causes of death worldwide
with breast cancer as the primary cancer incidence for women.1
Triple negative breast cancer (TNBC) is the subtype of breast
cancer with absence of estrogen receptor, progesterone receptor
and human epidermal growth factor receptor 2 (HER2). TNBC is
highly aggressive associated with high event of relapse, metas-
tasis and poor survival. Chemotherapy is the common strategy
among the limited treatment options for TNBC. However, TNBC
may possess resistance against standard chemotherapeutic
drugs such as anthracycline and taxane if they have been
previously used as adjuvant or neoadjuvant. Thus, there is
Curcumin (Fig. 1A) is one of the classical natural product
extracted from the rhizomes of Curcuma longa (turmeric) and
named it curcumin.8 Curcumin mainly identied as
aInstitute of Bioscience, Universiti Putra Malaysia, Serdang, Selangor, Malaysia.
E-mail: skyeap2005@gmail.com; Tel: +60-3-88006901
bBio-aromatic Research Center of Excellence, Faculty of Industrial Sciences
&
Technology, Universiti Malaysia Pahang, Lebuhraya Tun Razak, Kuantan 26300,
Pahang, Malaysia
cUKM Molecular Biology Institute (UMBI), UKM Medical Centre, Jalan Yaa'cob Latiff,
Bandar Tun Razak, Cheras 56000, Kuala Lumpur, Malaysia
dSchool of Biomedical Sciences, The University of Nottingham Malaysia Campus, Jalan
Broga, Semenyih 43500, Selangor, Malaysia
eMalaysian Agricultural Research and Development Institute (MARDI), Serdang,
Selangor 43400, Malaysia
fDepartment of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular
Sciences, Universiti Putra Malaysia, Serdang, Selangor 43400, Malaysia. E-mail:
noorjahan@upm.edu.my
gChina-ASEAN College of Marine Sciences, Xiamen University Malaysia, Jalan
Fig. 1 The chemical structures of (A) curcumin and (B) 2,6-bis-(4-
Sunsuria, Bandar Sunsuria, Sepang 43900, Selangor, Malaysia
hydroxy-3-methoxybenzylidene)cyclohexanone (BHMC).
This journal is © The Royal Society of Chemistry 2017
RSC Adv., 2017, 7, 36185–36192 | 36185

View Article Online
RSC Advances
Paper
antioxidant, anti-inammatory,9–12 anti-cancer9,13–17 and anti- chromatography. The column was eluted with ethyl acetate and
acetylcholinesterase18 activities. Several biological activities hexane (40 : 60%). Yield 76%; yellow powder, UV (CHCI3): lmax
including the hepato- and nephro-protective,19–22 thrombosis 302, 339 nm; IR (CHCI3 cmꢂ1): nmax 3393 (OH), 2928 (Ar-C–H)
1
suppressing,23 myocardial infarction protective,24,25 curcumin 1618 (C]O), 1527 (Ar C]C str.); H-NMR (600 MHz, CDCI3):
has proved to be potential candidate for future drug discovery. d in ppm: 7.78 (bs, 2H, –C]C–H), 7.12 (dd, 2H, J ¼ 8.34, 1.92 Hz,
In spite of several pharmacological properties, curcumin that H-60, H-600), 7.02 (d, 2H, J ¼ 1.92 Hz, H-20, H-200), 6.90 (d, 2H, J ¼
was classied under “pans-assay interference compounds” and 7.90 Hz, J ¼ 8.34, H-50, H-500), 3.91 (s, 6H, 2 ꢁ OCH3, C-30, C-300),
“invalid metabolic panaceas” still facing several liabilities 2.90 (m, 4H, H-3, H-5), 1.82 (m, 2H, H-4). 13C-NMR (150 MHz,
including instability, poor solubility, poor selectivity and CDCI3) d in ppm: 190.41, (C]O), 151.89 (C-40, C-400), 149.71 (C-
multiple modes of assay interference particularly to the in vitro 30, 300), 136.83, (–C]C–H), 134.80 (C-2, 6), 132.23 (C-10, 100)
based assays.26,27 Thus, more efforts to improve efficacy, selec- 128.36, (C-60, 600, 20, 200), 115.34, (C-50, 500), (56.07, OCH3), 28.74,
tivity of curcumin are needed. In recent years, chemical modi- (C-3, C-5), (23.42, C-4). MS: m/z ¼ 366 (100%) [M]+, EI-MS m/z
cation of curcuminoids has been increasingly investigated. For (rel. int.) 351 (56), 335 (68). 321 (17), 309 (12), 161 (24), 131 (15).
example, various curcumin analogues have been reported with HR-EIMS C22H22O5. 366.231 calc. for 366.229.
enhance antitumor effect than curcumin.28 A curcumin deriva-
tive, 2,6-bis(4-hydroxy-3-methoxybenzylidene)cyclohexanone HPLC attached with ChromNAV-soware (JASCO Corporation,
The purity of compound was determined by using JASCO-
(BHMC) (Fig. 1B) has been synthesised with diketone moiety Tokyo, Japan). The column used XBridge RP-18 (5 mm particle
of curcumin has been replaced with mono cyclic ketone. To size, 4.6 ꢁ 150 mm i.d.; Waters Corporation, Wexford, Ireland)
avoid false positive results contributed by the assay interference kept at ambient temperature. Injection volume of 20 mL, ow
character of curcumin, in vivo validation are especially on those rate at 1 mL minꢂ1. and detector wavelength was adjusted at 250
potential curcumin analog.27 This synthetic curcuminoid and 366 nm, mobile phase H2O and MeOH (40 : 60), retention
analogue has been reported with antinociceptive effect in mice time (tR) 11.66 min. The percentage of purity was determined by
through inhibition of various inammatory mediators.29–31 calculating the peak purity method automatically.36
Inammation has been correlated with progression of triple
negative breast cancer including promotion of cancer cells
2.2. In vitro cell viability assay
invasion and migration.32 The anti-inammatory effect of
Murine 4T1 TNBC cells were purchased from American Type
Culture Collection and cultured in RPMI-1640 medium (Sigma-
Aldrich, USA) supplemented with 10% Fetal Bovine Serum (FBS)
(Gibco, Thermo Fisher Scientic, USA) at 37 C, 5% CO2. Cell
BHMC has been evaluated in vitro29 and in vivo.30 BHMC has
been reported with cytotoxic effect on estrogen dependent MCF-
7 cells.33 In addition, BHMC was reported with greater in vitro
ꢀ
cytotoxic effect than curcumin to TNBC MDA-MB-231 cells.34
viability was determined by MTT assay where 4T1 cells were
However, the in vivo antitumor effect of BHMC particularly on
seeded (0.8 ꢁ 105 cells per mL) in 96 well plate overnight. Then,
TNBC was not evaluated. 4T1 has been reported as excellent
BHMC and curcumin (Sigma-Aldrich, USA) were added to the
model system for TNBC study as its physical location, prolifer-
cells at concentration ranging within 30–0.47 mg mLꢂ1 by two
ative, metastatic and inammatory characteristics mimic
ꢀ
fold serial dilution and further incubated at 37 C, 5% CO2 for
human TNBC.32,35 In this study, 2,6-bis(4-hydroxy-3-
methoxybenzylidene)cyclohexanone (BHMC) was synthesized
and its antitumor effect was compared with curcumin using in
vivo 4T1 mouse model.
24, 48 or 72 hours. Aer the incubation time, MTT solution
(5 mg mLꢂ1) was added into all wells and further incubated for 4
hours. The purple formazon formed was then dissolved by 100
mL of DMSO (Sigma-Aldrich, USA) and the absorbance was
measured at 570 nm using mQuant plate reader (Bio-Tek
2. Materials and methods
Instrument, USA). Cell viability was calculated as below:
2.1. Synthesis of BHMC
Cell viability (%) ¼ (absorbance of treated well)/
Curcumin (C7727) was purchased from Sigma-Aldrich (USA).
(absorbance of control well) ꢁ 100%
BHMC was chemically synthesized from 4-hydroxy-3-
methoxybenzaldehyde (cyclohexanone). Briey, a mixture of 3-
methoxy-4-hydroxy (vanillin) (40 mmol, 2 equiv.) and cyclohex-
IC50 (concentration that reduce 50% of cell viability
anone (20 mmol, 1 equiv.) was dissolved in 25 mL of absolute
comparing to untreated cells) was obtained from the graph of
ethanol. The mixture was heated at 50 ꢀC for half hour and conc.
cell viability vs. concentration.
HCl (2.0 mL) was added drop wise over 5 min to the stirred
mixture. The mixture was further stirred for one hours and le
over night in refrigerator. The mixture was dissolved in ice water
2.3. In vivo antitumor effect of BHMC
(500 mL) and transferred into separating funnel. A yellow Female mice (n ¼ 18, 6 weeks old) were purchased from
viscous product was oating on the surface of water, which was Comparative Medicine and Technology Unit (COMeT), Institute
extracted with ethyl acetate (250 mL ꢁ 3 times). The ethyl of Bioscience, Universiti Putra Malaysia. The mice were fed with
acetate layer was collected, dried over rotary evaporator and distilled water and standard pellets ad libitum at room
then pass to sodium sulphate anhydrous. The crude product temperature and 12 hours of day/dark light cycles. This study
was subjected to further purication by silica gel column was conducted according to the guidelines and was approved by
36186 | RSC Adv., 2017, 7, 36185–36192
This journal is © The Royal Society of Chemistry 2017

View Article Online
Paper
RSC Advances
Institution of Animal Care and Use Committee (IACUC), Uni- Evagreen Master Mix (NEX Diagnostics, Korea) using Eco Real
ꢀ
versiti Putra Malaysia (UPM/IACUC/AUP-R009/2015). All animal Time PCR system (Illumina, USA) by the following steps: 95 C
ꢀ
ꢀ
experiment was carried out in accordance with the Malaysia for 2 min, 40 cycles of 95 C for 10 s, 60 C for 45 s and acqui-
Animals Act 1953 (Revised-2006) under Malaysian Veterinary sition of uorescent signal. Expression of the targeted genes in
Council (MVC) for animal experiments.
the samples were normalized by b-actin and the fold change in
Aer 2 weeks of acclimatization of mice (body weight ꢃ22 g), the expression of each target gene was calculated by the Eco 48
mice were separated into 3 groups and challenged with 1 ꢁ 105 Soware (Illumina, USA) using the efficiency-corrected method.
4T1 cells per mice subcutaneously. BHMC and curcumin were
dissolved in olive oil. Untreated mice (n ¼ 6) were fed with olive
2.7. Serum IL-1b and TNF-a levels
oil, curcumin 50 mice were orally fed with 50 mg kgꢂ1 body
IL-1b and TNF-a cytokines level in the serum were measured by
weight (BW) of curcumin (Sigma-Aldrich, USA) and BHMC 50
ELISA kits (R&D system, USA) according to the manufacturer's
mice were orally fed with 50 mg kgꢂ1 BW of BHMC for 28 days.
protocol.
Throughout the experiment period, tumors were measured
using a caliper and the tumor volumes were calculated by the
following formula:
2.8. Secondary tumor regeneration
Tumor was harvested and dissociated using accutase (Innova-
Tumor volume ¼ (d2 ꢁ a)/2
tive Cell Tech, USA). Mice (n ¼ 10, 8 weeks old) were separated
into two groups. All mice were injected subcutaneously with 1 ꢁ
106 cells harvested from untreated tumor in the lower le
abdomen. On the other hand, mice in group 1 and 2 were
injected subcutaneously with 1 ꢁ 106 cells harvested from the
tumor of curcumin 50 mg kgꢂ1 BW mice and BHMC 50 mg kgꢂ1
BW tumor in the lower right abdomen, respectively. Tumor
progression was then observed for 21 days.
d ¼ tumor measurement at the widest point a ¼ tumor
dimension at the longest point.
Aer the 28 days of treatment, mice were amnestied with
isourane, and euthanised by cervical dislocation. Serum, lung
and tumor were collected and subjected to the following assays.
Tumor per body weight ratio was calculated.
2.4. Hematoxylin and eosin (H&E) histology analysis of
tumor
3. Results
3.1. In vitro cytotoxicity of BHMC on 4T1 cells
Harvested tumor was xed in 10% formalin, embedded in
paraffin, section and stained with H&E. Histology of the tumor
was viewed under bright-eld microscope (Nikon, Japan). Even
of mitotic cells were counted from ve random elds of the
slides.
BHMC was prepared as previously described.31 The in vitro
cytotoxicity of BHMC was compared with curcumin on 4T1 cells
by MTT assay. As shown in Table 1, both BHMC and curcumin
were cytotoxic to 4T1 cells in time dependent manner where the
IC50 value of both treatment reduced from 24 to 72 hours. More
interestingly, IC50 value of BHMC at 48 and 72 hours were
approximately 2 folds lower than curcumin on 4T1 cells.
2.5. Lung clonogenic assay
Lung was harvested, washed with ice-cold PBS, minced, treated
with 2 mg mLꢂ1 collagenase type IV for 1 hour at 37 ꢀC and
ltered through 70 mm strainer. Then, the ltrate was pelleted at
2000 rpm for 5 minutes. The lung pellet was cultured in 10 mL
of RPMI-1640 supplemented with 10% Fetal Bovine Serum (FBS)
(Gibco, Thermo Fisher Scientic, USA) at 37 ꢀC, 5% CO2 for 10
days. Aer the incubation period, all wells were xed with
methanol for 1 hour and stained with 0.5% crystal violet for 2
hours. Number of colonies formed per organ was counted for
untreated, curcumin treated and BHMC treated groups.
3.2. In vivo antitumor effect of BHMC on 4T1 challenged
mice
To evaluate the antitumor effect of BHMC on breast cancer,
mice challenged with 4T1 breast cancer cells were subjected to
50 mg kgꢂ1 BW of curcumin or BHMC treatment. Tumor start to
observe at day 5 in untreated mice post-inoculation of 4T1 cells.
Both curcumin and BHMC treated mice were observed with 5
and 9 days delay of tumor formation comparing to the
untreated mice (Fig. 2A). Aer 28 days of treatment, without
changes of the body weight were observed in all the mice
(Fig. 2B), tumor burden of curcumin and BHMC treated mice
were 1.86 and 3.10 folds smaller than the untreated mice
(Fig. 2C and D). Based on the histology analysis, tumor
2.6. Expression of MMP9, TNF-a, IL-1b, IL-4, G-CSF and NF-
kB in tumor by quantitative reverse transcription PCR (RT-
qPCR)
Total RNA from the tumor was extracted using RNeasy mini kit
(Qiagen, USA) according to the manufacturer's protocol. cDNA
was synthesized from 1 mg of total RNA using NEXscript cDNA
synthesis kit (NEX Diagnostics, Korea) according to the manu-
facturer's protocols. Primers for target genes MMP9, TNF-a, IL-
1b, IL-4, G-CSF, NF-kB and house-keeping gene b-actin were
listed in Table 2. Evaluation of primer efficiency and expression
of the targeted genes were performed using NEXpro qPCR
Table 1 IC50 value (mM) of BHMC and curcumin on murine 4T1 breast
cancer cells
24 h
48 h
72 h
BHMC (mM)
Curcumin (mM)
54.64 ꢄ 2.33
81.44 ꢄ 2.44
21.66 ꢄ 2.66
48.86 ꢄ 3.46
13.66 ꢄ 3.24
27.15 ꢄ 2.36
This journal is © The Royal Society of Chemistry 2017
RSC Adv., 2017, 7, 36185–36192 | 36187

View Article Online
RSC Advances
Paper
Fig. 2 (A) Tumor volume change; (B) body weight change; (C) representative image of tumor harvested (D) tumor/BW ratio of untreated,
curcumin 50 mg kgꢂ1 BW mice and BHMC 50 mg kgꢂ1 BW 4T1 challenged mice. Significant values were calculated against untreated group (*P <
0.05).
harvested from untreated mice was observed with highest of MMP9, TNF-a, IL-1b, IL-4, G-CSF and NF-kB genes in the
number mitotic cells. On the other hand, curcumin and BHMC tumor of untreated, curcumin 50 and BHMC 50 treated mice
treated mice were recorded with 1.67 and 3.75 folds less number were evaluated by RT-qPCR (Fig. 5). BHMC treatment was able
of mitotic cells in the tumor (Fig. 3), which indicated that lower to suppress expression of MMP9, TNF-a, IL-1b, IL-4, G-CSF and
tumor burden in the curcumin and BHMC treated mice maybe NF-kB genes comparing to the untreated mice. On the other
contributed by anti-proliferation effect. In addition, clonogenic hand, curcumin treated was able to suppress expression of TNF-
assay has shown that high number of 4T1 breast cancer cells a, IL-1b, IL-4, G-CSF and NF-kB genes comparing to the
have metastasized to lung in the untreated mice. On the other untreated mice. However, expression of MMP9 was not signi-
hand, mice treated with curcumin and BHMC were observed cantly regulated by curcumin treatment (Fig. 5). Level of IL-1b
with lower event of 4T1 metastasis into lung indicating that and TNF-a were further validated by checking serum IL-1b and
both treatment possess anti-metastasis effect (Fig. 4). Overall, TNF-a by ELISA. Both curcumin and BHMC treatment were able
antitumor effect of BHMC was better comparing to curcumin as to reduce the serum level of IL-1b and TNF-a comparing to the
the BHMC treated mice was recorded with lower tumor burden untreated mice (Fig. 6).
(Fig. 2), mitotic cells in the tumor (Fig. 3) and lung metastasis
(Fig. 4) comparing to the curcumin treated mice.
Furthermore, regeneration capacity of the tumor harvested
from untreated and curcumin or BHMC treated mice were
To understand the regulation of inammation and metas- evaluated by transplanting 1 million cells to healthy mice.
tasis related genes by both curcumin and BHMC treatment, When injected with tumor cells harvested from untreated and
which contribute to the delay of tumor progression, expression BHMC treated 4T1 challenged mice, tumor/BW ratio generated
Fig. 3 (A) Histological staining of the tumor. Red circles indicate mitotic cells. (B) Numbers of mitotic cells per groups. Significant values were
calculated against untreated group (*P < 0.05).
36188 | RSC Adv., 2017, 7, 36185–36192
This journal is © The Royal Society of Chemistry 2017

View Article Online
Paper
RSC Advances
dicarbonyl or b-diketone class of compounds, which possess
several biological activities including important building blocks
for the synthesis of core heterocycles such as pyrazole, iso-
xazole, and triazole in medicinal chemistry.39 Curcumin has
been identied as strong anti-inammatory agents that has
broad spectrum of antitumor activity.35 Structure activity rela-
tionship of curcumin and its analogous is well established in
the literatures.40,41 Curcumin was reported as potential agents
targeting TNBC as recent study has reported that it was more
sensitive to human TNBC MDA-MB-231 cells than human
estrogen dependent MCF-7 breast cancer cells.42 A part of
interesting biological activities, still curcumin not recom-
mended for therapeutic potential because of low bioavail-
ability.26,27 Therefore, there is need to modify its structure to
improve the bioavailability, stability and selectivity. Recent
study further support the idea that synthetic chemistry help to
enhance the efficacy and safety of known natural metabolites.43
For examples, curcumin analogues were reported with enhance
Fig. 4 RT-qPCR analysis on expression of MMP9, TNF-a, IL-1b, IL-4, cytotoxicity on various types of cancer cells.28,44 In this study,
G-CSF and NF-kB genes in the tumor of untreated, curcumin 50 mg
BHMC that is the analog of curcumin was synthesized. Previ-
kgꢂ1 BW mice and BHMC 50 mg kgꢂ1 BW 4T1 challenged mice. Results
ously, the antinociceptive activity31 and anti-inammatory
were indicated in the b-actin normalized fold changes comparing to
the untreated control. Fold changes >2 were indicated as significant.
effect29,30 of BHMC were evaluated. Unlike curcumin that
contain enol moiety, BHMC possessing a,b-unsaturated bis-
enone system which is an essential for the several biological
activities including anticancer effect as in chalcones and bis-
from the untreated tumor cells was approximate 2.8 fold higher
chalcones.41 Such compounds with conjugated enones or
than the tumor generated from BHMC group. On the other
enone-like compounds exhibited potential interaction with
hand, tumor generated from curcumin treated mice was only
Michael acceptor can react selectively with target nucleo-
1.25 fold lower than tumor generated from the untreated mice
philes.41 This structure may contributed to the greater cytotoxic
(Fig. 7).
effect of BHMC on 4T1 cells in vitro, which was similar to the
previous in vitro studies on human TBNC MDA-MB-231 cells.34
In addition, in vivo antitumor effect of BHMC was compared
with curcumin using mouse 4T1 model. Mice challenged with
4. Discussion
Prognosis of TNBC remains poor in spite of advance in under-
standing of breast cancer pathologic features and molecular
characteristics.37 TNBC are more difficult to treat as they carry
fewer targets and generally develop resistant to conventional
chemotherapeutic agents.38 Thus, there is a need to continue
the discovery of novel effective cytotoxic agents against TNBC
with minimum or no toxic side effect. Curcumin is a polyphenol
presents in the turmeric Curcumina longa. It belongs to the 1,3-
4T1 has been used as in vivo model to evaluate antitumor and
antimetastasis effect of chemicals on TNBC.45,46 In this study,
untreated mice was recorded with tumor development on day 3
post challenged. In addition, high tumor mitotic event and lung
metastasis were observed too. On the other hand, both curcu-
min and BHMC treatment were found with delayed tumor
formation. Curcumin was reported to suppress cell
Fig. 6 Representative images and bar chart of the colonies formed in
Fig. 5 Serum IL-1b and TNF-a level of untreated, curcumin 50 mg lung of untreated, curcumin 50 mg kgꢂ1 BW mice and BHMC 50 mg
kgꢂ1 BW mice and BHMC 50 mg kgꢂ1 BW 4T1 challenged mice. kgꢂ1 BW 4T1 challenged mice. Significant values were calculated
Significant values were calculated against untreated group (*P < 0.05). against untreated group (*P < 0.05).
This journal is © The Royal Society of Chemistry 2017
RSC Adv., 2017, 7, 36185–36192 | 36189

View Article Online
RSC Advances
Paper
Fig. 7 Tumor/BW ratio of mice transplanted with 1 ꢁ 106 cells harvested from untreated tumor in the lower left abdomen and 1 ꢁ 106 cells
harvested from curcumin 50 mg kgꢂ1 BW mice or BHMC 50 mg kgꢂ1 BW tumor in the lower right abdomen. Significant values were calculated
against untreated group (*P < 0.05).
Table 2 Primer sequences for qRT-PCR gene expression study
Primer sequence (50–30)
Gene
Forward
Reverse
MMP9
TNF-a
IL-1b
GTCTTCCTGGGCAAGCAGTA
CATCTTCTCAAAATTCGAGTGACAA
CGCCAATGACTCAGAGGAAGA
AGATGGATGTGCCAAACGTCCTCA
CTCAGAAATGTTTGACCTCCAG
GTG CGTCTGGCCTGGTAAG
TCCTTCCTGGGCATGGAG
CTGGACAGAAACCCCACTTC
TGGGAGTAGACAAGGTACAACCC
AGGGCGTCATTCAGGATGAA
AATATGCGAAGCACCTTGGAAGCC
TGACAAGCAGAAAGTCCTTCAG
CCCAGGATGTG TACTCAGAGC
AGGAGGAGCAATGATCTTGATCTT
IL-4
G-CSF
NF-kB
b-Actin
proliferation of TNBC in vitro.47 Lower number of mitotic cells to 40 mg kgꢂ1 BW.52 In addition, TNBC was also known with
observed in the tumor of curcumin and BHMC treated mice high rate of recurrence.48 In this study, recurrence of untreated
supported the report on the in vitro antiproliferation effect and tumor with tumor harvested from curcumin or BHMC treat-
given the idea that lower tumor burden in the treated mice ment were compared by injected them in the secondary healthy
maybe contributed by the inhibition of 4T1 cells proliferation. mice. Aer 21 days of secondary challenge, tumor burden
The antiproliferative effect of BHMC has been correlated to its originated from BHMC treated mice were remain lowest
interactions with nuclear type II sites.33
comparing those from untreated or curcumin treated mice.
TNBC is a type of highly metastatic cancer.48 Inammation This result indicate that BHMC may even help to delay recur-
was found to promote tumor cell proliferation and expression of rence of TNBC even better than curcumin.
MMP9 that support the cancer metastasis.49 Curcumin has been
reported with in vitro antimetastatic effect on breast cancer via
suppression of MMP-9 (ref. 50) and suppression of inamma-
5. Conclusions
tion.51 In this study, both curcumin and BHMC were found with
lower lung metastasis comparing to untreated mice. This anti-
metastatic effect maybe contributed by the suppression of
inammatory and MMP9 as observed in the gene expression
study. Although both curcumin and BHMC show similar inhi-
bition on inammatory related genes, signicant suppression
of MMP9 expression by BHMC may contribute to its better
antimetastatic effect than curcumin. Previous study has shown
that curcumin possessed substantial antitumor and antimeta-
stasis when treated at 800 mg kgꢂ1 BW.35 Encapsulation of
curcumin with dendrosome help to reduce the effective dosage
This study reported that the synthesis BHMC, which is an
analogue of curcumin showed better in vitro cytotoxicity and in
vivo antitumor effect on 4T1 TNBC model than curcumin via
suppression of inammation, cancer cells proliferation and
metastasis.
Conflict of interest
All authors in this article declare no conict of interest.
36190 | RSC Adv., 2017, 7, 36185–36192
This journal is © The Royal Society of Chemistry 2017

View Article Online
Paper
RSC Advances
26 K. M. Nelson, J. L. Dahlin, J. Bisson, J. Graham, G. F. Pauli
and M. A. Walters, J. Med. Chem., 2017, 60, 1620–1637.
27 K. M. Nelson, J. L. Dahlin, J. Bisson, J. Graham, G. F. Paulin
and M. A. Walters, ACS Med. Chem. Lett., 2017, 8, 467–470.
28 C. D. Mock, B. C. Jordan and C. Selvam, RSC Adv., 2015, 5,
75575–75588.
Acknowledgements
This study was supported by Universiti Malaysia Pahang
(internal grant no. RDU 150109 and 150349), MARDI internal
grant (vote no. 6300300) and MAKNA cancer research award
2013 (vote no. 6300123).
29 C. L. Tham, C. Y. Liew, K. W. Lam, A. S. Mohamad,
M. K. Kim, Y. K. Cheah, Z. A. Zakaria, M. R. Sulaiman,
N. H. Lajis and D. A. Israf, Eur. J. Pharmacol., 2010, 628,
247–254.
References
1 C. Fitzmaurice, C. Allen, R. M. Barber, L. Barregard,
Z. A. Bhutta, H. Brenner, et al., JAMA Oncol., 2015, 1, 505–527. 30 C. L. Tham, K. W. Lam, R. Rajajendram, Y. K. Cheah,
2 F. Andre and C. C. Zielinski, Ann. Oncol., 2012, 23, vi46–vi51.
3 M. T. Cook, Y. Liang, C. Besch-Williford and S. M. Hyder,
Breast Cancer, 2016, 9, 9–19.
4 P. Thulasiraman, D. J. McAndrews and I. Q. Mohiudddin,
BMC Cancer, 2014, 14, 724.
5 X. D. Sun, X. E. Liu and D. S. Huang, Mol. Med. Rep., 2012, 6,
1267–1270.
6 S. Neidle and D. E. Thurston, Nat. Rev. Cancer, 2005, 5, 285–
296.
M. R. Sulaiman, N. H. Lajis, M. K. Kim and D. A. Israf, Eur.
J. Pharmacol., 2011, 652, 136–144.
31 L. Ming-Tatt, S. I. Khalivulla, M. N. Akhtar, A. S. Mohamad,
E. K. Perimal, M. H. Khalid, A. Akira, N. Lajis, D. S. Israf and
M. R. Sulaiman, Basic Clin. Pharmacol. Toxicol., 2012, 110,
275–282.
32 D. Lv, Y. Zhang, H. J. Kim, L. Zhang and X. Ma, Cell. Mol.
Immunol., 2013, 10, 303–310.
33 B. M. Markaverich, T. H. Schauweker, R. R. Gregory,
M. Varma, F. S. Kittrell, D. Medina and R. S. Varma, Cancer
Res., 1992, 52, 2482–2488.
7 A. L. Demain and P. Vaishnav, Microb. Biotechnol., 2011, 4,
687–699.
8 S. C. Gupta, S. Patchva, W. Koh and B. B. Aggarwal, Clin. Exp. 34 B. Yadav, S. Taurin, R. J. Rosengren, M. Schumacher,
Pharmacol. Physiol., 2012, 39, 283–299.
9 B. B. Aggarwal, A. Kumar and A. C. Bharti, Anticancer Res.,
2003, 23, 363–398.
10 O. P. Sharma, Biochem. Pharmacol., 1976, 25(15), 1811–1812.
11 A. J. Ruby, G. Kuttan, K. D. Babu, K. N. Rajasekharan and
R. Kuttan, Cancer Lett., 1995, 94, 79–83.
12 Y. Sugiyama, S. Kawakishi and T. Osawa, Biochem.
Pharmacol., 1996, 52, 519–525.
13 R. C. Srimal and B. N. Dhawan, J. Pharm. Pharmacol., 1973,
25, 447–452.
14 W. C. Jordan and C. R. Drew, J. Natl. Med. Assoc., 1996, 88,
333.
M. Diederich, T. J. Somers-Edgar and L. Larsen, Bioorg.
Med. Chem. Lett., 2010, 18, 6701–6707.
35 M. Singh, I. Ramos, D. Asafu-Adjei, W. Quispe-Tintaya,
D. Chandra, A. Jahangir, X. Zang, B. B. Aggarwal and
C. Gravekamp, Cancer Med., 2013, 2, 571–582.
36 A. S. Mohamad, M. N. Akhtar, S. I. Khalivulla, E. K. Perimal,
M. H. Khalid, H. M. Ong, S. Zareen, A. Akira, D. A. Isra,
N. Lajis and M. R. Sulaiman, Basic Clin. Pharmacol.
Toxicol., 2011, 108, 400–405.
37 M. Arnedos, C. Bihan, S. Delaloge and F. Andre, Ther. Adv.
Med. Oncol., 2012, 4, 195–210.
38 W. Wang, E. R. Rayburn, S. E. Velu, D. Chen, D. H. Nadkarni,
S. Murugesan, D. Chen and R. Zhang, Breast Cancer Res.
Treat., 2010, 123, 321–331.
15 M. K. Kim, G. J. Choi and H. S. Lee, J. Agric. Food Chem., 2003,
51, 1578–1581.
16 R. C. Reddy, P. G. Vatsala, V. G. Keshamouni, 39 J. Pradhan and A. Goyal, Int. J. Biol., Pharm. Allied Sci., 2015,
G. Padmanaban and P. N. Rangarajan, Biochem. Biophys.
Res. Commun., 2005, 326(2), 472–474.
17 R. Kuttan, P. Bhanumathy, K. Nirmala and M. C. George,
Cancer Lett., 1985, 29(2), 197–202.
4, 1–18.
40 H. Yang, Z. Du, W. Wang, M. Song, K. Sanidad, E. Sukamtoh,
J. Zheng, L. Tian, H. Xian, Z. Liu and G. Zhang, J. Agric. Food
Chem., 2017, 65, 4509–4515.
18 X. Zhang, Y. Tian, Z. Li, X. Tian, H. Sun, H. Liu, A. Moore and 41 M. Nakhjiri, M. Safavi, E. Alipour, S. Emami, A. F. Atash,
C. Ran, J. Am. Chem. Soc., 2013, 135, 16397–16409.
19 Y. Kiso, Y. Suzuki, N. Watanabe, Y. Oshima and H. Hikino,
Planta Med., 1983, 49, 185–187.
M. Jafari-Zavareh, S. K. Ardestani, M. Khoshneviszadeh,
A. Foroumadi and A. Shaee, Eur. J. Med. Chem., 2012, 50,
113–123.
20 N. Venkatesan, Br. J. Pharmacol., 1998, 124, 425–427.
21 N. Venkatesan, D. Punithavathi and V. Arumugam, Br. J.
Pharmacol., 2000, 129, 231–234.
22 R. Srivastava, M. Dikshit, R. C. Srimal and B. N. Dhawan,
Thromb. Res., 1985, 40, 413–417.
42 T. Jia, L. Zhang, Y. Duan, M. Zhang, G. Wang, J. Zhang and
Z. Zhao, Cancer Cell Int., 2014, 14, 126.
43 D. A. Dias, S. Urban and U. Roessner, Metabolites, 2012, 2,
303–336.
44 N. M. Ali, S. K. Yeap, N. Abu, K. L. Lim, H. Ky, A. Z. M. Pauzi,
W. Y. Ho, S. W. Tan, H. K. Alan-Ong, S. Zareen, N. B. Alitheen
and M. N. Akhtar, Cancer Cell Int., 2017, 17, 30.
23 M. Dikshit, L. Rastogi, R. Shukla and R. C. Srimal, Indian J.
Med. Res., 1995, 101, 31–35.
24 C. Nirmala and R. Puvanakrishnan, Mol. Cell. Biochem., 45 G. Ferrari-Amorotti, C. Chiodoni, F. Shen, S. Cattelani,
1996, 159, 85–93.
25 C. Nirmala and R. Puvanakrishnan, Biochem. Pharmacol.,
1996, 51, 47–51.
A. R. Soliera, G. Manzotti, G. Grisendi, M. Dominici,
F. Rivasi, M. P. Colombo, A. Fatatis and B. Calabretta,
Neoplasia, 2014, 16, 1047–1058.
This journal is © The Royal Society of Chemistry 2017
RSC Adv., 2017, 7, 36185–36192 | 36191

View Article Online
RSC Advances
Paper
46 P. Kaur, G. M. Nagaraja, H. Zheng, D. Gizachew, 50 J. M. Kim, E. M. Noh, K. B. Kwon, J. S. Kim, Y. O. You,
M. Galukande, S. Krishnan and A. Asea, BMC Cancer, 2012,
12, 120.
47 X. D. Sun, X. E. Liu and D. S. Huang, Mol. Med. Rep., 2012, 6,
1267–1270.
J. K. Hwang, B. M. Hwang, B. S. Kim, S. H. Lee, S. J. Lee,
S. H. Jung, H. J. Youn and Y. R. Lee, Phytomedicine, 2012,
19, 1085–1092.
51 T. L. Chiu and C. C. Su, Int. J. Mol. Med., 2009, 23, 469–475.
48 J. Qiu, X. Xue, C. Hu, H. Xu, D. Kou, R. Li and M. Li, J. Cancer, 52 B. Farhangi, A. M. Alizadeh, H. Khodayari, S. Khodayari,
2016, 7, 167–173.
M. J. Dehghan, V. Khori, A. Heidarzadeh, M. Khaniki,
M. Sadeghiezadeh and F. Naja, Eur. J. Pharmacol., 2015,
758, 188–196.
49 L. Gan, Z. Qiu, J. Huang, Y. Li, H. Huang, T. Xiang, J. Wan,
T. Hui, Y. Lin, H. Li and G. Ren, Int. J. Biol. Sci., 2016, 12,
1533–1543.
36192 | RSC Adv., 2017, 7, 36185–36192
This journal is © The Royal Society of Chemistry 2017