Selective alkylation of T-T mismatched DNA using vinyldiaminotriazine-acridine conjugate

Article abstract of DOI:10.1093/nar/gkx1278

The alkylation of the specific higher-order nucleic acid structures is of great significance in order to control its function and gene expression. In this report, we have described the T-T mismatch selective alkylation with a vinyldiaminotriazine (VDAT)-acridine conjugate. The alkylation selectively proceeded at the N3 position of thymidine on the T-T mismatch. Interestingly, the alkylated thymidine induced base flipping of the complementary base in the duplex. In a model experiment for the alkylation of the CTG repeats DNA which causes myotonic dystrophy type 1(DM1), the observed reaction rate for one alkylation increased in proportion to the number of T-T mismatches. In addition, we showed that primer extension reactions with DNA polymerase and transcription with RNA polymerase were stopped by the alkylation. The alkylation of the repeat DNA will efficiently work for the inhibition of replication and transcription reactions. These functions of the VDAT-acridine conjugate would be useful as a new biochemical tool for the study of CTG repeats and may provide a new strategy for the molecular therapy of DM1.

Full text of DOI:10.1093/nar/gkx1278

Published online 4 January 2018
Nucleic Acids Research, 2018, Vol. 46, No. 3 1059–1068
doi: 10.1093/nar/gkx1278
Selective alkylation of T–T mismatched DNA using
vinyldiaminotriazine–acridine conjugate
Kazumitsu Onizuka1, Akira Usami1, Yudai Yamaoki2,3, Tomohito Kobayashi1, Madoka
E. Hazemi1, Tomoko Chikuni1, Norihiro Sato1, Kaname Sasaki1, Masato Katahira2,3 and
Fumi Nagatsugi1,*
1Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai,
Miyagi 980-8577, Japan, 2Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan and
3Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan
Received September 26, 2017; Revised December 8, 2017; Editorial Decision December 11, 2017; Accepted December 19, 2017
ABSTRACT
acids were reported (5–13), the reactive moiety with a high
selectivity and efficiency to the target is quite limited.
In our previous study, we developed 2-amino-6-
vinylpurine (AVP) as a reactive moiety for the selective
alkylation of the target thymine base (14). The AVP moiety
was conjugated with Hoechst 33258 (Figure 1A), and the
selective alkylation of the thymine base opposite an amino
purine (AP) site was achieved by a proximity effect. In
order to expand this alkylation ability, we investigated the
suitable DNA or RNA binding molecule which is applica-
ble for the vinyl alkylation chemistry. The triaminotriazine
(TAT)–acridine conjugate 1 developed by Zimmerman
is a T–T or U–U mismatch binding molecule which sta-
bilizes the complex by the intercalation of the acridine
and hydrogen bonds (15). In our study, we designed the
vinyldiaminotriazine (VDAT)–acridine conjugate 2 for
the selective alkylation of the T–T mismatched DNA or
U–U mismatched RNA. Based on the paper reported by
Zimmerman (16), we expected that the VDAT–acridine
conjugate would recognize the T–T or U–U by the stable
complex formation with hydrogen bonds as shown in
Figure 1 and selectively react with the T or U base by the
proximity effect.
Generally, the T–T mismatch in DNA and U–U mis-
match in RNA can be formed in the abnormal expanded
trinucleotide repeat sequence (1). The myotonic dystrophy
type 1 (DM1) is one of the trinucleotide repeat disorders
caused by an abnormal expansion of the CTG trinucleotide
repeats in the 3ꢀ-UTR of the DMPK gene. While the nor-
mal expansion of the CTG is 5–37 repeats, the abnormal
one reaches 50–2000 repeats. This repeat DNA produces
the toxic CUG repeat RNA which forms a complex with
the alternative-splicing regulator muscleblind-like protein
(MBNL), leading to splicing defects and disease symptoms.
Thus, abnormal extended CTG or CUG repeats are con-
sidered to be one of the important targets for DM1 and
several promising compounds have been developed (17,18).
For example, TAT derivatives, which can bind the CTG or
The alkylation of the specific higher-order nucleic
acid structures is of great significance in order to
control its function and gene expression. In this re-
port, we have described the T–T mismatch selec-
tive alkylation with a vinyldiaminotriazine (VDAT)–
acridine conjugate. The alkylation selectively pro-
ceeded at the N3 position of thymidine on the T–T
mismatch. Interestingly, the alkylated thymidine in-
duced base flipping of the complementary base in
the duplex. In a model experiment for the alkylation
of the CTG repeats DNA which causes myotonic dys-
trophy type 1 (DM1), the observed reaction rate for
one alkylation increased in proportion to the num-
ber of T–T mismatches. In addition, we showed that
primer extension reactions with DNA polymerase and
transcription with RNA polymerase were stopped by
the alkylation. The alkylation of the repeat DNA will
efficiently work for the inhibition of replication and
transcription reactions. These functions of the VDAT–
acridine conjugate would be useful as a new bio-
chemical tool for the study of CTG repeats and may
provide a new strategy for the molecular therapy of
DM1.
INTRODUCTION
Higher-order structures of nucleic acids, such as the mis-
matched, bulge and G-quadruplex structures, are signifi-
cant research targets in nucleic acid chemistry because the
structures are involved in the genetic control and diseases
(1,2). Reactive molecules, which recognize the specific struc-
ture and form a covalent bond, have been developed as a
strong inhibitor and biochemical research tool (3,4). While
several excellent molecules, which can selectively form the
covalent bond with the higher-order structures of nucleic
*To whom correspondence should be addressed. Tel: +81 22 217 5634; Fax: +81 22 217 5633; Email: nagatugi@tagen.tohoku.ac.jp
ꢁ
C
The Author(s) 2018. Published by Oxford University Press on behalf of Nucleic Acids Research.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which
permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact
journals.permissions@oup.com
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

1060 Nucleic Acids Research, 2018, Vol. 46, No. 3
MicrOTOFQ II. The high performance liquid chromatog-
raphy (HPLC) purification was performed by a JASCO
HPLC System (PU-2089Plus, UV-2075Plus, FP-2015Plus
and CO-2065Plus) using a reverse-phase C18 column (COS-
MOSIL 5C18-AR-II, Nacalai tesque, 4.6 × 250 or 10 ×
250 mm for ligand purification and CAPCELL PAK C18
MGII, Shiseido, 4.6 × 250 or 10 × 250 mm for oligo DNA
purification). MALDI-TOF MS measurements were per-
formed by a Bruker Autoflex speed instrument using a 3-
hydroxypicolinic acid/diammonium hydrogen citrate ma-
trix. The gel imaging and quantification were performed by
a FLA-5100 (Fujifilm Co.).
Synthesis of tert-butyl (4-aminobutyl)carbamate (4)
To a vigorously stirred solution of butan-1,4-diamine (5.00
g, 56.7 mmol) in CHCl3 (40 ml) was slowly added a solution
of Boc2O (2.48 g, 11.3 mmol) in CHCl3 (30 ml). The white
suspension was stirred at room temperature overnight. The
solvent was removed under reduced pressure, and 10%
aqueous Na2CO3 (100 ml) was added. The mixture was then
extracted with CH2Cl2 (80 ml × 3). The organic layer was
dried over Na2SO4, and concentrated under reduced pres-
sure. The crude product was purified by column chromatog-
raphy (CHCl3: MeOH: NH4OH = 89: 10: 1) to give 4 as a
pale yellow oil (2.00 g, 94%). 1H NMR (600 MHz, CDCl3)
δ (ppm) 1.19 (brs, 2H), 1.44 (s, 9H), 1.46–1.55 (m, 4H), 2.71
(t, J = 7.2 Hz, 2H), 3.12–3.14 (m, 2H), 4.74 (brs, 1H). 13
C
NMR (150 MHz, CDCl3) δ (ppm) 27.5, 28.4, 30.9, 40.4,
41.9, 79.0, 156.0. ESI–HRMS (m/z) calcd for C9H20N2O2
[M+H]+ 189.1598, found 189.1597.
Figure 1. Molecular design of the small molecule for the selective alky-
lation of the T–T mismatched DNA. (A) The structure of Hoechst–AVP
conjugate. (B) The structure of TAT–acridine conjugate 1 reported by Zim-
merman. (C) The structure of VDAT–acridine conjugate 2 designed in this
study. (D) The conceptual scheme of the T–T mismatched DNA alkylation.
(E) The predicted complex between the ligand and T–T mismatched DNA.
(F) The predicted complex between the ligand and U–U mismatched RNA.
Synthesis of tert-butyl (4-((4-amino-6-(2-(methylthio)ethyl)-
1,3,5-triazin-2-yl)amino)butyl)carbamate (5)
To a solution of 4, 6-dichloro-1, 3, 5-triazin-2-amine 3
(0.500 g, 3.03 mmol) and K2CO3 (0.628 g, 4.55 mmol) in
1,4-dioxane (5.0 ml) was added a solution of 4 (0.616 g, 3.27
mmol) in 1,4-dioxane (12.0 ml). The mixture was stirred
overnight at 50◦C. To the mixture were added H2O (5.0
ml), 1,4-dioxane (3.0 ml), Pd(PPh3)4 (0.350 g, 0.303 mmol),
K2CO3 (0.209 g, 1.52 mmol) and the vinylboronic anhy-
dride pyridine complex (1.09 g, 4.55 mmol). The mixture
was refluxed for 140 min, then cooled to room temperature.
To the mixture, NaSCH3 (0.425 g, 6.06 mmol) was added
and the mixture was stirred overnight at room temperature.
The solvent was removed under reduced pressure, and the
residue was dissolved in EtOAc (100 ml). The solution was
washed with water (50 ml × 2) and brine (50 ml × 3). The
organic phase was dried over Na2SO4, and concentrated
under reduced pressure. The crude was purified by column
chromatography (CH2Cl2: ethyl acetate = 3: 2→ ethyl ac-
CUG repeats, strongly inhibit the transcription or forma-
tion of the complex with MBNL (19). Disney’s group devel-
oped bis-Hoechst derivatives conjugated with chlorambucil
for the covalent bond formation, bleomycin for the RNA
cleavage or azide-alkyne moieties for in situ probe synthe-
sis (7). Berglund’s group found that actinomycin D (20) and
the diamidine derivatives (21) can reduce the abnormal ex-
tended CUG RNA levels. Nakatani’s group developed new
small molecules targeting the CUG repeats by the rational
molecular design (22). In this study, we aimed to develop a
reactive small molecule with the ability of the T–T or U–U
mismatch selective alkylation for DM1 research.
MATERIALS AND METHODS
The general chemicals were purchased from Wako Pure
Chemical, Aldrich or the Tokyo Chemical Institute. The
target oligo DNAs and RNAs were purchased from JBioS
(Japan). The oligo sequences used in this study are shown
in Table 1. The 1H NMR spectra (400 MHz) were recorded
1
etate only) to give 5 as a yellow foam (0.612 g, 57%). H
NMR (400 MHz, CDCl3) δ (ppm) 1.45 (s, 9H), 1.53–1.62
(m, 4H), 2.14 (s, 3H), 2.76 (t, J = 7.6 Hz, 2H), 2.87 (t, J =
7.6 Hz, 2H), 3.20 (m, 2H), 3.39 (m, 2H), 4.87–5.17 (m, 4H).
13C NMR (150 MHz, CDCl3) δ (ppm) 15.6, 26.5, 27.1, 28.5,
31.5, 38.4, 39.9, 40.2, 79.4, 156.0, 166.1, 167.0, 176.8. ESI-
HRMS (m/z) calcd for C15H28N6O2S [M+H]+ 357.2067,
found 357.2084.
1
by a Bruker 400 spectrometer. The H NMR spectra (600
MHz) and 13C NMR spectra (150 MHz) were recorded by
a Bruker AVANCE III 600 spectrometer. The high resolu-
tion electrospray mass analysis was performed by a Bruker
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

Nucleic Acids Research, 2018, Vol. 46, No. 3 1061
Table 1. ODN and ORN sequences used in this study
Entry
Sequences (5ꢀ-3ꢀ)
ODN1
ODN2
ODN3
ODN4
ODN5
ODN6
ODN7
ODN8
ODN9
ODN10
ODN11
ODN12
ODN13
ORN1
ORN2
ORN3
Alexa647-CTGGCXGCGC (X = dA, dG, dC, dT or dU)
FAM-GCGCYGCCAG (Y = dA, dG, dC, dT or dU)
FAM-CTGGCTGCGC
GCGCYGCCAG (Y = dA, dG, dC or dT)
FAM-CTGGCT*GCGC
GCGCT*GCCAG
CTGGCXGCGC (X = dA, dG, dC, dT or AP)
FAM-GC(CTG)12GC
FAM-TAATACGACTCACTATAGGG
(CTG)20CCCTATAGTGAGTCGTATTA
(CAG)20CCCTATAGTGAGTCGTATTA
TAATACGACTCACTATAGGG(CAG)20
TAATACGACTCACTATAGGG(CTG)20
Alexa647-CUGGCXGCGC (X = rA, rG, rC, rU or rT)
FAM-GCGCYGCCAG (Y = rA, rG, rC, rU or rT)
CUGGCXGCGC (X = rA, rG, rC or rU)
N2-(4-((6-chloro-2-methoxyacridin-9-
and stored at room temperature for 45 min. 1.0 M acetic
acid was added to neutralize the solution, and water was
added to prepare a 1.0 mM solution of 2. The solution was
used for the alkylations without further purification. For
1H-NMR and ESI–HRMS measurements, 2 was purified
by RP-HPLC. 1H NMR (600 MHz, CD3OD) δ (ppm) 1.80
(quint, J = 7.2 Hz, 2H), 2.06 (quint, J = 7.2 Hz, 2H), 3.46 (t,
J = 7.2 Hz, 2H), 4.00 (s, 3H), 4.21 (t, J = 7.2 Hz, 2H), 5.74
(d, J = 8.4 Hz, 0.25H), 5.90 (d, J = 8.4 Hz, 0.75H), 6.33
(dd, J = 16.8, 8.4 Hz, 0.25H), 6.40 (dd, J = 16.8, 8.4 Hz,
0.75H), 6.52 (d, J = 16.8 Hz, 0.25H), 6.58 (d, J = 16.8 Hz,
0.75H), 7.49 (d, J = 9.0 Hz, 1H), 7.67 (d, J = 9.0 Hz, 1H),
7.75 (d, J = 9.0 Hz, 1H), 7.78 (s, 1H), 7.81 (s, 1H), 8.46 (d, J
= 9.0 Hz, 1H). ESI–HRMS (m/z) calcd for C23H28ClN7O
[M+H]+ 450.1804, found 450.1813.
Synthesis
of
yl)amino)butyl)-6-(2-(methylthio)ethyl)-1,3,5-triazine-
2,4-diamine (6)
To a solution of 5 (0.050 g, 0.140 mmol) and triethylsi-
lane (0.14 ml) in CH2Cl2 (0.20 ml) was dropwise added
TFA (0.60 ml) and the mixture was stirred at room tem-
perature for 1 h. The reaction mixture was diluted with
toluene (3.0 ml) and concentrated under reduced pressure.
The residue was co-evaporated with toluene (3.0 ml) twice.
This crude was used without further purification. The mix-
ture of the deprotected triazine unit (0.140 mmol), phenol
(1.0 g) and 6-chloro-2-methoxy-9-phenoxyacridine (0.071
g, 0.21 mmol) was stirred at 90◦C for 5 h. The reaction
mixture was diluted with Et2O (100 ml) and washed with
3 M aqueous NaOH (100 ml × 3) and brine (100 ml × 2).
The organic layer was concentrated under reduced pressure.
The crude product was purified by column chromatography
(CH2Cl2: CH3OH: NH4OH = 97: 2: 1) to give 6 as a yellow
solid (0.045 g, 58%). Compound 6 was co-evaporated with
MeCN containing 0.1% TFA. The TFA salt was dissolved in
H2O containing 0.1% TFA and purified by RP-HPLC. The
concentration of the pure compound 6 TFA salt was quan-
tified by nuclear magnetic resonance (NMR) using maleic
acid as an internal standard. 1H NMR (600 MHz, CDCl3)
δ (ppm) 1.71 (quint, J = 7.2 Hz, 2H), 1.81 (quint, J = 7.2
Hz, 2H), 2.13 (s, 3H), 2.76–2.77 (m, 2H), 2.86 (t, J = 7.2
Hz, 2H), 3.39–3.47 (m, 2H), 3.73–3.75 (m, 2H), 3.95 (s, 3H),
4.70–5.17 (m, 4H), 7.20 (d, J = 2.4 Hz, 1H), 7.31 (dd, J =
9.0, 2.4 Hz, 1H), 7.43 (dd, J = 9.0, 2.4 Hz, 1H), 7.99 (d,
J = 9.0 Hz, 1H), 8.00 (d, 9.0 Hz, 1H), 8.08 (s, 1H). 13C
NMR (150 MHz, CDCl3) δ (ppm) 15.6, 27.0, 29.0, 31.4,
38.4, 40.1, 50.4, 55.6, 99.1, 116.2, 118.3, 123.9, 124.5, 124.8,
128.5, 131.7, 134.8, 146.9, 148.4, 149.5, 156.2, 166.2, 167.0,
177.0. ESI–HRMS (m/z) calcd for C24H28ClN7OS [M+H]+
498.1837, found 498.1844.
Alkylation to DNA
A solution (50 ␮l) of ODN1 (10 ␮M) and ODN2 (10 ␮M)
in MES buffer (100 mM) containing NaCl (200 mM) was
heated at 90◦C for 5 min, then gradually cooled to room
temperature. To the ODN solution (5.0 ␮l) were added wa-
ter (4.0 ␮l) and a 1.0 mM solution of 2 (1.0 ␮l), and the
mixture was incubated at 37◦C. The aliquots (1.0 ␮l each)
were removed from the reaction mixture at various time
points, quenched by a loading buffer (80% formamide, 10
mM ethylenediaminetetraacetic acid (EDTA), 4 ␮l), then
cooled to 0◦C. Electrophoresis was performed on a 16%
denaturing polyacrylamide gel containing 20% formamide
with 1 × TBE and 6.0 M urea at 450 V for 90 min.
Alkylation to RNA
The reaction was performed with ORN1 (5 ␮M) and ORN2
(5 ␮M) in the same manner as the alkylation to DNA.
Synthesis of VDAT–acridine conjugate (2)
Enzymatic hydrolysis of the alkylated ODN5 and ODN6
To a solution of 6 (25 nmol) in dimethyl sulfoxide (DMSO)
(1.0 ␮l) was added a solution of magnesium monoperphta-
late (MMPP) (125 nmol) in water (8.0 ␮l) and the mixture
was stored at room temperature for 45 min. 1.0 M aque-
ous NaOH (5.0 ␮l) and DMSO (4.0 ␮l) were then added
The alkylated ODN5 and ODN6 were synthesized with
ODN3 (600 nmol), ODN4 (Y = dT) (600 nmol) and
VDAT–acridine conjugate 2 (3.0 ␮mol) in the same man-
ner as the alkylation conditions with ODN1 (X = dT) and
ODN2 (Y = dT) and purified by RP-HPLC (CAPCELL
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

1062 Nucleic Acids Research, 2018, Vol. 46, No. 3
PAL MG-II, Shiseido, 4.6 × 250 mm, solvent A: 50 mM
TEAA, solvent B: MeCN, linear gradient: B 10–30%/ 20
min, flow rate: 1.0 ml/min, temperature: 40◦C). A solu-
tion (100 ␮l) of the alkylated ODN5 or ODN6 (100 ␮M),
alkaline phosphatase (0.03 U/␮l, Takara Bio Inc.) and
phosphodiesterase I (0.03 U/␮l, Worthington Biochemical
Corp.) in alkaline phosphatase buffer was incubated at 37◦C
for 1 h. The reaction mixture was heated at 90◦C for 3 min,
cooled to 0◦C for 3 min and analyzed by RP-HPLC (CAP-
CELL PAL MG-II, Shiseido, 4.6 × 250 mm, solvent A: 50
mM TEAA for analysis or HCOONH4 for purification, sol-
vent B: MeCN, linear gradient: B 5–40%/ 30 min, flow rate:
1.0 ml/min).
the ratio of the peak area. The percentages were calculated
from three separate experiments. The observed first-order
reaction rate constant (kobs) of the alkylation reaction to
(CTG)12 ODN8 was graphically obtained from the first-
order kinetic plot (Equation 1).
ln([ODN]t/[ODN]0) = −kobs · t
(1)
Primer extension reaction using CTG repeats DNA
A solution (20 ␮l) of (CTG)20 ODN10 (5.0 ␮M) and
VDAT–acridine conjugate 2 (100 ␮M) in MES buffer (50
mM, pH 7.0) containing NaCl (100 mM) and 2% DMSO
was incubated at 37◦C for 6 or 24 h. The mixture was used
as the alkylated template ODN10. A solution (30 ␮l) of the
primer ODN9 (0.17 ␮M), the alkylated template ODN10
(0.5 ␮M) and internal standard ODN2 (Y = dT) (0.07 ␮M)
in NE buffer 2 (50 mM NaCl, 10 mM Tris–HCl, 10 mM
MgCl2, 1 mM DTT, pH 7.9, New England Biolabs) was
heated at 93◦C and gradually cooled to room temperature
for the annealing. To the solution were added dNTP (2.4
␮l, final 0.2 mM) and the Klenow Fragment (exo−) (0.6
␮l, final 0.1 U/␮l, New England Biolabs), then the mix-
ture was incubated at 37◦C for 10 min. The reaction mixture
was quenched by a loading buffer (80% formamide, 10 mM
EDTA, 30 ␮l), then cooled to 0◦C. Electrophoresis was per-
formed on a 14% denaturing polyacrylamide gel containing
30% formamide with 1 × TBE and 5.3 M urea at 300 V and
40◦C for 25 min.
Determination of the alkylation position of dT* by NMR
The alkylated thymidine dT* obtained by enzymatic hydrol-
ysis of the alkylated ODN5 and ODN6 was dissolved in
DMSO-d6 containing 10 ␮M 4,4-dimethyl-4-silapentane-1-
sulfonic acid (DSS), the final concentration being 400 ␮M.
DSS was used as an internal chemical shift reference. The
COSY, edited-HSQC and HMBC spectra were recorded at
37◦C using Bruker BioSpin DRX 600 and AVANCE III HD
600 spectrometers equipped with a cryogenic probe and a
Z-gradient.
Melting temperature (Tm) measurement
A mixture of the DNA–DNA or DNA–RNA duplex (2.0
␮M) in MES buffer (50 mM, pH 7.0) containing NaCl (100
mM) was transferred to a microquartz cell with a 1-cm path
length. The melting temperature was then measured under
UV absorption at 260 nm from 25 to 85◦C at the rate of
1◦C/min. The measurements were carried out three times
per each sample and averaged for obtaining the final value.
The melting temperature measurement was performed by
a DU-800 (Beckman-coulter) equipped with a temperature
controller.
Transcription reaction using CTG repeats DNA
A solution (7.8 ␮l) of ODN12 and the alkylated template
ODN10 in buffer (40 mM Tris–HCl, 8 mM MgCl2, 2 mM
spermidine, 5 mM DTT, pH 8.0, Takara Bio Inc.) was
heated at 93◦C and gradually cooled to room temperature
for the annealing. A solution (10 ␮l) of the annealed duplex
(0.05 ␮M), T7 RNA polymerase (0.01 U/␮l, Takara Bio,
Inc.) and NTP (2 mM) in buffer (40 mM Tris–HCl, 8 mM
MgCl2, 2 mM spermidine, 5 mM DTT, pH 8.0, Takara Bio
Inc.) was incubated at 37◦C for 1 h, then to the mixture was
added DNase I (0.2 ␮l, final 0.1 U/␮l, Takara Bio Inc.). The
mixture was incubated at 37◦C for 20 min, quenched by a
loading buffer (80% formamide, 10 mM EDTA, 10 ␮l), then
cooled to 0◦C. Electrophoresis was performed on a 20% de-
naturing polyacrylamide gel with 1 × TBE and 7.5 M urea
at 300 V and 15◦C for 3.5 h. The gel was stained with SYBR
Green II for the RNA product detection.
Fluorescence measurement with 2-aminopurine-containing
ODN
A mixture of the duplex (5.0 ␮M) in MES buffer (50 mM,
pH 7.0) containing NaCl (100 mM) was transferred to a
quartz cell with a 3-mm path length. The emission spec-
tra were obtained with an excitation wavelength at 310 nm.
The fluorescence measurement was performed by a FP-6500
(JASCO Corporation).
RESULTS AND DISCUSSION
Alkylation to CTG repeats DNA
Alkylation with VDAT–acridine conjugate
A solution (150 ␮l) of (CTG)12 ODN8 (5.0 ␮M) and
VDAT–acridine conjugate 2 (100 ␮M) in MES buffer (50
mM, pH 7.0) containing NaCl (100 mM) and 2% DMSO
was incubated at 37◦C. The aliquots (20 ␮l each) were re-
moved from the reaction mixture at various time points
and purified by RP-HPLC to remove the ligand 2. The
conversion was analyzed by a MALDI-TOF/MS measure-
ment (linear negative mode) because the non-alkylated and
alkylated ODN8 were not separated in the HPLC profile.
The percentage of the residual (CTG)12 was quantified from
The designed VDAT–acridine conjugate 2 was synthesized
via the SMe precursor 6. First, the triazine unit 5 was syn-
thesized from 4, 6-dichloro-1, 3, 5-triazin-2-amine 3 by the
substitution reaction with the amine linker 4, vinylation and
the addition of methanethiol (Scheme 1). After deprotec-
tion of the Boc group, the triazine unit was conjugated with
6-chloro-2-methoxyacridine to give the SMe precursor 6.
Compound 6 was oxidized with MMPP and the resulting
sulfoxide 7 was converted to the vinyl compound 2 under
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

Nucleic Acids Research, 2018, Vol. 46, No. 3 1063
Figure 2. Alkylation to DNA using VDAT–acridine conjugate 2. The reaction was carried out with the duplex DNA (5 ␮M) and VDAT–acridine conjugate
2 (100 ␮M) in MES buffer (50 mM, pH 7.0) containing NaCl (100 mM) and 2% DMSO at 37◦C. (A) The sequence of the target duplex DNA. (B) Gel
image of the alkylation. The electrophoresis was performed on a 16% denaturing polyacrylamide gel containing 20% formamide. The red or green bases
indicate X in ODN1 or Y in ODN2, respectively. (C) Time course of the reaction yields. The alkylation yields were calculated by combining the yield of
each strand. (D) The reaction yields after 48 h to the mismatched duplex DNA.
Scheme 1. Synthesis of VDAT–acridine conjugate precursor.
Figure 3. Gel image of the alkylation to RNA using VDAT–acridine conju-
gate 2. The reaction was carried out with the duplex RNA (ORN1–ORN2)
(5 ␮M) and VDAT–acridine conjugate 2 (100 ␮M) in MES buffer (50 mM,
pH 7.0) containing NaCl (100 mM) and 2% DMSO at 37◦C. The red or
green bases indicate X in ORN1 or Y in ORN2, respectively.
Scheme 2. Synthesis of VDAT–acridine conjugate.
alkaline conditions (Scheme 2). The conversion from 6 to 2
was confirmed by HPLC and ESI–HRMS (Supplementary
Figure S1), and the product was used for the alkylation.
Alkylation with the VDAT–acridine conjugate was per-
formed using the ODN1 and ODN2 with the different fluo-
rescent labeling by Alexa647 and 6-FAM, respectively (Fig-
ure 2A). The reactions were evaluated by detecting the dif-
ferent fluorescent labeling on a denaturing polyacrylamide
gel (Figure 2B and Supplementary Figure S2). A clear band
shift was observed only when the T–T mismatched DNA
was used. The alkylation yields were calculated by combin-
ing the yield of each strand. The reaction yield to the T–T
mismatch reached 93% in 120 h and a slight reaction was
observed to the C–C mismatch (Figure 2C and D). The re-
action yields to other mismatches, full matches and single
strands were quite low, indicating that the selectivity of the
VDAT–acridine conjugate was significantly high. Next, the
reactions to the RNA target were performed in the same
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

1064 Nucleic Acids Research, 2018, Vol. 46, No. 3
manner as the DNA target. A slight alkylation was observed
to the U–U mismatched RNA and the yield reached 20% in
120 h (Figure 3). The reaction efficiency to the U–U mis-
matched RNA was much lower than that to the T–T mis-
matched DNA. Clear band shifts were not observed for the
other base pairs (Supplementary Figure S3). To check the
difference in the nucleophilicity between T and U, the alky-
lation was carried out using ODN1(X = dU)-ODN2(Y =
dU) for the DNA duplex or ORN1(X = rT)-ORN2(Y = rT)
for the RNA duplex (Supplementary Figure S4). While the
reaction with the dU–dU mismatched DNA proceeded, no
reaction occurred with the rT–rT mismatched RNA. Thus,
the large difference in the reaction efficiency will depend on
the structure difference between the DNA and RNA duplex
rather than the difference in the nucleophilicity. According
to the results using the TAT–acridine conjugate 1, the dis-
sociation constant (Kd) to T–T mismatch (0.39 ␮M) was
lower than that to the U–U mismatch (2.1 ␮M) (15). In ad-
dition, the dimethylation of the amino group on the triazine
significantly decreased the U–U mismatched RNA binding
affinity (16). These results suggest that the VDAT–acridine
conjugate 2 would bind to the T–T mismatched DNA more
tightly than the U–U mismatched RNA probably due to the
difference in the duplex conformation. Thus, the reaction
efficiency of the U–U mismatch would be much lower than
that to the T–T mismatch.
Figure 4. HPLC profiles of the enzymatic hydrolysis products. (A) HPLC
analysis after enzymatic hydrolysis of ODN5 (top) and ODN6 (bottom).
The enzymatic hydrolysis was performed with ODN5 or ODN6 (100 ␮M),
alkaline phosphatase (0.03 U/␮l) and phosphodiesterase I (0.03 U/␮l) in
alkaline phosphatase buffer at 37◦C for 1 h. (B) Co-injection of dT*1 and
dT*2.
Determination of the alkylated thymidine structure
To determine the alkylated nucleoside structure, the alky-
lated DNA was synthesized on a large scale. The reaction
was carried out using the FAM-labeled ODN3 and non-
labeled ODN4(Y = dT). FAM was labeled to easily dis-
criminate another strand by HPLC. After 5 days of reac-
tion, two new peaks, ODN5 and ODN6, were observed
in the HPLC profile (Supplementary Figure S5). MALDI-
TOF/MS measurement of the purified products showed
that the ODNs were the alkylated ODN with the VDAT–
acridine conjugate.
The alkylated ODNs were next enzymatically hydrolyzed
with alkaline phosphatase and phosphodiesterase I (Fig-
ure 4A). In addition to the native nucleosides and FAM,
a new peak dT* was observed in the HPLC profiles. The
peaks of dT*1 and dT*2 were collected and the products
were analyzed by ESI-MS. Both values of dT*1 (692.7204)
and dT*2 (692.7201) corresponded to the calculated value
of the thymidine alkylated with the VDAT–acridine conju-
gate (692.7206). Additionally, the co-injection of dT*1 and
dT*2 showed only one peak (Figure 4B). These results in-
dicated that the alkylation proceeded at the thymidine base
and the structure of dT*1 and dT*2 would be the same.
According to the papers by Singer, the O2 and O4-
alkylated dTs are hydrolyzed under acidic conditions (23),
in contrast, the N3-alkylated dT is stable under the same
conditions (24). The alkylated thymidine dT*1 and 2 were
combined and the mixture was treated with 0.1 M HCl at
50◦C for 5 min and at 70◦C for 60 min. An HPLC analy-
sis showed that dT* was stable (Supplementary Figure S6),
suggesting that dT* would be the N3 alkylated product.
To clearly determine the alkylation position, the COSY,
edited-HSQC and HMBC NMR spectra of dT* were
Figure 5. Elucidation of the alkylated position of dT* by NMR. (A) Chem-
ical structure of dT* alkylated at the N3 position. (B) The edited-HSQC
spectrum of dT* is overlaid on its HMBC spectrum for two portions. Pos-
itive and negative peaks of the edited-HSQC spectrum are indicated by
blue and green, respectively, while the peaks of the HMBC spectrum are
indicated by red.
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

Nucleic Acids Research, 2018, Vol. 46, No. 3 1065
Figure 6. Tm values of dT*-containing DNA–DNA or DNA–RNA duplex. (A) ODN7–ODN4 (Y = dT) (left blue bar) or −ODN6 (right red bar) duplex.
(B) ORN3–ODN4 (Y = dT) (left blue bar) or −ODN6 (right red bar) duplex. The Tm values were measured using duplex (2.0 ␮M) in MES buffer (20
mM, pH 7.0) containing NaCl (100 mM).
Figure 8. Fluorescence emission spectra excited at 310 nm to confirm the
base flipping. All measurements were carried out using the duplex (5.0 ␮M)
in MES buffer (50 mM, pH 7.0) containing 100 mM NaCl at room temper-
ature. (A) ODN6 (dT*)–ODN7 (X = AP) duplex, (B) ODN4 (Y = dT)–
ODN7 (X = AP) duplex, (C) ODN6 (dT*)–ODN7 (X = dA) duplex.
A-T base pair showed a high Tm value. Interestingly, for the
alkylated duplex, ODN7(X = dA, dG, dC or dT)–ODN6
or ORN3(X = rA, rG, rC or rU)–ODN6, all the Tm val-
ues were comparable to the native full match duplex. We
hypothesized that the alkylated ODN6 would stabilize the
duplex by the intercalation of the acridine part and flipping
out the complementary base. The base flipping structure
model of the alkylated duplex DNA is shown in Figure 7.
To confirm the base flipping, the fluorescence emission as-
say using 2-AP) was performed (Figure 8) (25,26). AP is a
purine base with a strong fluorescence and used as a fluo-
rescent probe. Since the AP fluorescence is highly quenched
in a duplex due to the stacking interactions, we can con-
firm whether the AP base is flipped out of the DNA he-
lix by checking the fluorescence increase. The fluorescence
of ODN6(dT*)–ODN7(X = AP) was significantly high, in
contrast, ODN4(Y = dT)-ODN7(X = AP) or ODN6(dT*)–
ODN7(X = dA) did not show any fluorescence, clearly in-
dicating that dT* can induce the flipping of the AP base.
Based on the results for the structural determination with
the adduct and the property of the alkylated ODN, we
propose the mechanism for the alkylation to the T–T mis-
matched duplex (Figure 9). Generally, the T–T mismatched
DNA forms a wobble base pair (27). The VDAT–acridine
conjugate will bind to the mismatched base pair and form
the initial complex with four hydrogen bonds (16). In the
Figure 7. The base flipping structure of the alkylated duplex DNA. The
model was calculated using the MacroModel software with the OPLS3
force field. The alkylating ligand is shown as the CPK model.
recorded (Figure 5 and Supplementary Figure S7). The pro-
ton resonances of dT*, including Ha, were assigned on the
basis of the COSY spectrum (Supplementary Figure S7).
The assignment of Ha, which is one of ethylene protons be-
tween the thymine base and triazine, was further confirmed
by the edited-HSQC spectrum, the sign of the correspond-
ing correlation peak being opposite to the sign of the corre-
lation peaks of CHs. Ha gave the HMBC correlation peaks
to two carbon resonances around 160 ppm, i.e. C2 and C4
(Figure 5). If the position of the alkylation of dT* is either
O2 or O4, these HMBC correlation peaks cannot be ob-
served. Thus, the position of the alkylation of dT* was con-
cluded to be the N3 position.
Thermal stability of the alkylated duplex and base flipping
structure
To investigate the property of the alkylated ODN6, the
Tm values of the dT*-containing DNA–DNA and DNA–
RNA duplex were investigated (Figure 6). For the native
duplex, ODN7 (X = dA, dG, dC or dT)–ODN4(Y = dT)
or ORN3(X = rA, rG, rC or rU)–ODN4(Y = dT), only the
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

1066 Nucleic Acids Research, 2018, Vol. 46, No. 3
Figure 9. The proposed alkylation mechanism to T–T mismatched duplex.
Figure 10. Alkylation to (CTG)12 ODN8 using VDAT–acridine conjugate 2. The reaction was carried out with ODN8 (5 ␮M) and VDAT–acridine conju-
gate 2 (100 ␮M) in MES buffer (50 mM, pH 7.0) containing NaCl (100 mM) and 2% DMSO at 37◦C. (A) The sequence of (CTG)12 ODN8. (B) MALDI-
TOF/MS spectra after running the reaction for 1, 6 and 24 h. (C) Time course of the residual (CTG)12. (D) Calculation of the observed first-order reaction
rate constant (kobs) of the alkylation reaction to (CTG)12 ODN8 or (CTG)2 ODN1(X = T)–ODN2(Y = T) duplex.
equilibrium, one thymidine base might gradually flip out
and enol form of the thymidine base would slowly react with
VDAT to give the N3-adduct. The O2-adduct was not ob-
served probably due to the poor nucleophilicity.
3-adduct peaks were observed in addition to the 1-adduct
peak. The percentage of the residual (CTG)12 ODN8 was
calculated from the peak area of each peak, and the time
course is shown in Figure 10C. The observed reaction rate
(kobs) of (CTG)12 ODN8 was calculated by treating the re-
action as a pseudo first-order reaction (Figure 10D). The
kobs of (CTG)12 (26.4 × 10−6 s−1) was six times higher than
that of (CTG)2 (ODN1(X = T)-ODN2(Y = T) duplex) (4.2
× 10−6 s−1), suggesting that the efficiency of one alkylation
would increase in proportion to the number of the T–T mis-
matches. This means that the alkylation efficiency to the ab-
normal expansion repeats target can be expected to increase
in proportion to the number of CTGs. For DM1, the abnor-
mal expansion of the CTG is 50–2000 repeats. Given that
T–T mismatches are formed in the expanded (CTG)·(CAG)
repeats sequence as reported (1,28,29), the efficient and se-
Alkylation to CTG repeats model DNA
It is considered that the expanded (CTG)·(CAG) repeats
sequence forms T–T mismatches by forming slipped DNA
structures (1,28,29). We used (CTG)12 ODN8 as the model
for the alkylation to the CTG repeats DNA (Figure 10A).
The reaction was observed by MALDI-TOF/MS measure-
ments because ODN8 was too large to discriminate the
alkylated products from the non-reacted ODN8 on a dena-
turing polyacrylamide gel electrophoresis and by an HPLC
analysis. In the MS spectrum after 6 h, a clear 1-adduct peak
was observed (Figure 10B). After 24 h, the 2-adduct and
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

Nucleic Acids Research, 2018, Vol. 46, No. 3 1067
Figure 12. The effect of the alkylation on the transcription reaction. (A)
Gel image of full length product in transcription reaction. The alkylation
was initially carried out with (CTG)20 ODN10 or (CAG)20 ODN11 (5 ␮M)
and VDAT–acridine conjugate 2 (100 ␮M) in MES buffer (50 mM, pH
7.0) containing NaCl (100 mM) and 2% DMSO at 37◦C for 6 h (lane 2 or
6) or 24 h (lane 3 or 7). For TAT–acridine conjugate 1, the mixture was
incubated for 24 h (lane 4 or 8). The ODNs were annealed with the sense
ODN12 or ODN13. The transcription reactions were performed with the
template ODN10 or ODN11 (0.05 ␮M), sense ODN12 or ODN13 (0.05
␮M), T7 RNA polymerase (0.01 U/␮l) and 2 mM NTP in buffer (pH 8.0)
at 37◦C for 1 h. (B) The ratio of the full length production.
Figure 11. The effect of the alkylation on the primer extension reac-
tion. (A) Gel image of primer extension reaction. The alkylation was ini-
tially carried out with (CTG)20 ODN10 or (CAG)20 ODN11 (5 ␮M) and
VDAT–acridine conjugate 2 (100 ␮M) in MES buffer (50 mM, pH 7.0)
containing NaCl (100 mM) and 2% DMSO at 37◦C for 6 h (lane 2 or 6)
or 24 h (lane 3 or 7). For TAT–acridine conjugate 1, the mixture was incu-
bated for 24 h (lane 4 or 8). The ODNs were then annealed with the primer
ODN9. The primer extension reactions were performed with the template
ODN10 or ODN11 (0.5 ␮M) and primer ODN9 (0.17 ␮M), Klenow Frag-
ment (exo−) (0.1 U/␮l) and 0.2 mM dNTP in buffer (pH 7.9) at 37◦C for
10 min. (B) The ratio of full length production.
transcription reaction (Figure 12). The alkylated ODN was
annealed with the sense ODN and the transcription reac-
tions were performed with the T7 RNA polymerase at 37◦C
for 1 h. When the alkylated (CTG)20 ODN10 was used as
the template, the ratio of the full length production of the
transcription reaction drastically decreased, the same as the
DNA polymerase reaction. The ratio did not significantly
change when (CAG)20 ODN11 was used. The TAT–acridine
conjugate 1 did not inhibit the transcription reaction. Al-
though this alkylation was performed with single strand
(CTG)20 ODN10 not (CTG)·(CAG) repeats duplex, these
results suggest that the alkylated thymidine would strongly
inhibit the transcription reaction.
lective alkylation to the long CTG repeats sequence might
be possible using the VDAT–acridine conjugate 2.
The alkylation of DNA should strongly inhibit the repli-
cation and transcription. We initially investigated the alky-
lation selectivity and the effect of the alkylation on the DNA
polymerase reaction (Figure 11). The alkylation was carried
out with (CTG)20 ODN10 and the VDAT–acridine conju-
gate 2 at 37◦C for 6 or 24 h. (CAG)20 ODN11 was used
as the control to check the alkylation selectivity. The alky-
lated ODN was annealed with the primer ODN9 and the
primer extension reactions were performed with the Klenow
Fragment (exo−) as a DNA polymerase at 37◦C for 10 min.
When the alkylated (CTG)20 ODN10 was used as the tem-
plate, the ratio of the full length production of the primer
extension reaction drastically decreased with the alkylation
time. The short length products were observed like a lad-
der instead of the full length product. The ratio did not
change when (CAG)20 ODN11 was used, indicating that
the alkylation selectivity was significantly high. In addition,
the non-reactive TAT–acridine conjugate 1 did not inhibit
the primer extension reaction. These results suggest that the
VDAT–acridine conjugate 2 would be able to selectively and
strongly inhibit the replication reaction.
CONCLUSION
We have described the T–T mismatch selective alkylation
with the VDAT–acridine conjugate 2. The selectivity was
significantly high while the yield to other mismatches was
quite low even to the U–U mismatched RNA. From the
NMR study of the alkylated thymidine, the alkylation selec-
tively proceeded at the N3 position of dT. Interestingly, the
alkylated thymidine induced the base flipping of the com-
plimentary base by the stabilization of the duplex with the
acridine part and the steric hindrance of the triazine part
alkylated at the N3 position of dT. This information would
be useful to develop the base flipping induced ODN, such
as the phenylurea derivative of deoxyadenosine developed
by Sugimoto’s group (26,30). Importantly, the observed re-
action rate for one alkylation increased in proportion to
the number of T–T mismatches. This indicates that the effi-
Next, we investigated the effect of the alkylation on the
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018

1068 Nucleic Acids Research, 2018, Vol. 46, No. 3
10. Tishinov,K., Schmidt,K., Haussinger,D. and Gillingham,D.G. (2012)
Structure-selective catalytic alkylation of DNA and RNA. Angew.
Chem. Int. Ed., 51, 12000–12004.
11. Spitale,R.C., Crisalli,P., Flynn,R.A., Torre,E.A., Kool,E.T. and
Chang,H.Y. (2013) RNA SHAPE analysis in living cells. Nat. Chem.
Biol., 9, 18–20.
12. Flynn,R.A., Zhang,Q.C., Spitale,R.C., Lee,B., Mumbach,M.R. and
Chang,H.Y. (2016) Transcriptome-wide interrogation of RNA
secondary structure in living cells with icSHAPE. Nat. Protoc., 11,
273–290.
ciency for one alkylation would increase to the abnormal ex-
tended CTG repeats DNA. In addition, the alkylation of the
CTG repeats DNA led to strongly inhibiting the primer ex-
tension reaction and transcription which the TAT–acridine
conjugate 1 could not inhibit. The VDAT–acridine conju-
gate 2 would be a new biochemical tool for a CTG repeats
study and may give a new strategy for the molecular therapy
of DM1.
From the results of the T–T mismatch alkylation, we con-
sider that a reactive vinyl group modified on a DNA or
RNA binding molecule is a promising and broad-applicable
alkylation moiety for nucleic acid chemistry. The alkylation
and modification of the various higher-order structures of
nucleic acid using vinyl-modified small molecules are ongo-
ing in our laboratory.
13. Lonnberg,T., Hutchinson,M. and Rokita,S. (2015) Selective
alkylation of C-rich bulge motifs in nucleic acids by quinone methide
derivatives. Chem. Eur. J., 21, 13127–13136.
14. Sato,N., Tsuji,G., Sasaki,Y., Usami,A., Moki,T., Onizuka,K.,
Yamada,K. and Nagatsugi,F. (2015) A new strategy for site-specific
alkylation of DNA using oligonucleotides containing an abasic site
and alkylating probes. Chem. Commun., 51, 14885–14888.
15. Arambula,J.F., Ramisetty,S.R., Baranger,A.M. and Zimmerman,S.C.
(2009) A simple ligand that selectively targets CUG trinucleotide
repeats and inhibits MBNL protein binding. Proc. Natl. Acad. Sci.
U.S.A., 106, 16068–16073.
16. Wong,C.H., Richardson,S.L., Ho,Y.J., Lucas,A.M., Tuccinardi,T.,
Baranger,A.M. and Zimmerman,S.C. (2012) Investigating the
binding mode of an inhibitor of the MBNL1.RNA complex in
myotonic dystrophy type 1 (DM1) leads to the unexpected discovery
of a DNA-selective binder. Chembiochem, 13, 2505–2509.
17. Konieczny,P., Selma-Soriano,E., Rapisarda,A.S.,
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
FUNDING
Fernandez-Costa,J.M., Perez-Alonso,M. and Artero,R. (2017)
Myotonic dystrophy: candidate small molecule therapeutics. Drug
Discov. Today, 22, 1740–1748.
Japan Society for the Promotion of Science (JSPS), Grant-
in-Aid for Scientific Research on Innovative Areas “Mid-
dle Molecular Strategy’ [JP15H05838]; Research Program
of ‘Dynamic Alliance for Open Innovation Bridging Hu-
man, Environment and Materials’ (in part). Funding for
open access charge: JSPS, Grant-in-Aid for Scientific Re-
search on Innovative Areas ‘Middle Molecular Strategy’
[JP15H05838].
18. Thornton,C.A., Wang,E. and Carrell,E.M. (2017) Myotonic
dystrophy: approach to therapy. Curr. Opin. Genet. Dev., 44, 135–140.
19. Nguyen,L., Luu,L.M., Peng,S., Serrano,J.F., Chan,H.Y. and
Zimmerman,S.C. (2015) Rationally designed small molecules that
target both the DNA and RNA causing myotonic dystrophy type 1. J.
Am. Chem. Soc., 137, 14180–14189.
20. Siboni,R.B., Nakamori,M., Wagner,S.D., Struck,A.J., Coonrod,L.A.,
Harriott,S.A., Cass,D.M., Tanner,M.K. and Berglund,J.A. (2015)
Actinomycin D specifically reduces expanded CUG repeat RNA in
myotonic dystrophy models. Cell Rep., 13, 2386–2394.
21. Siboni,R.B., Bodner,M.J., Khalifa,M.M., Docter,A.G., Choi,J.Y.,
Nakamori,M., Haley,M.M. and Berglund,J.A. (2015) Biological
efficacy and toxicity of diamidines in myotonic dystrophy type 1
models. J. Med. Chem., 58, 5770–5780.
22. Li,J., Matsumoto,J., Bai,L.P., Murata,A., Dohno,C. and Nakatani,K.
(2016) A ligand that targets CUG trinucleotide repeats. Chem. Eur. J.,
22, 14881–14889.
23. Singer,B., Kroger,M. and Carrano,M. (1978) O2- and O4-alkyl
pyrimidine nucleosides: stability of the glycosyl bond and of the alkyl
group as a function of pH. Biochemistry, 17, 1246–1250.
24. Kusmierek,J.T. and Singer,B. (1976) Reaction of diazoalkanes with
1-substituted 2, 4-dioxopyrimidines. Formation of O2, N-3 and
O4-alkyl products. Nucleic Acids Res., 3, 989–1000.
25. Holz,B., Klimasauskas,S., Serva,S. and Weinhold,E. (1998)
2-Aminopurine as a fluorescent probe for DNA base flipping by
methyltransferases. Nucleic Acids Res., 26, 1076–1083.
26. Nakano,S., Uotani,Y., Uenishi,K., Fujii,M. and Sugimoto,N. (2005)
DNA base flipping by a base pair-mimic nucleoside. Nucleic Acids
Res., 33, 7111–7119.
27. He,G., Kwok,C.K. and Lam,S.L. (2011) Preferential base pairing
modes of T.T mismatches. FEBS Lett., 585, 3953–3958.
28. Lopez Castel,A., Cleary,J.D. and Pearson,C.E. (2010) Repeat
instability as the basis for human diseases and as a potential target for
therapy. Nat. Rev. Mol. Cell Biol., 11, 165–170.
29. Pearson,C.E., Tam,M., Wang,Y., Montgomery,S.E., Dar,A.C.,
Cleary,J.D. and Nichol,K. (2002) Slipped-strand DNAs formed by
long (CAG)·(CTG) repeats: slipped-out repeats and slip-out
junctions. Nucleic Acids Res., 30, 989–1000.
30. Nakano,S., Uotani,Y., Uenishi,K., Fujii,M. and Sugimoto,N. (2005)
Site-selective RNA cleavage by DNA bearing a base pair-mimic
nucleoside. J. Am. Chem. Soc., 127, 518–519.
Conflict of interest statement. None declared.
REFERENCES
1. Mirkin,S.M. (2007) Expandable DNA repeats and human disease.
Nature, 447, 932–940.
2. Cech,T.R. and Steitz,J.A. (2014) The noncoding RNA
revolution-trashing old rules to forge new ones. Cell, 157, 77–94.
3. Singh,J., Petter,R.C., Baillie,T.A. and Whitty,A. (2011) The
resurgence of covalent drugs. Nat. Rev. Drug Discov., 10, 307–317.
4. Bauer,R.A. (2015) Covalent inhibitors in drug discovery: from
accidental discoveries to avoided liabilities and designed therapies.
Drug Discov. Today, 20, 1061–1073.
5. Yang,W.Y., Wilson,H.D., Velagapudi,S.P. and Disney,M.D. (2015)
Inhibition of non-ATG translational events in cells via covalent small
molecules targeting RNA. J. Am. Chem. Soc., 137, 5336–5345.
6. Velagapudi,S.P., Cameron,M.D., Haga,C.L., Rosenberg,L.H.,
Lafitte,M., Duckett,D.R., Phinney,D.G. and Disney,M.D. (2016)
Design of a small molecule against an oncogenic noncoding RNA.
Proc. Natl. Acad. Sci. U.S.A., 113, 5898–5903.
7. Rzuczek,S.G., Colgan,L.A., Nakai,Y., Cameron,M.D., Furling,D.,
Yasuda,R. and Disney,M.D. (2017) Precise small-molecule
recognition of a toxic CUG RNA repeat expansion. Nat. Chem. Biol.,
13, 188–193.
8. Di Antonio,M., McLuckie,K.I. and Balasubramanian,S. (2014)
Reprogramming the mechanism of action of chlorambucil by
coupling to a G-quadruplex ligand. J. Am. Chem. Soc., 136,
5860–5863.
9. Chen,C.H., Hu,T.H., Huang,T.C., Chen,Y.L., Chen,Y.R., Cheng,C.C.
and Chen,C.T. (2015) Delineation of G-Quadruplex Alkylation Sites
Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium
iodide)carbazole-Aniline Mustard Conjugates. Chem. Eur. J., 21,
17379–17390.
Downloaded from https://academic.oup.com/nar/article-abstract/46/3/1059/4788334
by guest
on 21 February 2018