Sanger dideoxy sequencing of DNA

Article abstract of DOI:10.1016/B978-0-12-418687-3.00014-8

While the ease and reduced cost of automated DNA sequencing has largely obviated the need for manual dideoxy sequencing for routine purposes, specific applications require manual DNA sequencing. For instance, in studies of enzymes or proteins that bind or modify DNA, a DNA ladder is often used to map the site at which an enzyme is bound or a modification occurs. In these cases, the Sanger method for dideoxy sequencing provides a rapid and facile method for producing a labeled DNA ladder.

Full text of DOI:10.1016/B978-0-12-418687-3.00014-8

CHAPTER FOURTEEN
Sanger Dideoxy Sequencing
of DNA
Sarah E. Walker, Jon Lorsch1
Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine,
Baltimore, MD, USA
1Corresponding author: e-mail address: jlorsch@jhmi.edu
Contents
1. Theory
2. Equipment
3. Materials
3.1 Solutions & buffers
4. Protocol
172
172
173
174
175
175
175
176
176
176
176
177
177
177
177
178
178
178
178
178
179
179
179
182
182
182
182
182
184
4.1 Preparation
4.2 Duration
4.3 Caution
5. Step 1 Anneal Primer to DNA
5.1 Overview
5.2 Duration
5.3 Tip
6. Step 2 Labeling
6.1 Overview
6.2 Duration
6.3 Tip
6.4 Tip
7. Step 3 Extension/Termination
7.1 Overview
7.2 Duration
8. Step 4 Resolution of Labeled Products by Urea-PAGE
8.1 Overview
8.2 Duration
8.3 Tip
8.4 Tip
8.5 Tip
8.6 Tip
8.7 Tip
References
#
Methods in Enzymology, Volume 529
ISSN 0076-6879
http://dx.doi.org/10.1016/B978-0-12-418687-3.00014-8
2013 Elsevier Inc.
All rights reserved.
171

172
Sarah E. Walker and Jon Lorsch
Abstract
While the ease and reduced cost of automated DNA sequencing has largely obviated
the need for manual dideoxy sequencing for routine purposes, specific applications
require manual DNA sequencing. For instance, in studies of enzymes or proteins that
bind or modify DNA, a DNA ladder is often used to map the site at which an enzyme
is bound or a modification occurs. In these cases, the Sanger method for dideoxy
sequencing provides a rapid and facile method for producing a labeled DNA ladder.
1. THEORY
Sequencing of DNA has been revolutionized by the advent of
dideoxynucleotides and the Sequenase enzyme. Dideoxynucleotide triphos-
phates are readily incorporated into a growing DNA chain, but lack the 30
hydroxyl group necessary to allow the chain to continue, and effectively ter-
minate polymerization. Sequenase is a T7 DNA polymerase that has been
chemically (Sequenase 1.0) or genetically (Sequenase 2.0) modified to
remove its 30–50 exonuclease activity (Fuller et al., 1996). Sequencing
DNA using Sequenase and dideoxynucleotides takes place in four steps. First
a primer is annealed to single-stranded DNA. Single-stranded DNA can be
synthesized by a bacteriophage, or as in the more frequently used method
described below, by denaturing double-stranded plasmid DNA. Next, the
annealed primer is extended to form various lengths of labeled DNA.
Label can be incorporated in the form of a radiolabeled primer used in
the annealing step, or, as described below, a radioactive nucleotide can
be incorporated during the extension step. We choose to use [a-32P]-
deoxythymidine, as it is less costly than other radioactive nucleotides, but
any [35S]-, [a-33P]-, or [a-32P]-deoxynucleotide can be used. Finally,
the extension reaction is divided between four different termination reac-
tions, each containing either dideoxy-adenosine, -cytosine, -guanosine,
or -thymidine. These four reactions are then resolved on a denaturing
polyacrylamide gel and visualized by autoradiography.
2. EQUIPMENT
Microcentrifuge
Heating block (68 and 95 ꢀC)
Incubator (42 ꢀC)
Sequencing gel apparatus (e.g., BRL Model S2, available from Labrepco
or Lab-X, or equivalent)

Sanger Dideoxy Sequencing of DNA
173
Power supply (capable of 65 W)
Sequencing gel plates (Labrepco for BRL Model S2 plates)
Sharktooth comb (CBS scientific, 0.2 mmꢁ62 well comb)
0.2 mm spacers with foam ears, slightly longer than plates
0.4 mm spacers (CBS scientific)
Large binder clips (or other gel clamps)
Gel dryer
Phosporimager (or film processor)
Phosphor screen (or autoradiography film)
Micropipettors
Micropipettor tips
1.5-ml microcentrifuge tubes
50-ml conical tubes
200 ml beaker
500 ml Sidearm vacuum flask
Buchner funnel
Microtiter plate (10 ml wells)
Glass fiber prefilter
Whatman 3MM chromatography paper
Syringe, 60 ml
Needle, 18 gauge
3. MATERIALS
DNA to be sequenced
Sequencing primer
dNTP stocks (dATP, dCTP, dGTP, dTTP, 10 mM)
[a-32P]-dTTP (800 Ci mmolꢂ1, 10 mCi mlꢂ1)
ddNTP stocks (ddATP, ddCTP, ddGTP, ddTTP, 10 mM)
N-tris(hydroxy–methyl)methyl-2-aminoethanesulfonic acid (TES)
Sodium chloride (NaCl)
Magnesium chloride (MgCl2)
Hydrochloric acid (HCl)
Formamide
EDTA
Xylene cyanol FF
Bromphenol blue
Sodium hydroxide (NaOH)
Dithiothreitol (DTT)

174
Sarah E. Walker and Jon Lorsch
Sequenase (USB Biochemicals)
40% Acrylamide:bisacrylamide solution (19:1)
Tris base
Boric acid (H3BO3)
Urea
Ammonium persulfate (APS)
Tetramethylethylenediamine (TEMED)
95% Ethanol
Siliconizing agent (e.g., Sigma-Cote or a nonsilicone smoothing agent)
3.1. Solutions & buffers
Step 1 TMN
Component
TES
Final concentration
Stock
Amount
1 ml
560 mM
400 mM
160 mM
1.21 M
2.8 M
NaCl
2 M
1 ml
MgCl2
HCl
0.8 M
1 ml
12.1 M (37%)
1 ml
H2O
1 ml
Step 2 Termination Mixes (ddA, ddC, ddG, ddT)
Component
dATP
Final concentration
80 mM
Stock
Amount
8 ml
10 mM
10 mM
10 mM
10 mM
10 mM
dCTP
80 mM
8 ml
dGTP
80 mM
8 ml
dTTP
80 mM
8 ml
Particular ddNTP
H2O
8 mM
0.8 ml
967 ml
-dT mix
Component
dATP
Final concentration
1.5 mM
Stock
Amount
0.75 ml
0.75 ml
0.75 ml
5 ml
10 mM
10 mM
10 mM
dCTP
1.5 mM
dGTP
1.5 mM
H2O

Sanger Dideoxy Sequencing of DNA
175
Step 3 STOP dye
Component
Final concentration
Stock
Amount
47.5 ml
2 ml
Formamide
95%
EDTA, pH 8.0
Xylene cyanol FF
Bromophenol blue
Add water to 50 ml
20 mM
0.05%
0.05%
500 mM
2.5 mg
2.5 mg
Step 4 10ꢁ TBE
Component
Tris base
Final concentration
Amount
108 g
55 g
89 mM
89 mM
2 mM
Boric acid
EDTA
7.44 g
Add water to 1 l
10% APS
Dissolve 5 g ammonium persulfate in 50 ml H2O in a 50-ml conical tube.
4. PROTOCOL
4.1. Preparation
Isolate plasmid DNA (see Isolation of plasmid DNA from bacteria) using
either a standard miniprep kit or CsCl density gradient centrifugation for
best results.
Order or synthesize an oligonucleotide primer (see Explanatory chapter:
PCR -Primer design) designed to anneal ꢃ30 nucleotides from where you
wish to start reading the DNA sequence, as you would for PCR, but use
only one primer for each sequence. Both plasmid and oligonucleotides
should be dissolved in water or a low salt solution without EDTA.
4.2. Duration
Preparation
About 1 day
Protocol
5–9 h þ overnight

176
Sarah E. Walker and Jon Lorsch
Figure 14.1 Flowchart of the complete protocol, including preparation.
4.3. Caution
Consult your institute Radiation Safety Officer for proper ordering, handling, and
disposal of radioactive materials.
See Fig. 14.1 for the flowchart of the complete protocol.
5. STEP 1 ANNEAL PRIMER TO DNA
5.1. Overview
Anneal a complementary primer ꢃ30 nucleotides from where you wish to
start reading the DNA sequence.
5.2. Duration
30 min
1.1 Mix the following in a 1.5-ml tube:
1–10 mg DNA
1 ml primer at 3 pmol mlꢂ1
1 ml 1 M NaOH
H2O to bring volume to 10 ml
1.2 Incubate for 10 min at 68 ꢀC.
1.3 Add 2 ml of TMN buffer as each tube is removed from the water bath or
heat block.
1.4 Transfer tubes to a rack at room temperature for 10 min.

Sanger Dideoxy Sequencing of DNA
177
Figure 14.2 Flowchart of Step 1.
5.3. Tip
Make labeling mix (for Step 2) and aliquot termination mixes (for Step 3) during
incubations (Steps 1.2 and 1.4) for best use of time.
See Fig. 14.2 for the flowchart of Step 1.
6. STEP 2 LABELING
6.1. Overview
Extend the annealed primer, incorporating 32P-labeled TTP to label
each strand.
6.2. Duration
5 min
2.1 Aliquot 2.5 ml of termination mixes to four wells of a microtiter dish for
each reaction. Add ddA to one column, ddC to the next, ddG to the
third, and ddT to the fourth column, with as many rows as you
have reactions.
2.2 Make a labeling master mix for 10–12 reactions plus 2 extra for
pipetting loss.
For each reaction include:
2 ml – dT mix
1 ml 100 mM DTT
0.5–1 ml [a-32P]-TTP

178
Sarah E. Walker and Jon Lorsch
Figure 14.3 Flowchart of Step 2.
0.167 ml Sequenase
H2O to make 4.25 ml
2.3 Add 4.25 ml labeling mix to each tube from Step 1 (containing DNA
annealed with primer) and leave at room temperature for 3–5 min.
6.3. Tip
If a 10-ml microtiter dish is not available, PCR plates or tubes also work, and can be
placed in a thermal cycler to incubate.
6.4. Tip
Use 0.5 ml [a-32P]-TTP if less than 2-weeks old or 1 ml if older.
See Fig. 14.3 for the flowchart of Step 2.
7. STEP 3 EXTENSION/TERMINATION
7.1. Overview
Labeled DNAs will be extended and terminated by the incorporation
of dideoxynucleotides.
7.2. Duration
30 min
3.1 Remove 3.5 ml each labeling reaction and add to each of the four ter-
mination mixes in the microtiter dish.

Sanger Dideoxy Sequencing of DNA
179
Figure 14.4 Flowchart of Step 3.
3.2 Incubate microtiter dish in a 42 ꢀC incubator for 10 min.
3.3 Add 4 ml STOP dye to each reaction.
See Fig. 14.4 for the flowchart of Step 3.
8. STEP 4 RESOLUTION OF LABELED PRODUCTS BY
UREA-PAGE
8.1. Overview
Pour a sequencing gel and resolve the labeled DNA products by electropho-
resis (see Analysis of RNA by analytical polyacrylamide gel electrophoresis).
8.2. Duration
4–8 hþovernight
4.1 Place sequencing plates on two stable racks. Wipe plates with 95%
ethanol until dry.
4.2 Treat plates with a siliconizing or nonsilicone smoothing agent. Do
not use excessive amounts (>1 ml per plate) as this can allow the
gel to migrate upwards during electrophoresis.
4.3 Assemble plate sandwich as shown in Fig. 14.5. Clamp together with
five large binder clips on each side on the center of the spacers.
4.4 Make gel solution:
42 g Urea
10 ml 10ꢁ TBE
15 ml 40% acrylamide:bisacrylamide solution (19:1)
H2O to make 100 ml
Solution will get cold. Heat in a microwave for 10 s or on a hot
plate at high temperature to bring solution just to room temperature.
Do not allow the acrylamide solution to get warmer than room

180
Sarah E. Walker and Jon Lorsch
Figure 14.5 Resolution of labeled DNA products by electrophoresis through denaturing
polyacrylamide gels. (a) Assembly of plates and spacers. A plate sandwich is assembled
by first placing the spacers on the siliconized surface along each edge of the long plate.
To create a wedge, a ꢃ5–10 mm piece cut from a 0.4 mm spacer is placed at the bottom
of the plate, and a 5–10 mm piece of a 0.2 mm spacer is placed ꢃ10 cm from the
bottom end of the plate. A 0.2 mm spacer with a foam block adhered to the top end
is placed directly on top of these spacers to create a sandwich that is 0.2–0.6 mm thick.
The short plate is then placed on top of the spacers so that the foam blocks are
flush with the top edge of the short plate and the bottom edge of the short plate is
ꢃ5 mm from the bottom of the long plate, leaving a gap for pouring the gel. The sand-
wich is clamped together on the center of each spacer using binder clips. (b) Analysis
of a sequencing gel. A gel was loaded with four reactions each containing
(1) ddT, (2) ddG, (3) ddC, or (4) ddA and the DNA was sequenced from a reverse
primer. The portion of the gel that is shown is read from top to bottom 50-CTAATA
CGACTCACTATAGGTAAAGTGTCATAGCACCAACTGTTAATTAAATTAAATTAAAAAG-30.
temperature as this can cause premature polymerization. Invert several
times or stir to dissolve urea. Filter solution through a glass fiber filter
in a Buchner funnel attached to a vacuum flask and degas briefly.
4.5 Transfer the filtered gel solution to a 250 ml beaker, and add 500 ml
10% APS and 50 ml of TEMED. Quickly stir solution with a 60 ml
syringe, and draw solution into the syringe. Pour gel from bottom
to top, by placing the syringe outlet at the center of the gel sandwich
and slowly pushing the gel solution between the plates. Allow gel to
move across the bottom section, and then tilt the plates slightly to

Sanger Dideoxy Sequencing of DNA
181
facilitate gradual movement of the gel front into the plates until the
syringe is almost empty. Lower the plates, refill the syringe, and con-
tinue tilting and pushing gel into plates until the gel front reaches the
top of the short plate.
4.6 Insert the flat side of a sharktooth comb into the sandwich to make a
large well ꢃ0.5 cm into the gel (Combs from CBS scientific have a
line marking how far to insert comb). Clamp the comb in place with
three evenly spaced binder clips.
4.7 Rinse the syringe for future use. Allow the gel to polymerize for
ꢃ30 min to 1 h.
4.8 Remove comb and rinse well with a gentle stream of water to remove
any strings of polyacrylamide that may be present.
4.9 Place the gel in sequencing apparatus without disturbing spacers. Fill
the upper and lower reservoirs with 1ꢁ TBE and use a 60 ml syringe
with a bent 18-gauge needle to rinse the well and underneath the gel
to remove any bubbles.
4.10 Prerun gel at 65 W for 15 min to 1 h.
4.11 Place the microtiter dish (from Step 3.3) on a heat block at 95 ꢀC for
3 min to denature DNA, and then place on ice. Wash well just before
loading to remove any urea that has seeped out of gel, and insert
sharktooth comb with teeth into the gel to ꢃ1 mm deep.
4.12 Load 2 ml per lane in the wells between the teeth of the comb. After
loading the first set of four sequencing lanes, load one lane with stop
dye and then continue loading the remaining sets in adjacent lanes so
that loading is asymmetrical for later analysis.
4.13 Run the gel at 65 W for ꢃ1 h 45 min to 2 h to run bromphenol blue
dye near the bottom of the gel in order to resolve the first ꢃ100–150
nucleotides. Run the gel longer to see sequence further from the
primer, keeping in mind that Sequenase extends only ꢃ600–800
nucleotides.
4.14 Drain buffer from the upper chamber, and lay gel sandwich on a cov-
ered area of bench.
4.15 Remove spacers and use a metal spatula or wedge separator to care-
fully pry plates apart. If the gel is stuck to both plates, leave it until it
cools completely and then attempt to pry apart.
4.16 Place Whatman 3MM paper on the gel and press gloved hands firmly
around entire surface to stick the gel to Whatman paper. Carefully
remove gel/paper from plate, starting from top. Cover the gel with

182
Sarah E. Walker and Jon Lorsch
plastic wrap and trim any areas that were not loaded to speed up the
drying process.
4.17 Place the gel on a second piece of Whatman 3MM paper on the gel
dryer and dry at 85 ꢀC for 1 h, or longer, under vacuum.
4.18 Expose to X-ray film or phosphor screen for autoradiography over-
night, and process (Fig. 14.5).
8.3. Tip
Handle the sequencing plates very carefully as they are much more easily broken than
most electrophoresis plates. The slightest bump into the side of a sink or a benchtop will
chip the plates, which can render the plates unusable.
8.4. Tip
Reactions may be stored at ꢂ20 ꢀC for several days to several weeks, but the quality
of sequence may deteriorate over time. It is recommended that samples be run on a gel
as soon as possible after sequencing.
8.5. Tip
To maximize time, the sequencing gel can be poured before setting up annealing reac-
tions (Step 1), and set up and prerun during extension/termination (Step 3).
8.6. Tip
To get more information from one set of sequencing reactions, simply load the reactions
multiple times. Load a set of samples and run the gel for 1–2 h, pause running and
load the samples again in empty lanes, and run the bromphenol blue from these sam-
ples to the bottom of the gel. The first set of samples loaded will have sequence further
from the primer, while the samples run last will have sequence starting from the primer.
8.7. Tip
Drying times may vary depending on the pump. Allow the gel to cool before removing
vacuum to prevent cracking if you are unsure that gel is dry.
See Fig. 14.6 for the flowchart of Step 4.

Sanger Dideoxy Sequencing of DNA
183
Figure 14.6 Flowchart of Step 4.

184
Sarah E. Walker and Jon Lorsch
REFERENCES
Referenced Literature
Fuller, C. W., McArdle, B. F., Griffin, A. M., & Griffin, H. G. (1996). DNA sequencing
using sequenase version 2.0 T7 DNA polymerase. Methods in Molecular Biology, 58,
373–387.
Referenced Protocols in Methods Navigator
Isolation of plasmid DNA from bacteria
Explanatory chapter: PCR -Primer design
Analysis of RNA by analytical polyacrylamide gel electrophoresis