Quantification of meccnu-induced dg-dc crosslinks in oligonucleotide duplexes by liquid chromatography/electrospray ionization tandem mass spectrometry

Article abstract of DOI:10.1002/rcm.5064

Chloroethynitrosoureas (CENUs) are important alkylating agents widely used in the treatment of cancers. Decomposition of CENUs generates active electrophilic ions that damage DNA, including the formation of dG-dC crosslinks which represents the most important cytotoxic mechanism of CENUs. In this work, a high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ESI-MS/MS) method was employed to analyze the dG-dC crosslinks induced by 1-(2-chloroethyl)-3-(4-methylcyclohexyl)-1-nitrosourea (meCCNU, Semustine). The direct quantitation of dG-dC crosslinks in oligonucleotide duplexes was achieved by the selected reaction monitoring (SRM) mode using synthesized ¹⁵N₃-labeled dG-dC as an internal standard. Methods of enzymatic digestion and HPLC separation were developed for obtaining separation and reproducibility of the dG-dC peak in chromatograms. The limit-of-detection (LOD) was determined to be 0.08 nM and the limit-of-quantification (LOQ) was determined to be 0.16 nM. The linearity of the calibration curve was 0.9997 over the range of 0.08 to 32 nM. The precision and accuracy of the method ranged from 1.1 to 6.6% and 96 to 109%, respectively. The recovery of the dG-dC crosslink in the enzymatic hydrolysates from the oligonucleotide duplex was determined to be from 91 to 106%. The results of the validation study indicate that the method is suitable for quantifying dG-dC crosslinks in DNA. Consequently, this method was used to determine meCCNU-induced dG-dC crosslinks in four duplexes with different GC contents. The results showed that the crosslinking fraction (CF) increased as the GC content in the duplex increased, and a relatively low CF was observed in the early period of the reaction. Copyright

Full text of DOI:10.1002/rcm.5064

Evaluation Only. Created with Aspose.PDF. Copyright 2002-2021 Aspose Pty Ltd.
Research Article
Received: 27 February 2011
Revised: 17 April 2011
Accepted: 17 April 2011
Published online in Wiley Online Library
Rapid Commun. Mass Spectrom. 2011, 25, 2027–2034
(wileyonlinelibrary.com) DOI: 10.1002/rcm.5064
Quantification of meCCNU‐induced dG‐dC crosslinks in
oligonucleotide duplexes by liquid chromatography/electrospray
ionization tandem mass spectrometry
*
Baoqing Bai, Lijiao Zhao and Rugang Zhong
College of Life Sciences and Bioengineering, Beijing University of Technology, Beijing 100124, P. R. China
Chloroethynitrosoureas (CENUs) are important alkylating agents widely used in the treatment of cancers.
Decomposition of CENUs generates active electrophilic ions that damage DNA, including the formation of dG‐dC
crosslinks which represents the most important cytotoxic mechanism of CENUs. In this work, a high‐performance
liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ESI‐MS/MS) method was
employed to analyze the dG‐dC crosslinks induced by 1‐(2‐chloroethyl)‐3‐(4‐methylcyclohexyl)‐1‐nitrosourea
(meCCNU, Semustine). The direct quantitation of dG‐dC crosslinks in oligonucleotide duplexes was achieved by
the selected reaction monitoring (SRM) mode using synthesized 15N3‐labeled dG‐dC as an internal standard.
Methods of enzymatic digestion and HPLC separation were developed for obtaining separation and reproducibility
of the dG‐dC peak in chromatograms. The limit‐of‐detection (LOD) was determined to be 0.08 nM and the limit‐of‐
quantification (LOQ) was determined to be 0.16 nM. The linearity of the calibration curve was 0.9997 over the range
of 0.08 to 32 nM. The precision and accuracy of the method ranged from 1.1 to 6.6% and 96 to 109%, respectively. The
recovery of the dG‐dC crosslink in the enzymatic hydrolysates from the oligonucleotide duplex was determined to
be from 91 to 106%. The results of the validation study indicate that the method is suitable for quantifying dG‐dC
crosslinks in DNA. Consequently, this method was used to determine meCCNU‐induced dG‐dC crosslinks in
four duplexes with different GC contents. The results showed that the crosslinking fraction (CF) increased as the
GC content in the duplex increased, and a relatively low CF was observed in the early period of the reaction.
Copyright © 2011 John Wiley & Sons, Ltd.
Chloroethynitrosoureas (CENUs), such as 1,3‐bis‐(2‐chloro-
ethyl)‐1‐nitrosourea (BCNU), 1‐(2‐chloroethyl)‐3‐cyclohexyl-
1‐nitrosourea (CCNU) and 1‐(2‐chloroethyl)‐3‐(4‐methyl-
cyclohexyl)‐1‐nitrosourea (meCCNU), have been widely
used as chemotherapeutics for the inhibition of leukemia,
Hodgkin’s disease and various solid tumors.[1–4] CENUs are
unstable in aqueous media and spontaneously decompose
to yield chloroethyldiazohydroxides, which give rise to
diazonium ions, and perhaps other carbocations.[5–10] These
electrophilic ions damage DNA by alkylation of bases,
single/double strand breakages and interstrand crosslinks
(ISC).[10–12] Significant effort has been devoted to the
investigation of DNA damage by CENUs. These studies
demonstrated that DNA ISC were the most important type
of DNA modification leading to cytotoxicity by CENUs. This
is because such DNA modifications prevented the separa-
tion of DNA double strands in the replication process.[13,14]
Bodell et al.[15,16] compared the levels of DNA alkylation
products in human glioma cell lines after treatment with
3H‐CENUs using high‐performance liquid chromatography
(HPLC). They demonstrated that there was a significant
correlation between LD10 of CENUs and the levels of dG‐dC
crosslink, which suggested that the levels of dG‐dC crosslink
could be used as molecular dosimeters of therapeutic
response following treatment with CENUs. Electrophoretic
and fluorescence assays were performed for the quantifica-
tion of ISC induced by CENUs. Chen et al.[17] investigated the
effect of buffers on DNA adduction, crosslinks and cytotoxi-
city induced by CENUs using polyacrylamide gel electro-
phoresis. Their results demonstrated that Tris increased the
yield of not only the monofunctional adducts, but also the
bifunctional adducts, such as the formation of the interstrand
dG‐dC crosslinks. The agarose gel electrophoresis assay of
ISC showed a correlation between the time of exposure to
Fotemustine and Semustine (meCCNU) and the level of
ISC,[18] which indicated increasing exposure time led to
increases in the amount of ISC formed. Penketh et al.[19]
investigated the ISC induced by Cloretazine, which is a
relatively new prodrug with a similar anticancer mechanism
to CENUs, using a fluorescence assay with the Hoechst
33258 dye. Using an ethidium bromide fluorescence assay,
Ueda‐Kawamitsu et al.[20] measured the time course of DNA
ISC in L1210 cells treated with BCNU. The results showed
that the percentage of crosslinks reached the maximum after
6 h exposure to BCNU and subsequently decreased pre-
sumably because of DNA repair. As hypothesized in our
previous research,[21,22] the distance between a pair of
negative atoms in DNA base pairs spatially matches with
* Correspondence to: L. Zhao, College of Life Science and
Bioengineering, BeijingUniversity of Technology. Pingleyuan
No. 100, Chaoyang District, Beijing 100124, China.
E‐mail: zhaolijiao@bjut.edu.cn
Rapid Commun. Mass Spectrom. 2011, 25, 2027–2034
Copyright © 2011 John Wiley & Sons, Ltd.

Evaluation Only. Created with Aspose.PDF. Copyright 2002-2021 Aspose Pty Ltd.
B. Bai, L. Zhao and R. Zhong
the –CH2–CH2– ethylene bridge. Consequently, the N3
position of cytosine is inferred to be the favorable site for
the second alkylation and therefore the crosslinks form
between the N1 atom of guanine and the N3 atom of
cytosine. By modeling a crosslinked 13‐mer B‐DNA, the
crosslink between N1 of guanine and N3 of cytosine was
demonstrated to be the most energetically preferred structure
when compared with the crosslinks of G(O6)‐C(N4), G(N2)‐C
(O2) and A(N6)‐T(O4).[23] The works mentioned above
reported a series of methods for the quantitation of DNA
ISC induced by CENUs. However, these methods were
relatively non‐specific for the detection of dG‐dC crosslinks
and validation of the methods was insufficient.
buffer B for 3 min and this was followed by a gradient down
to 5% buffer B over 2 min. The flow rate of the mobile phase
was 1 mL/min and the UV detector was set at 258 nm.
The synthesis of the internal standard, isotope‐labeled
15N3‐dG‐dC, was carried out using the same procedure of
unlabeled dG‐dC except 15N3‐2’‐deoxycytidine was used in
the final step of the synthesis. Isotope‐labeled 15N3‐2′‐
deoxycytidine (5 mg, 22 µmol) was reacted with O6‐(2‐fluo-
roethyl)‐2′‐deoxyguanosine (5 mg, 16 µmol) in DMSO (50 μL)
at 55 °C for 20 days. The final products and intermediates
were characterized by NMR, MS/MS, IR and UV spectro-
scopy, and the data were consistent with results obtained
previously.[15,24–26]
In this work, a high‐performance liquid chromatography/
electrospray ionization tandem mass spectrometry (HPLC/
ESI‐MS/MS) method was employed to analyze the dG‐dC
crosslinks induced by meCCNU. The direct quantitation of
dG‐dC crosslinks was achieved by selected reaction monitor-
ing (SRM) mode following enzymatic digestion and HPLC
separation. The method was applied to determine the
crosslinking fractions of four oligonucleotide duplexes with
different sequences. This work is expected to shed light on
in vitro and in vivo investigations examining the formation of
DNA adducts induced by anticancer agents, carcinogens
and related chemicals. Based on the sensitivity of the assay,
only several micrograms of DNA are required for analysis of
animal or human samples.
Incubation of oligonucleotide duplexes with meCCNU
The commercially purchased synthetic oligonucleotides were
annealed to form duplexes. Sixty OD (2 mg) of oligonucleo-
tide was freshly dissolved in annealing buffer (10 mM Tris,
50 mM NaCl, 1 mM EDTA, pH 7.6). The oligonucleotides
were then annealed by heating the solution to 95°C and
cooling slowly to room temperature. This annealing step
generated duplexes with different sequences (see Table 1),
which were diluted using deionized water to a concentration
of 0.25 mg/mL. meCCNU (4 mg) freshly dissolved in 25 μL of
alcohol was added into the duplex solution and the final
concentration of meCCNU in the reaction system was 2 mM.
The reaction mixture was incubated at 37°C for 10 h in the
dark. At 2 h intervals, 200 μL was removed from reaction
mixture. The sample solutions were stored at −20°C until
enzyme hydrolysis was performed.
EXPERIMENTAL
Materials
Enzymatic digestion of the oligonucleotide duplexes
MeCCNU, acetonitrile (HPLC grade), 2′‐deoxyguanosine,
2′‐deoxycytidine and phosphodiesterase I were purchased
from Sigma‐Aldrich (St. Louis, MO, USA). Nuclease S1,
alkaline phosphatase (CIAP) and deoxyribonuclease I were
obtained from TaKaRa (TaKaRa Biotechnology, Japan).
15N3‐2′‐Deoxycytidine was purchased from Cambridge
Isotope Laboratories (Andover, MA, USA). The synthetic
oligonucleotides were acquired from SBS (SBS Genetech
Co., Ltd., China). Microcon YM‐10 centrifugal columns
were purchased from Millipore (Billerica, MA, USA). All
other chemicals, reagents and solvents were purchased
from Sigma‐Aldrich. Deionized water was purified using a
PALL deionizer (NYSE, PALL, USA).
To facilitate the release of dG‐dC from the DNA duplexes,
four digestion enzymes were used. Every sample solution
(200 μL, containing about 50 µg of the oligonucleotides) was
firstly hydrolyzed using 100 units of DNase I (30 μL,
buffered in CH3COONa 20 mM, NaCl 150 mM, pH 5.0)
and 170 units of nuclease S1 (30 μL, buffered in CH3COONa
10 mM, NaCl 150 mM, ZnSO4 0.05 mM, pH4.6). After
incubation at 37 °C for 3 h, the oligonucleotides were further
digested by the addition of 17 units (50 μL) of alkaline
phosphatase and 3 milliunits of phosphodiesterase I (5 μL)
buffered in Tris‐HCl 500 mM, MgCl2 10 mM (pH 9.0), and
incubated at 37 °C for 3 h. After enzymatic digestion, the
samples were filtered using Microcon YM‐10 centrifugal
filters to remove the enzymes, and ~315 μL of filtrate was
obtained from each sample which was used for HPLC/ESI‐
MS/MS analysis.
Standards
The synthesis of the dG‐dC standard, 1‐[N3‐deoxycytidyl]‐
2‐[N1‐deoxyguanosyl]ethane, was carried out according
to previously reported procedures.[15,24,25] N2,3′,5′‐Triacetyl‐
2′‐deoxyguanosine was initially synthesized and was used
as the material for the subsequent synthesis of O6‐(2‐
fluoroethyl)‐2′‐deoxyguanosine (O6‐FEtdG). O6‐FEtdG (10 mg,
32 µmol) was reacted with 2′‐deoxycytidine (20 mg, 88 µmol)
in dimethyl sulfoxide (DMSO) (200 μL) at 55 °C for 20 days.
The synthesized dG‐dC was isolated by HPLC using a
ZORBAX SB‐C18 column (4.6 × 250 mm, 5 µm particle size).
The mobile phase was 2 mM ammonium acetate (0.1% acetic
acid, pH 6.8) (A) and acetonitrile (B) with a gradient of 5 to
10% of buffer B for 20 min followed by a gradient to 30%
buffer B over 10 min. An isocratic wash was then used at 30%
HPLC/ESI‐MS/MS conditions
The resulting mixtures of nucleosides containing dG‐dC
crosslinks were analyzed by reversed‐phase HPLC/ESI‐MS/
MS with a Thermo TSQ QUANTUM Discovery MAX triple
quadrupole tandem mass spectrometer equipped with a
ThermoFinnigan HPLC system (ThermoFinnigan, San Jose,
CA, USA). The instrument was operated using Xcalibur 1.4
software. A ZORBAX SB‐C18 column (2.1 × 150 mm, 5 µm
particle size; Agilent Technologies, Palo Alto, CA, USA) was
used for the separation of dG‐dC from the digestion mixture.
Solutions of 2 mM ammonium acetate containing 0.1% acetic
wileyonlinelibrary.com/journal/rcm
Copyright © 2011 John Wiley & Sons, Ltd. Rapid Commun. Mass Spectrom. 2011, 25, 2027–2034

Evaluation Only. Created with Aspose.PDF. Copyright 2002-2021 Aspose Pty Ltd.
Quantification of meCCNU‐induced dG‐dC crosslinks by HPLC/ESI‐MS/MS
Table 1. The sequences and GC contents of the four 26‐mer oligonucleotide duplexes treated with meCCNU for the analysis
of dG‐dC crosslinks
Number of
GC pairs
Content of
GC pairs (%)
Molecular weight
of duplexes
Name
Sequences
A
B
5′‐TTAATAAATAAAATATATAAATATTA‐3′
3′‐AATTATTTATTTTATATATTTATAAT‐5′
5′‐TTAATGGGCGCAATACGCGAATATTA‐3′
3′‐AATTACCCGCGTTATGCGCTTATAAT‐5′
5′‐TTAATGGGCGCCATACGCGGGCATTA‐3′
3′‐AATTACCCGCGGTATGCGCCCGTAAT‐5′
5′‐TGGCGGGCGCCAATACGCGGGCGCGA‐3′
3′‐ACCGCCCGCGGTTATGCGCCCGCGCT‐5′
0
0
15929.0
15938.6
15942.5
15948.3
10
14
20
38
54
77
C
D
acid (pH 6.8) (solution A) and acetonitrile (solution B) were
used as the mobile phase. The mobile phase gradient started
from 5% buffer B and linearly increased over 25 min to 15%
buffer B where it was held for 2 min. The percentage of buffer
B was then reduced to 5% in 1 min followed by an
equilibration time of 7 min. All calibration standards and
enzymatic digestion samples were introduced to the column
via a 25 μL sample loop. The sample components from the
HPLC column were eluted into the mass spectrometer.
Mass spectrometric detection was performed in the
positive mode with an electrospray ionization (ESI) source.
The parameters of the ESI source were optimized using a
dG‐dC standard solution and was set as follows: spray
voltage 4000 V; sheath gas (nitrogen) pressure 50 psi; aux
gas (nitrogen) pressure 15 psi; capillary temperature 300°C;
and tube lens offset 141 V. Argon was used as the collision
gas for tandem mass spectrometric analysis and the collision
gas pressure was 1.0 mTorr. The collision energy was set to
20 V. Positive ions were acquired in the selected reaction
monitoring (SRM) mode. The signal of dG‐dC was
monitored by the transition m/z 521 to 289, and the signal
of the internal standard 15N3‐dG‐dC was monitored by the
transition m/z 524 to 292. The product ion spectra of dG‐dC
and 15N3‐dG‐dC are presented in Fig. 1.
Method validation
Quality control (QC) samples were prepared independently
by diluting appropriate amounts of dG‐dC and 15N3‐dG‐dC
stock solutions in deionized water. The concentrations of the
QC samples were calculated 0.32, 3.2, 16 and 32 nM of dG‐dC
with 5.3 nM of 15N3‐dG‐dC. The precision and accuracy
of intra‐day and inter‐day assays[27–31] were determined by
replicate analyses of QC samples at the four concentration
levels. The intra‐day assay precision and accuracy were
obtained by repeated analyses (n = 6) of the QC samples
within one assay, and the inter‐day assay precision and
Calibration standards
A stock solution of dG‐dC and the internal standard stock of
15N3‐dG‐dC were prepared at 1.6 and 0.53 mM in deionized
water, respectively. The calibration working standards of
dG‐dC with a fixed amount of 15N3‐dG‐dC were prepared by
diluting the corresponding appropriate amounts of dG‐dC
and 15N3‐dG‐dC initial stock solutions with deionized water.
The stock solution of dG‐dC was serially diluted with
deionized water to obtain a series of lower calibration
working solutions of 0.08, 0.16, 0.32, 0.8, 1.6, 3.2, 8, 16 and
32 nM, and the 15N3‐dG‐dC working solution (5.3 nM) was
prepared by gradient dilutions of the internal standard stock
solution with deionized water. All solutions were stored at
−20°C.
The calibration curves were obtained by plotting the SRM
peak area ratios of dG‐dC to 15N3‐dG‐dC versus the
concentration of dG‐dC. The linearity of the calibration
curves was evaluated by the values of the correlation
coefficients (R2). The concentration of dG‐dC in the enzy-
matic digestion samples was calculated from their peak area
ratios by using the calibration equations.
Figure 1. Positive ESI product ion spectrum of [M + H]+ ions
of (A) dG‐dC and (B) 15N3‐dG‐dC.
Rapid Commun. Mass Spectrom. 2011, 25, 2027–2034 Copyright © 2011 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/rcm

Evaluation Only. Created with Aspose.PDF. Copyright 2002-2021 Aspose Pty Ltd.
B. Bai, L. Zhao and R. Zhong
accuracy were determined by repeated analysis of the QC
samples over three consecutive days.
CENUs, qualitative and quantitative assays of DNA ISC have
been performed by various analytical techniques. Using an
alkaline elution technique, Erickson et al.[34] demonstrated a
correlation between DNA ISC and cytotoxicity, and Aida
et al.[35] obtained a crosslinking index for rat brain tumor cells
treated with BCNU. Polyacrylamide gel electrophoresis has
been applied to evaluate the buffer effects on DNA adduction,
crosslinking and cytotoxicity induced by CENUs.[17] Penketh
et al.[19,36,37] reported a fluorescence method for the quantitation
of DNA ISC in T7 DNA using the H33258 molecular probe. The
values of the crosslinking fraction (CF), which were repre-
sented by the fraction of DNA molecules containing one or
more crosslinks per molecule, were employed to compare the
crosslinking activity of anticancer agents. The above research
provided suitable protocols for the analysis of DNA ISC;
however, these methods did not directly quantify the number of
crosslinked base pairs orconfirm the position of the crosslinking
sites in DNA. Bodell et al.[11,15,16,38,39] reported a series of direct
quantifications of dG‐dC crosslinks in purified calf thymus
DNA and in glioma cell lines using HPLC. Fischhaber et al.[40]
performed direct quantitation of dG‐dC crosslinks in synthe-
sized DNA duplexes by HPLC/ESI‐MS. We recently investi-
gated dG‐dCcrosslinks in calf thymus DNA treatedwith BCNU
using HPLC/ESI‐MS/MS.[26] These research efforts achieved
direct quantitation of dG‐dC crosslinks in DNA or cell lines;
however, these methods either had relatively low specificity and
sensitivity or did not indicate the validation of the assay, such as
the precision, accuracy and recovery.
In this work, an analytical method with high selectivity
and sensitivity was developed for the quantitation of dG‐dC
crosslinks induced by meCCNU. The dG‐dC standard was
synthesized and used to optimize the ESI‐MS/MS conditions.
The optimum instrumental parameters were obtained as
described in the Experimental section, including spray
voltage, gas pressure, capillary temperature, tube lens offset
and collision energy. The standard solution was repeatedly
introduced into the mass spectrometer to confirm the
optimum SRM precursor/fragment ion transition for
dG‐dC. The product ion spectrum of the protonated dG‐dC
is presented in Fig. 1(A). The [M + H]+ ion of dG‐dC (m/z 521)
yields two fragment ions at m/z 405 and 289, which
respectively correspond to the loss of one or two ribosyl
moieties because of the cleavage of the glucosidic bond.
Because the signal of m/z 289 is much stronger than the signal
for the m/z 405 species, the positive SRM quantitation for
dG‐dC was performed at the m/z 521 → 289 transition. Stable
isotopically labeled 15N3‐dG‐dC was used as the internal
standard to avoid possible measurement error from sample
preparation and instrument response. The tandem mass
spectrum of 15N3‐dG‐dC is shown in Fig. 1(B). The [M + H]+
ion of dG‐dC (m/z 524) also yields two fragment ions at
m/z 408 and 292, which are produced from the same
fragmentation mechanism as dG‐dC. The precursor/fragment
ion transition at m/z 524 → 292 was therefore employed as the
SRM quantitation of 15N3‐dG‐dC.
To test the recovery of the dG‐dC crosslinks in the
enzymatic digestion samples, a series of control samples
were spiked with standard dG‐dC at concentrations of 0.32,
3.2, 16 and 32 nM with a fixed 15N3‐dG‐dC concentration
of 5.3 nM. The concentrations of dG‐dC in every sample were
analyzed six times. The recovery was calculated as the
formula:
Recovery ¼ mean of the determined concentration
=added concentration ꢀ 100%:
The stability of the 1.6 mM dG‐dC and 0.53 mM 15N3‐dG‐dC
stock solutions was determined after storage at −20°C for
3 months with intermittent thawing and freezing. The
response was compared to a freshly prepared stock solution
and stability was expressed as the percentage recovery of the
stored solution relative to the fresh solution. The stability of
dG‐dC in the enzymatic digestion mixtures during sample
preparation was evaluated by assaying samples after 24 h of
storage at room temperature and 4°C.
Data analysis
HPLC/ESI‐MS/MS chromatograms were integrated using
analysis software Xcalibur 1.4. Calibration curves in the
concentration range of 0.08–32 nM were constructed by
plotting the SRM peak area ratios of dG‐dC/15N3‐dG‐dC
versus the corresponding dG‐dC concentrations. The con-
centrations of dG‐dC in the mixtures were determined
according to the calibration equation. The obtained concen-
trations of dG‐dC were used to calculate the crosslinking
fractions (CF) of the oligonucleotide duplexes with the
following formula:
À
Á
CF ¼ C ꢀ V ꢀ 107 =ð26 ꢀ C0 ꢀ V0=M0Þ
(1)
Because the oligonucleotides were completely hydrolyzed
to free nucleosides by the enzymatic digestion, the values
of CF indicated the number of crosslinked GC base pairs in
every 107 base pairs. In the formula for CF, C refers to the
determined concentrations of dG‐dC crosslinks in the
samples (in nM); V refers to the volume of the enzymatic
digestion solution, which was ~315 μL; C0 is concentration of
the oligonucleotide duplexes, which was 0.25 mg/mL; V0 is
the volume of the sample withdrawn from the reaction
solution in 2 h intervals, which was 200 μL; and M0 represents
the molecular weight of the oligonucleotide duplex.
RESULTS AND DISCUSSION
Development of HPLC/ESI‐MS/MS analysis
Because N‐methyl‐N′‐nitro‐N‐nitrosoguanidine (MNNG) was
demonstrated to have activity against LI210 cells in 1959,[32,33]
significant effort has been made to clarify the anticancer
mechanism of CENUs. DNA ISC induced by the active
electrophilic species yielded from the decomposition of CENUs
was considered to play a predominant role in the anticancer
activity of CENUs. In order to obtain a better understanding of
the relationship between DNA ISC and the anticancer activity of
A number of protocols for HPLC separation were tested to
obtain satisfactory separation and peak shape of dG‐dC from
the mixture of the hydrolysates. Various combinations of the
inorganic mobile phase (deionized water or ammonium
acetate solution with a concentration range of 1–10 mM) and
organic mobile phase (methanol or acetonitrile) were used for
the separation. The optimal mobile phase selected was 2 mM
wileyonlinelibrary.com/journal/rcm
Copyright © 2011 John Wiley & Sons, Ltd. Rapid Commun. Mass Spectrom. 2011, 25, 2027–2034