Synthesis and anti-fibrosis activity study of 14-deoxyandrographolide-19-oic acid and 14-deoxydidehydroandrographolide-19-oic acid derivatives

Article abstract of DOI:10.1016/j.ejmech.2018.08.046

A series of 14-deoxyandrographolide-19-oic acid and 14-deoxy-11,12 (or 14,15)-didehydroandrographolide-19-oic acid derivatives were designed, synthesized and screened in vitro against the mouse fibroblast cell lines NIH-3T3. Thirteen compounds 8a-f, 14a-c, 14e-f, and 18a-b were found to exhibit better anti-fibrotic activities than andrographolide, with compounds 8b and 14e displaying best activity with IC₅₀ values of 12.86 and 13.57 μM against NIH-3T3 respectively. Further anti-fibrotic investigation was performed in terms of PCR and western bolt analysis. Our study demonstrated that compounds 8b and 14e suppressed effectively the expression of α-smooth muscle actin, fibronectin and collagen in NIH-3T3. Preliminary structure-activity analysis revealed that 14-deoxygenation and 19-carboxylation of andrographolide could significantly improve its anti-fibrotic effect, which made 14-deoxyandrographolide-19-oic acid and 14-deoxy-11,12-didehydroandrographolide-19-oic acid promising leads for the development of new anti-fibrotic agents.

Full text of DOI:10.1016/j.ejmech.2018.08.046

Accepted Manuscript
Synthesis and anti-fibrosis activity study of 14-deoxyandrographolide-19-oic acid and
14-deoxydidehydroandrographolide-19-oic acid derivatives
Zhiqiang Song, Sujie Huang, Yuchen He, Jiabin Li, Kejiang Lin, Xiaowen Xue
PII:
S0223-5234(18)30716-5
10.1016/j.ejmech.2018.08.046
EJMECH 10657
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 21 May 2018
Revised Date: 15 August 2018
Accepted Date: 17 August 2018
Please cite this article as: Z. Song, S. Huang, Y. He, J. Li, K. Lin, X. Xue, Synthesis and anti-fibrosis
activity study of 14-deoxyandrographolide-19-oic acid and 14-deoxydidehydroandrographolide-19-oic
acid derivatives, European Journal of Medicinal Chemistry (2018), doi: 10.1016/j.ejmech.2018.08.046.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Graphical Abstract

ACCEPTED MANUSCRIPT
Synthesis and anti-fibrosis activity study of 14-deoxyandrographolide-19-oic acid
and 14-deoxydidehydroandrographolide-19-oic acid derivatives
Zhiqiang Song a, Sujie Huang a, Yuchen He a, Jiabin Li b, Kejiang Lin a, Xiaowen Xue a,*
a Department of Medicinal Chemistry, School of Pharmacy, China Pharmaceutical University, Nanjing 210009,
China
b School of Science, China Pharmaceutical University, Nanjing 211198, China
*Corresponding author. E-mail address: xwenxue@cpu.edu.cn, Tel: 86 25 83199600.
Abstract
A series of 14-deoxyandrographolide-19-oic acid and 14-deoxy-11,12 (or 14,15)-didehydroandrographolide-19-oic
acid derivatives were designed, synthesized and screened in vitro against the mouse fibroblast cell lines NIH-3T3.
Thirteen compounds 8a-f, 14a-c, 14e-f, and 18a-b were found to exhibit better anti-fibrotic activities than
andrographolide, with compounds 8b and 14e displaying best activity with IC50 values of 12.86 and 13.57 µM
against NIH-3T3 respectively. Further anti-fibrotic investigation was performed in terms of PCR and western bolt
analysis. Our study demonstrated that compounds 8b and 14e suppressed effectively the expression of α-smooth
muscle actin, fibronectin and collagen in NIH-3T3. Preliminary structure-activity analysis revealed that
14-deoxygenation and 19-carboxylation of andrographolide could significantly improve its anti-fibrotic effect,
which made 14-deoxyandrographolide-19-oic acid and 14-deoxy-11,12-didehydroandrographolide-19-oic acid
promising leads for the development of new anti-fibrotic agents.
Keywords:
14-Deoxyandrographolide-19-oic acid; Anti-fibrosis; α-SMA; FN; COL1A1
1. Introduction
Fibrosis, defined by the accumulation of excess extracellular matrix (ECM) components such as
collagen and fibronectin, is a pathological process of most chronic inflammatory diseases [1].
Fibrosis affects almost every tissue in the body, such as liver [2], lung [3], kidney [4] and skin [5].
The fibrotic process ultimately leads to organ malfunction and even death if highly progressive.
Although fibrogenesis is becoming increasingly recognized as a major cause of morbidity and
mortality in most chronic inflammatory diseases, there are few treatment strategies available
specifically targeting the pathogenesis of fibrosis.
Anti-fibrotic drugs may provide a promising strategy for the treatment of chronic inflammatory
diseases associated with pathological fibrosis. Recently nintedanib and pirfenidone have been
approved by Food and Drug Administration (FDA) for the treatment of idiopathic pulmonary
fibrosis (IPF) [6,7]. Clinical results for these two drugs showed they could reduce the rate of
decline of lung function with acceptable adverse effects [8]. However, best to our knowledge,
nintedanib and pirfenidone are the only two drugs available now which specifically target the
pathogenesis of fibrosis. Therefore, development of new anti-fibrotic drugs is in urgent need.
Natural products have been widely used since ancient time for the treatment of various diseases.
Many of them serve successfully as the source of leads for the development of drugs.
Andrographolide (1), a naturally occurring labdane diterpenoid isolated from the plant
Andrographis paniculata (family Acanthaceae) [9], is used extensively as the traditional medicine
in many Asian countries. It has been reported to process a wide spectrum of biological activities
such as antibacterial [10], anti-inflammatory [11], anti-hepatitis [12], antimalarial [13], and
1

ACCEPTED MANUSCRIPT
anti-tumor activities [14]. Recently, andrographolide was found to exhibit anti-fibrotic activity
against pulmonary [15], hepatic [16] or renal fibrosis [17]. Various mechanisms have been
suggested for its anti-fibrotic activity, including inactivation of nuclear factor-κB (NF-κB) [15],
inhibition of transforming growth factor-β (TGF-β) secretion [17], and inhibition of hepatic
stellate cells (HSCs) for hepatic fibrosis [16].
Although andrographolide displays promising anti-fibrotic activity, shortcomings remain such
as low potency and poor solubility. In order to increase the anti-fibrotic effects of andrographolide,
structural modification appears necessary. The present work describes the structural investigation
of andrographolide to improve anti-fibrotic activity.
2. Result and discussion
2.1. Design concepts
Structural modification based on andrographolide has been well demonstrated with various
biological activities, especially with anti-tumor activity [18]. However, to our surprise, the
structural modification for enhancing its anti-fibrotic activity is almost in blank state. Only hit was
the findings made by Tzeng that 14-deoxy-11,12-didehydroandrographolide (2) showed more
potent activity than andrographolide in reducing the production of extracellular molecule
fibronectin and cytokine TGF-β [17]. We have recently reported the synthesis and antitumor
activity of a series of andrographolide-19-carboxylates, and found that conversion of 19-hydroxyl
group of andrographolide into carboxylate group would improve anti-tumor activity [19]. We
hypothesized that the similar modification against 19-hydroxyl may be beneficial for improving
anti-fibrotic effects. Taking these factors into account, we set to introduce both 14-deoxy-11,12-
didehydro unit and 19-caboxylate group into andrographolide. The influences of rearrangement or
reduction of the conjugated double bonds on anti-fibrotic activity were also investigated. The
corresponding structures of targets designed (8a-f, 14a-f and 18a-d) are shown in Fig. 1.
Fig. 1. Structural modification of andrographolide to develop new anti-fibrotic andrographolide derivatives.
2

ACCEPTED MANUSCRIPT
2.2. Chemistry
The first series of 14-deoxyandrographolide-19-oic acid derivatives (8a-f) were synthesized as
shown in Scheme 1. The synthesis began with readily available andrographolide (1), which was
converted into triacetyl andrographolide 3 by reacting with acetic anhydride under the catalysis of
zinc chloride. Reductive rearrangement of 3 with sodium borohydride [20], followed by basic
hydrolysis of ester groups at C-3 and C-19 of 4, furnished 14-deoxyandrographolide 5. Selective
oxidation of primary hydroxyl group at C-19 position of 5 with TEMPO-NCS system [21] to yield
corresponding aldehyde 6a. 6a was acetylated with acetic anhydride at room temperature to
furnish 3-acetylated aldehyde 6b. The formed aldehyde group of 6a or 6b was further oxidized
with NaClO2-NaH2PO4 and isopentene [22], affording corresponding carboxylic acid 7a or 7b.
The carboxyl group of 7a and 7b was esterificated with MeI, BnBr or 2-chloromethylpyridine at
the presence of K2CO3 in DMF at room temperature to provide the first series targets 8a-f.
O
O
O
O
AcO
O
O
HO
O
O
c
a
b
H
H
H
H
AcO
AcO
HO
HO
OAc
OAc
OH
OH
4
1
3
5
O
O
O
O
O
O
g
f
d
8a R1 = Ac, R2 = Me
8b R1 = Ac, R2 = Bn
8c R1 = Ac, R2 = 2-pyridyl
8d R1 = H, R2 = Me
8e R1 = H, R2 = Bn
8f R1 = H, R2 = 2-pyridyl
H
H
H
R1O
R1O
R1O
CO2R2
CHO
6a R1 = H
6b
CO2H
7a R1 = H
7b R1 = Ac
8a-f
e
R1 = Ac
Scheme 1. Synthesis of the 14-deoxyandrographolide-19-oic acid derivatives 8a-f. Reagents and conditions: (a)
Ac2O, ZnCl2, 50 oC, 2 h, 97%; (b) NaBH4, MeOH, 0 oC to rt, 2 h, 91%; (c) HCl, MeOH, rt, 16 h, 87%; (d) TEMPO,
TBAB, NCS, DCM, K2CO3-KHCO3 buffer, rt, 9 h, 61%; (e) Ac2O, DMAP, DCM, rt, 5 h, 77%; (f)
NaClO2-NaH2PO4, isopantene, t-BuOH, H2O, rt, 30 h, 54% for 7a from 6a while 64% for 7b from 6b; (g) R2X,
K2CO3, DMF, rt, 0.5 h, 74-91%.
The second series of 14-deoxy-11,12-didehydroandrographolide-19-oic acid derivatives 14a-f
were prepared as depicted in Scheme 2. The hydroxyl groups at C-3 and C-19 of andrographolide
were first protected by reacting with 2,2-dimethoxypropane at the presence of catalytic p-TsOH,
followed by the acetylation of the hydroxyl group at C-14, to produce 10. Deacetoxylation of 10
under basic conditions was significantly affected by reaction temperature, with
14-deoxy-11,12-didehydroandrographolide (2) as deacetoxylation product under reflux while
14-deoxy-14,15-didehydroandrographolide (11) at room temperature. Compound 2 underwent a
similar series of conversions as described for compound 5 in Scheme 1, to afford the second series
targets 14a-f.
3

ACCEPTED MANUSCRIPT
Scheme 2. Synthesis of the 14-deoxy-11,12-didehydroandrographolide-19-oic acid derivatives 14a-f. Reagents
and conditions: (a) 2,2-dimethoxypropane, p-TsOH, Tol/DMSO, 80 oC, 1.5 h, 93%; (b) Ac2O, reflux, 1.5 h, 93%; (c)
i. DMAP (1.5 eq), DCM, reflux, 24 h; ii. HCl (dilute), 85% for two steps; (d) i. DMAP (0.2 eq), DCM, rt, 24 h; ii.
HCl (dilute), 89% for two steps; (e) TEMPO, TBAB, NCS, DCM, K2CO3-KHCO3 buffer, rt, 9 h, 91%; (f) Ac2O,
DMAP, DCM, rt, 5 h, 76%; (g) NaClO2-NaH2PO4, isopantene, t-BuOH, H2O, rt, 30 h, 64% for 13a from 12a while
78% for 13b from 12b; (h) R2X, K2CO3, DMF, rt, 0.5 h, 56-74%.
The third series of 14-deoxy-14,15-didehydroandrographolide-19-oic acid derivatives 18a-d
were prepared as shown in Scheme 3. At first, a similar synthetic strategy as used for the synthesis
of the second series compounds was employed with intermediate 11 as starting material. However,
the poor solubility of 11 brought big problem for the subsequent oxidation. Considering the fact
that poor solubility of compound 11 was caused from the formation of conjugated C-12=C-13 and
C-14=C-15 double bonds, a synthetic route with the formation of this conjugated double bonds as
the last step was taken to synthesize targets 18a-d. 3,19-Isopropylidene-andrographolide (9) was
firstly acetylated by treatment with acetic anhydride, followed by deprotection with aqueous acetic
acid to give 14-acetylandrographolide (15). Selective oxidation of primary hydroxyl group of 15
with TEMPO-NCS to yield corresponding aldehyde 16a. 16a was acetylated with acetic anhydride
at room temperature to furnish 3-acetylated aldehyde 16b. The formed aldehyde group of 16a or
16b was further oxidized under Pinnick conditions, providing corresponding carboxylic acid 17a
or 17b. The carboxyl group of 17a and 17b was esterificated with MeI or BnBr at the presence of
K2CO3 in DMF at room temperature, followed by elimination reaction under basic conditions to
afford the third series targets 18a-d. Regretfully, when 17a and 17b were esterificated with
2-chloromethylpyridine at the presence of K2CO3, 2-pyridylmethyl 14-deoxy-11,12-didehydro
andrographolide-19-carboxylates 14c and 14f, instead of 2-pyridylmethyl 14-deoxy-14,15-
didehydroandrographolide-19-carboxylates, were obtained.
4

ACCEPTED MANUSCRIPT
O
O
O
AcO
O
HO
O
AcO
O
b
a
d
H
H
H
R1O
O
HO
CHO
16a R1 = H
R = Ac
OH
O
15
9
c
16b
1
O
O
O
AcO
O
e
H
H
18a R1 = Ac, R2 = Me
18b R1 = Ac, R2 = Bn
18c R1 = H, R2 = Me
18d R1 = H, R2 = Bn
R1O
R1O
CO2R2
CO2H
17a R1 = H
17b R1 = Ac
18a-d
Scheme 3. Synthesis of the 14-deoxy-14,15-didehydroandrographolide-19-oic acid derivatives 18a-d. Reagents
and conditions: (a) i. Ac2O, reflux, 1.5 h; ii. AcOH, H2O, 85% for two steps; (b) TEMPO, TBAB, NCS, DCM,
K2CO3-KHCO3 buffer, rt, 9 h, 91%; (c) Ac2O, DMAP, DCM, rt, 5 h, 76%; (d) NaClO2-NaH2PO4, isopantene,
t-BuOH, H2O, rt, 30 h, 42% for 17a from 16a while 76% for 17b from 16b; (e) R2X, K2CO3, DMF, rt, 0.5 h, then
cat DMAP, rt, 0.5 h, 38-47%.
The structure of the target compounds was identified using spectroscopic techniques (1H NMR,
13C NMR, and mass spectroscopic analyses). The compound 8a was taken to elucidate structure
1
identification as follows. 8a showed key signals in the H NMR spectrum for a C-14 alkenyl
proton (7.11 ppm, a singlet), a C-15 methylene group (4.79 ppm, singlet), two C-17 alkenyl
protons (4.63 and 4.91 ppm, both as a singlet), a methyl carboxylate group (3.65 ppm, singlet), an
acetyl group (2.07 ppm, singlet), and two angular methyl groups (1.24 and 0.61 ppm, both as
singlet). All other protons of 8a appeared at the positions similar to those of andrographolide. In
addition, the 13C NMR data clearly showed the presence of three ester carbonyl carbon atoms with
chemical shifts at 173.79, 173.54 and 170.53 ppm and four alkenyl carbon atoms with chemical
shifts at 145.91, 143.51, 134.12 and 107.13 ppm. Furthermore, the presence of a molecular ion
peak at m/z = 422.2544 ([M+NH4]+) in the mass spectra (calcd. 422.2537) further confirmed the
structure of compound 8a.
For 14-deoxy-11,12-didehydroandrographolide-19-oic acid derivatives 14a-f and 14-deoxy-
14,15-didehydroandrographolide-19-oic acid derivatives 18a-d, the structure identification was
performed very carefully, since the main structural difference between these two series was only
the position of conjugated double bonds. Luckily enough, their structures could be distinguished
easily by means of the signal of C-15 proton (s) in 1H NMR spectra: the signal of C-15 CH2 group
for 14 series appeared around 4.8 ppm, while the signal for C-15 alkenyl proton for 18 series
appeared around 7.0 ppm.
5

ACCEPTED MANUSCRIPT
2.3. Biology
2.3.1 In vitro inhibitory activities against NIH-3T3 cells
To evaluate the anti-fibrotic effects of synthesized compounds, NIH-3T3 cells (mouse fibroblast
cell lines) were employed since they have been recognized as a convenient screening model (in
vitro) for studies of fibrosis [23]. Firstly, the inhibitory activities of target compounds were tested
by MTT assay with andrographolide as control. The biological results, expressed as the compound
concentration [µM] that causes a 50% inhibition of cell growth, are expressed as IC50 values and
are summarized in Table 1. Most compounds tested, except 14d, 18c and 18d, showed better
anti-fibrotic activities than andrographolide, with 8b and 14e displaying the strongest activities
with IC50 values of 12.86 and 13.57 µM respectively. The first series of 14-deoxyandrographolide-
19-oic acid derivatives 8a-f and the second series of 14-deoxy-11,12-didehydro
andrographolide-19-oic acid derivatives 14a-f were found to exhibit better activities than the third
series of 14-deoxy-14,15-didehydro andrographolide-19-oic acid derivatives 18a-d, suggesting
that molecular rigidity might play a crucial role in biological activities. Significantly, all three
series of target compounds showed better anti-fibrotic activities than their counterparts with C-19
hydroxyl unoxidized (8a-f vs 5, 14a-f vs 2, and 18a-d vs 11), which validated our previous
hypothesis that the oxidation of 19-hydroxyl of andrographolide may be of benefit to improving
anti-fibrosis effects.
Next, in order to investigate whether the compounds 8b and 14e showing the strongest
inhibitory effects on NIH-3T3 are also toxic in other normal cell types, HUVEC (human umbilical
vein endothelial cells) were chosen for test with MTT assay under the same conditions. As shown
in Fig. 2, both 8b and 14e showed a certain but much weaker cytotoxicity towards HUVEC
compared with NIH-3T3, which meant these two compounds did have anti-fibrotic effects. At low
concentrations (10 and 40 µM), 8b and 14e both had an inhibition rate almost equivalent to
andrographolide against HUVEC (6.6% and 9.7% vs 10.4% at 10 µM, while 41% and 41% vs
38.7% at 40 µM), although they showed a higher inhibition rate (55.7% and 68.7% ) than
andrographolide (26.4%) at high concentration (80 µM).
Table 1
The structures of 14-deoxyandrographolide-19-oic acid and 14-deoxydidehydroandrographolide-19-oic acid
derivatives and their inhibitory activities against NIH-3T3 cell lines
6

ACCEPTED MANUSCRIPT
Compounds
IC50 (µM )
Entry
No
R1
R2
NIH-3T3
1
2
8a
8b
Ac
Ac
Ac
H
Me
Bn
80.6
12.86
55.45
60.6
3
8c
2-pyridyl
Me
4
8d
5
8e
H
Bn
37.86
79.82
32.25
52.71
34.86
110.7
13.57
80.16
69.66
78.03
177.3
177.2
176.3
64.27
not active
95.28.
H
2-pyridyl
Me
6
8f
7
14a
14b
14c
14d
14e
14f
18a
18b
18c
18d
5
Ac
Ac
Ac
H
8
Bn
9
2-pyridyl
Me
10
11
12
13
14
15
16
17
18
19
20
H
Bn
H
2-pyridyl
Me
Ac
Ac
H
Bn
Me
H
Bn
14-deoxyandrographolide
14-deoxy-11,12-didehydro-andrographolide
14-deoxy-14,15-didehydro-andrographolide
andrographolide
2
11
1
Fig. 2. Cell proliferation of human umbilical vein endothelial cells treated with different concentrations of 8b and
14e (1, 10, 40, and 80 µM) with andrographolide (1) as control. Data are presented as the mean of three repeated
experiments.
2.3.2 8b and 14e suppressed the TGF-β1-induced gene and protein expression of α-SMA, FN and
COL1A1 in NIH-3T3
The hallmark of fibrotic diseases is overexpression of α-smooth muscle actin (α-SMA) and
7

ACCEPTED MANUSCRIPT
increased production of matrix proteins, including collagen and fibronectin (FN) [24,25].
Therefore, α-SMA, FN and collagen type I alpha 1 (COL1A1) have been commonly used as
fibrotic markers. To further investigate the anti-fibrotic activity of screened compounds (8b and
14e), their abilities to suppress the gene and protein expression of α-SMA, FN and COL1A1 in
vitro were investigated. For this purpose, mouse fibroblast cell lines NIH-3T3 were employed
again and rat TGF-β1 was used as a fibrosis stimulant in cultured fibroblasts. The effects of 8b
and 14e on the mRNA expression of α-SMA, FN and COL1A1 were explored with
andrographolide as positive control under two conditions: either TGF-β stimulation or not.
NIH-3T3 cells were pre-incubated with tested compounds (500 nM) for 1 h alone/and then treated
with rat TGF-β1 (5 ng/mL) for 24 h. The results from real-time qPCR were shown in Fig. 3. 8b
and 14e both displayed better anti-fibrotic effects than andrographolide for all three markers no
matter whether they were TGF-β stimulated or not, with 14e showing better anti-fibrotic activities
than 8b. The data from real-time qPCR also showed that the expression levels of these three
fibrotic genes were all significantly up-regulated by rat TGF-β1, but the up-regulated mRNA
levels could be suppressed by the tested compounds. Interestedly, 8b and 14e showed better
anti-fibrotic activities than 5 and 2 respectively for all three fibrotic markers, which further
validated our previous hypothesis that the oxidation of 19-hydroxyl of andrographolide would be
helpful for improving anti-fibrosis effects.
Fig. 3. Effects of 8b, 14e, 5 and 2 on TGF-β1-induced mRNA expression of α-SMA, FN and COL1A1 in NIH-3T3
by Real Time-PCR with andrographolide (andro) as positive control. NIH-3T3 were treated with tested compounds
(500 nM) for 1 h and in the presence or absence of 5 ng/ml TGF-β1 for 24 h. Data were expressed as means ± SD,
n = 3. Error bars indicate standard error.
8

ACCEPTED MANUSCRIPT
Protein expression revealed by Western Blot (Fig. 4) showed similar results as those in the
Real-Time PCR assay. As previously observed, the protein expression levels of α-SMA, FN and
COL1A1 were all significantly up-regulated by rat TGF-β1, but the up-regulated protein levels
could be suppressed by 8b and 14e. 8b exhibited a little bit better suppression than 14e on TGF-β1
stimulated COL1A1 protein expression, while 8b and 14e displayed almost the same inhibition on
TGF-β1 stimulated α-SMA and FN protein expression.
Fig. 4. The effects of 8b and 14e on TGF-β1-induced α–SMA, FN and COL1A1 expression. NIH-3T3 cells were
treated with 500 nM screened compounds in the presence of 5 ng/ml rat TGF-β1 for 24 h. The protein expression
levels of α-SMA, FN and COL1A1 were probed through western bloting. β-actin was used as the loading control,
and PBS served as the control (Ctl). This experiment was repeated three times under the same conditions and data
were expressed as means ± SD. Error bars indicate standard error.
3. Conclusion
In summary, a total of sixteen 14-deoxyandrographolide-19-carboxylate compounds were
successfully synthesized and characterized. The in vitro anti-fibrotic activities of all compounds
were primarily evaluated against mouse fibroblast cell lines. To our knowledge, this is the first
attempt to modify the structure of andrographolide with the aim of improving its anti-fibrotic
effect. The results indicated that thirteen compounds (all except 14d and 18c-d) exhibited
inhibitory activities stronger than that of parent compound 1, with 8b and 14e displaying the
strongest activities with IC50 values of 12.86 and 13.57 µM against NIH-3T3 respectively. More
important, we demonstrated that the conversion of 19-hydroxyl into 19-carboxylate of
andrographolide is of significant benefit for anti-fibrosis. Further PCR and western bolt
investigation of 8b and 14e exhibited that they both inhibited the proliferation of NIH-3T3
through inhibiting the expression of α-SMA, fibronectin and collagen. The most potent
compounds 8b and 14e both showed around 7-fold higher inhibitory activities against NIH-3T3
9

ACCEPTED MANUSCRIPT
than andrographolide, which made them two promising leads for the development of new
anti-fibrotic agents. Studies in this direction are in progress.
4. Experimental Section
4.1. General
Reagents were purchased from commercial sources and used without further purification unless
otherwise indicated. Melting points were determined with an XT-4 Melting Point apparatus and
1
are uncorrected. H and 13C NMR spectra were recorded on Bruker AV-300 (300 MHz) with
CDCl3 or DMSO-d6 as the solvents and chemical shifts are reported as δ values in parts per
million (ppm). High-resolution mass spectra (HRMS) were performed on an Agilent ESI TOF
(time of flight) mass spectrometer. Anti-alpha smooth muscle actin antibody, anti-fibronectin
antibody, and anti-collagen I antibody were purchased from Abcam Co. (Shanghai, China) while
β-Actin (8H10D10) Mouse mAb was purchased from Cell Signaling Technology Co. (Shanghai,
China).
4.2. Chemistry
4.2.1 Synthesis of the 14-deoxyandrographolide-19-oic acid derivatives 8a-f
4.2.1.1. 3,14,19-Triacetylandrographolide (3)
To a stirred suspension of andrographolide (1) (15.0 g, 42.9 mmol) in Ac2O (210 mL) were
added ZnCl2 (catalytic amount) and Ac2O (15.0 mL). The mixture was stirred vigorously at 50 oC
until the suspended solution became clarified and then cooled to r.t. To the reaction mixture was
added EtOH (150 mL) H2O (450 mL), then stirred vigorously at r.t. for 30 min, then filtered to
1
give a white solid (19.3 g, 97%). H NMR (300 MHz, DMSO-d6) δ: 7.49 (s, 1H), 4.88 (s, 1H),
4.82 (d, J = 1.5 Hz, 2H), 4.63 (s, 1H), 4.52 (dd, J = 11.2, 4.9 Hz, 1H), 4.35 (d, J = 11.7 Hz, 1H),
3.97 (d, J = 11.7 Hz, 1H), 2.40–2.15 (m, 2H), 2.00 (d, J = 1.0 Hz, 9H), 1.79 (s, 3H), 1.65 (dd, J =
13.6, 7.5 Hz, 3H), 1.43 (d, J = 13.5 Hz, 2H), 1.23 (s, 3H), 0.94 (s, 3H), 0.65 (s, 3H). The 1H NMR
spectroscopic data were matched those reported in literature [26].
4.2.1.2. 3,19-Diacetyl-14-deoxyandrographolide (4)
To a solution of 3 (0.4 g, 0.84 mmol) in MeOH (6 mL) was added NaBH4 (0.13 g, 3.36 mmol)
at 0 °C, and the resulting solution was stirred at r.t. for 2 h. After the reaction was complete, the
reaction mixture was diluted with ethyl acetate (120 mL). The organic layer was separated,
washed with water (60 mL×3) and brine (60 mL×3), dried with anhydrous Na2SO4, concentrated
under reduce pressure, and purified by column chromatography (EtOAc/PE = 1/4) to give
compound 4 as a white solid (0.32 g, 91%). 1H NMR (300 MHz, CDCl3) δ: 7.10 (s, 1H), 4.91 (s,
1H), 4.78 (d, J = 1.7 Hz, 2H), 4.63 (s, 1H), 4.61-4.55 (m, 1H), 4.37 (d, J = 11.7 Hz, 1H), 4.10 (d, J
= 11.8 Hz, 1H), 2.53–2.36 (m, 2H), 2.28–2.07 (m, 1H), 2.04 (s, 6H), 1.95-1.80 (m, 3H), 1.74 (dd,
J = 13.8, 6.5 Hz, 2H), 1.70–1.60 (m, 3H), 1.50 (dd, J = 12.8, 3.9 Hz, 1H), 1.36–1.26 (m, 3H), 1.02
1
(s, 3H), 0.72 (s, 3H). The H NMR spectroscopic data were matched those reported in literature
[20].
4.2.1.3. 14-Deoxyandrographolide (5)
10

ACCEPTED MANUSCRIPT
3,19-Diacetyl-14-deoxyandrographolide (4) (0.13 g, 0.31 mmol) was dissolved in 6ml of 7%
hydrochloric acid methanol solution, then stirred at r.t for 16 h. After the reaction was complete,
the reaction mixture was diluted with ethyl acetate (120 mL). The organic layer was separated,
washed with water (60 mL×3) and brine (60 mL×3), dried with anhydrous Na2SO4, concentrated
under reduce pressure, and purified by column chromatography (EtOAc/PE = 1/2) to give
compound 5 as a white solid (0.09 g, 87%). 1H NMR (300 MHz, DMSO-d6) δ: 7.47 (s, 1H), 5.05
(d, J = 4.9 Hz, 1H), 4.82 (s, 3H), 4.59 (s, 1H), 4.12 (dd, J = 7.5, 2.6 Hz, 1H), 3.83 (dd, J = 10.9,
2.7 Hz, 1H), 3.29-3.14 (m, 2H), 2.35–2.22 (m, 2H), 2,03–1.87 (m, 2H), 1.70 (d, J = 13.2 Hz, 2H),
1.65–1.50 (m, 3H), 1.32 (dd, J = 12.7, 3.9 Hz, 1H), 1.15 (d, J = 10.3 Hz, 3H), 1.07 (s, 3H), 0.60 (s,
3H). The 1H NMR spectroscopic data were matched those reported in literature [26].
4.2.1.4. 14-Deoxyandrographolide-19-al (6a)
To a solution of compound 5 (0.33 g, 0.99 mmol) in 20 ml of methylene chloride, were added
TEMPO (0.028 g, 0.18 mmol), 20 ml of K2CO3-NaHCO3 buffer (pH ~7), TBAB (0.058 g, 0.18
mmol) and NCS (0.48 g, 3.6 mmol) under ice bath. The reaction mixture was then stirred
vigorously for 10 h. The organic layer was separated and the aqueous layer was extracted with
methylene chloride (60 mL×2). The combined organic layer was washed with brine (30 mL×2),
dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified
by column chromatography (EtOAc/PE = 1/2) to give compound 6a as a light yellowish solid (0.2
1
g, 61%). Mp 121-124 °C; H NMR (300 MHz, CDCl3) δ: 9.77 (s, 1H), 7.12 (d, J = 1.4 Hz, 1H),
4.95 (s, 1H), 4.78 (s, 2H), 4.66 (s, 1H), 3.19 (d, J = 24.9 Hz, 2H), 2.53–2.37 (m, 2H), 2.19–1.97
(m, 2H), 1.89 (dd, J = 14.8, 2.4 Hz, 3H), 1.78 (dd, J = 17.5, 9.3 Hz, 2H), 1.70–1.56 (m, 3H), 1.37
(d, J = 13.1 Hz, 1H), 1.29 (s, 3H), 1.26-1.15 (m, 1H), 0.63 (s, 3H); 13C NMR (75 MHz, CDCl3) δ:
207.30, 173.78, 145.60, 143.60, 134.03, 107.54, 76.56, 69.63, 55.14, 54.30, 52.32, 39.17, 37.54,
36.44, 28.12, 24.04, 23.61, 21.58, 18.88, 13.23; HRMS (ESI) m/z calcd for C20H28NaO4 [M+Na]+
355.1885, found 355.1878.
4.2.1.5. 3-Acetyl-14-deoxyandrographolide-19-al (6b)
To a solution of compound 6a (0.92 g, 2.77 mmol) in 60 mL of methylene chloride, were added
Ac2O (5.2 mL), DMAP (0.068 g, 0.55 mmol), then stirred at r.t. for 5 h. After the reaction was
complete, the reaction mixture was diluted with methylene chloride (120 mL). The organic layer
was separated, washed with water (60 mL×3) and brine (60 mL×3), dried with anhydrous Na2SO4,
concentrated under reduce pressure, and purified by column chromatography (EtOAc/PE = 1/3) to
give compound 6b as a white solid (0.8 g, 77%). Mp 142-146 °C; 1H NMR (300 MHz, CDCl3) δ:
9.97 (s, 1H), 7.05 (s, 1H), 4.85 (s, 1H), 4.72 (d, J = 1.7 Hz, 2H), 4.69–4.60 (m, 1H), 4.57 (s, 1H),
2.36 (dd, J = 9.8, 3.3 Hz, 2H), 2.06 (dd, J = 17.1, 8.7 Hz, 1H), 1.99 (s, 3H), 1.95–1.79 (m, 3H),
1.78–1.62 (m, 2H), 1.62–1.48 (m, 2H), 1.40 (d, J = 13.4 Hz, 1H), 1.35–1.20 (m, 3H), 1.02 (s, 3H),
0.56 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 203.80, 173.74, 169.98, 145.52, 143.64, 134.00,
107.55, 77.88, 69.61, 56.15, 53.98, 51.65, 38.73, 37.22, 35.69, 23.99, 23.67, 21.59, 20.57, 20.41,
14.76; HRMS (ESI) m/z calcd for C22H30NaO5 [M+Na]+ 397.1985, found 397.1982.
4.2.1.6. 14-Deoxyandrographolide-19-oic acid (7a)
To a solution of compound 6a (0.3 g, 0.90 mmol), H2O (8 mL), isoamylene (1.1 mL) and
t-BuOH (20 mL), was added NaClO2 (0.29 g, 3.21 mmol) and NaH2PO4 (0.5 g, 3.21 mmol), then
stirred at r.t. for 30 h. After the reaction was complete, the reaction mixture was diluted with ethyl
acetate (120 mL). The organic layer was separated, washed with water (60 mL×3) and brine (60
11

ACCEPTED MANUSCRIPT
mL×3), dried with anhydrous Na2SO4, concentrated under reduce pressure, and purified by
column chromatography (EtOAc/PE = 1/2) to give compound 7a as a light yellowish solid (0.17 g,
1
54%); Mp 196-200 °C; H NMR (300 MHz, CDCl3) δ: 7.11 (s, 1H), 4.90 (s, 1H), 4.77 (s, 2H),
4.61 (s, 1H), 3.17 (dd, J = 11.9, 4.2 Hz, 1H), 2.54–2.27 (m, 2H), 2.09–1.92 (m, 3H), 1.92–1.67 (m,
4H), 1.67–1.51 (m, 2H), 1.43 (d, J = 6.5 Hz, 3H), 1.22 (dd, J = 19.8, 6.4 Hz, 3H), 0.61 (s, 3H); 13C
NMR (75 MHz, CDCl3) δ: 181.46, 174.01, 146.14, 143.75, 134.09, 106.81, 77.38, 69.72, 55.14,
54.95, 48.78, 39.50, 37.85, 37.11, 28.03, 25.25, 24.09, 23.51, 21.55, 12.26; HRMS (ESI) m/z
calcd for C20H28NaO5 [M+Na]+ 371.1829, found 371.1832.
4.2.1.7. 3-Acetyl-14-deoxyandrographolide-19-oic acid (7b)
7b was synthesized from 6b using the same method described for the synthesis of 7a as a light
yellowish solid (64%); Mp 166-169 °C; 1H NMR (300 MHz, CDCl3) δ: 7.11 (s, 1H), 4.91 (s, 1H),
4.78 (s, 2H), 4.64 (s, 1H), 4.58 (dd, J = 12.1, 4.3 Hz, 1H), 2.57–2.28 (m, 3H), 2.14 (d, J = 8.8 Hz,
1H), 2.07 (s, 3H), 1.95 (dd, J = 21.1, 13.0 Hz, 3H), 1.75 (t, J = 13.5 Hz, 2H), 1.61 (d, J = 7.5 Hz,
3H), 1.47–1.31 (m, 2H), 1.27 (s, 3H), 0.68 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 179.09, 173.81,
170.45, 145.76, 143.58, 134.10, 107.25, 78.41, 69.63, 55.18, 55.02, 47.76, 39.24, 37.56, 36.50,
24.88, 24.02, 23.52, 21.45, 20.77, 11.99; HRMS (ESI) m/z calcd for C22H30NaO6 [M+Na]+
413.1935, found 413.1935.
4.2.1.8. General procedure for the synthesis of alkyl 14-deoxyandrographolide-19-oates (8)
To a solution of compound 7a or 7b (0.092 mmol) in 2 mL of DMF, were added K2CO2 (0.026
g, 0.19 mmol), alkyl halide (methyl iodide, benzyl bromide or 2-chloromethylpyridine, 0.14
mmol), then stirred at r.t. for 0.5 h. After the reaction was complete, the reaction mixture was
diluted with ethyl acetate (60 mL). The organic layer was separated, washed with water (20 mL×3)
and brine (20 mL×3), dried with anhydrous Na2SO4, concentrated under reduce pressure, and
purified by column chromatography (EtOAc/PE = 1/3) to yield corresponding compound 8.
4.2.1.8.1. Methyl 3-acetyl-14-deoxyandrographolide-19-oate (8a). A light yellowish solid (0.032 g,
1
86%); Mp 115-119 °C; H NMR (300 MHz, CDCl3) δ: 7.11 (s, 1H), 4.91 (s, 1H), 4.79 (s, 2H),
4.63 (s, 1H), 4.57 (dd, J = 12.2, 4.5 Hz, 1H), 3.65 (s, 3H), 2.44 (dd, J = 11.0, 7.4 Hz, 3H), 2.12 (d,
J = 7.9 Hz, 1H), 2.07 (s, 3H), 2.02–1.84 (m, 3H), 1.84–1.68 (m, 2H), 1.67-1.54 (m, 2H),
1.54–1.43 (m, 1H), 1.43–1.29 (m, 2H), 1.24 (s, 3H), 0.61 (s, 3H); 13C NMR (75 MHz, CDCl3) δ:
173.79, 173.54, 170.53, 145.91, 143.51, 134.12, 107.13, 78.73, 69.63, 55.13, 54.96, 50.63, 47.87,
39.06, 37.59, 36.53, 29.18, 25.02, 23.98, 23.48, 21.39, 20.84, 11.95; HRMS (ESI) m/z calcd for
C23H36NO6 [M+NH4]+ 422.2537, found 422.2544.
4.2.1.8.2. Benzyl 3-acetyl-14-deoxyandrographolide-19-oate (8b). A light yellowish solid (0.040 g,
1
91%); Mp 125-128 °C; H NMR (300 MHz, CDCl3) δ: 7.37 (m, 5H), 7.11 (s, 1H), 5.17 (d, J =
12.6 Hz, 1H), 5.09 (d, J = 12.6 Hz, 1H), 4.90 (s, 1H), 4.79 (d, J = 1.5 Hz, 2H), 4.62 (s, 1H), 4.58
(d, J = 6.0 Hz, 1H), 2.42 (dd, J = 18.3, 7.4 Hz, 3H), 2.21–2.08 (m, 1H), 2.06 (s, 3H), 2.04–1.85 (m,
3H), 1.85–1.70 (m, 2H), 1.69–1.55 (m, 3H), 1.55–1.34 (m, 2H), 1.29 (s, 3H), 0.58 (s, 3H); 13C
NMR (75 MHz, CDCl3) δ: 172.86, 170.48, 145.83, 143.49, 135.34, 134.15, 127.96, 127.71,
127.58, 107.19, 78.77, 69.64, 65.55, 55.07, 48.01, 39.07, 37.58, 36.48, 25.00, 24.13, 23.98, 23.80,
21.38, 20.82, 12.07; HRMS (ESI) m/z calcd for C29H40NO6 [M+NH4]+ 498.2853, found 498.2857.
4.2.1.8.3. 2-Pyridylmethyl 3-acetyl-14-deoxyandrographolide-19-oate (8c). A light yellowish solid
(0.036 g, 82%); Mp 132-136 °C; 1H NMR (300 MHz, CDCl3) δ: 8.60 (s, 1H), 7.70 (d, J = 7.5 Hz,
12

ACCEPTED MANUSCRIPT
1H), 7.43 (d, J = 7.9 Hz, 1H), 7.26 (d, J = 9.1 Hz, 1H), 7.11 (s, 1H), 5.24 (q, J = 13.8 Hz, 2H),
4.91 (s, 1H), 4.80 (s, 2H), 4.62 (s, 2H), 2.44 (s, 3H), 2.17 (s, 1H), 2.07 (s, 3H), 2.03–1.86 (m, 3H),
1.86–1.67 (m, 3H), 1.57 (d, J = 23.5 Hz, 3H), 1.41 (d, J = 12.8 Hz, 1H), 1.33 (s, 3H), 0.58 (s, 3H);
13C NMR (75 MHz, CDCl3) δ: 172.60, 170.39, 155.27, 148.69, 145.75, 143.50, 136.33, 134.12,
122.38, 121.42, 107.22, 78.80, 69.62, 66.06, 55.08, 48.08, 39.09, 37.56, 36.46, 29.19, 24.99, 24.13,
23.98, 23.77, 21.39, 20.80, 12.05; HRMS (ESI) m/z calcd for C28H36NO6 [M+H]+ 482.2537, found
482.2547.
4.2.1.8.4. Methyl 14-deoxyandrographolide-19-oate (8d). A light yellowish solid (84%); Mp
1
76-80 °C; H NMR (300 MHz, CDCl3) δ: 7.12 (d, J = 1.5 Hz, 1H), 4.92 (s, 1H), 4.79 (d, J = 1.8
Hz, 2H), 4.63 (s, 1H), 3.66 (s, 3H), 3.20–2.90 (m, 1H), 2.61–2.29 (m, 2H), 2.26–1.95 (m, 3H),
1.92–1.85 (m, 3H), 1.82–1.65 (m, 2H), 1.65–1.50 (m, 2H), 1.41 (s, 3H), 1.32–1.11 (m, 3H), 0.54
(s, 3H); 13C NMR (75 MHz, CDCl3) δ: 177.49, 173.81, 146.28, 143.52, 134.14, 106.70, 77.69,
69.62, 55.09, 54.94, 50.75, 49.03, 39.33, 37.89, 37.21, 28.14, 25.55, 24.09, 23.23, 21.52, 11.99;
HRMS (ESI) m/z calcd for C21H30NaO5 [M+Na]+ 385.1985, found 385.1992.
4.2.1.8.5. Benzyl 14-deoxyandrographolide-19-oate (8e). A light yellowish solid (74%); Mp
92-95 °C; 1H NMR (300 MHz, CDCl3) δ: 7.36 (d, J = 4.4 Hz, 5H), 7.11 (s, 1H), 5.21 (d, J = 12.4
Hz, 1H), 5.01 (d, J = 12.4 Hz, 1H), 4.90 (s, 1H), 4.79 (d, J = 1.6 Hz, 2H), 4.61 (s, 1H), 3.32 – 3.02
(m, 2H), 2.43 (t, J = 13.5 Hz, 2H), 2.23–1.96 (m, 3H), 1.87 (dd, J = 15.4, 11.5 Hz, 3H), 1.74 (dd, J
= 12.7, 3.8 Hz, 2H), 1.61 (d, J = 9.7 Hz, 3H), 1.44 (s, 3H), 1.29–1.18 (m, 4H), 0.51 (s, 3H); 13C
NMR (75 MHz, CDCl3) δ: 176.61, 173.80, 146.20, 143.48, 134.84, 134.17, 128.10, 127.82,
127.76, 106.74, 77.76, 69.62, 65.78, 55.27, 54.93, 49.21, 39.38, 37.89, 37.23, 28.15, 25.62, 24.10,
23.43, 21.53, 12.12; HRMS (ESI) m/z calcd for C27H35O5 [M+H]+ 439.2479, found 439.2493.
4.2.1.8.6. 2-Pyridylmethyl 14-deoxyandrographolide-19-oate (8f). A light yellowish solid (83%);
Mp 105-108 °C; 1H NMR (300 MHz, CDCl3) δ: 8.58 (d, J = 4.3 Hz, 1H), 7.71 (td, J = 7.7, 1.6 Hz,
1H), 7.31 (d, J = 7.8 Hz, 1H), 7.23 (d, J = 7.0 Hz, 1H), 7.10 (s, 1H), 5.23 (q, J = 13.5 Hz, 2H),
4.89 (s, 1H), 4.77 (d, J = 1.7 Hz, 2H), 4.60 (s, 1H), 3.17 (dd, J = 12.1, 4.2 Hz, 1H), 2.56–2.33 (m,
2H), 2.23–1.98 (m, 3H), 1.90 (dd, J = 15.5, 11.9 Hz, 3H), 1.82–1.64 (m, 2H), 1.60 (d, J = 7.8 Hz,
2H), 1.47 (s, 3H), 1.36–1.10 (m, 3H), 0.53 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 175.97, 154.74,
148.93, 146.16, 143.46, 136.36, 134.19, 122.49, 121.29, 106.82, 77.71, 69.62, 65.84, 55.24, 54.96,
49.48, 39.34, 37.84, 37.17, 28.19, 25.51, 24.10, 23.78, 21.52, 12.13; HRMS (ESI) m/z calcd for
C26H34NO5 [M+H]+ 440.2431, found 440.2445.
4.2.2 Synthesis of the 14-deoxy-11,12-didehydroandrographolide-19-oic acid derivatives 14a-f
4.2.2.1. 3,19-Isopropylidene-andrographolide (9)
Andrographolide (1) (10.0 g, 28.54 mmol) was dissolved in a mixed solution of toluene (200
mL) DMSO (27 mL), and to the formed solution were added 2,2-dimethoxypropane (14 mL) and
TsOH (catalytic amount). After the reaction mixture was stirred at 80 °C for 1.5 h, and cooled
down to room temperature, the reaction was quenched by adding TEA (7 mL). The reaction
mixture was diluted with toluene (150 mL) and washed with water. The organic layer was
separated, dried with anhydrous Na2SO4, concentrated under reduced pressure and rinsed with
ether to yield 9. White solid, 93% yield; 1H NMR (300 MHz, CDCl3) δ：6.96 (t, J = 6.4 Hz, 1H),
13

ACCEPTED MANUSCRIPT
5.03 (d, J = 5.9 Hz, 1H), 4.91 (s, 1H), 4.63 (s, 1H), 4.48–4.43 (dd, J = 10.4, 6.1 Hz, 1H),
4.28–4.24 (dd, J = 1.9, 10.4 Hz, 1H), 3.97 (d, J = 5.8 Hz, 1H), 3.52–3.48 (dd, J = 3.4, 8.4 Hz, 1H),
3.2 (m, 1H), 2.64–2.40 (m, 4H), 2.05–1.97 (m, 2H), 1.85–1.72 (m, 4H), 1.32–1.25 (m, 3H), 1.42 (s,
3H), 1.37 (s, 3H), 1.20 (s, 3H), 0.96 (s, 3H). The 1H NMR spectroscopic data were matched those
reported in literature [26].
4.2.2.2. 3,19-Isopropylidene-14-acetyl-andrographolide (10)
A mixture of 3,19-isopropylidene-andrographolide (9) (1.00 g, 2.56 mmol) and acetic
anhydride (20 mL) was refluxed for 1.5 h. After cooled down to room temperature, the reaction
mixture was neutralized with saturated NaHCO3 until no bubble was formed and then diluted with
ethyl acetate (120 mL). The organic layer was separated, washed with water (60 mL×3) and brine
(60 mL×3), dried with anhydrous Na2SO4, concentrated under reduce pressure, and purified by
column chromatography (EtOAc/PE = 1/4) to give compound 10 as a white solid (1.06 g, 93%).
1H NMR (300 MHz, CDCl3) δ: 7.01 (td, J = 6.9, 1.6 Hz, 1H), 5.91 (d, J = 6.0 Hz, 1H), 4.88 (s,
1H), 4.52 (d, J = 6.0 Hz, 2H), 4.22 (dd, J = 11.2, 1.9 Hz, 1H), 3.94 (d, J = 11.6 Hz, 1H), 3.48 (dd,
J = 8.5, 3.7 Hz, 1H), 3.16 (d, J = 11.6 Hz, 1H), 2.55–2.30 (m, 3H), 2.11 (s, 3H), 2.05–1.87 (m,
2H), 1.87–1.76 (m, 2H), 1.76–1.61 (m, 3H), 1.39 (s, 3H), 1.35 (s, 3H), 1.26 (td, J = 12.6, 7.7 Hz,
1
2H), 1.18 (s, 3H), 0.92 (s, 3H). The H NMR spectroscopic data were matched those reported in
literature [26].
4.2.2.3. 14-Deoxy-14,15-didehydroandrographolide (11)
To a solution of compound 10 (0.70 g, 1.62 mmol) in 20 mL of methylene chloride were added
DMAP (0.04 g, 0.324 mmol), and the formed mixture was stirred at r.t. for 24 h. After the reaction
was complete, the reaction mixture was diluted with methylene chloride (120 mL). The organic
layer was separated, washed with dilute hydrochloric acid (60 mL), water (60 mL×3), and brine
(60 mL), dried with anhydrous Na2SO4, concentrated under reduce pressure, and purified by
column chromatography (EtOAc/PE = 1/2) to give compound 11 as a white solid (0.48 g, 89.2%).
1H NMR (300 MHz, CDCl3) δ: 7.05–6.92 (m, 1H), 6.67 (d, J = 7.6 Hz, 1H), 6.17 (d, J = 3.7 Hz,
1H), 4.85 (s, 1H), 4.41 (s, 1H), 4.25–4.13 (m, 1H), 3.49 (t, J = 8.2 Hz, 1H), 3.32 (d, J = 11.2 Hz,
1H), 2.95 (s, 2H), 2.49 (dt, J = 7.8, 3.7 Hz, 1H), 2.45–2.30 (m, 2H), 1.96 (t, J = 12.3 Hz, 1H),
1
1.90–1.64 (m, 6H), 1.24 (s, 3H), 0.69 (d, J = 2.1 Hz, 3H). The H NMR spectroscopic data were
matched those reported in literature [26].
4.2.2.4. 14-Deoxy-11,12-didehydroandrographolide (2)
To a solution of compound 10 (0.7 g, 1.62 mmol) in 20 ml of methylene chloride were added
DMAP (0.30 g, 2.43 mmol), then stirred at 50 °C for 24 h. After the reaction was complete, the
reaction mixture was diluted with methylene chloride (120 mL). The organic layer was separated,
washed with dilute hydrochloric acid (60 mL), water (60 mL×2) and brine (60 mL×1), dried with
anhydrous Na2SO4 for 14 h, concentrated under reduce pressure, and purified by column
1
chromatography (EtOAc/PE = 1/2) to give compound 2 as a white solid (0.46 g, 85%). H NMR
(300 MHz, DMSO-d6) δ: 7.65 (s, 1H), 6.75 (dd, J = 15.8, 10.1Hz, 1H), 6.13 (d, J = 15.8 Hz, 1H),
5.05 (d, J = 4.9 Hz, 1H), 4.89 (s, 2H), 4.73 (s, 1H), 4.43 (s, 1H), 4.14 (dd, J = 7.4, 2.7 Hz, 1H),
3.85 (dd, J = 10.9, 2.7 Hz, 1H), 3.33–3.13 (m, 2H), 2.36 (d, J = 10.3 Hz, 2H), 2.03–1.92 (m, 1H),
1.74-1.70 (m, 1H), 1.63–1.54 (m, 2H), 1.47–1.40 (m, 1H), 1.38–1.29 (m, 1H), 1.24–1.13 (m, 2H),
1
1.09 (s, 3H), 0.76 (s, 3H). The H NMR spectroscopic data were matched those reported in
literature [27].
14

ACCEPTED MANUSCRIPT
4.2.2.5. 14-Deoxy-11,12-didehydroandrographolide-19-al (12a)
12a was synthesized from 2 using the same method described for the synthesis of 6a. A white
solid (91%); Mp 65-69 °C; 1H NMR (300 MHz, DMSO-d6) δ: 9.97 (s, 1H), 7.69 (s, 1H), 6.73 (dd,
J = 15.9 , 10.0 Hz, 1H), 6.15 (d, J = 15.9 Hz, 1H), 5.17 (d, J = 4.5 Hz, 1H), 4.9 (s, 2H), 4.75 (s,
1H), 4.43 (s, 1H), 3.32 (s, 1H), 2.36 (d, J = 13.1 Hz, 1H), 2.03–1.90 (m, 3H), 1.79–1.74 (m, 2H),
1.47–1.41 (m, 2H), 1.28–1.23 (m, 1H), 1.21–1.13 (m, 1H), 1.09 (s, 3H), 0.65 (s, 3H); 13C NMR
(75 MHz, CDCl3) δ: 207.20, 171.73, 146.83, 142.73, 135.01, 128.64, 120.96, 109.31, 76.85, 69.14,
59.91, 54.68, 52.32, 38.63, 37.95, 35.98, 27.98, 22.55, 18.87, 13.99; HRMS (ESI) m/z calcd for
C20H26NaO4 [M+Na]+ 353.1723, found 353.1722.
4.2.2.6. 3-Acetyl-14-deoxy-11,12-didehydroandrographolide-19-al (12b)
12b was synthesized from 12a using the same method described for the synthesis of 6b. A light
yellowish solid (76%); Mp 64-68 °C; 1H NMR (300 MHz, CDCl3) δ: 10.08 (s, 1H), 7.19 (s, 1H),
6.90 (dd, J = 15.8, 10.1 Hz, 1H), 6.15 (d, J = 15.8 Hz, 1H), 4.83 (s, 3H), 4.78–4.67 (m, 1H), 4.56
(s, 1H), 2.49–2.39 (m, 2H), 2.06 (s, 3H), 1.96–1.88 (m, 1H), 1.69–1.64 (m, 3H), 1.49–1.37 (m,
2H), 1.35–1.33 (m, 1H), 1.11 (s, 3H), 0.88–0.85 (m, 1H), 0.80 (s, 3H) ; 13C NMR (75 MHz,
CDCl3) δ: 203.7, 169.9, 146.8, 142.9, 134.9, 128.6, 121.1, 109.3, 78.0, 69.1, 59.7, 55.6, 51.6, 38.1,
37.1, 35.6, 24.0, 22.7, 20.6, 20.5, 15.5; HRMS (ESI) m/z calcd for C22H29O5 [M+H]+ 373.2010,
found 373.2014.
4.2.2.7. 14-Deoxy-11,12-didehydroandrographolide-19-oic acid (13a)
13a was synthesized from 12a using the same method described for the synthesis of 7a. A white
solid (64%); Mp 170-172 °C; 1H NMR (300 MHz, CDCl3) δ: 7.20 (s, 1H), 6.89 (dd, J = 15.7, 10.2
Hz, 1H), 6.13 (d, J = 15.7 Hz, 1H), 4.82 (s, 3H), 4.55 (s, 1H), 3.19 (dd, J = 12.1, 4.3 Hz, 1H), 2.47
(d, J = 13.1 Hz, 1H), 2.33 (d, J = 10.1 Hz, 1H), 2.09-1.95 (m, 3H), 1.92–1.78 (m, 2H), 1.6 (d, J =
13.7 Hz, 1H), 1.47 (s, 3H), 1.32–1.13 (m, 3H), 0.80 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 181.09,
172.09, 147.52, 142.90, 135.19, 128.63, 120.71, 108.50, 77.62, 69.32, 60.52, 54.52, 48.75, 38.94,
38.54, 36.32, 27.83, 24.24, 23.52, 13.07; HRMS (ESI) m/z calcd for C20H26NaO5 [M+Na]+
369.1672, found 369.1681.
4.2.2.8. 3-Acetyl-14-deoxy-11,12-didehydroandrographolide-19-oic acid (13b)
13b was synthesized from 12b using the same method described for the synthesis of 7a. A light
yellowish solid (78%); Mp 211-214 °C; 1H NMR (300 MHz, CDCl3) δ: 7.17 (s, 1H), 6.90 (dd, J =
15.8, 10.0 Hz, 1H), 6.12 (d, J = 15.8 Hz, 1H), 4.81 (s, 3H), 4.61–4.56 (m, 1H), 4.55 (s, 1H),
2.49-2.45 (m, 1H), 2.33 (t, J = 9.3 Hz, 1H), 2.06 (s, 3H), 2.04–1.95 (m, 2H), 1.77–1.65 (m, 2H),
1.63–1.58 (m, 2H), 1.39 (d, J = 11.6 Hz, 1H), 1.29 (s, 3H), 0.86 (s, 3H); 13C NMR (75 MHz,
CDCl3) δ: 179.49, 171.81, 170.55, 147.08, 142.88, 135.02, 128.63, 120.90, 109.04, 78.56, 69.18,
60.89, 54.34, 47.80, 38.69, 37.89, 35.95, 23.89, 23.59, 20.83, 12.77; HRMS (ESI) m/z calcd for
C22H28NaO6 [M+Na]+ 411.1778, found 411.1784.
4.2.2.9. Methyl 3-acetyl-14-deoxy-11,12-didehydroandrographolide-19-oate (14a)
14a was synthesized from 13b using the general procedure described for the synthesis of 8. A
light yellowish solid (64%); Mp 52-55 °C; 1H NMR (300 MHz, CDCl3) δ: 7.16 (s, 1H), 6.88 (dd, J
= 15.9, 10.1 Hz, 1H), 6.12 (d, J = 15.8 Hz, 1H), 4.80 (s, 2H), 4.79 (s, 1H), 4.61–4.55 (m, 1H),
4.54 (s, 1H), 3.66 (s, 3H), 2.49–2.41 (m, 1H), 2.40–2.22 (m, 2H), 2.05 (s, 1H), 2.03–1.91 (m, 2H),
1.74–1.66 (m, 1H), 1.64–1.46 (m, 2H), 1.44–1.27 (m, 2H), 1.24 (s, 3H), 0.77 (s, 3H); 13C NMR
15

ACCEPTED MANUSCRIPT
(75 MHz, CDCl3) δ: 173.49, 171.71, 170.51, 147.28, 142.74, 135.13, 128.66, 120.85, 108.85,
78.90, 69.10, 60.93, 54.32, 50.69, 47.95, 38.50, 37.93, 36.00, 24.02, 23.97, 23.56, 20.81, 12.72;
HRMS (ESI) m/z calcd for C23H31O6 [M+H]+ 403.2115, found 403.2121.
4.2.2.10. Benzyl 3-acetyl-14-deoxy-11,12-didehydroandrographolide-19-oate (14b)
14b was synthesized from 13b using the general procedure described for the synthesis of 8. A
1
light yellowish solid (62%); Mp 74-78 °C; H NMR (300 MHz, CDCl3) δ: 7.39–7.30 (m, 5H),
7.16 (s, 1H), 6.88 (dd, J = 15.9, 10.1 Hz, 1H), 6.11 (d, J = 15.8 Hz, 1H), 5.13 (q, J = 12.5 Hz, 2H),
4.80 (s, 2H), 4.78 (s, 1H), 4.59 (dd, J = 12.1, 4.5 Hz, 1H), 4.53 (s, 1H), 2.47–2.40 (m, 1H),
2.39–2.26 (m, 2H), 2.02 (s, 3H), 1.98–1.95 (m, 2H), 1.74–1.66 (m, 1H), 1.68–1.41 (m, 3H),
1.39–1.33 (m, 1H), 1.29 (s, 3H), 0.73 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 172.82, 171.76,
170.45, 147.21, 142.83, 135.13, 128.61, 127.97, 127.67, 120.84, 108.90, 78.94, 69.13, 65.65,
60.87, 54.41, 48.08, 38.51, 37.88, 35.98, 24.04, 24.00, 23.87, 20.78, 12.84; HRMS (ESI) m/z
calcd for C29H34NaO6 [M+Na]+ 501.2248, found 501.2253.
4.2.2.11. 2-Pyridylmethyl 3-acetyl-14-deoxy-11,12-didehydroandrographolide-19-oate (14c)
14c was synthesized from 13b using the general procedure described for the synthesis of 8. A
light yellowish solid (73%); Mp 57-60 °C; 1H NMR (300 MHz, CDCl3) δ: 8.61 (d, J = 4.4 Hz, 1H),
7.72 (td, J = 7.7, 1.7 Hz, 1H), 7.44 (d, J = 7.9 Hz, 1H), 7.25 (d, J = 6.9 Hz, 1H), 7.18 (s, 1H), 6.90
(dd, J = 15.8, 10.2 Hz, 1H), 6.14 (d, J = 15.8 Hz, 1H), 5.26 (dd, J = 26.9, 11.0 Hz, 2H), 4.83 (s,
2H), 4.80 (s, 1H), 4.64 (dd, J = 12.2, 4.5 Hz, 1H), 4.55 (s, 1H), 2.55–2.26 (m, 3H), 2.07 (s, 3H),
2.02 (d, J = 11.7 Hz, 2H), 1.83–1.68 (m, 1H), 1.67–1.51 (m, 3H), 1.41 (dd, J = 15.2, 4.5 Hz, 1H),
1.35 (s, 3H), 0.74 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 172.60, 171.71, 170.38, 155.20, 148.79,
147.13, 142.73, 136.28, 135.11, 128.65, 122.42, 121.57, 120.85, 108.95, 78.95, 69.10, 66.25,
60.87, 54.44, 48.12, 38.53, 37.88, 35.97, 29.19, 24.00, 23.84, 20.80, 12.81; HRMS (ESI) m/z
calcd for C28H34NO6 [M+H]+ 480.2381, found 480.2379.
4.2.2.12. Methyl 14-deoxy-11,12-didehydroandrographolide-19-oate (14d)
14d was synthesized from 13a using the general procedure described for the synthesis of 8. A
light yellowish solid (74%). Mp 53-57 °C; 1H NMR (300 MHz, CDCl3) δ: 7.17 (s, 1H), 6.90 (dd, J
= 15.8, 10.0 Hz, 1H), 6.12 (d, J = 15.8 Hz, 1H), 4.81 (s, 2H), 4.80–4.75 (m, 1H), 4.54 (s, 1H),
3.67 (s, 3H), 3.12 (dd, J = 12.0, 4.3 Hz, 1H), 2.50–2.41 (m, 1H), 2.31 (d, J = 10.1 Hz, 1H),
2.04–1.95 (m, 3H), 1.85–1.72 (m, 2H), 1.601–.56 (m, 1H), 1.42 (s, 3H), 1.29–1.13 (m, 3H), 0.70
(s, 3H); 13C NMR (75 MHz, CDCl3) δ: 177.29, 171.72, 147.63, 142.55, 135.29, 128.73, 120.74,
108.41, 77.96, 69.10, 60.63, 54.60, 50.82, 49.16, 38.79, 38.69, 36.39, 28.00, 24.53, 23.30, 12.80;
HRMS (ESI) m/z calcd for C21H28NaO5 [M+Na]+ 383.1829, found 383.1832.
4.2.2.13. Benzyl 14-deoxy-11,12-didehydroandrographolide-19-oate (14e)
14e was synthesized from 13a using the general procedure described for the synthesis of 8. A
1
light yellowish solid (65%); Mp 50-53 °C; H NMR (300 MHz, CDCl3) δ: 7.487–.28 (m, 5H),
7.16 (s, 1H), 6.88 (dd, J = 15.9, 10.3 Hz, 1H), 6.11 (d, J = 15.8 Hz, 1H), 5.20 (d, J = 12.3 Hz, 1H),
5.03 (d, J = 12.3 Hz, 1H), 4.81 (s, 2H), 4.77 (s, 1H), 4.52 (s, 1H), 3.13 (dd, J = 11.8, 4.3 Hz, 1H),
2.49–2.36 (m, 1H), 2.30 (d, J = 10.2 Hz, 1H), 2.05–1.97 (m, 3H), 1.82–1.70 (m, 2H), 1.60–1.55
(m, 1H), 1.45 (s, 3H), 1.29–1.14 (m, 3H), 0.65 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 176.40,
171.72, 147.52, 142.53, 135.34, 128.12, 127.89, 127.85, 120.72, 108.47, 78.03, 69.10, 65.91,
60.62, 54.76, 49.31, 38.81, 38.71, 36.37, 28.00, 24.57, 23.51, 12.93; HRMS (ESI) m/z calcd for
16

ACCEPTED MANUSCRIPT
C27H33O5 [M+H]+ 437.2323, found 437.2302.
4.2.2.14. 2-Pyridylmethyl 14-deoxy-11,12-didehydroandrographolide-19-oate (14f)
14f was synthesized from 13a using the general procedure described for the synthesis of 8. A
light yellowish solid (56%); Mp 48-51 °C; 1H NMR (300 MHz, CDCl3) δ: 8.60 (d, J = 4.5 Hz, 1H),
7.72 (td, J = 7.7, 1.7 Hz, 1H), 7.34 (d, J = 7.8 Hz, 1H), 7.28–7.23 (m, 1H), 7.17 (s, 1H), 6.90 (dd,
J = 15.8, 10.1 Hz, 1H), 6.13 (d, J = 15.8 Hz, 1H), 5.37–5.18 (m, 2H), 4.82 (d, J = 1.4 Hz, 2H),
4.80 (s, 1H), 4.54 (s, 1H), 2.53–2.41 (m, 1H), 2.33 (d, J = 10.3 Hz, 1H), 2.15–1.95 (m, 4H), 1.80
(ddd, J = 15.4, 9.9, 4.3 Hz, 2H), 1.72–1.56 (m, 2H), 1.51 (s, 3H), 1.3–81.29 (m, 2H), 0.70 (s, 3H);
13C NMR (75 MHz, CDCl3) δ: 175.80, 154.66, 148.99, 147.52, 142.55, 136.34, 135.36, 128.72,
122.54, 121.45, 120.72, 108.55, 77.97, 69.11, 65.93, 60.65, 54.69, 49.59, 38.77, 38.65, 36.30,
28.05, 24.46, 23.89, 12.93; HRMS (ESI) m/z calcd for C26H32NO5 [M+H]+ 438.2275, found
438.2280.
4.2.3. Synthesis of the 14-deoxy-14,15-didehydroandrographolide-19-oic acid derivatives 18a-d
4.2.3.1. 14-Acetylandrographolide (15)
A mixture of 3,19-isopropylidene-andrographolide (9) (7.0 g, 17.93 mmol) and acetic anhydride
(60 mL) was refluxed for 1.5 h. After cooled down to room temperature, the reaction mixture was
neutralized with saturated NaHCO3 until no bubble was formed and then diluted with methylene
chloride (100 mL). The organic layer was separated, washed with saturated NaHCO3 (120 mL×3)
and brine (120 mL×3), and concentrated under reduce pressure to provide a crude. The crude was
dissolved in aqueous acetic acid solution (AcOH/H2O: 28 mL/12 mL) and stirred at r.t. for 1 h.
After the reaction was complete, NaHCO3 powder was added until no bubble was released, and
the resulted mixture was diluted with methylene chloride (80 mL). The organic layer was
separated, washed with saturated NaHCO3 (100 mL×3) and brine (100 mL×3), dried with
anhydrous Na2SO4, concentrated under reduce pressure, and recrystallized from ethyl
1
acetate-petroleum ether to provide compound 15 as a white needle (5.21 g, 85%). H NMR (300
MHz, CDCl3) δ: 7.01 (td, J = 6.9, 1.5 Hz, 1H), 5.92 (d, J = 6.0 Hz, 1H), 4.88 (s, 1H), 4.57–4.51
(m, 2H), 4.24 (dd, J = 11.2, 1.9 Hz, 1H), 4.18 (d, J = 11.1 Hz, 1H), 3.49 (t, J = 16.0 Hz, 1H), 3.33
(d, J = 11.1 Hz, 1H), 2.45–2.37 (m, 3H), 2.31 (s, 2H), 2.12 (s, 3H), 2.01–1.92 (m, 1H), 1.831–.72
1
(m, 5H), 1.25 (s, 3H), 1.33–1.20 (m, 3H), 0.67 (s, 3H). The H NMR spectroscopic data were
matched those reported in literature [26].
4.2.3.2. 14-Acetylandrographolide-19-al (16a)
16a was synthesized from 15 using the same method described for the synthesis of 6a. A light
yellowish solid (91%). 1H NMR (300 MHz, CDCl3) δ: 9.74 (d, J = 1.9 Hz, 1H), 6.99 (t, J = 6.0 Hz,
1H), 5.90 (d, J = 5.8 Hz, 1H), 4.92 (s, 1H), 4.62–4.51 (m, 2H), 4.23 (dd, J = 11.3, 1.7 Hz, 1H),
3.22 (d, J = 9.7 Hz, 1H), 2.57–2.45 (m, 2H), 2.43–2.28 (m, 3H), 2.10 (s, 1H), 2.08–1.97 (m, 2H),
1.96–1.92 (m, 1H), 1.90–1.73 (m, 3H), 1.68–1.50 (m, 2H), 1.44–1.33 (m, 1H), 1.28 (s, 3H), 0.64
(s, 3H); 13C NMR (75 MHz, CDCl3) δ：207.51, 170.47, 169.01, 150.01, 146.08, 124.06, 109.37,
77.47, 71.57, 67.75, 55.53, 54.62, 52.79, 39.44, 37.60, 37.06, 28.53, 25.30, 23.80, 20.66, 19.39,
13.69; HRMS (ESI) m/z calcd for C22H30O6Na [M+Na]+ 413.1940, found 413.1932.
4.2.3.3. 3,14-Diacetylandrographolide-19-al (16b)
16b was synthesized from 16a using the same method described for the synthesis of 6b. A light
yellowish solid (76%). 1H NMR (300 MHz, CDCl3) δ 10.04 (s, 1H), 6.99 (t, J = 6.0 Hz, 1H), 5.93
17

ACCEPTED MANUSCRIPT
(d, J = 5.6 Hz, 1H), 4.91 (s, 1H), 4.78–4.66 (m, 1H), 4.52 (s, 2H), 4.25 (dd, J = 11.2, 1.7 Hz, 1H),
2.55–2.28 (m, 3H), 2.12 (s, 3H), 2.06 (s, 3H), 2.02–1.75 (m, 5H), 1.49–1.21 (m, 4H), 1.10 (s, 3H),
0.65 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 203.98, 170.39, 170.31, 168.87, 149.73, 146.06,
124.15, 109.31, 78.10, 71.50, 67.70, 56.38, 54.38, 51.99, 38.99, 37.25, 36.26, 25.36, 24.61, 23.88,
21.0, 20.90, 20.65, 15.13; HRMS (ESI) m/z calcd for C24H32O7Na [M+Na]+ 455.2046, found
455.2052.
4.2.3.4. 14-Acetylandrographolide-19-oic acid (17a)
17a was synthesized from 16a using the same method described for the synthesis of 7a. A white
1
solid (42%). H NMR (300 MHz, CDCl3) δ: 12.31 (s, 1H), 6.83 (t, J = 6.3 Hz, 1H), 5.92 (d, J =
5.3 Hz, 1H), 4.86 (s, 1H), 4.59–4.52 (m, 2H), 4.38 (bs, 1H), 4.29–4.26 (d, 1H), 3.09 (d, 1H ),
2.50–2.32 (m, 2H), 2.12–1.91 (m, 8H), 1.81–1.59 (m, 3H),1.32–1.20 (m, 5H), 0.63 (s, 3H); 13C
NMR (75 MHz, CDCl3) δ: 181.42, 170.51, 169.10, 150.32, 146.57, 123.98, 108.69, 77.75, 71.61,
67.76, 55.51, 55.28, 49.38, 39.79, 37.90, 37.74, 28.52, 25.42, 25.30, 24.07, 20.69, 12.78; HRMS
(ESI) m/z calcd for C22H30O7Na [M+Na]+ 429.1889, found 429.1898.
4.2.3.5. 3,14-Diacetylandrographolide-19-oic acid (17b)
17b was synthesized from 16b using the same method described for the synthesis of 7a. A white
1
solid (76%). H NMR (300 MHz, CDCl3) δ: 12.34 (s, 1H), 6.84 (t, J = 6.5 Hz, 1H), 5.95 (d, J =
5.4 Hz, 1H), 4.87(s, 1H), 4.59–4.45 (m, 3H), 4.30–4.27 (d, 1H), 2.42–2.27 (m, 4H), 2.09–1.99 (m,
8H), 1.93–1.76 (m, 2H), 1.631–.60 (m, 1H), 1.52–1.31 (m, 3H), 1.15 (s, 3H), 0.68 (s, 3H); 13C
NMR (75 MHz, CDCl3) δ: 179.31, 170.82, 170.44, 169.03, 150.06, 146.31, 124.08, 109.02, 78.67,
71.58, 67.76, 55.55, 55.29, 48.26, 39.52, 37.58, 37.06, 25.24, 25.07, 24.56, 24.44, 24.09, 21.23,
20.69, 12.52; HRMS (ESI) m/z calcd for C24H32O8Na [M+Na]+ 471.1995, found 471.1988.
4.2.3.6. General procedure for the synthesis of alkyl 14-deoxy-14,15-didehydroandrographolide
-19-oates (18)
To a solution of compound 17a or 17b (0.20 mmol) in 3 ml of DMF, K2CO3 (0.028 g, 0.20
mmol), alkyl halide (methyl iodide or benzyl bromide, 0.20 mmol), then stirred at r.t. for 0.5 h.
Then DMAP (catalytic amount) were added and stirred at r.t. for 0.5 h. After the reaction was
complete, the reaction mixture was diluted with ethyl acetate (120 mL). The organic layer was
separated, washed with water (60 mL×2) and brine (60 mL×1), dried with anhydrous Na2SO4,
concentrated under reduce pressure, and purified by column chromatography (EtOAc/PE = 1/3) to
give corresponding compound 18.
4.2.3.6.1. Methyl 3-acetyl-14-deoxy-14,15-didehydro-andrographolide-19-oate (18a): a light
yellowish solid (0.030 g, 42%); Mp 118-121°C; 1H NMR (300 MHz, CDCl3) δ: 7.01 (dd, J = 3.3,
1.7 Hz, 1H), 6.70 (t, J = 7.2 Hz, 1H), 6.17 (dd, J = 3.5, 0.7 Hz, 1H), 4.88 (s, 1H), 4.58 (dd, J =
12.1, 4.3 Hz, 1H), 4.44 (s, 1H), 3.67 (s, 3H), 2.63–2.28 (m, 4H), 2.08 (s, 3H), 2.05–1.93 (m, 2H),
1.91–1.70 (m, 3H), 1.57–1.31 (m, 3H), 1.25 (s, 3H), 0.67 (s, 3H); 13C NMR (75 MHz, CDCl3) δ:
173.45, 170.50, 167.45, 145.87, 144.97, 143.57, 125.34, 108.43, 104.48, 78.57, 55.26, 54.72,
50.74, 47.84, 38.98, 37.12, 36.64, 25.45, 24.73, 23.99, 23.49, 20.85, 12.01; HRMS (ESI) m/z
calcd for C23H31O6 [M+H]+ 403.2115, found 403.2115.
4.2.3.6.2. Benzyl 3-acetyl-14-deoxy-14,15-didehydro-andrographolide-19-oate (18b): light
yellowish solid (47%); Mp 123-126 °C; 1H NMR (300 MHz, CDCl3) δ: 7.35 (s, 5H), 6.99 (d, J =
1.4 Hz, 1H), 6.69 (t, J = 7.2 Hz, 1H), 6.15 (d, J = 3.3 Hz, 1H), 5.13 (q, J = 12.5 Hz, 2H), 4.85 (s,
18

ACCEPTED MANUSCRIPT
1H), 4.59 (dd, J = 12.1, 4.3 Hz, 1H), 4.41 (s, 1H), 2.62–2.24 (m, 4H), 2.05 (s, 3H), 2.00 (d, J =
10.2 Hz, 2H), 1.85 (d, J = 13.1 Hz, 3H), 1.60–1.33 (m, 3H), 1.29 (s, 3H), 0.62 (s, 3H); 13C NMR
(75 MHz, CDCl3) δ: 172.76, 170.46, 145.81, 144.97, 143.61, 135.26, 127.98, 127.63, 125.32,
108.47, 104.48, 78.62, 65.64, 55.21, 54.84, 47.99, 38.98, 37.11, 36.59, 29.21, 25.46, 24.71, 24.07,
23.80, 20.80, 12.10; HRMS (ESI) m/z calcd for C29H35O6 [M+H]+ 479.2428, found 479.2432.
4.2.3.6.3. Methyl 14-deoxy-14,15-didehydro-andrographolide-19-oate (18c): a light yellowish
solid (41%); Mp 108-111 °C; 1H NMR (300 MHz, CDCl3) δ: 7.02 (d, J = 1.7 Hz, 1H), 6.71 (t, J =
7.2 Hz, 1H), 6.19 (dd, J = 3.5, 0.9 Hz, 1H), 4.91 (s, 1H), 4.45 (s, 1H), 3.68 (s, 4H), 3.17 (d, J = 7.9
Hz, 1H), 2.65–2.51 (m, 1H), 2.51–2.35 (m, 2H), 2.17–1.99 (m, 2H), 1.98–1.72 (m, 5H), 1.44 (s,
3H), 1.38–1.29 (m, 2H), 0.62 (s, 3H); 13C NMR (75 MHz, CDCl3) δ: 177.36, 146.21, 144.94,
143.68, 125.30, 108.03, 104.49, 77.56, 54.95, 50.84, 49.07, 39.25, 37.47, 37.38, 28.09, 25.51,
25.27, 23.25, 12.06; HRMS (ESI) m/z calcd for C21H28NaO5 [M+Na]+ 383.1829, found 383.182.
4.2.3.6.4. Benzyl 14-deoxy-14,15-didehydro-andrographolide-19-oate (18d): a light yellowish
solid (38%); Mp 110-114 °C; 1H NMR (300 MHz, CDCl3) δ: 7.35 (d, J = 3.8 Hz, 5H), 6.99 (s, 1H),
6.69 (t, J = 7.3 Hz, 1H), 6.16 (d, J = 3.5 Hz, 1H), 5.20 (d, J = 12.4 Hz, 1H), 5.02 (d, J = 12.3 Hz,
1H), 4.86 (s, 1H), 4.41 (s, 1H), 3.18 (s, 2H), 2.68–2.27 (m, 3H), 2.04 (td, J = 20.9, 9.4 Hz, 3H),
1.94–1.78 (m, 4H), 1.73–1.50 (m, 2H), 1.45 (s, 3H), 0.55 (s, 3H); 13C NMR (75 MHz, CDCl3) δ:
172.07, 146.62, 145.43, 144.20, 135.26, 134.22, 128.63, 128.39, 128.31, 108.56, 104.98, 78.12,
66.39, 55.60, 55.44, 49.72, 39.78, 37.96, 37.89, 28.59, 26.01, 25.82, 23.93, 12.66; HRMS (ESI)
m/z calcd for C27H32NaO5 [M+Na]+ 459.2142, found 459.2141.
4.3. Biology
4.3.1 Cell culturing
Mouse fibroblast cell line (NIH-3T3) and human umbilical vein endothelial cell line (HUVEC)
were all cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) and
1% penicillin-streptomycin in a humidified atmosphere of 5% CO2 at 37 °C.
4.3.2 MTT assay
Proliferation of NIH-3T3 and HUVEC cells was evaluated by MTT method. This assay is a
well-established colorimetric assay which relies on the reduction of 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyltetrazolium bromide (MTT) to insoluble blue formazan crystals by cellular reductase
activities in living cells. Cells were plated on 96-wells with a density of 5000 cells/well. After
attachment (24h), the cells were treated for 72h (42h for HUVEC cells) with each compound at
different concentrations. After incubation, 20 µL of MTT solution (5 mg/mL in PBS) was added
and incubated for an additional 2-4 h. Subsequently, the medium was aspirated carefully, and 150
µL of DMSO was added to dissolve the crystal. The optical density was measured at 490 nm using
RT-2100C Micro-plate Reader (Rayto, China). Each experiment was repeated three times, and the
data represent the mean of all measurements. Data were recorded and analyzed for the assessment
of the effects of the test substances on cell viability and growth inhibition. The IC50 values were
calculated using regression equation.
4.3.3 Real-time PCR
NIH-3T3 cells were treated for 1 h with 500 nM screened compounds before the addition of 5
ng/ml TGF-β1. Twenty-four hours after adding TGF-β1, cells were lysed and total RNA was
19

ACCEPTED MANUSCRIPT
extracted using an RNAiso Plus (Takara, Dalian) kit. Six microliter of RNA was then reverse
transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian) according to
the instruction. The primers for qPCR were listed in Table 2. Subsequent PCR amplification was
performed on an ABI StepOne Plus Real-time Detection System (Applied Biosystems, CA,
USA) with SYBR® Premix Ex TaqTM (Takara, Dalian). Forty amplification cycles, consisting of 5
s at 95 °C and 60 s at 60 °C, were run on 20 µl reactions. Expression was normalized to GAPDH
endogenous control and relative gene expression was calculated by 2-∆∆CT method [28] using cycle
time (Ct) values and data for normalization. Data were showed as the mean of three experiments.
Table 2
Primers used for real-time qPCR.
Gene
FN
PCR product
size (bp)
122
Primer sequences
F
R
F
R
F
R
F
R
CACCTTCAGTAGAAGGCAGTAG
GTTCTCCTCCACAGCATAGATAG
CCAATGGTGCTCCTGGTATT
GGTTCACCACTGTTACCCTT
CCATCATGCGTCTGGACTT
COL1A1
α-SMA
112
92
GGCAGTAGTCACGAAGGAATAG
GGGTGTGAACCACGAGAAATA
GTCATGAGCCCTTCCACAAT
GAPDH
129
4.3.4 Western blot
Whole cell proteins were lysed on ice by RIPA lysis buffer with 1% phenylmethylsulfonyl
fluoride (PMSF) for 30 min, centrifuged at 12000g rpm for 5 min and the supernatant was
collected. Protein concentration was measured using an enhanced bicinchoninic acid (BCA)
protein assay kit. Samples were subsequently loaded into each lane of a 10% SDS–polyacrylamide
gel and transferred onto PVDF membranes (Bio-Rad, USA). Membranes were blocked for 1 h in
5% non-fat milk in TBST buffer and then incubated with α-SMA, FN and COL1A1 primary
antibodies overnight at 4 °C at a dilution of 1:1000. Having been washed 3 times in TBST, the
membranes were incubated with secondary antibody horseradish peroxidase (HRP)-conjugated
rabbit IgG (diluted 1:5000) for 2 h at room temperature, and then washed 3 times. Finally,
immuno-detection was visualized using the ECL detection system (Tanon-5200) according to the
manufacturer’s instructions. The load protein was normalized to β-actin. The immunoblotted
bands were quantified by Gel-Pro Analyzer 4.0 software. All experiments were performed in
triplicate.
Acknowledgements
We thank China Pharmaceutical University for the financial support.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
References
20

ACCEPTED MANUSCRIPT
[1] T. A. Wynn, and T. R. Ramalingam, Mechanisms of fibrosis: therapeutic translation for fibrotic disease, Nature Medicine 18
(2012) 1028-1040.
[2] D. Povero, C. Busletta, E. Novo, L. V. di Bonzo, S. Cannito, C. Paternostro, M. Parola, Liver fibrosis: a dynamic and
potentially reversible process, Histol. Histopathol. 25 (2010) 1075-1091.
[3] W. W. Douglas, J. Ryu, D. Schroeder, Idiopathic pulmonary fibrosis, Bmj British Medical Journal 347 (2000) 333-364.
[4] Y. H. Liu, Cellular and molecular mechanism of renal fibrosis, Nat. Rev. Nephrol. 7 (2011) 684-696.
[5] M. Jinnin, Mechanisms of skin fibrosis in systemic sclerosis, J. Dermatol. 37 (2010) 11–25.
[6] L. Richeldi, R. M. D. Bois, G. Raghu, A. Azuma, K. K. Brown, U. Costabel, V. Cottin, K. R. Flaherty, D. M. Hansell, Y.
Inoue, D. S. Kim, M. Kolb, A. G. Nicholson, P. W. Noble, M. Selman, H. Taniguchi, M. Brun, F. Le Maulf, M. Girard, S.
Stowasser, R. Schlenker-Herceg, B. Disse, H. R. Collard, Efficacy and safety of nintedanib in idiopathic pulmonary fibrosis, N.
Engl. J. Med. 370 (2014) 2071-2082.
[7] G. Raghu, W. C. Johnson, D. Lockhart, Y. Mageto, Treatment of idiopathic pulmonary fibrosis with a new antifibrotic agent,
pirfenidone: results of a prospective, open-label phase ii study, Am. J. Respir. Crit. Care. Med. 159 (1999) 1061-1069.
[8] J. A. Galli, A. Pandya, M. Vega-Olivo, C. Dass, H. Zhao, G. J. Criner, Pirfenidone and nintedanib for pulmonary fibrosis in
clinical practice: tolerability and adverse drug reactions, Respirology 22 (2017) 1171-1178.
[9] M. K. Gorter, The bitter constituent of andrographis paniculata nees, Rec. Trav. Chim. 30 (1911) 151-160.
[10] S. Gupta, M.A. Choudhry, J.N.S. Yadava, V. Srivastava, J.S. Tandon, Anti-diarrheal activity of diterpenes of andrographis
paniculata (kalmegh) against Escherichia coli enterotoxin in in vivo models, Int. J. Crude Drug Res. 28 (1990) 273-283.
[11] S. Madav, S.K. Tanda, J. Lal, H.C. Tripathi, Anti-inflammatory activity of andrographolide, Fitoterapia 67 (1996) 452-458.
[12] J.-C. Lee, C.-K. Tseng, K.-C. Young, H.-Y. Sun, S.-W. Wang, W.-C. Chen, C.-K. Lin, Y.-H. Wu, Andrographolide exerts
anti-hepatitis C virus activity by up-regulating haeme oxygenase-1 via the p38 MAPK/Nrf2 pathway in human hepatoma cells,
Brit. J. Pharmacol. 171 (2014) 237–252.
[13] P. Misra, N.L. Pal, P.Y. Guru, J.C. Katiyar, V. Srivastava, J.S. Tandon, Anti-malarial activity of Andrographis paniculata
(kalmegh) against Plasmodium berghei NK 65 in Mastomys natalensis, Int. J. Pharmacognosy 30 (1992) 263-274.
[14] S. Rajagopal, R.A. Kumar, D.S. Deevi, C. Satyanarayana, R. Rajagopalan, Andrographolide, a potential cancer therapeutic
agent isolated from Andrographis paniculata, J. Exp. Ther. Oncol. 3 (2003) 147-158.
[15] T. Zhu, W. Zhang, M. Xiao, H. Chen, H. Jin, Protective role of andrographolide in bleomycin-induced pulmonary fibrosis in
mice, Int. J. Mol. Sci. 14 (2013) 23581-96.
[16] T.Y. Lee, H.H. Chang, C.K. Wen, T.H. Huang, Y.S. Chang, Modulation of thioacetamide-induced hepatic inflammations,
angiogenesis and fibrosis by andrographolide in mice, J. Ethnopharmacol. 158 Pt A (2014) 423-430.
[17] M. J. Lee, Y. K. Rao, K. Chen, Y. C. Lee, Y. S. Chung, Y. M. Tzeng, Andrographolide and 14-deoxy-11,12-
didehydroandrographolide from andrographis paniculata, attenuate high glucose-induced fibrosis and apoptosis in murine renal
mesangeal cell lines, J. Ethnopharmacol. 132 (2010) 497-505.
[18] (a) S. R. Jada, G. S. Subur, C. Matthews, A. S. Hamzah, N. H. Lajis, M. S. Saad, M. F. G. Stevens, J. Stanslas,
Semisynthesis and in vitro anticancer activities of andrographolide analogues, Phytochemistry 68 (2007) 904-912; (b) P. Das, D.
Kumar, R. Roy, C. Chowdhury, M. Chatterjee, Andrographolide analogue induces apoptosis and autophasy mediated cell death
in U937 cells, Eur. J. Cancer 48 (Suppl. 5) (2012) S156; (c) S. Wei, Y.-B. Tang, H. Hua, E. Ohkoshi, M. Goto, L.-T. Wang,
K.-H. Lee, Z. Xiao, Discovery of novel andrographolide derivatives as cytotoxic agents, Bioorg. Med. Chem. Lett. 23 (2013)
4056-4060; (d) R. Preet, B. Chakraborty, S. Siddharth, P. Mohapatra, D. Das, S. R. Satapathy, S. Das, N. C. Maiti, P. R. Maulik,
C. N. Kundu, C. Chowdhury, Synthesis and biological evaluation of andrographolide analogues as anti-cancer agents, Eur. J.
Med. Chem. 85 (2014) 95-106; (e) T. Kasemsuk, P. Piyachaturawat, R. Bunthawong, U. Sirion, K. Suksen, A. Suksamrarn, R.
Saeeng, One-pot three steps cascade synthesis of novel isoandrographolide analogues and their cytotoxic activity, Eur. J. Med.
Chem. 138 (2017) 952-963.
21

ACCEPTED MANUSCRIPT
[19] (a) D. Chen, Y. Song, Y. Lu, X. Xue, Synthesis and in vitro cytotoxicity of andrographolide-19-oic acid analogues as
anti-cancer agents, Bioorg. Med. Chem. Lett. 23 (2013) 3166–3169; (b) Y. Song, Z. Xin, Y. Wan, J. Li, B. Ye, X. Xue, Synthesis
and anticancer activity of some novel indolo[3,2-b]andrographolide derivatives as apoptosis-inducing agents, Eur. J. Med. Chem.
90 (2015) 695-706.
[20] Y. Luo, K. Wang, M. H. Zhang, D. Y. Zhang., Y. C. Wu, X. M. Wu, W. Y. Hua, Synthesis of new ent-labdane diterpene
derivatives from andrographolide and evaluation on cytotoxic activities, Bioorg. Med. Chem. Lett. 25 (2015), 2421-2424.
[21] J. Einhorn, C. Einhorn, F. Ratajczak, J.-L. Pierre, Efficient and highly selective oxidation of primary alcohols to aldehydes
by N-chlorosuccinimide mediated by oxoammonium salts, J. Org. Chem. 61 (1996) 7452-7454.
[22] B. S. Bal, W. E. Childers Jr., H. W. Pinnick, Oxidation of α, β-unsaturated aldehydes, Tetrahedron 37 (1981) 2091-2096.
[23] (a) C. H. Liu, Y. Y. Hu, X. L. Wang, P. Liu, L. M. Xu, Effects of salvianolic acid-a on NIH/3T3 fibroblast proliferation,
collagen synthesis and gene expression, World J. Gastroentero. 6 (2000) 361-364; (b) J. Chen, M.-M. Lu, B. Liu, Z. Chen., Q.-B.
Li, L.-J. Tao, G.-Y. Hu, Synthesis and structure-activity relationship of 5-substituent-2(1h)-pyridone derivatives as anti-fibrosis
agents, Bioorg. Med. Chem. Lett. 22 (2012) 2300-2302.
[24] A. Leask, D. J. Abraham, TGF-β signaling and the fibrotic response, FASEB J 18 (2004) 816-827.
[25] G. Gabbiani, The myofibroblast in wound healing and fibrocontractive diseases, J. Pathol. 200 (2003) 500–503.
[26] S. Pandeti, R. Sonkar, A. Shukla, G. Bhatia, N. Tadigoppula, Synthesis of new andrographolide derivatives and evaluation of
their antidyslipidemic, LDL-oxidation and antioxidant activity, Eur. J. Med. Chem. 69 (2013) 439-448.
[27] V. L. N. Reddy, S. M. Reddy, V. Ravikanth, P. Krishnaiah, T. V. Goud, T. P. Rao, T. S. Ram, R. G. Gonnade, M. Bhadbhade,
Y. Venkateswarlu, A new bis-andrographolide ether from androgphis paniculata nees and evaluation of anti-HIV activity, Nat.
Prod. Res. 19 (2005) 223-230.
[28] H. Tabatabaeian, Z. Hojati. Assessment of HER-2 gene overexpression in Isfahan province breast cancer patients using Real
Time RT-PCR and immunohistochemistry, Gene 531 (2013) 39-43.
22

ACCEPTED MANUSCRIPT
Highlights
ò
ò
14-Deoxyandrographolide-19-oic acid derivatives were designed and synthesized.
Anti-fibrotic effects of targets were evaluated by inhibiting the growth of
NIH-3T3 cell lines.
ò
ò
13 compounds showed better anti-fibrotic activities than andrographolide.
Compounds 8b and 14e displayed best activities with IC50 of 12.86 and 13.57 µM
against NIH-3T3.
ò
Compounds 8b and 14e suppressed effectively the expression of α-SMA, FN and
COL1A1 in NIH-3T3.