Epoxyalcohol Synthase RjEAS (CYP74A88) from the Japanese Buttercup (Ranunculus japonicus): Cloning and Characterization of Catalytic Properties

Article abstract of DOI:10.1134/S0006297919020081

Cytochromes P450 of the CYP74 family play a key role in the lipoxygenase cascade generating oxylipins (products of polyunsaturated fatty acid oxidation). The CYP74 family includes allene oxide synthases, hydroperoxide lyases, divinyl ether synthases, and epoxyalcohol synthases. In this work, we cloned the CYP74A88 gene from the Japanese buttercup (Ranunculus japonicus) and studied the properties of the encoded recombinant protein. The CYP74A88 enzyme specifically converts linoleic acid 9-and 13-hydroperoxides to oxiranyl carbinols 9,10-epoxy-11-hydroxy-12-octadecenoic acid and 11-hydroxy-12,13-epoxy-9-octadecenoic acid, respectively, which was confirmed by GC-MS analysis and kinetic studies. Therefore, the CYP74A88 enzyme is a specific epoxyalcohol synthase.

Full text of DOI:10.1134/S0006297919020081

ISSN 0006ꢀ2979, Biochemistry (Moscow), 2019, Vol. 84, No. 2, pp. 171ꢀ180. © Pleiades Publishing, Ltd., 2019.
Published in Russian in Biokhimiya, 2019, Vol. 84, No. 2, pp. 269ꢀ280.
Epoxyalcohol Synthase RjEAS (CYP74A88)
from the Japanese Buttercup (Ranunculus japonicus):
Cloning and Characterization of Catalytic Properties
Y. Y. Toporkova1,a*, V. S. Fatykhova1, S. S. Gorina1, L. S. Mukhtarova1, and A. N. Grechkin1
1Kazan Institute of Biochemistry and Biophysics, Kazan Scientific Center of Russian Academy of Sciences,
420111 Kazan, Tatarstan, Russia
aeꢀmail: kibmail@kibb.knc.ru
Received April 13, 2018
Revised October 7, 2018
Accepted October 7, 2018
Abstract—Cytochromes P450 of the CYP74 family play a key role in the lipoxygenase cascade generating oxylipins (prodꢀ
ucts of polyunsaturated fatty acid oxidation). The CYP74 family includes allene oxide synthases, hydroperoxide lyases,
divinyl ether synthases, and epoxyalcohol synthases. In this work, we cloned the CYP74A88 gene from the Japanese butterꢀ
cup (Ranunculus japonicus) and studied the properties of the encoded recombinant protein. The CYP74A88 enzyme specifꢀ
ically converts linoleic acid 9ꢀ and 13ꢀhydroperoxides to oxiranyl carbinols 9,10ꢀepoxyꢀ11ꢀhydroxyꢀ12ꢀoctadecenoic acid
and 11ꢀhydroxyꢀ12,13ꢀepoxyꢀ9ꢀoctadecenoic acid, respectively, which was confirmed by GCꢀMS analysis and kinetic studꢀ
ies. Therefore, the CYP74A88 enzyme is a specific epoxyalcohol synthase.
DOI: 10.1134/S0006297919020081
Keywords: lipoxygenase cascade, cytochromes P450, CYP74 family, epoxyalcohol synthase, Ranunculus japonicus
Oxylipins are physiologically active compounds ether synthases from different plant species, and only one
formed by oxidative transformations of polyunsaturated epoxyalcohol synthase SmEAS (CYP74M2, GenBank:
fatty acids. Oxylipins can function as signaling molecules XP_002972803) from the spikemoss Selaginella moellenꢀ
or protective molecules, often exhibiting a combination dorffii [6] have been characterized. Additionally, CYP74C
of these properties [1ꢀ4]. A variety of oxylipins is proꢀ enzymes exhibiting both hydroperoxide lyase and
duced by lipoxygenases and enzymes of the CYP74 famiꢀ epoxyalcohol synthase activities were found in higher
ly [2, 5]. The CYP74 family includes four groups of plant plants [7].
enzymes: allene oxide synthases (EC 4.2.1.92), divinyl
Recently, classification of CYP74 enzymes has
ether synthases (EC 4.2.1.121), hydroperoxide lyases, and undergone significant changes. The diversity of CYP74
epoxyalcohol synthases (not classified in EC) [3, 5, 6]. So proteins was extended from the family to the clan [8]. In
far, within the CYP74 family several dozens of hydroperꢀ addition to the CYP74 family plant enzymes, a number of
oxide lyases and allene oxide synthases, several divinyl metazoan and bacterial proteins have been attributed to
the CYP74 clan, including several epoxyalcohol synthasꢀ
es: BfEAS from the lancelet Branchiostoma floridae
Abbreviations: GCꢀMS, gas chromatography/mass spectromeꢀ
try; HPLC, highꢀperformance liquid chromatography; 9ꢀ
H(P)OD, (9S,10E,12Z)ꢀ9ꢀhydro(pero)xyꢀ10,12ꢀoctadecaꢀ
dienoic acid; 9ꢀH(P)OT, (9S,10E,12Z,15Z)ꢀ9ꢀhydro(pero)xyꢀ
10,12,15ꢀoctadecatrienoic acid; 13ꢀH(P)OD, (9Z,11E,13S)ꢀ
13ꢀhydro(pero)xyꢀ9,11ꢀoctadecadienoic acid; 13ꢀH(P)OT,
(9Z,11E,13S,15Z)ꢀ13ꢀhydro(pero)xyꢀ9,11,15ꢀoctadecaꢀ
trienoic acid; Me, methyl; ORF, open reading frame; TMS,
trimethylsilyl.
(CYP440A1, GenBank: ACD88492.1) [9], EsEAS from
the brown alga Ectocarpus siliculosus (CYP5164B1,
GenBank: APG42673.1) [10], and NvEAS from the
actinia Nematostella vectensis (CYP443D1, GenBank:
XP_001636360.1) [11]. In this study, we cloned the
CYP74A88 gene from the Japanese buttercup (Ranunculus
japonicus) and characterized the properties of the encodꢀ
ed recombinant enzyme that was identified as epoxyalcoꢀ
hol synthase.
* To whom correspondence should be addressed.
171

172
TOPORKOVA et al.
Cloning of the CYP74A88 gene. Leaves (100 mg) of
MATERIALS AND METHODS
wildꢀgrowing Japanese buttercup (R. japonicus) plants
Materials. The following reagents were used: linoleꢀ were harvested, frozen, and homogenized by trituration
ic and αꢀlinolenic acids, type V soybean lipoxygenase, in liquid nitrogen. Total RNA from the leaves was isolatꢀ
methanol (HPLC grade) from SigmaꢀAldrich, USA; ed using a commercial RNeasy Plant Mini Kit (Qiagen,
sodium borohydride, silylation reagents, Nꢀnitrosoꢀ USA) and treated with DNase (Qiagen). RNA concenꢀ
tolueneꢀ4ꢀsulfomethylamide (used for diazomethane tration was determined using a Qubit fluorimeter
preparation), and isopropanol from Fluka, Switzerland. (Invitrogen) and a commercial QuantꢀiT™ RNA HS
Primers were synthesized by Evrogen (Russia). Assay Kit (Invitrogen). cDNA was synthesized on the isoꢀ
(9S,10E,12Z)ꢀ9ꢀHydroperoxyꢀ10,12ꢀoctadecadienoic lated RNA by reverse transcription using a MINT kit
(9ꢀHPOD) and (9S,10E,12Z,15Z)ꢀ9ꢀhydroperoxyꢀ (Evrogen). To obtain fragments of the CYP74A88 gene,
10,12,15ꢀoctadecatrienoic (9ꢀHPOT) acids were degenerate primers deg_F and deg_R (Table 1) compleꢀ
obtained by incubation of linoleiс and αꢀlinolenic acids mentary to the CYP74 gene sequences were used. PCR
(SigmaꢀAldrich, USA), respectively, with recombinant fragments of the expected size were purified, cloned into
lipoxygenase ZmLOX3 from the maize (Zea mays) the pGemꢀT vector (Promega, USA), and sequenced
(GenBank: AAG61118.1) [12] in Naꢀphosphate buffer with a 3130 Genetic Analyzer DNA sequencer (Applied
(100 mM, pH 6.0) at 0°C with continuous oxygen bubꢀ Biosystems, USA). The obtained sequences were anaꢀ
bling through the reaction mixture. (9Z,11E,13S)ꢀ lyzed using the BLAST program. The resulting central
Hydroperoxyꢀ9,11ꢀoctadecadienoic (13ꢀHPOD) and region of the hypothetical CYP74 gene was used to deterꢀ
(9Z,11E,13S,15Z)ꢀhydroperoxyꢀ9,11,15ꢀoctadecaꢀ mine the 5′ꢀ and 3′ꢀterminal sequences by the RACE
trienoic (13ꢀHPOT) acids were obtained by incubation of method (rapid amplification of cDNA ends) using a
linoleiс and αꢀlinolenic acids (SigmaꢀAldrich), respecꢀ SMARTTM RACE cDNA amplification kit (Clontech
tively, with the soybean lipoxygenase type V (Sigmaꢀ Laboratories Inc., USA). The fullꢀlength doubleꢀstrandꢀ
Aldrich, USA) in TrisꢀHCl buffer (50 mM, pH 9.0) at ed cDNA was used for two rounds of PCR with the 5′ꢀ
23°C with continuous oxygen bubbling through the reacꢀ and 3′ꢀterminal adapters and geneꢀspecific primer pairs
tion mixture. Extracted hydroperoxides (as free carꢀ Rj5R1/Rj5R2 and Rj3F1/Rj3F2 (Table 1) to amplify the
boxylic acids) were purified twice by normalꢀphase 5′ꢀ and 3′ꢀterminal regions of the target gene, respectiveꢀ
HPLC on two consecutive Kromasil Si columns (7 μm, ly. The obtained 5′ꢀ and 3′ꢀterminal fragments were
250 × 4.0 mm; Elsico, Russia) with isocratic elution (flow cloned into the pGemꢀT Easy vector (Promega) and
rate, 0.4 ml/min) with a hexane–isopropanol–acetic sequenced with
a 3130 Genetic Analyzer DNA
acid mixture (98.1 : 1.8 : 0.1; v/v). The obtained sequencer. Overlapping of the 5′ꢀ and 3′ꢀterminal fragꢀ
hydroperoxides were chromatographically pure and at ments and the central region of the target gene enabled
least 98% optically pure, as determined by chiralꢀphase the reconstruction of the fullꢀsize CYP74 gene. The
HPLC [13].
obtained 1548ꢀbp sequence encoding a 516ꢀa.a. protein
Bioinformatics methods. The search for nucleotide was amplified with Q5 polymerase (New Biolabs, UK)
and amino acid sequences of CYP74 clan enzymes was using the geneꢀspecific RjcF and RjcR primers (Table 1)
carried out in the NCBI databases (http://www.ncbi.nlm. and doubleꢀstranded cDNA as a template and then
nih.gov/entrez); the identified sequences were compared cloned into the pETꢀ23a vector (Novagen, USA) at the
using the BLAST program. Multiple alignments of amino NdeI and XhoI restriction sites.
acid sequences, nucleotide sequence analyses, and primer
design were performed with the Vector NTI Advance 9 pETꢀ23a vector with the cloned CYP74A88 gene was used
program (Invitrogen, USA). for the transformation of E. coli BL21(DE3)pLysS cells.
Purification of recombinant CYP74A88 enzyme. The
Table 1. Oligonucleotide primers used for CYP74A88 gene cloning
Primer
5'ꢀ3' sequence
Tm, °C
deg_F
deg_R
Rj3F1
Rj3F2
Rj5R1
Rj5R2
RjcF
CCAACATgCC(T/A)CC(T/g/C)ggCCC(C/T/A)TTC
gTCTC(A/C)(C/g)gC(T/C)C(A/g)TT(T/C)gACC
GCGTGGTTGGGTTCTGATGG
GTTTGGCGTGGTTGGGTTCTG
CCTGTTTCAATGCCTACGGTGG
CCCTCCAGCTCTAATCAAATCCAG
CATATGGCTACTTCAACATCTCTAGTC
CTCGAGCCCGTTTAAGAGACGTCAAAG
64ꢀ67
64ꢀ67
57.4
58.8
58.1
57.2
52
RjcR
63.2
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

EPOXYALCOHOL SYNTHASE FROM Ranunculus japonicus
173
The cells were grown in 2 ml of Luria–Bertani medium methyldisilazane–trimethylchlorosilane (v/v) for 30 min
[14] supplemented with one volume of M9 [15] (LB/M9 at 23°C. The silylation reagents were then removed in
medium) containing 500 mg/liter ampicillin and 35 mg/ vacuo. The dry residue was dissolved in 100 μl of hexane
liter chloramphenicol in a shaker incubator (Sanyo, and analyzed by gas chromatography/massꢀspectrometry
Japan) for 14 h at 37°C and then used for inoculation of (GCꢀMS) as methyl esters (Me) of trimethylsilyl (TMS)
1 liter of fresh LB/M9 medium containing ampicillin and derivatives (Me/TMS) using a QP5050A mass spectroꢀ
chloramphenicol. The cells were grown with intense aerꢀ meter connected to a GCꢀ17A gas chromatograph
ation (250 rpm) at moderate temperature (32°C) up to (Shimadzu, Japan). In some cases, the products were
OD600 of 0.6ꢀ0.8. The cell suspension was then rapidly reduced with NaBH4, then methylated and trimethylsilyꢀ
cooled to 20°C in an ice bath, and isopropylꢀβꢀDꢀ1ꢀthioꢀ lated. Some NaBH4ꢀreduced products were hydrogenated
galactopyranoside (IPTG) (SigmaꢀAldrich) was added to over PtO2 prior to trimethylsilylation.
a final concentration of 0.1 mM together with the heme
Spectral studies. The final products (with or without
precursor δꢀaminolevulinic acid (50 mg/liter). For the prior hydrogenation and reduction) were analyzed as Me
protein synthesis, the cells were incubated for another or Me/TMS by GCꢀMS by full spectral scanning of ions
14 h with moderate aeration (180 rpm) at reduced temꢀ in the m/z range from 50 to 650 as described previously
perature (20°C) and then collected by centrifugation in a [17] using a QP5050A mass spectrometer coupled with a
Z36HK centrifuge (Hermle, Germany) at 8000 rpm for GCꢀ17A gas chromatograph. The analyzed sample was
5 min at 4°C.
loaded into an MDNꢀ5S quartz column (5% phenyl, 95%
Cell lysates were obtained by mechanical disintegraꢀ methyl polysiloxane; 30,000 × 0.25 mm; film thickness,
tion of the pelleted cells with a French Press Cell 0.25 μm); the temperature gradient was 120ꢀ240°C at
Disrupter system (Thermo Scientific, USA). The recomꢀ 10°C/min; and helium was used as a carrier gas at a linear
binant protein was purified by metalꢀchelating affinity velocity of 30 cm/s. Full scanning or monitoring of
chromatography on BioꢀScale Mini Profinity IMAC colꢀ selected ions were performed using electron ionization
umn using a BioLogic LP chromatography system (Bioꢀ (70 eV) [17].
Rad, USA). The target protein was eluted with Naꢀphosꢀ
phate buffer (pH 7.0) containing 30 mM histidine. The
protein yield and the degree of purification were evaluatꢀ
ed by SDSꢀPAGE using PowerPac Universal
MiniProtean system (BioꢀRad). The gels were stained
RESULTS
a
Cloning of CYP74A88 gene and purification of the
with Coomassie Brilliant Blue R250 (SigmaꢀAldrich). recombinant enzyme. The absence of genomic data for the
The enzyme concentration was measured from the heme Japanese buttercup (R. japonicus) limits the possibility of
content [16].
detecting unknown genes in its mRNA transcriptome.
Kinetic studies of recombinant CYP74A88 enzyme. Currently, the use of degenerate oligonucleotide primers,
The enzymatic activity of the purified protein was deterꢀ partly or fully complementary to the target sequence, in
mined by monitoring the decrease in the optical absorpꢀ combination with various polymerase chain reaction variꢀ
tion of the reaction mixture at 234 nm using a PB 2201 B ants, is an efficient approach for searching target DNA
spectrophotometer (Solar, Belarus). The molar extinction and RNA sequences. The degenerate primers for identifiꢀ
coefficient of 9ꢀ and 13ꢀhydroperoxides of linoleic and αꢀ cation of CYP74 family genes were developed by us earliꢀ
linolenic acids at 234 nm is 25,000 M–1·cm–1. The subꢀ er for cloning the LuDES (CYP74B16) gene from flax [18]
strate concentration ranged from 7 to 300 μM. The pH based on the conserved amino acid sequences of the B′ꢀ
analysis of the enzymatic activity was carried out at 25°C helix (ANMPPGP) and the ERR triad (WSNGPE). As a
in Naꢀphosphate buffer (0.6 ml, 50 mM) at pH 6.0ꢀ8.0. template, we used the doubleꢀstranded cDNA obtained
The reaction rates were calculated from the initial linear by reverse transcription of the total RNA isolated from
parts of the kinetic curves. The kinetic parameters were the leaves of the Japanese buttercup plants. PCR with the
estimated based on the saturation binding oneꢀsite model degenerate primers deg_F and deg_R (Table 1) generated
using the SigmaPlot 11 software (Systat Software Inc., a set of amplification products approximately 1000 bp in
USA). For each variant, the averaged values from five length, which corresponded to the calculated length of
independent experiments were used for the calculations.
the central regions of the CYP74 genes when amplified
Analyses of CYP74A88 reaction products. The with these primers.
recombinant enzyme (10 μg) was incubated with 9ꢀ
The search for the amplified sequences in the NCBI
HPOD, 9ꢀHPOT, 13ꢀHPOD, and 13ꢀHPOT for 15 min database revealed that one of the obtained fragments posꢀ
at 4°C in 10 ml of 100 mM Naꢀphosphate buffer (pH 7.0), sessed a high degree of similarity with the CYP74A subꢀ
after which the pH of the mixture was adjusted to 6.0 and family sequences, including 13ꢀhydroperoxideꢀspecific
the products were extracted with a 1 : 1 hexane–ethyl allene oxide synthases.
acetate mixture (v/v), methylated with diazomethane,
and silylated with a 1 : 1 : 1 mixture of pyridine–hexaꢀ amplified gene, two geneꢀspecific forward (Rj3F1 and
To determine the 5′ꢀ and 3′ꢀterminal regions of the
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

174
TOPORKOVA et al.
Fig. 1. Nucleotide sequence of the CYP74A88 gene ORF. Start and stop codons are marked with grey color.
Rj3F2) and two reverse (Rj5R1 and Rj5R2) primers HPOT, 13ꢀHPOD, and 13ꢀHPOT as substrates. The
(Table 1) tandemly located on the cDNA decoded fragꢀ optimal pH value for the CYP74A88 enzyme catalytic
ment were used. To amplify the 5′ꢀ and 3′ꢀterminal activity was found to be pH 7.0 (Fig. 3), so all further
regions by RACE, nonspecific adapter sequences comꢀ experiments were performed at this pH value. The
plementary to the universal M1 primer were added to the CYP74A88 enzyme had the highest affinity toward 13ꢀ
5′ꢀ and 3′ꢀ ends of the template. The 5′ꢀ and 3′ꢀterminal
regions of the cDNA transcripts of the gene (or several
genes) of unknown enzyme were amplified, cloned into
the pGemꢀT vector, and sequenced. Since the 5′ꢀ and 3′ꢀ
terminal regions could correspond to the genes of differꢀ
ent enzyme isoforms, an additional round of amplificaꢀ
116 kDa
tion of the fullꢀlength cDNAs corresponding to the tranꢀ
scripts of the CYP74A subfamily genes was performed to
obtain complete open reading frame (ORF). For this purꢀ
66 kDa
pose, the RjcF and RjcR primers (Table 1) complementaꢀ
ry to the 5′ꢀ and 3′ꢀterminal regions were used. The
obtained amplicons were cloned into the pGemꢀT vector
and sequenced. The primers RjcF and RjcR contained
the NdeI and XhoI restriction sites that were used for
cloning of the amplified ORF into the pETꢀ23a expresꢀ
sion vector. Translation of the complete nucleotide
sequence of the CYP74A88 gene (Fig. 1) revealed the
presence of conserved motifs characteristic of the CYP74
enzymes, namely, the hydroperoxideꢀbinding motif, the
ERR triad, the PPV motif, and the conserved cysteine
residue.
The recombinant CYP74A88 was produced in E. coli
BL21(DE3)pLysS cells transformed with the pETꢀ23a
expression vector with the cloned CYP74A88 ORF and
purified by metalꢀchelating affinity chromatography (Fig.
2). The purified enzyme was used to study its catalytic
properties.
45 kDa
35 kDa
25 kDa
18 kDa
14 kDa
Fig. 2. Electrophoresis of fractions obtained during CYP74A88
enzyme purification: 1) BL21(DE3)pLysS cell lysate before
induction with IPTG; 2) BL21(DE3)pLysS cell lysate with the
recombinant CYP74A88 enzyme 14 h after IPTG addition;
3) purified preparation of the recombinant CYP74A88 enzyme;
M, SDSꢀPAGE standards, low range (BioꢀRad, USA).
Catalytic properties of the recombinant CYP74A88
enzyme. The catalytic properties of the recombinant
CYP74A88 enzyme were studied using 9ꢀHPOD, 9ꢀ
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

EPOXYALCOHOL SYNTHASE FROM Ranunculus japonicus
175
lowed by methylation and trimethylsilylation resulted in
the formation of a compound whose mass spectrum corꢀ
responded to that of 9,10ꢀepoxyꢀ11ꢀhydroxyoctadeꢀ
canoic acid (Me/TMS) [10]. Hence, the mass spectrum
data confirmed that compound 1 was 9,10ꢀepoxyꢀ11ꢀ
hydroxyꢀ12ꢀoctadecenoic acid. An additional product of
9ꢀHPOD conversion by CYP74A88 was a compound
whose mass spectrum (Me) exhibited [M – CO]+ at m/z
158 (12.67%), [M – OMe]+ at m/z 155 (15.51%), [M –
C8/C9]+ at m/z 143 (38.66%), 87 (63.16%), as well as the
methyl ester McLafferty rearrangement ion at m/z 74
(100%) (Fig. 4c), and matched the mass spectrum of 9ꢀ
oxononanoic acid (Me) [19].
Incubation of the CYP74A88 enzyme with 13ꢀ
HPOD resulted in the formation of the main product 2,
as well as three additional products having slightly longer
retention times than product 2 (Fig. 5a). The mass specꢀ
trum of product 2 exhibited M+ at m/z 398 (1.19%); [M –
Me]+ at m/z 383 (1.82%); [M – nꢀpentyl]+ at m/z 327
(2.54%); [M – MeOH]+ at m/z 367 (1.17%); m/z 163
(17.02%); [M – C12/C18]+ at m/z 285 (47.58%); and
[TMS]+ at m/z 73 (80.89%) (Fig. 5b). The fragmentation
profile confirmed that compound 2 was 11ꢀhydroxyꢀ
12,13ꢀepoxyꢀ9ꢀoctadecenoic acid (Me/TMS). Catalytic
hydrogenation of product 2 over PtO2 followed by methyꢀ
lation and trimethylsilylation resulted in the formation of
a compound whose mass spectrum corresponded to that
of 11ꢀhydroxyꢀ12,13ꢀepoxyoctadecanoic acid (Me/
TMS) [10], confirming the identification of product 2.
The minor peaks eluted after product 2 had identical mass
spectra profiles, thus being stereoisomers of compound 2
that differed mainly in stereo configuration at C11 or
C12. An additional product of CYP74A88 incubation
with 13ꢀHPOD with a longer elution time was compound
3 (Fig. 5a), whose electron mass spectrum exhibited
M+ at m/z 398 (1.17%); [M – Me]+ at m/z 383 (1.36%);
[M – MeOH]+ at m/z 367 (1.19%); [M – C1/C8]+ at
m/z 241 (8.38%); [M – C1/C12 + TMS]+ at m/z 173
(2.64%); CH2=O+–TMS at m/z 103 (6.96%); [M –
C1/C12 – H]+ at m/z 99 (14.05%); and [TMS]+ at m/z 73
(16.87%) (Fig. 5c). This spectrum corresponded to
(10E)ꢀ9ꢀhydroxyꢀ12,13ꢀepoxyꢀ10ꢀoctadecenoic acid
(Me/TMS) [20].
Fig. 3. The pH dependence of the recombinant CYP74A88
enzyme.
HPOD and exhibited the highest reaction rate with this
compound (Table 2). As seen from the kcat/Km ratio, the
CYP74A88 enzyme preferred linoleic acid hydroperoxꢀ
ides as substrates (Table 2). At the same time, CYP74A88
was inactive towards 9ꢀHPOT; 13ꢀHPOT appeared to be
a poor substrate for this enzyme (Table 2).
To identify the products of the CYP74A88ꢀcatalyzed
reactions, CYP74A88 was incubated with the hydroperꢀ
oxides (100 μg) for 15 min at 25°C in 10 ml of Naꢀphosꢀ
phate buffer (100 mM, pH 7.0). The reaction products
(Me/TMS) were analyzed by GCꢀMS.
Incubation of the recombinant CYP74A88 enzyme
with 9ꢀHPOD resulted in the formation of the main
product 1 (Fig. 4a). The mass spectrum of product 1
(Me/TMS) exhibited M+ at m/z 398 (1.16%); [M – Me]+
at m/z 383 (1.84%); [M – C1/C8]+ at m/z 241 (3.86%);
[M – C1/C9]+ at m/z 212 (6.57%); [M – C1/C10]+ at
m/z 199 (84.64%); and [TMS]+ at m/z 73 (94.98%) (Fig.
4b). The characteristic main peak at m/z 199 in the specꢀ
trum indicated the presence of oxiranyl carbinol group
with oxirane at C9/C10 and secondary alcohol (TMS) at
C11. Catalytic hydrogenation of product 1 over PtO2 folꢀ
Table 2. Kinetic parameters and substrate specificity of the recombinant CYP74A88 enzyme
Substrate
Parameter
13(S)ꢀHPOD
13(S)ꢀHPOT
9(S)ꢀHPOD
9(S)ꢀHPOT
Km, μM
59.8 5.8
161.2 14.1
2.7
199.2 21.5
17.4 3.4
0.1
139.2 15.3
93.0 10.0
0.7
n.d.
n.d.
0
kcat, s–1
kcat/Km, μM–1⋅s–1
Specificity, %
100
3.4
24.9
0
Note: n.d., not detected.
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

176
TOPORKOVA et al.
The catalytic activity of the CYP74A88 enzyme sponded to 11ꢀhydroxyꢀ12,13ꢀepoxyꢀ9,15ꢀoctadecaꢀ
towards 13ꢀhydroperoxide of αꢀlinolenic acid was much dienoic acid (Me/TMS). Catalytic hydrogenation of this
lower than towards linoleic acid hydroperoxides. compound over PtO2 followed by methylation and
Incubation of CYP74A88 with 13ꢀHPOT resulted in the trimethylsilylation led to the formation of a compound,
formation of a product whose mass spectrum exhibited whose mass spectrum matched that of 11ꢀhydroxyꢀ12,13ꢀ
[M – Me]+ at m/z 383 (1.71%); [M – pentenyl]+ at m/z epoxyoctadecanoic acid (Me/TMS). These results identiꢀ
327 (1.97%); [M – C12/C18]+ at m/z 285 (13.3%); m/z fied the product of 13ꢀHPOT conversion by the
155 (8.39%); m/z 129 (19.71%); and [TMS]+ at m/z 73 CYP74A88 enzyme as 11ꢀhydroxyꢀ12,13ꢀepoxyꢀ9,15ꢀ
(23.98%) (data not shown). This mass spectrum correꢀ octadecadienoic acid (Me/TMS).
a
9ꢀHOD
9ꢀoxoꢀ9:0
Retention time, min
b
c
Fig. 4. GCꢀMS analysis of products (Me/TMS) of CYP74A88 incubation with 9ꢀHPOD. a) Chromatogram of the reaction products. Product
1 is 9,10ꢀepoxyꢀ11ꢀhydroxyꢀ12ꢀoctadecenoic acid (Me/TMS). b) Massꢀspectrum and fragmentation scheme of product 1 (Me/TMS).
c) Massꢀspectrum and fragmentation scheme of 9ꢀoxononanoic acid (Me). 9ꢀHOD, (9S,10E,12Z)ꢀ9ꢀhydroxyꢀ10,12ꢀoctadecadienoic acid.
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

EPOXYALCOHOL SYNTHASE FROM Ranunculus japonicus
177
a
b
13ꢀHOD
Retention time, min
c
Fig. 5. GCꢀMS analysis of the products (Me/TMS) of CYP74A88 incubation with 13ꢀHPOD. a) Chromatogram of reaction products.
Product 2 is 11ꢀhydroxyꢀ12,13ꢀepoxyꢀ9ꢀoctadecenoic acid (Me/TMS). Product 3 is 9ꢀhydroxyꢀ12,13ꢀepoxyꢀ10ꢀoctadecenoic acid (Me/
TMS). b) Massꢀspectrum and fragmentation scheme of product 2 (Me/TMS). c) Massꢀspectrum and fragmentation scheme of product 3
(Me/TMS). 13ꢀHOD, (9Z,11E,13S)ꢀ13ꢀhydroxyꢀ9,11ꢀoctadecadienoic acid.
DISCUSSION
ether synthases were detected. Therefore, the CYP74A88
enzyme is a specific epoxyalcohol synthase (EC 5.3.99.ꢀ).
The GCꢀMS data and the kinetic parameters of the According to the accepted nomenclature of the CYP74
CYP74A88 enzyme from the Japanese buttercup indicatꢀ enzymes, this enzyme should be referred to as RjEAS (R.
ed that the products of reactions catalyzed by this enzyme japonicus epoxyalcohol synthase), a product of the correꢀ
are oxiranyl carbinols. No reaction products typical for sponding gene RjEAS. However, in further text, we will
allene oxide synthases, hydroperoxide lyases, or divinyl keep the name CYP74A88.
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

178
TOPORKOVA et al.
Only three epoxyalcohol synthases of the CYP74 CYP74M2 (SmEAS) of S. moellendorffii [6]. SmEAS
clan have been characterized so far, namely, CYP440A1 (CYP74M2) is 13ꢀhydroperoxideꢀspecific enzyme with
(BfEAS) from the lancelet B. floridae [9], CYP5164B1 the preference for 13ꢀHPOT as a substrate, whereas
(EsEAS) from the brown alga E. siliculosus [10], and CYP74A88 catalyzes conversion of linoleic acid
CYP443D1 (NvEAS) from the sea anemone (N. vectenꢀ hydroperoxides and prefers 13ꢀHPOD as a substrate.
sis) [11]. The CYP74A88 enzyme is the second true
Plant epoxyalcohol synthases, as well as EsEAS, synꢀ
epoxyalcohol synthase belonging to the CYP74 family. thesize mainly (9S, 10S, 11S)ꢀepimers of epoxyalcohols
The first epoxyalcohol synthase of this family is the (transꢀepoxides), whereas BfEAS and NvEAS produce
Fig. 6. Multiple alignment of amino acid sequences of CYP74A88 and allene oxide synthases of the CYP74A subfamily; HBD domain is
shown in the box with numbered (1 to 6) residues; inverted triangles, ERR triad; diamond, conserved cysteine residue of the hemeꢀbinding
domain; asterisk, respectively, F/L toggle [33]. Sequences: At, Arabidopsis thaliana, AtAOS, NP_199079.1; Le, Lycopersicon esculentum
(Solanum lycopersicum), LeAOS1, CAB88032.1; St, Solanum tuberosum, StAOS2, ABD15175.1; Lu, Linum usitatissimum, LuAOS, P48417.1;
Pa, Parthenium argentatum, PaAOS, Q40778.2.
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

EPOXYALCOHOL SYNTHASE FROM Ranunculus japonicus
179
(S, R, S)ꢀstereoisomers with the cisꢀepoxide. Experiꢀ enzymes: 13ꢀhydroperoxideꢀspecific allene oxide synꢀ
ments using 18O have shown that the epoxyalcohol synꢀ thases and 9/13ꢀhydroperoxideꢀspecific epoxyalcohol
thases are isomerases that incorporate both oxygen atoms synthases.
from the labeled 18O2 substrates [10, 11].
Two mechanisms of epoxyalcohol biosynthesis from
fatty acid hydroperoxides have been described. The first Funding
mechanism proceeds through the epoxidation of the
hydroperoxide double bond by the oxygen atom catalyzed
Experiments on the CYP74A88 gene cloning and
by peroxygenases [20ꢀ22] and other less studied plant purification of the recombinant enzyme were carried out
enzymes, such as beetroot enzyme [23]. The second with the financial support from the Russian Foundation
mechanism involves homolytic cleavage of the hydroperꢀ for Basic Research (project 16ꢀ34ꢀ60231). Experiments
oxide O–O bond, attack of the alkoxy radical, and forꢀ on the characterization of catalytic properties of the
mation of the epoxyallylic radical, that then undergoes recombinant CYP74A88 enzyme were carried out with
recombination with the hydroxyl radical resulting in the the partial financial support from the Russian Science
formation of oxiranyl carbinol. This rearrangement Foundation (project 16ꢀ14ꢀ10286).
occurs nonꢀenzymatically under the action of acids [24,
25], transition metals [26ꢀ30], hemoproteins [31], and
heat [32]. The same reaction is catalyzed by CYP74A88 Conflict of Interest
and CYP74 enzymes described above. Apparently, all
epoxyalcohol synthases catalyze formation of epoxyalcoꢀ
hols through the intramolecular rearrangement of
hydroperoxides; this mechanism was experimentally conꢀ
firmed for EsEAS [10] and NvEAS [11]. The epoxyalcoꢀ
hol synthase reaction proceeds through the following
stages: (i) homolysis of the hydroperoxide group; (ii)
rearrangement of the formed oxy radical with the formaꢀ
tion of the epoxyallylic radical; (iii) recombination of the
epoxyallylic radical with the hydroxyl radical resulting in
the epoxyalcohol formation.
The CYP74A88 enzyme exhibits a high degree of
similarity with the CYP74A subfamily enzymes (Fig. 6).
All CYP74A subfamily enzymes described previously are
13ꢀhydroperoxideꢀspecific allene oxide synthases. The
CYP74A88 is the first epoxyalcohol synthase that belongs
to the same subfamily according to the nomenclature criꢀ
teria. One of the catalytically essential domains in
CYP74A88 is the hydroperoxideꢀbinding domain (HBD,
earlier referred to as Iꢀhelix central domain) that correꢀ
sponds to the oxygenꢀbinding domain of classical
monooxygenases of the P450 superfamily. Its sequence is
almost identical to analogous domains in CYP74A
enzymes (Fig. 6), except for the alanine residue in the
fifth position, characteristic of the CYP74B subfamily
hydroperoxide lyases and CYP74C subfamily enzymes
with the double hydroperoxide lyase/epoxyalcohol synꢀ
thase activity [7].
The authors declare no conflict of interest.
REFERENCES
1. Blee, E. (1998) Phytooxylipins and plant defense reactions,
Prog. Lipid Res., 37, 33ꢀ72.
2. Grechkin, A. N. (1998) Recent developments in biochemꢀ
istry of the plant lipoxygenase pathway, Prog. Lipid Res., 37,
317ꢀ352.
3. Grechkin, A. N. (2002) Hydroperoxide lyase and divinyl
ether synthase, Prostaglandins Other Lipid Mediat., 68ꢀ69,
457ꢀ470.
4. Stumpe, M., and Feussner, I. (2006) Formation of oxylipꢀ
ins by CYP74 enzymes, Phytochem. Rev., 5, 347ꢀ357.
5. Brash, A. R. (2009) Mechanistic aspects of CYP74 allene
oxide synthases and related cytochrome P450 enzymes,
Phytochemistry, 70, 1522ꢀ1531.
6. Toporkova, Y. Y., Smirnova, E. O., Gorina, S. S.,
Mukhtarova, L. S., and Grechkin, A. N. (2018) Detection
of the first higher plant epoxyalcohol synthase: molecular
cloning and characterization of the CYP74M2 enzyme of
spike moss Selaginella moellendorffii, Phytochemistry, 156,
73ꢀ82.
7. Toporkova, Y. Y., Gorina, S. S., Bessolitsyna, E. K.,
Smirnova, E. O., Fatykhova, V. S., Bruhlmann, F., Ilyina,
T. M., Mukhtarova, L. S., and Grechkin, A. N. (2018)
Double function hydroperoxide lyases/epoxyalcohol synꢀ
thases (CYP74C) of higher plants: identification and conꢀ
version into allene oxide synthases by siteꢀdirected mutageꢀ
nesis, Biochim. Biophys. Acta, 1863, 369ꢀ378.
8. Nelson, D. R., Goldstone, J. V., and Stegeman, J. J. (2013)
The cytochrome P450 genesis locus: the origin and evoluꢀ
tion of animal cytochrome P450s, Philos. Trans. R. Soc.
Lond. B Biol. Sci., 368, 20120474.
9. Lee, D.ꢀS., Nioche, P., Hamberg, M., and Raman, C. S.
(2008) Structural insights into the evolutionary paths of
oxylipin biosynthesis enzymes, Nature, 455, 363ꢀ370.
10. Toporkova, Y. Y., Fatykhova, V. S., Gogolev, Y. V.,
Khairutdinov, B. I., Mukhtarova, L. S., and Grechkin, A.
N. (2017) Epoxyalcohol synthase of Ectocarpus siliculosus.
All subfamilies of the CYP74 family include several
types of enzymes: the CYP74B subfamily includes 13ꢀ
hydroperoxideꢀspecific hydroperoxide lyases and divinyl
ether synthases; the CYP74C subfamily – 9/13ꢀ
hydroperoxideꢀspecific allene oxide synthases and
enzymes with the double hydroperoxide lyase/epoxyalcoꢀ
hol synthase activity; the CYP74M subfamily – 13ꢀ
hydroperoxideꢀspecific divinyl ether synthases and
epoxyalcohol synthases. In this work, we demonstrated
that the CYP74A subfamily also includes two types of
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019

180
TOPORKOVA et al.
First CYP74ꢀrelated enzyme of oxylipin biosynthesis in
brown algae, Biochim. Biophys. Acta, 1862, 167ꢀ175.
22. Blee, E., Wilcox, A. L., Marnett, L. J., and Schuber, F.
(1993) Mechanism of reaction of fatty acid hydroperoxides
with soybean peroxygenase, J. Biol. Chem., 268, 1708ꢀ1715.
23. Hamberg, M., and Olsson, U. (2011) Efficient and specific
conversion of 9ꢀlipoxygenase hydroperoxides in the beetꢀ
root, formation of pinellic acid, Lipids, 46, 873ꢀ878.
24. Gardner, H. W., Weisleder, D., and Nelson, E. C. (1984)
Acid catalysis of a linoleic acid hydroperoxide: formation of
epoxides by an intramolecular cyclization of the hydroperꢀ
oxide group, J. Org. Chem., 49, 508ꢀ515.
25. Gardner, H. W., Nelson, E. C., Tjarks, L. W., and England,
R. E. (1984) Acidꢀcatalyzed transformation of 13(S)ꢀ
hydroperoxylinoleic acid into epoxyhydroxyoctadecenoic
and trihydroxyoctadecenoic acids, Chem. Phys. Lipids, 35,
87ꢀ101.
26. Gardner, H. W., Kleiman, R., and Weisleder, D. (1974)
Homolytic decomposition of linoleic acid hydroperoxide:
identification of fatty acid products, Lipids, 9, 696ꢀ706.
27. Gardner, H. W. (1975) Decomposition of linoleic acid
hydroperoxides. Enzymic reactions compared with nonenꢀ
zymic, J. Agr. Food Chem., 23, 129ꢀ136.
28. Gardner, H. W., and Jursinic, P. A. (1981) Degradation of
linoleic acid hydroperoxides by a cysteine FeCl3 catalyst as
a model for similar biochemical reactions: I. Study of oxyꢀ
gen requirement, catalyst and effect of pH, Biochim.
Biophys. Acta, 665, 100ꢀ112.
29. Gardner, H. W., and Kleiman, R. (1981) Degradation of
linoleic acid hydroperoxides by a cysteine FeCl3 catalyst as
a model for similar biochemical reactions: II. Specificity in
formation of fatty acid epoxides, Biochim. Biophys. Acta,
665, 113ꢀ125.
30. Dix, T. A., and Marnett, L. J. (1985) Conversion of linoleꢀ
ic acid hydroperoxide to hydroxy, keto, epoxyhydroxy, and
trihydroxy fatty acids by hematin, J. Biol. Chem., 260,
5351ꢀ5357.
31. Gardner, H. W. (1989) Oxygen radical chemistry of polyunꢀ
saturated fatty acids, Free Rad. Biol. Med., 7, 65ꢀ86.
32. Hamberg, M., and Gotthammar, B. (1973) A new reaction
of unsaturated fatty acid hydroperoxides: formation of 11ꢀ
hydroxyꢀ12,13ꢀepoxyꢀ9ꢀoctadecenoic acid from 13ꢀ
hydroperoxyꢀ9,11ꢀoctadecadienoic acid, Lipids, 8, 737ꢀ744.
33. Gorina, S. S., Smirnova, E.O., Mukhtarova, L. S.,
Toporkova, Y. Y., and Grechkin, A. N. (2018) Conversion
of tomato allene oxide synthase LeAOS3 (CYP74C3) into
epoxyalcohol synthase by siteꢀdirected mutagenesis, Dokl.
Biochem. Biophys, 483, 329ꢀ332.
11. Toporkova, Y. Y., Gorina, S. S., Mukhitova, F. K.,
Hamberg, M., Ilyina, T. M., Mukhtarova, L. S., and
Grechkin, A. N. (2017) Identification of CYP443D1
(CYP74 clan) of Nematostella vectensis as a first cnidarian
epoxyalcohol synthase and insights into its catalytic mechꢀ
anism, Biochim. Biophys. Acta, 1862, 1099ꢀ1109.
12. Wilson, R. A., Gardner, H. W., and Keller, N. P. (2001)
Cultivarꢀdependent expression of a maize lipoxygenase
responsive to seed infesting fungi, Mol. Plant Microbe
Iinteract., 14, 980ꢀ987.
13. Chechetkin, I. R., Osipova, E. V., Tarasova, N. B.,
Mukhitova, F. K., Hamberg, M., Gogolev, Y. V., and
Grechkin, A. N. (2009) Specificity of oxidation of linoleic
acid homologs by plant lipoxygenases, Biochemistry
(Moscow), 74, 855ꢀ861.
14. Glover, D. M. (1988) Gene Cloning. The Mechanics of DNA
Manipulation, Springer.
15. Maniatis, T., Fritsch, E., and Sambrook, J. (1984) The
Methods of Genetic Engineering. Molecular Cloning [Russian
translation], Mir, Moscow.
16. Schenkman, J. B., and Jansson, I. (2006) Spectral analyses
of cytochromes P450, Meth. Mol. Biol., 320, 11ꢀ18.
17. Grechkin, A. N., Bruhlmann, F., Mukhtarova, L. S.,
Gogolev, Y. V., and Hamberg, M. (2006) Hydroperoxide
lyases (CYP74C and CYP74B) catalyze the hemolytic isoꢀ
merization of fatty acid hydroperoxides into hemiacetals,
Biochim. Biophys. Acta, 1761, 1419ꢀ1428.
18. Gogolev, Y. V., Gorina, S. S., Gogoleva, N. E., Toporkova,
Y. Y., Chechetkin, I. R., and Grechkin, A. N. (2012) Green
leaf divinyl ether synthase: gene detection, molecular
cloning and identification of a unique CYP74B subfamily
member, Biochim. Biophys. Acta, 1821, 287ꢀ294.
19. Mukhtarova, L. S., Mukhitova, F. K., Gogolev, Y. V., and
Grechkin, A. N. (2011) Hydroperoxide lyase cascade in pea
seedlings: nonꢀvolatile oxylipins and their age and stress
dependent alterations, Phytochemistry, 72, 356ꢀ364.
20. Hamberg, M., and Hamberg, G. (1996) Peroxygenaseꢀcatꢀ
alyzed fatty acid epoxidation in cereal seeds (sequential
oxidation of linoleic acid into 9(S),12(S),13(S)ꢀtrihydroxyꢀ
10(E)ꢀoctadecenoic acid), Plant Physiol., 110, 807ꢀ815.
21. Hamberg, M., and Hamberg, G. (1990) Hydroperoxideꢀ
dependent epoxidation of unsaturated fatty acids in the
broad bean (Vicia faba L.), Arch. Biochem. Biophys., 283,
409ꢀ416.
BIOCHEMISTRY (Moscow) Vol. 84 No. 2 2019