Hybridization-dependent fluorescence of oligodeoxynucleotides incorporating new pyrene-modified adenosine residues

Article abstract of DOI:10.1016/j.bmc.2008.05.042

We report the synthesis and properties of oligonucleotides incorporating N⁶-[N-(pyren-1-ylmethyl)carbamoyl]-deoxyadenosine (dA^pymcm). We designed the ODN which incorporated two consecutive dA^pymcm residues. It was revealed

Full text of DOI:10.1016/j.bmc.2008.05.042

Bioorganic & Medicinal Chemistry 16 (2008) 8287–8293
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Hybridization-dependent fluorescence of oligodeoxynucleotides
incorporating new pyrene-modified adenosine residues
*
Kohji Seio, Masanhiro Mizuta, Kaori Tasaki, Keigo Tamaki, Akihiro Ohkubo, Mitsuo Sekine
Department of Life Science, Tokyo Institute of Technology and CREST, JST Nagatsuda, Midoriku, Yokohama 226-8501, Japan
a r t i c l e i n f o
a b s t r a c t
We report the synthesis and properties of oligonucleotides incorporating N6-[N-(pyren-1-ylmethyl)car-
bamoyl]-deoxyadenosine (dApymcm). We designed the ODN which incorporated two consecutive dApymcm
residues. It was revealed that on hybridization with the target DNA and RNA oligomers, the fluorescence
spectra of ODNs having two consecutive dApymcm molecules near the 50-terminal position can change
from the pyrene monomer emission to the excimer, depending on the chain length of the target DNA
and RNA. These results indicated that dApymcm-modified ODNs can be used as interesting hybridization
sensors that are sensitive to the size of the target strand.
Article history:
Received 22 February 2008
Revised 16 May 2008
Accepted 16 May 2008
Available online 22 May 2008
Keywords:
Pyrene
Fluorescence
ODN
Ó 2008 Elsevier Ltd. All rights reserved.
Size discrimination
O
1. Introduction
HN
N
N
H
Fluorescent oligodeoxynucleotides (ODNs) with pyrene resi-
dues have been widely used as molecular probes for the hybridiza-
tion and structure modification of functional nucleic acids.1–13
Pyrene modifications have attracted attention because of the
chemical stability and large solvatochromic effect of pyrene resi-
dues.1–5,14 Moreover, two pyrene residues introduced in close
proximity to each other can form a pyrene excimer that has a un-
ique fluorescence absorbance around 480 nm.6–13
dApymcm
N
N
N
HO
O
OH
Figure 1. Structure of dApymcm
.
For example, Okamoto et al. reported purine and pyrimidine
nucleoside derivatives having a pyrene residue at position 5 of
pyrimidine bases, and demonstrated their photochemical base
discrimination.5 In addition, Yamana and co-workers reported
oligonucleotides incorporating a uridine residue having a pyre-
nylmethyl group at the 20-hydroxyl group and developed an
RNA-selective hybridization sensor4 and dipyrenyl-labeled ODNs
for SNPs analysis.8 Apart from such modifications at the sugar moi-
ety and aromatic rings of nucleobases, we have researched the
functionalization of the amino group of nucleosides15 because a
functional group at the amino groups can interact with comple-
mentary strands or their upstream and downstream bases through
stacking interactions.15,16 In this study, we report the preparation
of a deoxyadenosine derivative (dApymcm) having a pyrenylmeth-
ylcarbamoyl group attached to the amino group (Fig. 1), and the
synthesis and properties of ODNs incorporating this modified
deoxynucleoside.
These modified ODNs showed interesting fluorescence proper-
ties upon hybridization with complementary DNA or RNA strands.
Moreover, it was revealed that on hybridization with the target
DNA and RNA oligomers, the fluorescence spectra of ODNs having
two consecutive dApymcm molecules near the 50-terminal position
can change the ratio of the pyrene monomer’s emission at around
400 nm and the excimer’s at around 480 nm, depending on the
chain length of the target DNA and RNA. These results indicated
that dApymcm-modified ODNs can be used as interesting hybridiza-
tion sensors that are sensitive to the size of the target strand.
2. Results and discussion
2.1. Synthesis of oligodeoxynucleotides incorporating dApymcm
The phosphoramidite unit of dApymcm (3) was synthesized as
shown in Scheme 1. Pyrenylmethylamine hydrochloride was cou-
pled with 1.2 equiv of 4-nitrophenyl chloroformate in the presence
* Corresponding author. Tel.: +81 45 924 5706; fax: +81 45 924 5772.
E-mail address: msekine@bio.titech.ac.jp (M. Sekine).
0968-0896/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2008.05.042

8288
K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
2.5 equiv
Pyr
1.8 equiv
HCl
NH2
Ade
Et3N
RO
NO2
O
Adepymcm
O
O
3.5 equiv
Et3N-3HF
RO
Adepymcm
O
1.2 equiv
Cl
HO
OR
O
CH2Cl2, rt
30 min
OR
THF, rt
14 h
Pyr, 120 °C
5 h
OH
1
78%
R =
t-butyldimethylsilyl
1.5 equiv
Adepymcm
CEO
N(i-Pr)2
O
N
P
Adepymcm
1.2 equiv
DMTrCl
Cl
Adepymcm
HN
N
H
DMTrO
CEO
O
DMTrO
1.8 equiv
O
N
N
EtN(i-Pr)2
Pyr, rt
8 h
O
P
3
OH
CH2Cl2, rt
overnight
N
(i-Pr)2N
2
85%
70%
Scheme 1. Synthesis of the pyrene-modified deoxyadenosine derivatives.
of 2.5 equiv of pyridine to give the activated carbamate, which was
subsequently condensed with 5 equiv of 20,30-O-bis(tert-butyldi-
methylsilyl)deoxyadenosine to give desired pyrene-modified sily-
are listed in Scheme 2. ODN1 and ODN2 are the oligodeoxynucleo-
tides incorporating
dApymcm residue and two consecutive
a
dApymcm residues in the middle of the strand, respectively. ODN3
incorporates two consecutive dApymcm residues in the site close
to the 50-terminus of the strand. The target-DNA and target-RNA
which are the oligonucleotides used in the hybridization experi-
ments with ODN1, ODN2, and ODN3 are also shown in Scheme 2.
First, the hybridization property of ODN1, 50-d(TTTCTCdA
pymcmTTCTCT)-30, was studied using the target-ODNs, 30-d(AAAG
AGXAAGAGA)-50, where X = T (1a), A (1b), G (1c), or C (1d) as
shown in Scheme 2. The UV-melting experiments revealed the
melting temperatures (Tm) of 40 °C for X = T (target-ODN-1a),
38 °C for X = A (-1b) 40 °C for X = G (-1c), and 38 °C for X = C
(-1d). These nearly equal Tm values for all the four nucleobases at
the X position indicated that dApymcm does not form the base pair
with thymidine and does not discriminate any nucleobase at the
base-pairing position in the opposite strand like the universal
bases because the N1 position of the adenine base was blocked
from the base pairing by the intramolecular hydrogen bond with
the NH group of the carbamoyl group as shown in Figure 1.15,16
lated deoxyadenosine derivative
1 in 78% yield. The tert-
butyldimethylsilyl groups were removed by treatment with 3.5
equiv of triethylamine trihydrofluoride in the presence of 1.8 equiv
of triethylamine to give a 30,50-free derivative, which in turn was
treated with 1.2 equiv of DMTrCl to give the protected nucleoside
2 in 85% yield. Finally, the 30-hydroxyl group was phosphitylated
according to the usual procedure to give the phosphoramidite 3.
Using phosphoramidite 3, ODNs incorporating dApymcm were
synthesized. The nucleotide sequences of the synthesized ODNs
ODN1: d(TTTCTC[Apymcm]TTCTCT)
ODN2: d(TTCTCTTTTCT[Apymcm][Apymcm]TTCTCTTTCTCT)
ODN3:d(CTC[Apymcm][Apymcm]TATACAACCT)
Counter strands for ODN1
Target-DNA-1a: d(AGAGAATGAGAAA)
1b: d(AGAGAAAGAGAAA)
1c: d(AGAGAAGGAGAAA)
2.2. Fluorescent properties of ODN1 in single and double strand
states
1d: d(AGAGAACGAGAAA)
Next, we studied the fluorescence properties of ODN1 in the
single- and the double-stranded states formed with the four coun-
ter strands, target-DNA-1a, 1b, 1c, and 1d. As shown in Figure 2,
the fluorescence intensity was weakest in its single-stranded state.
When the target strands were added, the intensities increased
depending on the opposite base (X) in the order of X = A (target-
DNA-1b) > T (-1a) > G (-1c) > C (-1d). It is well known that pyrene
derivatives become more emissive in aqueous media than in non-
aqueous media.1–5,14 Therefore, larger fluorescence intensities of
the double strands compared to the single strand indicated that
the pyrene residue exposed in the surrounding aqueous media in
the duplex state than in the single strand state. It was also ob-
served that the fluorescence intensity of pyrene was quenched by
interaction with the nucleobases at position X, and the quenching
was most significant in the interaction with cytosine and least sig-
nificant with adenine. Therefore, the fluorescence intensities could
be partly explained by the interaction with the base opposite to
dApymcm. The small fluorescence intensities of the G-counter strand
Counter strands for ODN2
Target-DNA-2a: d(AGAGAAAGAGAATGAGAAAAGAGAA)
2b: d(AGAGAAAGAGAAAGAGAAAAGAGAA)
2c: d(AGAGAAAGAGAAGGAGAAAAGAGAA)
2d: d(AGAGAAAGAGAACGAGAAAAGAGAA)
Target-RNA-2a: r(AGAGAAAGAGAAUGAGAAAAGAGAA)
2b: r(AGAGAAAGAGAAAGAGAAAAGAGAA)
2c: r(AGAGAAAGAGAAGGAGAAAAGAGAA)
2d: r(AGAGAAAGAGAACGAGAAAAGAGAA)
Counter strands for ODN3
Short DNA: 5'-d(AGGTTGTATA)-3'
Long DNA: 5'-d(AGGTTGTATAGGGAG)-3'
Short RNA: 5'-r(AGGUUGUAUA)-3'
Long RNA: 5'-d(AGGUUGUAUAGGGAG)-3'
Scheme 2. Sequences of ODNs incorporating dApymcm and the hybridization targets.

K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
8289
Figure 2. Fluorescence spectra of ODN1 (2.0 lM) in the absence (ss) or the presence
of thetarget-DNA, 50-d(AGAGAAXGAGAAA)-30 where X = T (target-DNA-1a), A (-
1b), G (-1c), or C (-1d) measured at 20 °C.
Figure 3. Fluorescence spectra of ODN2 (1.0
l
M) in the presence or the absence
(ss) of the 50-d(AGA GAA AGA GAA XGA GAA AAG AGA A)-30 (X = A, T, G, or C)
measured at 20 °C.
is probably due to the charge transfer from the guanine to pyrene
producing the guanine radical cation. The C- and T-counter strands
probably promote an electron transfer from the pyrene to the C or
T producing the cytosine and thymine radical anion as indicated by
the previous report on the dependence of the pyrene fluorescence
on the redox behavior of the DNA bases.17
2.3. Fluorescent properties of ODN2 in the single and double
strand state
Next, we examined the fluorescence properties of ODN2 having
two consecutive dApymcm residues. We expected excimer formation
depending on the hybridization. In these experiments, the DNA se-
quences target-DNA-2a, 2b, 2c, 2d, 50-d(AGAGAAAGAGAAXGAG
AAAAGAGAA)-30, where X = A (-2a), T (-2b), G (-2c), or C (-2d),
were used as the targets. In these sequences, the nucleotide resi-
due positioned at the opposite site to the second dApymcm residue
of the 50-dApymcmdApymcm-30 dimer was arbitrarily fixed to guanine
as indicated by the underline in the sequence, because no base
discrimination was observed for dApymcm residue as indicated by
the Tm analyses. In the single-stranded state, the fluorescence spec-
trum of ODN2 showed a peak at around 490 nm, which corre-
sponded to the excimer of the two pyrenes. Very small peaks
corresponding to those of the monomer were also detected at
around 400 nm. Interestingly, upon addition of the target strands,
the intensity of the monomer peaks increased. These results can
be explained as follows. In the flexible single-stranded state, the
two dApymcm residues could change the conformation rather freely.
Therefore, the two hydrophobic pyrene rings could stack on each
other to avoid the contact with the aqueous media, thus giving
the excimer peak. When the duplexes were formed, one of the
dApymcm residues or both the dApymcm residues intercalated in the
duplex, and the interaction between the two pyrene residues was
released. As a result, the dApymcmdApymcm site can serve as an indi-
cator of hybridization by measuring the fluorescence intensity at
around 400 nm.
We also examined the hybridization-dependent fluorescences
of ODN2 by changing the hybridization target to the RNAs such
as Target-RNA-2a to 2d: 50-r(AGA GAA AGA GAA XGA GAA AAG
AGA A)-30, where X = U (-2a), A (-2b), G (-2c), or C (-2d). The results
are shown in Figure 4. In contrast to the case of the ODN2–DNA
duplexes, the addition of the target RNA strands leads to an
increase in both the monomer and the excimer peaks although
increase ratio of the monomer peaks and the excimer peaks dif-
fered depending on the nucleobase at position X. This simulta-
neous increase of both monomer and the excimer peaks was in
clear opposition to that shown in Figure 3, wherein the monomer
peak increased on addition of the target DNAs.
Figure 4. Fluorescence spectra of ODN2 (0.4 lM) measured at 20 °C in the presence
or the absence of the RNA targets 50-r(AGA GAA AGA GAA XGA GAA AAG AGA A)-50
(X = A, U, G or C).
The presence of both the excimer peaks and the monomer peaks
of the ODN2–RNA duplexes indicated that the two pyrene residues
are in the equilibrium between the monomers and a stacked dimer.
This result suggested that the intercalation of the pyrene into the
duplexes became less favorable because the A-type ODN2–RNA
duplexes were more rigid than the B-type conformation of the
ODN2–DNA duplexes. Similar, DNA–DNA duplex selective interca-
lation of the pyrene moiety introduced to the 20-position of probe
ODN was also reported.4
2.4. Fluorescent properties of ODN3 in the hybridization with
DNA and RNA targets having different size
Next, we examined the fluorescent properties of 15mer ODN3:
d(CTC[Apymcm][Apymcm]TATACAACCT) which incorporate the two
consecutive dApymcm residues at the positions close to the 50-termi-
nus. The experiments were designed as described below. The
15mer ODN3 having the dApymcmdApymcm near the 50-terminus
was synthesized. As the hybridization targets, the 10mer short-
DNA: 50-d(AGGTTGTATA)-30 which is complementary to the
50-TATACAACCT-30 part of ODN3 and the 15mer long-DNA:
50-d(AGGTTGTATAGGGAG)-30 which included the additional five
nucleotides at the 30-termini of short-DNA. Each of the short-
DNA and long-RNA was added to a solution containing ODN3,
and the fluorescence properties of the dApymcmdApymcm part
were monitored. In the single strand state, ODN3 gave both the
monomer’s and excimer’s peaks at around 400 nm and 490 nm,

8290
K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
The size-dependent fluorescence of ODN3 would be more useful
if it could discriminate the RNA targets rather than DNA targets. In
living cells, many small functional RNAs need to be processed from
the long precursor RNAs transcribed from the genome. The pro-
cessing of the miRNA from the pre-miRNA is a good example.18–20
In the analyses of such functional RNAs, both the sequence and
the size of the RNAs must be important in distinguishing the al-
ready processed functional miRNA from the non-functional
pre-miRNAs.21 Therefore, we studied the fluorescence of ODN3
when hybridized to the 10mer short-RNA: 30-AUAUGUUGGA-50,
and the 15mer tlong-RNA: 30-GAGGGAUAUGUUGGA-50. The
results are shown in Figure 6.
In this case, the target dependence of the fluorescence of ODN3
was quite different from that observed using the DNA target shown
in Figure 5. In the single-stranded state, ODN3 gave the fluores-
cence of the excimer as already shown in Figure 5. In the presence
of the long-RNA target both the monomer and the excimer peaks
were observed similarly. In contrast, in the presence of the
short-RNA target, the emission of the excimer decreased while
that of the monomer increased. These results suggested the ratio
of the monomer peak at around 400 nm, and the excimer peak at
490 nm of ODN3 can be used as an indicator of the chain length
of the RNA targets at their 30-terminal region.
The unique fluorescence properties of ODN3 in the presence of
the RNA targets could not simply be explained from the results
shown in Figure 4. The presence of both the excimer and monomer
peaks in the case of ODN3 + long-RNA is similar to the case of the
hybridization-dependent fluorescence of ODN2 and RNA targets
shown in Figure 4. However, while the fluorescence intensities of
ODN2 were higher in the presence of the targets strands than in
the single strand state, those of ODN3 + long-RNA were smaller
than those in the single strand state of ODN3. Moreover, the in-
crease in the monomer peaks and the decrease of the excimer peak
in the duplex with the short-RNA target could not be expected at
all from Figure 4. The increase of the monomer peak and the de-
crease of the excimer peak indicated that at lease one of the pyrene
residues could intercalate to the nearby base pair so that the
stacked pyrene dimer was dissociated to produce the monomer
emission especially when the nearby base pair was rather fragile
terminal base pair. Although more detailed structural studies are
required, the results observed here showed that the conformation
of the dApymcmdApymcm site of ODN3 was very sensitive to the
structure of the nearby sites so that the fluorescence properties
of this site became sensitive to the chain length of the RNA targets
at their 30-terminal region.
Figure 5. Fluorescence spectra of ODN3 (0.7 lM) measured at 10 °C in the presence
or the absence of the target DNA. short, ODN3 + 10mer short-DNA; long, OD-
N3 + 15mer long-DNA; ss, ODN3.
respectively, as shown in Figure 5. The relative intensities of the
monomer’s peak and the excimer’s peak of the single-stranded
ODN3 were somewhat different from that of ODN2 in which the
dApymcmdApymcm dimer was introduced at the central position of
the strand. This result suggests that the two pyrene residues in
ODN2 were more tightly fixed in the stacked conformation than
in ODN3 probably because the dApymcmdApymcm dimer can move
more freely near the 50 terminal site than in the central position.
As shown in Figure 5, the fluorescence spectrum in the presence
of short-DNA showed both the excimer peak and the monomer
peaks as in the case of the single-stranded ODN3. On the other
hand, the excimer peak disappeared and the monomer peaks be-
came significantly larger in the duplex with the long-DNA.
The results showed that ODN3 could discriminate the target
DNA which was shorter than itself from the longer target at the
50-terminal region. This size-dependent fluorescence could be
explained as follows. In the duplex with the 10mer short-DNA tar-
get, the dApymcmdApymcm site existed as the single strand because
dApymcmdApymcm was located at the 11th and 12th positions from
the 30-terminus. In this case, the excimer peak was observed, as
described in Figure 3. In contrast, the dApymcmdApymcm site was
present as the duplex to give the monomer peak when ODN3
was bound to the 15mer long-DNA target. These results clearly
showed an interesting property of ODN3 that it changed its fluo-
rescence when the 50-terminal region dangled. Similar increase of
the monomer’s peak of the bis-pyrene-modified oligodeoxynucleo-
tides upon binding to the longer DNA was already reported by
Yamana et al.8
2.5. CD and UV spectra of duplexes containing ODN3
In order to obtain the structure property of the duplexes of
ODN3 and the targets we measured the CD spectra of ODN3 +
short-DNA and ODN3 + long-DNA (Fig. 7). As shown in Figure 7,
the duplex with short-DNA gave the spectrum of a standard B-type
duplex giving a positive peak at 280 nm and a negative peak at
240 nm. In addition a small peak which could be assigned to that
of the pyrene residues was observed at around 370 nm. Interest-
ingly, when ODN3 formed a duplex with the long-DNA, the posi-
tive peak and the negative peak shifted to shorter wave lengths
and a new positive peak appeared at 290 nm. In addition, the signal
from the pyrene residues increased and shifted to a shorter wave
length slightly. These observations suggested that the B-type struc-
ture was distorted by the steric hindrance of the pyrenylmethyl
group when ODN3 bound to long-DNA.
We also measured the CD spectra of ODN3 + short-RNA and
ODN3 + long-RNA (Fig. 8). In these cases, both spectra showed that
the A-type duplexes gave a positive peak at 270 nm and a negative
peak at 210 nm. The pyrene residues gave only small peaks at
Figure 6. Fluorescence spectra of ODN3 (1.0 lM) measured at 10 °C in the presence
or the absence of the target RNA. short, ODN3 + short-RNA; long, ODN3 + long-
RNA; ss, ODN3.

K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
8291
Figure 10. UV spectra of ODN3 (2.0
l
M) measured at 10 °C in the presence of the
target DNA. ss, ODN3; short, ODN3 + short-RNA; long, ODN3 + long-RNA.
Figure 7. Fluorescence spectra of ODN3 (2.0
lM) measured at 10 °C in the presence
of the target DNA. short, ODN3 + short-DNA; long, ODN3 + long-DNA.
slight blue-shift (ca. 1 nm) in these two duplexes (Fig. 9). There-
fore, the interactions between the pyrene residues and the nucleo-
bases did not seem to be the p–p stack interaction. In the case of
the duplexes with the RNA targets (Fig. 10), the spectra of ODN3 +
long-RNA were almost identical to that of ODN3 + long-DNA at
the 300–380 nm region despite a difference in the fluorescent
spectra between them. Similarly to the case of ODN3 +
short-DNA, the peak hight at 350 nm was lowered and broadened
in the case of ODN3 + short-RNA.
3. Conclusion
In this study, we report oligonucleotides incorporating dApymcm
.
The ODN1 singly modified by dApymcm showed hybridization-
dependent fluorescence increase depending on the nucleobases
positioned at the opposite site of dApymcm. When two dApymcm res-
idues were incorporated consecutively in the middle of ODN such
as ODN2, the ODN showed hybridization induced increase of the
fluorescence depending on the targets strand. ODN2 gave the pyr-
ene excimer’s fluorescence peak in its single strand state. When it
bound to the target DNAs, as a rule-of-thumb, the excimer’s peak
reduced and pyrene monomer’s peak increased. When it bound
to the target RNAs both the excimer’s and monomer’s peak were
observed.
Figure 8. Fluorescence spectra of ODN3 (2.0 lM) measured at 10 °C in the presence
or the absence of the target RNA. ss, ODN3; short, ODN3 + short-RNA; long, OD-
N3 + long-RNA.
370 nm which suggested less effective interaction between the
pyrene residues and the nucleobases.
In this study, we also designed ODN3 which incorporated two
consecutive dApymcm residues to demonstrate the size discrimina-
tion of the target strands by hybridization. The behavior of ODN3
when it bound to the 10mer and 15mer DNA targets was the one
expected from the behavior of ODN2 and another bis-pyrenyl-
modified ODNs reported previously.8 Therefore, such fluorescence
properties might be common to modified oligonucleotides having
two pyrene groups at nearby positions. In contrast, the behavior
when it bound to 10mer and 15mer RNAs are more complicated
but interesting. The ODN3 gave both excimer’s and monomer’s
fluorescence in the single strand state and when bound to the
15mer RNA. In contrast, it gave mainly the monomer’s peak when
bound to the shorter RNA. We could not explain at this time this
behavior of ODN3 on the basis of detailed structure of the duplexes
of ODN3 and the RNA targets. The prediction of the duplex struc-
tures including dApymcm dimer does not seem simple. Because
the adenine part and the pyrene part are not in a plane in the en-
ergy minimized structure due to the presence of a sp3 hybridized
carbon atom between the pyrene ring and the carbamoyl group
(Fig. 11), the intercalation of the pyrene ring is likely accompanied
by some conformation changes of the strands and the nucleoside
backbones. Such conformation changes must be analyzed by use
of 2D NMR or other techniques in detail and are not clarified yet.
However, the behaviors of ODN3 are very interesting and
might be useful for the design of new oligonucleotide probes
It is well known that the stacking between the nucleobases and
the pyrene residue could be monitored by the UV absorption max-
ima of the pyrene residue. When the UV spectra of ODN3 + long-
DNA and ODN3 + short-DNA are compared, the peak at 350 nm
was lower and broader in the case of the duplex with short-
DNA, but the peak positions were almost identical showing only
Figure 9. UV spectra of ODN3 (2.0
lM) measured at 10 °C in the presence of the
target DNA. short, ODN3 + short-DNA; long, ODN3 + long-DNA.

8292
K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
HRMS calcd for
737.3630.
C
40H52N6O4Si2 (M+H+) 737.3766. Found
4.2. 50-O-(4,40-Dimethoxytrityl)-N6-[N-(pyren-1-
ylmethyl)carbamoyl]-deoxyadenosine (2)
Compound 1 (3.3 g, 4.5 mmol) was dissolved in THF (23 mL). To
this solution were added triethylamine trihydrofluoride (2.6 mL,
16 mmol) and triethylamine (1.1 mL, 8.2 mmol). After being stirred
at ambient temperature for 14 h, the solvents were removed under
reduced pressure. The residue was chromatographed on silica gel
column to give the crude material of the nucleoside. The material
was rendered anhydrous by the co-evaporation with dry pyridine
three times. The residue was dissolved in dry pyridine (45 mL)
and 4,40-dimethoxytritylchloride (1.8 g, 5.4 mmol) was added.
After being stirred at ambient temperature for 5 h, the reaction
was quenched by adding water (5 mL). The solvents were evapo-
rated under reduced pressure, and the residue was dissolved in
ethyl acetate (100 mL). The solution was washed three times with
saturated aqueous NaHCO3 (100 mL each), dried over Na2SO4, and
concentrated under reduced pressure. The residue was chromato-
graphed on a silica gel column with chloroform/methanol (100:1,
v/v) containing 0.5% triethylamine to give 2 (3.1 g, 85%). 1H NMR
(CDCl3, 500 MHz) d 2.49–2.54 (1H, m), 2.76–2.83 (2H, m), 3.35–
3.42 (2H, m), 3.71 (6H, s), 4.15–4.18 (1H, dd, J = 4.4, 4.2 Hz),
4.66–4.48 (1H, m), 5.34–5.36 (2H, t, J = 5.1 Hz), 6.40–6.43 (1H,
m), 6.75–6.77 (4H, m), 7.15–7.18 (1H, t, , J = 7.3 Hz), 7.21–7.24
(2H, m), 7.28 (4H, d, J = 2.2 Hz), 7.37–7.38 (2H, d, J = 7.3 Hz),
8.00–8.03 (1H, t, J = 7.6 Hz), 8.05 (2H, s), 8.10–8.12 (1H, d,
J = 8.5 Hz), 8.14–8.20 (4H, m), 8.39–8.40 (1H, d, J = 9.0 Hz), 8.51
(1H, s), 10.10 (1H, m); 13C NMR (CDCl3) d 40.2, 42.5, 55.3, 63.7,
72.5, 84.6, 86.2, 86.7, 113.3, 120.9, 123.0, 124.9, 125.0, 125.1,
125.4, 125.4, 126.1, 126.7, 127.1, 127.5, 127.5, 128.0, 128.2,
129.0, 130.1, 130.9, 131.1, 131.4, 131.7, 135.7, 135.7, 141.3,
144.6, 150.0, 150.2, 151.1, 154.0, 158.7; HRMS calcd for
Figure 11. The energy minimized structure of 9-N-methyl-N6-(N-pyrenylmethylc-
arbamoyl)adenine calculated at the HF/6-31G** level by use of GAUSSIAN03
program.22
which can recognize both the sequence and the size of RNA tar-
gets. Such probes seem useful for the detection of the functional
RNAs such as miRNAs, which are transcribed from genome DNAs
and work after being processed to short RNA fragments. Cur-
rently, the differences in the fluorescence intensity between
ODN3/long-RNA duplexes and ODN3/short RNA duplexes were
not sufficient in terms of the sensitivity to achieve the discrimina-
tion of matured miRNAs and pre-miRNAs in living cells. In addi-
tion, the dependence of the fluorescences on the probe and
target sequences must be also clarified to be applied to the large
scale RNA detection. However, the dynamic properties of the pyr-
ene residues found in this study in combination with more sensi-
tive fluorescent dyes might be useful for the development of
more sensitive fluorescent probes capable of the target size dis-
crimination. Further studies are being conducted on the improved
design of new oligonucleotide probes based on the results of this
study and will be reported later.
C
44H44N6O6 (M+H+) 833.3058. Found 833.3093.
4. Experimental
4.1. 30,50-O-Bis(tert-butyldimethylsilyl)-N6-[N-(pyren-1-
ylmethyl)carbamoyl]-deoxyadenosine (1)
4.3. 50-O-(4,40-Dimethoxytrityl)-N6-[N-(pyren-1-
ylmethyl)carbamoyl]deoxyadenosine 30-(2-cyanoethyl N,N-
diisopropylphosphoramidite) (3)
To the suspension of (pyren-1-ylmethyl)amine (2.7 g,
10.0 mmol) in CH2Cl2 (100 mL) were added pyridine (2.0 mL,
25 mmol) and 4-nitrophenyl chloroformate (2.4 g, 12 mmol).
The resulting mixture was stirred at ambient temperature for
1 h, and the reaction was quenched by the addition of water
(3 mL). The solution was washed twice with saturated aqueous
NaHCO3 (100 mL each) and the organic layer was dried over
Na2SO4, filtered, and evaporated under reduced pressure. To
the residue were added dry pyridine (50 mL) and 30,50-O-bis
(tert-butyldimethylsilyl)-deoxyadenosine (13.7 g, 30.0 mmol),
and the mixture was stirred at 120 °C for 2 h. After the solution
was cooled to the ambient temperature, it was diluted with
ethyl acetate (100 mL). The solution was washed five times with
saturated aqueous NaHCO3 (100 mL each), dried over Na2SO4, fil-
tered, and evaporated under reduced pressure. The residue was
chromatographed on a silica gel column with hexane/ethyl ace-
tate (3:2, v/v) to give 1 (5.7 g, 78%). 1H NMR (CDCl3, 500 MHz)
d 0.06–0.08 (12H, m), 0.89 (18H, m), 2.40–2.44 (1H, m), 2.56–
2.61 (1H, m), 3.74 (1H, dd, J = 11.0, 2.4 Hz), 3.84 (1H, dd,
J = 11.0, 3.9 Hz), 4.00 (1H, m), 4.58–4.61 (1H, m), 5.36 (2H, m),
6.42 (1H, t, J = 6.4 Hz), 8.00–8.03 (1H, m), 8.06 (2H, s), 8.11–
8.12 (2H, m), 8.17–8.21 (4H, m), 8.30 (2H, d, J = 12.4 Hz), 8.41
(1H, d, J = 9.3 Hz), 10.01–10.03 (1H, m); 13C NMR (CDCl3) d
18.4, 18.8, 26.1, 26.3, 41.6, 42.8, 63.0, 84.8, 88.4, 121.1, 123.3,
125.2, 125.4, 125.7, 126.4, 127.0, 127.7, 127.8, 128.4, 129.3,
131.1, 131.4, 131.7, 132.0, 141.6, 150.3, 150.5, 151.3, 154.2;
Compound 2 (320 mg, 0.4 mmol) was rendered anhydrous by
co-evaporation twice with dry toluene, twice with dry acetonitrile,
and once with dry CH2Cl2, and finally dissolved in dry CH2Cl2
(4 mL). To this solution were added N,N-diisopropylethylamine
(125 lL, 0.72 mmol) and chloro(2-cyanoethoxy)(N,N-diisopropyl-
amino)phosphine (140 mg, 0.6 mmol). After being stirred at ambi-
ent temperature for 18 h, the reaction was quenched by addition of
water (500 lL). The solvents were evaporated under reduced pres-
sure, and the residue was dissolved in ethyl acetate/ethyl ether
(3 mL, 1:2, v/v). The solution was washed eight times with 0.2 M
NaOH (3 mL, each), dried over Na2SO4 and concentrated under re-
duced pressure. The residue was chromatographed on a gel-filtra-
tion column with CHCl3 to give 3 (280 mg, 70%). 1H NMR (DMSO,
500 MHz) d 1.00–1.13 (12H, m), 2.52–2.59 (1H, m), 2.64–2.66
(2H, m), 3.05–3.12 (1H, m), 3.16–3.29 (2H, m), 3.48–3.59 (2H,
m), 3.61–3.78 (2H, m), 3.65–3.66 (6H, m), 4.09–4.16 (1H, m),
4.76–4.82 (1H, m), 5.24–5.27 (2H, m), 6.42–6.46 (1H, m), 6.71–
6.77 (4H, m), 7.08–7.28 (9H, m), 8.07 (1H, t, J = 7.56 Hz), 8.13–
8.17 (3H, m), 8.28–8.33 (H, m), 8.50 (1H, d, J = 9.27 Hz), 8.54 (1H,
d, J = 5.61 Hz), 9.85 (1H, s), 10.0 (1H, t, J = 5.12 Hz); 13C NMR
(DMSO) d 19.7, 19.8, 19.9, 24.1, 24.2, 24.3, 24.4, 41.2, 42.5, 42.6,
54.9, 54.9, 58.3, 58.4, 58.5, 63.3, 63.4, 72.5, 79.2, 84.0, 84.7, 85.0,
85.5, 112.9, 113.0, 118.8, 119.0, 120.6, 123.0, 123.9, 124.1, 124.9,
125.2, 125.3, 126.2, 126.3, 126.5, 127.1, 127.5, 127.6, 127.7,
128.0, 129.5, 129.6, 130.2, 130.3, 130.8, 132.9, 135.3, 135.4,

K. Seio et al. / Bioorg. Med. Chem. 16 (2008) 8287–8293
8293
142.7, 142.8, 144.7, 149.9, 150.3, 150.5, 153.5, 158.0, 158.0;
31PNMR (DMSO) d 148.1, 148.8. HRMS calcd for C58H59N8O7P
(M+H+) 1033.4136. Found 1033.4779.
1.0
1.0
l
l
M for Figure 3, 0.4
M for Figure 6.
l
M for Figure 4, 0.7
l
M for Figure 5, and
The melting temperatures of the 2 lM duplexes containing
ODN3 were 37 °C for ODN3 + short-RNA, 44 °C for ODN3 + long-
RNA, 47 °C for ODN3 + short-DNA, and 49 °C for ODN3 + long-
RNA.
4.4. Oligonucleotide synthesis
The oligonucleotides incorporating dApymcm residues were
synthesized by using phosphoramidite 3 on an automated DNA
synthesizer. The cleavage of the synthesized 50-DMTr-oligonucleo-
tide from the solid support and the deprotection of the nucleobases
were carried out by treatment with 28% aqueous ammonia at room
temperature for 24 h. The products were purified according to the
standard Trityl-ON procedure followed by the purification on an
anion-exchange HPLC by use of 0–50% gradient of 1 M NaCl in
25 mM sodium phosphate–10% CH3CN. The sequences and the re-
sults of the mass analyses are shown below.
4.7. UV and CD measurement
Each duplex was dissolved in 10 mM sodium phosphate (pH
7.0) containing 100 mM NaCl and 0.1 mM EDTA so that the final
concentration of each oligonucleotide became 2 lM. The spectra
were measured at 10 °C.
Acknowledgments
ODN1: d(TTTCTC[Apymcm]TTCTCT), mass calcd [M+H]+ 4109.3,
found 4099.8.
This study was supported by Industrial Technology Research
Grant Program in ’05 from New Energy and Industrial Technol-
ogy Development Organization (NEDO) of Japan. This work was
also financially supported partly by a Grant-in-Aid from CREST,
Japan Science and Technology Agency and the Ministry of Educa-
tion, Science, Sports and Culture, Grant-in-Aid for Scientific
Research.
ODN2: d(TTCTCTTTTCT[Apymcm][Apymcm]TTCTCTTTCTCT), mass
calcd [M+H]+ 7967.4, found 7974.2.
ODN3: d(CTC[Apymcm][Apymcm]TATACAACCT), mass calcd
[M+H]+ 4993.0, found 4993.8.
4.5. Tm measurement
References and notes
Each oligonucleotide was dissolved in 10 mM sodium phos-
phate (pH 7.0) containing 100 mM NaCl and 0.1 mM EDTA so that
the final concentration of each oligonucleotide became 2 lM. The
solution was separated into quartz cells (10 mm) and incubated
at 85 °C. After 10 min the solution was cooled to 5 °C at the rate
of 0.5 °C/min and heated to 85 °C at the same rate. During this
annealing and melting, the absorption at 260 nm was recorded
and used to draw UV-melting curves. The Tm value was calculated
as the temperature that gave the maximum of the first derivative
1. Kierzek, R.; Li, Y.; Turner, D. H.; Bevilacqua, P. C.. J. Am. Chem. Soc. 1993, 115,
4985–4992.
2. Bevilacqua, P. C.; Kierzek, R.; Johnson, K. A.; Turner, D. H. Science 1992, 258,
1355–1358.
3. Mann, J. S.; Shibata, Y.; Meehan, T. Bioconjugate Chem. 1992, 3, 554–558.
4. Nakamura, M.; Fukunaga, Y.; Sasa, K.; Ohtoshi, Y.; Kanaori, K.; Hayashi, H.;
Nakano, H.; Yamana, K. Nucleic Acids Res. 2005, 33, 5887–5895.
5. Okamoto, A.; Kanatani, K.; Saito, I. J. Am. Chem. Soc. 2004, 126, 4820–4827.
6. Lewis, F. D.; Zhang, Y.; Letsinger, R. L. J. Am. Chem. Soc. 1997, 119, 5451–5452.
7. Telser, J.; Cruickshank, K. A.; Morrison, L. E.; Netzel, T. L. J. Am. Chem. Soc. 1989,
111, 6966–6976.
of the UV-melting curve. The molar extinction constant (e260) of
8. Yamana, K.; Iwai, T.; Ohtani, Y.; Sato, S.; Nakamura, M.; Nakano, H. Bioconjugate
Chem. 2002, 13, 1266–1273.
ODN1 was estimated to be 107,600 assuming the extinction coef-
9. Okamoto, A.; Ichiba, T.; Saito, I. J. Am. Chem. Soc. 2004, 126, 8364–8365.
10. Kumar, T. S.; Wengel, J.; Hrdlicka, P. J. ChemBioChem 2007, 8, 1122–1125.
11. Fujimoto, K.; Shimizu, H.; Inouye, M. J. Org. Chem. 2004, 59, 3271–3275.
12. Paris, P. L.; Langenhan, J. M.; Kool, E. T. Nucleic Acids Res. 1998, 26, 3789–3793.
13. Christensen, U. B.; Pedersen, E. B. Nucleic Acids Res. 2002, 30, 4918–4925.
14. Kalyanasundaram, K.; Thomas, J. K. J. Phys. Chem. 1977, 81, 2176–2180.
15. Miyata, K.; Tamamushi, R.; Ohkubo, A.; Taguchi, H.; Seio, K.; Sekine, M.
Tetrahedron Lett. 2004, 45, 9365–9368.
16. Nakano, S.; Uotani, Y.; Uenishi, K.; Fujii, M.; Sugimito, N. Nucleic Acids Res. 2005,
33, 7111–7119.
17. Manoharan, M.; Tivel, K. L. J. Phys. Chem. 1995, 99, 17461–17472.
18. Ambros, V. Cell 2001, 107, 823–826.
19. Bartel, D. P. Cell 2004, 116, 281–297.
20. Cullen, B. R. Mol. Cell 2004, 16, 861–865.
21. Chen, C.; Ridzon, D. A.; Broomer, A. J.; Zhou, Z.; Lee, D. H.; Nguyen, J. T.;
Barbisin, M.; Xu, N. L.; Mahuvakar, V. R.; Andersen, M. R.; Lao, K. Q.; Livak, K. J.;
Guegler, K. J. Nucleic Acids Res. 2005, 33, e179.
ficient are equal to that of 50-d(TTTCTCATTCTCT)-30. The molar
extinction constants (e260) of ODN2 and ODN3 were determined
as 214,000 and 141,000 after the enzymatic digestion according
to the general procedure. For example, ODN3 (0.97 OD260) was dis-
solved in 290
solution was added nuclease P1 (6
from Crotalus adamanteus (3 L, 0.03 mg) and calf intestine alkaline
phosphatase (2 L, 2 U). The solution was incubated at 37 °C for
12 h and then quenched by heating for 1 min at 80 °C. After remov-
ing the enzyme by a filtration, the aliquot (50 L) was analyzed by
a reversed-phase HPLC. The peak area was quantified by compar-
ing with those of the 50 L of the standard sample containing
lL of 10 mM phosphate (1 M NaCl, pH 7.0). To this
l
L, 3 U), phosphodiesterase I
l
l
l
l
0.1 mM of deoxyadenosine, deoxyguanosine, deoxycytidine, and
22. Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.;
Cheeseman, J. R.; Montgomery, J. A., Jr.; Vreven, T.; Kudin, K. N.; Burant, J. C.;
Millam, J. M.; Iyengar, S. S.; Tomasi, J.; Barone, V.; Mennucci, M.; Cossi, M.;
Scalmani, G.; Rega, N.; Petersson, G. A.; Nakatsuji, H.; Hada, M.; Ehara, M.;
Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.;
Kitao, O.; Nakai, H.; Klene, M.; Li, X.; Knox, J. E.; Hratchian, H. P.; Cross, J. B.;
Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A.
J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Ayala, P. Y.; Morokuma, K.; Voth,
G. A.; Salvador, P.; Dannenberg, J. J.; Zakrezwski, V. G.; Dapprich, S.; Daniels,
A. D.; Strain, M. C.; Farkas, O.; Malick, D. K.; Rabuck, A. D.; Raghavachari, K.;
Foresman, J. B.; Ortiz, J. V.; Cui, Q.; Baboul, A. G.; Clifford, S.; Cioslowski, J.;
Stefanov, B. B.; Liu, G.; Liashenko, A.; Piskorz, P.; Komaromi, I.; Martin, R. L.;
Fox, D. J.; Keith, T.; Al-Laham, M. A.; Peng, C. Y.; Nanayakkara, A.;
Challacombe, M.; Gill, P. M. W.; Johnson, B.; Chen, W.; Wong, M. W.;
Gonzalez, C.; Pople, J. A. Gaussian 03, Revision C.02; Gaussian, Inc.: Pittsburgh
PA, 2003.
thymidine.
4.6. Fluorescence measurement
An ODN incorporating dApymcm and the target strand was dis-
solved in 10 mM sodium phosphate buffer (pH 7.0) containing
1.0 M NaCl. Fluorescence spectra were obtained at 10 °C in the
absence or the presence of the small excess (1.2 equiv) of the target
DNAs and RNAs in a 1 cm path length cell. The oligonucleotide
concentrations were adjusted so that the fluorescence signal did
not exceeded 1000. The concentrations of the pyrene-modified oli-
gonucleotides were 2.0 lM for the experiments shown in Figure 2,