High physiological thermal triplex stability optimization of twisted intercalating nucleic acids (TINA)

Article abstract of DOI:10.1039/b808564a

The structure of the monomer (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl] glycerol (1) in twisted intercalating nucleic acids (TINA) was optimized for stabilizing interactions between the intercalator and surrounding nucleobases when used as a triplex forming oligonucleotide (TFO). Enhancement of π-π interactions with nucleobases of the TFO was achieved by increasing the aromatic surface using the (R)-1-O-[4-(1-pyrenylethynyl)naphthylmethyl]glycerol monomer (2). Bulge insertion of 2 in the middle of a Hoogsteen-type triplex increased the triplex thermal stability, ΔT_m = +2.0 °C compared with 1 at pH 7.2. Syntheses and thermal denaturation studies of triplexes and duplexes are described for three novel TINA monomers. The influence of π-π interactions, link length and the positioning of the ether in the linker in the TINA derivatives are described. The Royal Society of Chemistry 2008.

Full text of DOI:10.1039/b808564a

View Article Online / Journal Homepage / Table of Contents for this issue
PAPER
www.rsc.org/obc | Organic & Biomolecular Chemistry
High physiological thermal triplex stability optimization of twisted
intercalating nucleic acids (TINA)†
Niels Bomholt, Amany M. A. Osman‡ and Erik B. Pedersen*
Received 21st May 2008, Accepted 30th June 2008
First published as an Advance Article on the web 6th August 2008
DOI: 10.1039/b808564a
The structure of the monomer (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol (1) in twisted
intercalating nucleic acids (TINA) was optimized for stabilizing interactions between the intercalator
and surrounding nucleobases when used as a triplex forming oligonucleotide (TFO). Enhancement of
p–p interactions with nucleobases of the TFO was achieved by increasing the aromatic surface using the
(R)-1-O-[4-(1-pyrenylethynyl)naphthylmethyl]glycerol monomer (2). Bulge insertion of 2 in the middle
of a Hoogsteen-type triplex increased the triplex thermal stability, DTm = +2.0 ◦C compared with 1 at
pH 7.2. Syntheses and thermal denaturation studies of triplexes and duplexes are described for three
novel TINA monomers. The influence of p–p interactions, link length and the positioning of the ether
in the linker in the TINA derivatives are described.
sertion of one (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol
Introduction
monomer (1) in a 14-mer TFO.10 High thermal stability was
not achieved at the expense of low mismatch discrimination
as a single base pair mismatch in the dsDNA resulted in a
minimum DTm of -11.5 ◦C. Moreover, the Watson–Crick duplex
was destabilized, demonstrating discrimination between parallel
duplex/triplex and antiparallel duplex. In addition, Paramav-
isam et al.11 have recently shown that incorporation of TINA
monomers in G-rich oligonucleotides interferes with quadruplex
formation at physiologic potassium concentrations releasing the
oligonucleotide for antiparallel triplex formation. These properties
make the TINA monomer a suitable tool for dsDNA targeting in
silencing and in diagnostic applications.
In our ongoing research, optimization of the thermal triplex
stability by intercalation has mainly been focused on modify-
ing the 1-pyrenylethynyl moiety. Replacing this moiety with 9-
aminoacridin-2-ylethynyl,12 naphthalen-1-ylethynyl, biphenyl-4-
ethynyl, phenyl-1-ethynyl13 or 4-(1-(pyren-1-yl)-1H-1,2,3-triazol-
4-yl)14 all resulted in lower thermal stability indicating that
the 4-(1-pyrenylethynyl) moiety has an appropriate size and
configuration for optimal intercalation. It is worth mentioning
that we have recently shown that by substituting pyrene with a
naphthalimide comprising an N,N-dimethylaminoethyl group, the
triplex stability can be increased as a result of an ionic interaction
between the protonated dimethylamino group and the negatively
charged phosphate backbone of the duplex.15
Herein we report a thermal stability optimization of TINA
(1) based on a molecular modelling examination of its in-
tercalating properties, leading to a DTm(pH7.2) = +2.0 ◦C for
(R)-1-O-[4-(1-pyrenylethynyl)naphthylmethyl]glycerol (2) where
the benzene ring has been substituted by naphthalene
(Fig. 1). Length dependence of the glycerol for the opti-
mized TINA was investigated using the analogues (S)-[4-
(1-pyrenylethynyl)naphthylmethoxy]butane-1,2-diol (3). Further-
more was the importance of the ether position in the linker with
respect to thermal stability investigated by the synthesis of a
third novel TINA, (S)-4-(4-(pyren-1-ylethynyl)phenoxy)butane-
1,2-diol (4).
Triplex forming oligonucleotides (TFOs) are cable of targeting
DNA duplexes through sequence specific recognition, making the
antigene technology a potential tool for human gene therapy and
diagnostics applications.1,2 Triplex formation results from purines’
ability to form additional hydrogen bonds to a third oligonu-
cleotide positioned in the major groove of the DNA duplex.3
These so called Hoogsteen hydrogen bonds are specifically formed
between G·G ¥ C and A·A ¥ T or T·A ¥ T and C+·G ¥ C. In
the former case, the triplex is known as a reverse-Hoogsteen
triplex or as an antiparallel triplex, with an antiparallel binding
motif. The latter case is known as a Hoogsteen triplex or as
a parallel triplex, with a parallel binding motif. In both cases,
the triplex formation is limited by the need of a duplex target
containing a homopurine tract of ideally 15–30 nucleobases.4
In addition, the parallel triplex is limited by the requirement
of N3 protonation of cytosine in order to form the C+·G ¥ C
triplet, rendering the parallel triplex unstable at physiological
pH.5 Several modified nucleotides have in recent years successfully
been applied to the triplex technology, in order to overcome
low thermal stability and to improve targeting, such as locked
nucleic acids (LNA),6 5¢–5¢-linked intercalating alternate strand
TFOs7,8 and modified nucleotides with the ability to recognize
all four base pairs.9 Insertion of conjugated intercalators in the
TFO have been shown to be an effective way to stabilize triplexes.
The twisted intercalating nucleic acids (TINA) inserted as a bulge
in a triple-helix forming oligonucleotide (TFO), stabilize parallel
Hoogsteen triplexes considerably, with DTm = +19.0 ◦C for the in-
Nucleic Acid Center, Department of Physics and Chemistry, University of
Southern Denmark, Campusvej 55, DK-5230, Odense M, Denmark
† Electronic supplementary information (ESI) available: Melting curves of
thermal denaturation experiments of triplexes ON1–ON5/D2 and ON6–
ON10/D2; first derivative plots of thermal denaturation experiments
of triplexes ON1–ON5/D2 and ON6–ON10/D2; HPLC ion-exchange
chromatography and purity determination of ON3, ON4, ON5, ON7,
ON8, ON9 and ON10. See DOI: 10.1039/b808564a
‡ On leave from Chemistry Department, Faculty of Science, Menoufia
University, Shebin El-Koam, Egypt.
3714 | Org. Biomol. Chem., 2008, 6, 3714–3722
This journal is
The Royal Society of Chemistry 2008
©

View Article Online
Fig. 1 Twisted intercalating nucleic acids.
Fig. 2 Representative low-energy structures of the truncated triplexes obtained by molecular modelling. The monomer TINA 1 (Fig. 2a and 2b) and 2
(Fig. 2c and 2d) are shown in colour. The side view is shown on Fig. 2a and 2c. The top view is shown on Fig. 2b and 2d.
has not been investigated. Our modelling study showed that the
benzene ring could be substituted with naphthalene as shown in
Results and discussion
Molecular modelling
Fig. 2c and 2d. As a consequence of the larger aromatic surface,
the naphthalene moiety will be able to obtain more favourable p–p
interactions with the nucleobases of the TFO and thereby enhance
triplex stability at elevated temperatures. The second conformation
of the unsymmetrical intercalator where the naphthalene is twisted
180◦ around the triple bond results in equal interacting properties
and no optimal conformation could be assigned.
In order to optimize the intercalating properties of the TINA
(1), we decided to examine it via molecular modelling studies.
An AMBER* force field was used to generate representative
low-energy structures of a truncated 8mer triplex with the bulge
insertion of the monomer (Fig. 2).
As can be seen from Fig. 2a and 2b, the pyrene is positioned in
the Watson–Crick duplex where it forms p–p interactions to the
adjacent nucleobases. The C–C triple bond is believed to enhance
intercalating properties,16 which is supported by this study, where
Synthesis of TINA phosphoramidites
˚
it is positioned within 3.5 A to neighbouring nucleobases, allowing
In addition to the planned synthesis of 2, we wanted to investigate
the effect of increasing the linkage length by synthesizing a second
TINA analogue3 with an extra carbon atom in the linkage between
the TFO backbone and the intercalator comprising naphthalene
and pyrene. 2 and 3 were synthesized from the enantiomeric
pure starting compounds 5 and 6 (Scheme 1), respectively, which
were reacted with 1-bromo-4-(bromomethyl)naphthalene7 under
Dean–Stark conditions (toluene, KOH), followed by the depro-
tection of the isopropylidene groups in 80% aq. AcOH to afford 7
and 8 without using chromatography in satisfactory purity for the
subsequent step. The Sonogashira coupling with 1-ethynylpyrene
was done with Pd(PPh3)2Cl2, CuI, PPh3, NEt3, reflux under Ar
resulting in compounds 9 and 10 in 47% and 80% yield, respec-
tively. The primary hydroxy groups were protected with DMT-Cl
it to form stabilizing p–p interactions. In addition, the ability of
twisting the aromatic moieties around the triple bond allows them
to adjust to the local secondary structure of the triplex. The pyrene
ring is positioned in the duplex whereas the benzene ring interacts
with the two adjacent nucleobases of the TFO by p–p interactions,
adding to the triplex stability. In addition, it ensures the same
degree of enforced unwinding of the TFO as for the duplex and
consequently ensures accurate T·A ¥ T and C+·G ¥ C triplets
neighbouring the bulge insertion. Previous optimization studies
have, as mentioned earlier, failed to enhance triplex stability at
physiological pH by substituting the pyrene moiety with different
aromatic systems as well as substituting the acetylene bond with
a 1,2,3-triazole. Until now, the importance of the benzene ring
This journal is
The Royal Society of Chemistry 2008
Org. Biomol. Chem., 2008, 6, 3714–3722 | 3715
©

View Article Online
Scheme 1 Reagents and conditions: (a) 1-bromo-4-(bromomethyl)naphthalene,7 KOH, toluene, reflux; (b) 80% aq. AcOH, room tempera-
ture; (c) 1-ethynylpyrene, Pd(PPh3)2Cl2, CuI, PPh3, NEt3, reflux, Ar; (d) DMTCl, pyridine, room temperature; (e) 2-cyanoethyl-N,N,N¢,N¢-
tetraisopropylphosphordiamidite, diisopropylammonium tetrazolide, CH2Cl2, 0 ◦C → room temperature.
Scheme 2 Reagents and conditions: (a) 4-iodophenol, DEAD, PPh3, THF, 0 ◦C → room temperature; (b) 80% aq. AcOH, room temperature;
(c) 1-ethynylpyrene, Pd(PPh3)2Cl2, CuI, NEt3, room temperature, Ar; (d) DMTCl, pyridine, room temperature; (e) 2-cyanoethyl-N,N,N¢,N¢-
tetraisopropylphosphordiamidite, diisopropylammonium tetrazolide, CH2Cl2, 0 ◦C → room temperature.
in dry pyridine to give 11 and 12, before they were converted to
the respective phosphoramidites, 13 and 14, by treatment with 2-
cyanoethyl-N,N,N¢,N¢-tetraisopropylphosphordiamidite and di-
isopropylammonium tetrazolide in dry CH2Cl2, which were used
in standard DNA synthesis.
To find the best TINA derivative, a third novel TINA derivative
4 was synthesized. Here the purpose was to investigate the
importance of the ether position in the linkage with respect to
thermal stability of the corresponding DNA triplexes. Compound
4 was synthesized from compound 6 (Scheme 2), which was reacted
with 4-iodophenol under Mitsunobu conditions, followed by the
deprotection of the isopropylidene groups in 80% aq. AcOH,
affording 15 in satisfactory yield. The subsequent Sonogashira
coupling with 1-ethynylpyrene, Pd(PPh3)2Cl2, CuI, NEt3 under Ar
afforded 16 in 73% yield. After protection of the primary hydroxy
group with DMT-Cl in dry pyridine to give 17, the corresponding
phosphoramidite 18 could be isolated after treatment with 2-
cyanoethyl-N,N,N¢,N¢-tetraisopropylphosphordiamidite and di-
isopropylammonium tetrazolide in dry CH2Cl2 and it could
subsequently be used for standard DNA synthesis.
Thermal stability studies
The phosphoramidites, 13, 14 and 18, were used in standard DNA
synthesis to obtain modified oligonucleotides possessing TINAs,
which were used in pH dependent thermal stability studies of
the Hoogsteen-type triplex as well as parallel and antiparallel
3716 | Org. Biomol. Chem., 2008, 6, 3714–3722
This journal is
The Royal Society of Chemistry 2008
©

View Article Online
Table 1 Tm [◦C] data for DNA triplex, parallel and antiparallel duplex melting, taken from UV melting curves (l = 260 nm)
Triplexa
Parallel duplexb
Antiparallel duplexb
3¢-CTGCCCCTTTCTTTTTT
5¢-GACGGGGAAAGAAAAAA
(duplex D1)
5¢-GACGGGGAAAGAAAAAA 3¢-GGGGAAAGAAAAAA
(ssDNA ON17)
(ssDNA ON18)
Entry
Sequence
pH 6.0 Tm/◦C
pH 7.2 Tm/◦C pH 6.0 Tm/◦C
pH 6.0 Tm/◦C pH 7.2 Tm/◦C
ON1c
ON2c
ON3
ON4
ON5
ON6c
ON7
ON8
ON9
5¢-CCCCTTTCTTTTTT
5¢-CCCCTT1TCTTTTTT
5¢-CCCCTT2TCTTTTTT
5¢-CCCCTT3TCTTTTTT
5¢-CCCCTT4TCTTTTTT
5¢-CCCCTT1TCT1TTTTT
5¢-CCCCTT2TCT2TTTTT
5¢-CCCCTT3TCT3TTTTT
5¢-CCCCTT4TCT4TTTTT
27.0c(26.5)d
45.5(44.0)d
48.0e(46.5)d
42.5(40.5)d
45.5(42.5)d
56.5c(51.0)d
58.5f(59.5)d
50.5e(49.5)d
57.0f(54.0)d
58.5f(62.5)d,e,h
<5.0c
28.0c
30.0
24.5
27.0
40.0c
n.t.g
19.0c
33.5c
36.0
29.5
31.0
38.0c
41.5
33.0
39.0
41.5
48.0c
46.5c
46.0
48.0
47.5
45.0c
42.5
38.5
44.0
45.0
47.0c
45.5c
47.0
48.0
48.0
42.0c
39.5
40.0
43.0
43.5
n.t.g
42.0
ON10 5¢-CCCCT2TTCTT2TTTT
46.5e,h
a C = 1.5 mM of ON1–ON10 and 1.0 mM of each strand of dsDNA in 20 mM sodium cacodylate, 100 mM NaCl, 10 mM MgCl2, pH 6.0 and
7.2; duplex Tm = 57.5 ◦C and 58.0 ◦C at pH 6.0 and pH 7.2 respectively. b C = 1.0 mM of each strand in 20 mM sodium cacodylate, 100 mM
NaCl, 10 mM MgCl2, pH 6.0 and pH 7.2. c Oligonucleotides and Tm data are from ref. 10. d Tm was determined with the extended duplex D2: 3¢-
CCGGCTGCCCCTTTCTTTTTTCGCG/5¢-GGCCGACGGGGAAAGAAAAAAGCGC, the target being underlined, duplex Tm = 74.0 ◦C. e Third
f
g
strand and duplex melting overlapped. Third strand and duplex melting overlaid. n.t. = no transition observed. h Transition determined at 373 nm.
¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯
Table 2 Tm [◦C] data for mismatched triplex melting, taken from UV melting curves (l = 260 nm)
Triplexa
3¢-CTGCCCCTTXCTTTTTT
5¢-GACGGGGAAYGAAAAAA
Duplex D1
X·Y = T·A
Duplex D3
X·Y = A·T
Duplex D4
X·Y = C·G
Duplex D5
X·Y = G·C
Entry
Sequence
ON1b
ON2b
ON3
ON4
ON5
5¢-CCCCTTTCTTTTTT
5¢-CCCCTT1TCTTTTTT
5¢-CCCCTT2TCTTTTTT
5¢-CCCCTT3TCTTTTTT
5¢-CCCCTT4TCTTTTTT
27.0
45.5
48.0c
42.5
45.5
< 5.0
27.0
28.5
26.5
32.5
< 5.0
34.5
35.5
28.0
40.0
< 5.0
28.5
28.0
25.0
31.5
a C = 1.5 mM of ON1–ON5 and 1.0 mM of each strand of dsDNA in 20 mM sodium cacodylate, 100 mM NaCl, 10 mM MgCl2, pH 6.0. b Oligonucleotides
and Tm data are from ref. 10. c See Table 1.
duplexes. For comparison, the modified oligonucleotides and
their complementary strands used in this study are equal to
those described earlier for other TINA analogues.10,12–15 Thermal
stability of triplexes and duplexes were assessed by thermal
denaturation experiments, and the melting temperatures (Tm,
◦C) were determined from melting curves via the first derivation
method (Tables 1, 2 and ESI†).17 Due to high triplex stability for
ON3/D1 with the bulge insertion of 2 in the middle of the TFO,
an overlap of triplex and duplex melting curves was observed,
precluding an accurate Tm determination. Similar overlaps were
observed for the bulge insertion of two TINA-analogues, therefore,
in order to assess accurate and comparable Tm’s at pH 6.0 for
triplexes formed by ON2–ON10, an extended target duplex D2
was used. Thermal melting measurements using an extended
target duplex resulted in higher Tm of the duplex, allowing a
non-overlapping transition of the triplex, thereby ensuring an
accurate Tm-determination. But in the case of ON10, even the
triplex transition overlapped with the duplex D2, for which the
absorbance for the monomer 2 (373 nm) was used to determine the
transition. From these measurements, it was possible to determine
Tm for all triplexes (ON1–ON10/D2) at pH 6.0 and compare
stabilizing properties of the novel TINA analogues.
The highest thermal◦stability at pH 6.0 was observed for
ON3/D2 (DTm = +2.5 C compared to ON2/D2) with a Tm
=
◦
◦
46.5 C and a DTm/mod = +20.0 C. In addition, the length of
the glycerol linkage was shown to be optimal for obtaining high
thermal stability, since a DTm = -5.5 ◦C at pH 6.0 was observed
for ON4/D2 when compared to ON3/D2. The position of the
ether in TINA was shown only to influence the triplex stability
mildly, since ON5/D2 showed similar Tm as ON2/D2 at both pH
values. At pH 7.2, an overall decrease in thermal stability was
observed due to the lack of cytosine protonation, but triplexes
formed by ON3–ON5 showed a similar distribution in thermal
stability as observed at pH 6.0 with a maximum thermal stability
for ON3/D1, Tm = 30.0 ◦C. This enhanced triplex stability at
both pH values proves that the larger aromatic surface of the
naphthalene moiety of TINA 2 improves, pH-independently, p–
p interactions with neighbouring nucleobases of the TFO as
compared to the smaller aromatic surface of the benzene ring of
TINA 1.
This journal is
The Royal Society of Chemistry 2008
Org. Biomol. Chem., 2008, 6, 3714–3722 | 3717
©

View Article Online
Upon bulge insertion of two TINA monomers in the TFO, the
triplex stability at pH 6.0 was further enhanced (ON6–ON9/D2)
with a DTm/mod = +16.5 ◦C for the ON7/D2 triplex compared
to DTm/mod = +12.3 ◦C for the ON6/D2. Surprisingly, no
triplex formation was detected for ON7–ON8/D1 at pH 7.2.
This observation could be the result of deprotonation of the
cytosine residues, making it more difficult to accommodate two
large inserted intercalators in a stringent triplex structure. The size
of the intercalator in the case of ON7–8 is larger than for ON6
and ON9 because of the naphthalene moiety, explaining why this
behaviour was only observed for these TFOs.
compared with 1, whereas no triplex formation was observed at
pH 7.2. However, when the distance between the insertions of 2
was increased to five nucleobases (ON10), the triplex formation
was observed at physiological pH 7.2.
Experimental section
General
NMR spectra were recorded on a Varian Gemini 2000 spectrom-
eter; 1H at 300 MHz, 13C at 75 MHz and 31P at 121.5 MHz.
1
The internal standard used in H NMR was TMS (d = 0.00)
In order to investigate whether the promising analogue 2 at
pH 7.2 could achieve a sufficiently relaxed triplex structure, the
oligonucleotide ON10 was synthesized with increased distance
between the bulge insertions. As can be seen from Table 1, ON10
for CDCl3 and DMSO-d6; in 13C NMR was CDCl3 (d = 77.16)
and DMSO-d6 (d = 39.52); in 31P NMR was H3PO4 (d = 0.00)
used as external standard. Accurate ion mass determinations were
performed using the 4.7 Tesla Ultima Fourier Transform (FT)
mass spectrometer (Ion Spec, Irvine, CA). The [M]+ ions were
peak matched using ions derived from the 2,5-dihydroxybenzoic
acid matrix. EI-MS was performed on Finnigan SSQ 710. Melting
points were detected with a Bu¨chi melting point apparatus. Thin
layer chromatography (TLC) analyses were carried out with use
of TLC plates 60 F254 purchased from Merck and visualized
under an UV light (254 nm). The silica gel (0.040–0.063 mm)
used for column chromatography was purchased from Merck.
Solvents used for column chromatography and reagents were used
as purchased without further purification.
resulted in a small increase in thermal stability at pH 6.0 (DTm
=
+3.5 ◦C) when compared to ON7/D2, but more importantly,
triplex formation was observed at pH 7.2 with a thermal stability
of 46.5 ◦C allowing the use of multiple insertion of the optimized
TINA analogue 2 at physiological pH.
An important property of TINAs is their ability to favour
Hoogsteen hybridization over Watson–Crick. This is also the
case for the bulge insertion of the analogues 2, 3 and 4 in the
parallel duplex (ON17), which results in stabilization, whereas
the antiparallel duplex (ON18), is only mildly stabilized or
destabilized.
High sensitivity to mismatches is essential for the use of selective
TFOs in the triplex technology. Therefore the thermal stability of
ON3–ON5 towards a single neighbouring mismatch in the purine
strand was investigated, Table 2. In all cases the triplex were desta-
Molecular modelling
Molecular modelling was performed with a MacroModel v9.1
from Schro¨dinger. All calculations were conducted with an
AMBER* force field and the GB/SA water model. The dy-
namic simulations were preformed with stochastic dynamics, a
SHAKE algorithm to constrain bonds to hydrogen, time step
of 1.5 fs and simulation temperature of 300 K. Simulation
for 0.5 ns with an equilibration time of 150 ps generated 250
structures, which all were minimized using the PRCG method
with a convergence threshold of 0.05 kJ mol-1. The minimized
structures were examined with Xcluster from Schro¨dinger, and
representative low-energy structures were selected. The starting
structures were generated with Insight II v97.2 from MSI, followed
by incorporation of the modified nucleotide.
◦
bilized with DTm in the range of -14.0 to -21.5 C. Surprisingly
ON4 showed less significant mismatch sensitivity compared to
ON2, even though they gave similar thermal stability of matched
triplexes and duplexes. ON3 mismatch sensitivity was not affected
even though an increased triplex stability was observed for the
matched triplex.
Conclusions
It was found possible to improve the lead structure (R)-1-
O-[4-(1-pyrenyl-ethynyl)phenylmethyl]glycerol monomer (1) by
optimizing the stabilizing interactions between the intercalator
and the surrounding nucleobases in a DNA triplex. The molecular
modelling study showed that increasing the aromatic surface of
the intercalator moiety between TFO nucleobases could enhance
p–p interactions thereby increasing the thermal stability of the
triplex. In addition to the synthesis of the novel TINA analogue 2
based on the molecular modelling study, importance of the linkage
length and ether position in the linkage was investigated by the
synthesis of the two novel TINA analogues 3 and 4. Bulge inser-
tion of the (R)-1-O-[4-(1-pyrenylethynyl)naphthylmethyl]glycerol
monomer (2) gave the best results and it increased the triplex
thermal stability, DTm = +2.0 ◦C at pH 7.2, when compared
with 1, thereby showing the correlation of p–p interactions of
an intercalator and thermal stability. The novel TINA analogues
3 and 4 showed that the glycerol linkage has an optimal length
and that no significant importance of the ether position could
be observed. Insertion of two monomers (2), three nucleobases
apart, ON7, led to further increase of thermal stability at pH 6.0
Synthesis
(R)-3-((4-Bromonaphthalen-1-yl)methoxy)propane-1,2-diol 7.
(S)-(+)-2,2-Dimethyl-1,3-dioxolane-4-methanol (5; 2.33 g,
17.63 mmol) and 1-bromo-4-(bromomethyl)naphthalene7 (5.00 g,
16.67 mmol) were refluxed under Dean–Stark conditions in
toluene (150 mL) in the presence of KOH (17.11 g, 304.9 mmol)
for 21 h. The reaction mixture was allowed to cool, and
H2O (60 mL) was added. After separation of the phases, the
water layer was washed with toluene (2 ¥ 30 mL). Combined
organic layers were washed with H2O (30 mL) and concentrated
under reduced pressure to afford (S)-4-(((4-bromonaphthalen-
1-yl)methoxy)methyl)-2,2-dimethyl-1,3-dioxolane as a reddish
brown oil, which was used in the next step without further
1
purification. Yield 4.40 g (88%). H NMR (CDCl3) d 1.35, 1.41
(2 ¥ s, 6H, 2 ¥ C(CH3)2), 3.56 (m, 2H, ArCH2OCH2), 3.70 (m, 1H,
CHCH2O), 4.01 (m, 1H, CHCH2O), 4.28 (quintet, J = 6.0 Hz, 1H,
3718 | Org. Biomol. Chem., 2008, 6, 3714–3722
This journal is
The Royal Society of Chemistry 2008
©

View Article Online
CH2CHCH2), 4.93, 5.02 (2 ¥ d, J = 12.6 Hz, 2H, ArCH2O), 7.33,
7.73 (2 ¥ d, J = 7.8 Hz, 2H, Ar), 7.57–7.61 (m, 2H, Ar), 8.09–8.12
(m, 1H, Ar), 8.27–8.30 (m, 1H, Ar). 13C NMR (CDCl3) d 25.5, 26.9
(2 ¥ C(CH3)2), 66.9 (CHCH2O), 71.2 (OCH2CH), 71.8 (ArCH2O),
74.8 (CH2CHCH2), 109.6 (C(CH3)2), 123.6, 124.6, 127.0, 127,2,
127.4, 127.9, 129.4, 132.2, 132.9, 133.6 (Ar). HR-MALDI-MS
calcd for C17H19BrO3Na [M + Na]+ m/z 373.0410; found m/z
pressure and the residue was dissolved in CH2Cl2 (100 mL), which
was washed with 0.3 M aq. EDTA (2 ¥ 100 mL). After back
extraction with CH2Cl2 (100 mL), the combined organic phase
was washed with brine (100 mL), dried (MgSO4), filtered and
concentrated under reduced pressure. The residue was purified by
column chromatography (silica gel; CH2Cl2–MeOH 5%, v/v) to
afford compound 9 ◦as an ochreous yellow solid. Yield 685 mg
1
373.0397.
(S)-4-(((4-Bromonaphthalen-1-yl)methoxy)methyl)-
(47%). Mp 93–100 C. H NMR (DMSO-d6) d 3.52–3.75 (m,
2,2-dimethyl-1,3-dioxolane (4.40 g, 12.53 mmol) was treated
with 80% aq. AcOH (40 mL) for 48 h at room temperature. The
solvent was removed under reduced pressure and the residue
was coevaporated with toluene–EtOH (2 ¥ 60 mL, 5 : 1, v/v).
The residue was dried under reduced pressure to afford 7 as
brown oil, which was used in the next step without further
5H, OCH2CHCH2OH), 4.62 (t, J = 5.55 Hz, 1H, CH2OH), 4.82
(d, J = 5.10, 1H, CHOH), 5.04 (s, 2H, ArCH2O), 7.69–7.84 (m,
3H, Ar), 8.04–8.46 (m, 10H, Ar), 8.65–8.75 (m, 2H, Ar). 13C
NMR (DMSO-d6) d 63.2 (CHCH2OH), 70.6, 70.7 (CHCH2OH,
OCH2CH), 72.4 (ArCH2O), 93.36, 93.40 (C∫C), 116.8, 120.0,
123.5, 123.8, 124.8, 124.9, 125.1, 125.6, 126.1, 126.2, 126.9, 127.0,
127.3, 127.4, 128.5, 129.1, 130.0, 130.4, 130.6, 130.8, 131.1, 131.2,
132.6, 136.0 (Ar). HR-MALDI-MS calcd for C32H24O3Na [M +
Na]+ m/z 479.1618; found m/z 479.1626.
1
purification. Yield 3.52 g (80%). H NMR (CDCl3) d 3.56–3.69
(m, 5H, OCH2CHCH2OH), 4.21 (br. s, 2H, 2 ¥ OH), 4.94 (s,
2H, ArCH2O), 7.30, 7.73 (2 ¥ d, J = 7.8 Hz, 2H, Ar), 7.58–7.62
(m, 2H, Ar), 8.05–8.08 (m, 1H, Ar), 8.27–8.31 (m, 1H, Ar).
13C NMR (CDCl3) d 64.0 (CHCH2OH), 70.8 (CHCH2OH),
71.8 (CH2CHCH2, ArCH2O), 123.8, 124.3, 127.2, 127.3, 127.5,
128.0, 129.4, 132.3, 133.0, 133.3 (Ar). HR-MALDI-MS calcd for
C14H15BrO3Na [M + Na]+ m/z 333.0097; found m/z 333.0085.
(S)-4-((4-(Pyren-1-ylethynyl)naphthalen-1-yl)methoxy)butane-
1,2-diol 10. Compound 10 was synthesized from 8 according
to the procedure described for 9. Yield (80%) bronze coloured
1
foam. H NMR (CDCl3) d 1.72–1.79 (m, 2H, OCH2CH2), 2.30,
3.01 (s, 2H, 2 ¥ OH), 3.44–3.50 (m, 1H, CHCH2O), 3.59–3.64
(m, 1H, CHCH2O), 3.74–3.79 (m, 2H, OCH2CH2), 3.89–3.92 (m,
1H, CH2CHCH2), 4.97, 5.02 (2 ¥ d, J = 12.6 Hz, 2H, ArCH2O),
7.43–7.71 (m, 3H, Ar), 8.88–8.30 (m, 10H, Ar), 8.69–8.76 (m, 2H,
Ar). 13C NMR (CDCl3) d 33.0 (OCH2CH2), 66.8 (OCH2CH2),
68.5 (CHCH2OH), 71.3 (CHCH2OH), 71.8 (ArCH2O), 93.3, 94.1
(C∫C), 117.9, 122.1, 124.3, 124.7, 125.7, 125.8, 125.8, 126.1, 126.4,
127.0, 127.1, 127.2, 127.4, 128.4, 128.6, 129.9, 130.1, 131.2, 131.4,
131.5, 131.6, 132.0, 132.2, 132.3, 133.6, 134.4 (Ar). HR-MALDI-
MS calcd for C33H26O3Na [M + Na]+ m/z 493.1774; found m/z
493.1782.
(S)-4-((4-Bromonaphthalen-1-yl)methoxy)butane-1,2-diol
8.
(S)-4-(2-((4-Bromonaphthalen-1-yl)methoxy)ethyl)-2,2-dimethyl-
1,3-dioxolane was synthesized from (S)-(+)-4-(2-hydroxyethyl)-
2,2-dimethyl-1,3-dioxolane (6) according to the procedure
described under 7. Yield 75% reddish brown oil. 1H NMR
(CDCl3) d 1.33, 1.39 (s, 6H, 2 ¥ C(CH3)2), 1.84–1.91 (m, 2H,
OCH2CH2), 3.53 (m, 1H, CHCH2O), 3.65 (m, 2H, OCH2CH2),
4.00 (m, 1H, CHCH2O), 4.19 (m, 1H, CH2CHCH2), 4.85–
4.94 (m, 2H, ArCH2), 7.32, 7.73 (2 ¥ d, J = 7.8 Hz, 2H,
Ar), 7.56–7.63 (m, 2H, Ar), 8.06–8.09 (m, 1H, Ar), 8.27–8.30
(m, 1H, Ar). 13C NMR (CDCl3) d 25.9, 27.1 (2 ¥ C(CH3)2),
34.0 (OCH2CH2), 67.4 (CHCH2O), 69.7 (OCH2CH2), 71.4
(ArCH2O), 73.9 (CH2CHCH2), 108.7 (C(CH3)2), 123.4, 124.5,
127.0, 127,1, 127.3, 127.9, 129.4, 132.2, 133.0, 134.0 (Ar).
HR-MALDI-MS calcd for C18H21BrO3Na [M + Na]+ m/z
387.0566; found m/z 387.0577. Compound 8 was synthesized
(S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)-3-((4-(pyren-1-
ylethynyl)naphthalen-1-yl)-methoxy)propan-2-ol 11. (R)-3-((4-
(Pyren-1-ylethynyl)naphthalen-1-yl)methoxy)propane-1,2-diol
(9; 600 mg, 1.314 mmol) was dissolved in dry pyridine (20 mL)
and flushed with Ar, before 4,4¢-dimethoxytrityl chloride (534mg,
1.577 mmol) dissolved in dry pyridine (10 mL) was added
dropwise. The reaction was stirred at room temperature under Ar
for 24 h before it was quenched with MeOH (2 mL). The reaction
mixture was diluted with CH2Cl2–NEt3 (50 mL, 99.5%/0.5%, v/v)
before washed with H2O (3 ¥ 100 mL). After back extraction with
CH2Cl2–NEt3 (50 mL, 99.5%/0.5%, v/v) the combined organic
phase was washed with brine (100 mL), dried (MgSO4), filtrated
and concentrated under reduced pressure before the residue was
purified by column chromatography (silica gel; 0.5% Et3N v/v,
0–50% EtOAc in cyclohexane) to afford 11 as yellow foam. Yield
from
(S)-4-(2-((4-bromonaphthalen-1-yl)methoxy)ethyl)-2,2-
dimethyl-1,3-dioxolane according to the procedure described for
7. Yield 100% brown oil. 1H NMR (CDCl3) d 1.72–1.77 (m, 2H,
OCH2CH2), 3.40–3.46 (m, 1H, CHCH2O), 3.55–3.60 (m, 1H,
CHCH2O), 3.68–3.73 (m, 2H, OCH2CH2), 3.85–4.01 (m, 1H,
CH2CHCH2), 4.01 (s, 2H, 2 ¥ OH), 4.86–4.94 (m, 2H, ArCH2),
7.30, 7.72 (2 ¥ d, J = 7.50 Hz, 2H, Ar), 7.57–7.61 (m, 2H, Ar),
8.03–8.06 (m, 1H, Ar), 8.26–8.29 (m, 1H, Ar). 13C NMR (CDCl3)
d 32.9 (OCH2CH2), 66.7 (OCH2CH2), 68.3 (CHCH2OH), 71.1
(CHCH2OH), 71.5 (ArCH2O), 123.6, 124.3, 126.9, 127.1, 127.3,
128.0, 129.2, 132.2, 132.9, 133.5 (Ar). HR-MALDI-MS calcd for
C15H17BrO3Na [M + Na]+ m/z 347.0253; found m/z 347.0267.
1
895 mg (90%). H NMR (CDCl3) d 3.20–3.23, 3.66–3.76 (2 ¥
m, 5H, OCH2CH, CHCH2O, CHCH2ODMT), 3.76 (s, 6H, 2 ¥
OMe), 3.99 (br. s, 1H, CHOH), 5.02 (s, 2H, ArCH2O), 6.80 (d,
J = 6.9 Hz, 4H, DMT), 7.20–7.68 (m, 12H, Ar), 7.88–8.32 (m,
10H, Ar), 8.69–8.76 (m, 2H, Ar). 13C NMR (CDCl3) d 55.3 (2 ¥
OMe), 64.6 (CHCH2ODMT), 70.2 (CHCH2ODMT, OCH2CH),
71.8 (ArCH2O), 86.3 (CPh3), 93.4, 94.0 (C∫C), 113.3, 127.0,
127.4, 128.0, 128.3, 130.2, 136.1, 145.0, 158.6 (DMT), 118.0,
121.8, 124.4, 124.5, 124.7, 124.7, 125.7, 125.8, 126.0, 126.4, 126.9,
127.0, 127.2, 128.4, 128.7, 129.9, 130.1, 131.2, 131.4, 131.5, 131.6,
(R)-3-((4-(Pyren-1-ylethynyl)naphthalen-1-yl)methoxy)propane-
1,2-diol 9. (R)-3-((4-Bromo-naphthalen-1-yl)methoxy)propane-
1,2-diol (7; 1.01 g, 3.25 mmol), Pd(PPh3)2Cl2 (158 mg, 0.23 mmol),
CuI (73 mg, 0.38 mmol) and powdered PPh3 (169 mg, 0.64 mmol)
were dissolved in dry NEt3 (40 mL). The reaction mixture was
flushed with Ar before 1-ethynylpyrene (1.09 g, 4.82 mmol) was
added. The reaction mixture was stirred under reflux conditions
and Ar for 24 hours. The solvent was removed under reduced
This journal is
The Royal Society of Chemistry 2008
Org. Biomol. Chem., 2008, 6, 3714–3722 | 3719
©

View Article Online
133.6, 134.7 (Ar). HR-MALDI-MS calcd for C53H42O5Na [M +
CHCH2O, CHCH2ODMT, CH2CH2CN), 3.76 (s, 6H, 2 ¥ OMe),
4.93, 4.97 (m, 2H, ArCH2O), 6.76–6.81 (m, 4H, DMT), 7.17–7.71
(m, 12H, Ar), 7.86–8.33 (m, 10H, Ar), 8.69–8.80 (m, 2H, Ar).
13C NMR (CDCl3) d 20.3 (CH2CN), 24.5, 24.6, 24.7, 24.8 (2 ¥
CH(CH3)2), 34.1 (OCH2CH2), 43.1, 43.2 (2 ¥ CH(CH3)2), 55.3 (2 ¥
OMe), 58.2 (OCH2CH2CN), 66.4 (CHOP), 67.1 (OCH2CH2), 71.3
(CHCH2ODMT), 71.3 (ArCH2O), 86.0 (CPh3), 93.5, 93.9 (C∫C),
113.1, 127.1, 127.4, 127.9, 128.4, 130.3, 136.4, 145.2, 158.5 (DMT),
118.1, 124.5, 124.6, 124.8, 125.7, 125.8, 126.4, 126.8, 126.8, 126.9,
128.4, 128.7, 129.9, 130.2, 131.3, 131.4, 131.5, 131.7, 133.6, 135.3,
135.4, 136.5 (Ar). 31P NMR (CDCl3): d 149.6, 150.0. HR-MALDI-
MS calcd for C63H61N2O6PNa [M + Na]+ m/z 995.4160; found m/z
995.4145.
Na]+ m/z 781.2925; found m/z 781.2934.
(S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)-4-((4-(pyren-1-
ylethynyl)naphthalen-1-yl)methoxy)butan-2-ol 12. Compound
12 was synthesized from 10 according to the procedure described
1
for 11. Yield (58%) bronze coloured foam. H NMR (CDCl3)
d 1.82 (m, 2H, OCH2CH2), 3.10–3.14, 3.67–3.76 (2 ¥ m, 5H,
OCH2CH2, CHCH2O, CHCH2ODMT), 3.76 (s, 6H, 2 ¥ OMe),
4.00 (br. s, 1H, CHOH), 4.95 (s, 2H, ArCH2O), 6.80 (d, J = 8.7 Hz,
4H, DMT), 7.20–7.68 (m, 12H, Ar), 7.87–8.32 (m, 10H, Ar),
8.67–8.78 (m, 2H, Ar). 13C NMR (CDCl3) d 33.7 (OCH2CH2),
55.3 (2 ¥ OMe), 67.4 (OCH2CH2), 68.2 (CHCH2ODMT), 69.6
(CHCH2ODMT), 71.6 (ArCH2O), 86.1 (CPh3), 93.5, 93.9 (C∫C),
113.2, 127.0, 127.4, 128.0, 128.3, 130.2, 136.2, 145.1, 158.6
(DMT), 118.0, 121.8, 124.4, 124.5, 124.7, 125.7, 125.8, 126.4,
127.2, 128.2, 128.4, 128.7, 129.9, 130.1, 131.2, 131.4, 131.5, 131.6,
132.1, 133.6, 134.9 (Ar). HR-MALDI-MS calcd for C54H44O5Na
[M + Na]+ m/z 795.3081; found m/z 795.3100.
(S)-4-(4-Iodophenoxy)butane-1,2-diol 15. An ice-cooled solu-
tion of diethyl azodicarboxylate (DEAD, 2.42 ml, 15.6 mmol)
in THF (150 ml) was treated with 2-(2,2-dimethyl-1,3-dioxolan-4-
yl)ethanol (6, 1.84 ml, 12.95 mmol) for 25 min before 4-iodophenol
(3.70 g, 16.8 mmo◦l), and PPh3 (4.08 g, 15.6 mmol) were added.
After 45 min at 0 C, the reaction mixture was allowed to reach
room temperature overnight. The reaction was quenched with
saturated aq. NH4OH (100 ml) and the mixture was extracted with
EtOAc. The organic layer was washed with water, dried (MgSO4),
and concentrated under reduced pressure. The residue was purified
by column chromatography (silica gel; petroleum ether (60–
80 ◦C)–Et2O, 1 : 1, v/v) to afford (S)-4-(2-(4-iodophenoxy)ethyl-
2,2-dimethyl-1,3-dioxolane as an oil. Yield 2.87 g (72%). 1H NMR
(CDCl3) d 1.36, 1.42 (2 s, 6H, C(CH3)2), 2.04 (q, J = 6.3 Hz,
2H, OCH2CH2), 3.63 (t, J = 7.8 Hz, 1H, OCHHCH), 4.02–4.13
(m, 3H, OCHHCH2, OCH2CHCH2), 4.28 (quintet, J = 6.3 Hz,
1H, OCH2CHCH2), 6.69 (d, J = 9.0 Hz, 2H, Ar), 7.54 (d, J =
9.0 Hz, 2H, Ar). 13C NMR (CDCl3) d 25.7, 26.9 (2 ¥ C(CH3)2),
33.4 (OCH2CH2), 64.8 (OCH2CH2), 69.5 (CH2CHCH2), 73.3
(CH2CHCH2), 82.8 (Ph), 108.9 (C(CH3)2), 116.9, 138.2 (Ph), 158.6
(Ph). HR-MALDI-MS calcd for C13H17IO3Na [M + Na]+ m/z
371.0115; found m/z 371.0112. (S)-4-(2-(4-Iodophenoxy)ethyl)-
2,2-dimethyl-1,3-dioxolane (1.2 g, 5.75 mmol) was treated with
80% aq. AcOH (25 ml) for 24 h at room temperature. The
solvent was removed under reduced pressure and the residue
was coevaporated with toluene–EtOH (2 ¥ 30 ml, 5 : 1, v/v).
The residue was dried under reduced pressure to afford 15 as an
oil, which was used in the next step without further purification.
(S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)-3-((4-(pyren-1-
ylethynyl)naphthalen-1-yl)methoxy)propan-2-yl 2-cyanoethyl diiso-
propylphosphoramidite 13. (S)-1-(Bis(4-methoxyphenyl)(phenyl)-
methoxy)-3-((4-(pyren-1-ylethynyl)naphthalen-1-yl)methoxy)-
propan-2-ol (11; 877 mg, 1.156 mmol) and diisopropyl ammo-
nium tetrazolide (295 mg, 1.723 mmol) were dissolved under
Ar in dry CH2Cl2 (40 mL), followed by dropwise addition
of 2-cyanoethyl N,N,N¢,N¢-tetraisopropylphosphordiamidite
(1.097 mg, 3.639 mmol) via a syringe at 0 ◦C. The reaction mixture
was stirred under Ar at room temperature overnight before the
reaction was quenched with H2O (50 mL) and the organic phase
was washed with H2O (2 ¥ 50 mL). After back extraction with
CH2Cl2 (50 mL), the combined organic phase was dried (MgSO4),
filtrated and concentrated under reduced pressure. The residue
was purified by dry column vacuum chromatography (silica gel;
Et3N 0.5% v/v, 0–50% EtOAc in cyclohexane) to afford 13 as a
1
yellow foam. Yield 996 mg (90%). H NMR (CDCl3) d 1.15 (m,
12H, 2 ¥ CH(CH3)2), 2.40–2.54 (m, 2H, CH2CN), 3.21–3.31 (m,
2H, 2 ¥ CH(CH3)2), 3.55–3.65, 3.67–3.76 (2 ¥ m, 7H, OCH2CH,
CHCH2O, CHCH2ODMT, CH2CH2CN), 3.76 (s, 6H, 2 ¥ OMe),
5.00–5.06 (m, 2H, ArCH2O), 6.78 (d, J = 8.7 Hz, 4H, DMT),
7.20–7.67 (m, 12H, Ar), 7.86–8.34 (m, 10H, Ar), 8.69–8.80 (m, 2H,
Ar). 13C NMR (CDCl3) d 20.3, 20.4 (CH2CN), 24.6, 24.7, 24.8,
24.9 (2 ¥ CH(CH3)2), 43.2, 43.4 (2 ¥ CH(CH3)2), 55.3 (2 ¥ OMe),
58.4, 58.7 (OCH2CH2CN), 64.4 (CHOP), 71.6 (CHCH2ODMT),
72.7 (OCH2CH), 72.9 (ArCH2O), 86.2 (CPh3), 93.5, 93.9 (C∫C),
113.2, 127.0, 127.4, 127.9, 128.3, 130.2, 136.2, 145.2, 158.6 (DMT),
118.1, 121.6, 124.5, 124.8, 125.7, 125.8, 126.4, 126.9, 126.9, 128.4,
128.7, 129.9, 130.1, 130.3, 131.2, 131.4, 131.5, 132.1, 133.5, 135.0,
135.2, 136.3, 136.3 (Ar). 31P NMR (CDCl3): d 150.3, 150.4. HR-
MALDI-MS calcd for C62H59N2O6PNa [M + Na]+ m/z 981.4004;
found m/z 981.3995.
1
Yield 1.73 g (98%). H NMR (DMSO-d6) d 1.58–1.67 (m, 1H,
OCH2CHH), 1.87–1.96 (m, 1H, OCH2CHH), 3.26–3.67 (m, 2H,
CHCH2OH), 3.60–3.64 (m, 1H, CHCH2OH), 4.05 (t, J = 6.8 Hz,
2H, OCH2CH2), 4.54 (t, J = 5.6 Hz, 1H, CHCH2OH), 4.60 (d, J =
5.4 Hz, 1H, CH2CHOH), 6.78 (d, J = 9.0 Hz, 2H, Ph), 7.57 (d, J =
9.0 Hz, 2H, Ph). 13C NMR (DMSO-d6) d 32.9 (OCH2CH2), 64.7
(OCH2CH2), 65.9 (CH2CHOH), 67.9 (CH2OH), 82.7 (Ph), 117.2,
137.8 (Ph), 158.5 (Ph). HR-MALDI-MS calcd for C10H13IO3 [M +
Na]+ m/z 330.9802; found m/z 330.9793.
(S)-4-(4-(Pyren-1-ylethynyl)phenoxy)butane-1,2-diol 16. (S)-
4-(4-Iodophenoxy)butane-1,2-diol (15; 1.00 g, 3.24 mmol),
Pd(PPh3)2Cl2 (161 mg, 0.23 mmol) and CuI (72 mg, 0.38 mmol)
were dissolved in dry NEt3 (40 ml). The mixture was flushed with
Ar for 10 minutes before 1-ethynylpyrene (1.086 g, 4.80 mmol)
was added. The reaction mixture was stirred for 24 hours. The
solvent was removed under reduced pressure and the residue was
dissolved in CH2Cl2 (100 ml), which was washed with 0.3 M aq.
(S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)-4-((4-(pyren-1-
ylethynyl)naphthalen-1-yl)methoxy)butan-2-yl 2-cyanoethyl diiso-
propylphosphoramidite 14. Compound 14 was synthesized from
12 according to the procedure described for 13. Yield (81%) yellow
foam. H NMR (CDCl3) d 1.16 (m, 12H, 2 ¥ CH(CH3)2), 1.92–
2.04 (m, 2H, OCH2CH2), 2.49–2.56 (m, 2H, CH2CN), 3.48–
1
3.73 (m, 2H, 2 ¥ CH(CH3)2), 3.55–3.76 (m, 7H, OCH2CH2,
3720 | Org. Biomol. Chem., 2008, 6, 3714–3722
This journal is
The Royal Society of Chemistry 2008
©

View Article Online
Table 3 Calculated and found masses of synthesized oligonucleotides
m/z (Da)
EDTA (2 ¥ 100 ml). After back extraction with CH2Cl2 (100 ml),
the combined organic phase was washed with brine (100 ml), dried
(MgSO4), filtered and concentrated under reduced pressure. The
residue was purified by column chromatography (silica gel; 5%
MeOH in CH2Cl2, v/v) to afford compound 16 as yellow solid.
Yield 1.17 g (74%). Mp 171–173 ◦C. 1H NMR (DMSO-d6) d 1.65–
1.76 (m, 1H, OCH2CHH), 1.94–2.05 (m, 1H, OCH2CHH), 3.37–
3.45 (m, 2H, CHCH2OH), 3.67–3.73 (m, 1H, CHCH2OH), 4.18 (t,
J = 6.7 Hz, 2H, OCH2CH2), 4.61 (t, J = 5.7 Hz, 1H, CHCH2OH),
4.68 (d, J = 5.41 Hz, 1H, CH2CHOH), 7.07 (d, J = 9.0 Hz, 2H,
Ar), 7.70 (d, J = 9.0 Hz, 2H, Ar), 8.11–8.39 (m, 8H, Ar), 8.63 (d,
J = 9.0 Hz, 1H, Ar). 13C NMR (DMSO-d6) d 33.0 (OCH2CH2),
64.8 (OCH2CH2), 65.9 (CH2CHOH), 67.9 (CH2OH), 86.8, 95.5
(C∫C), 114.1, 114.9, 117.2, 123.4, 123.6, 124.8, 125.8, 125.8, 126.6,
127.2, 128.1, 128.6, 129.3, 130.5, 130.6, 130.7, 130.8, 133.1, 159.2
(Ar). HR-MALDI-MS calcd for C28H22O3 [M]+ m/z 406.1564;
found m/z 406.1560
Entry
Sequence
Calcd.
Founda
ON3
ON4
ON5
ON7
ON8
ON9
ON10
5¢-CCCCTT2TCTTTTTT
5¢-CCCCTT3TCTTTTTT
5¢-CCCCTT4TCTTTTTT
5¢-CCCCTT2TCT2TTTTT
5¢-CCCCTT3TCT3TTTTT
5¢-CCCCTT4TCT4TTTTT
5¢-CCCCT2TTCTT2TTTT
4640.3
4654.3
4589.2
5158.8
5186.8
5056.6
5158.8
4642.1
4651.1
4586.4
5158.4
5185.6
5053.3
5153.2
a Measured by MALDI-TOF MS.
tetrazole as an activator with an extended coupling time (10 min).
DMT-on ONs were cleaved from the CPG-support with 32%
aqueous ammonia (1.2 mL) and were deprotected at 55 ◦C
overnight. Purification of ONs was carried out on reverse-phase
semipreparative HPLC on a Waters Xterra MS C18 column (10 mm,
7.8 mm ¥ 150 mm). DMT deprotection was done with 80% aq.
AcOH (100 mL) for 20 minutes, followed by addition of H2O
(100 mL) and 3 M aq. NaOAc (50 mL). The ONs were precipitated
from 99.9% EtOH (550 mL) at -18 ◦C. The purity of the obtained
ONs was checked by ion-exchange chromatography on a LaChrom
system (Merck Hitachi) using a GenPak-Fax column (Waters),
see ESI.† Verification was done by MALDI-TOF analysis on
a Voyager Elite Bio spectrometry Research Station (Perspective
Biosystems), Table 3.
(S)-1-(Bis(4-methoxyphenyl)(phenyl)methoxy)-4-(4-(pyren-1-
ylethynyl)phenoxy)butane-2-ol 17. (S)-4-(4-(Pyren-1-ylethynyl)-
phenoxy)butane-1,2-diol (16; 0.745 g, 1.83 mmol) was dissolved in
dry pyridine (20 ml) before 4,4¢-dimethoxytrityl chloride (0.743 g,
2.20 mmol) was added under N2. The reaction was stirred at room
temperature overnight before it was quenched with MeOH (2 ml).
The reaction mixture was diluted with EtOAc (150 ml) before
washing with saturated aq. NaHCO3 (2 ¥ 40 ml). After back
extraction with EtOAc (2¥ 20 ml), the combined organic phase was
dried (Na2SO4), filtered, and concentrated under reduced pressure.
The residue was coevaporated with toluene–EtOH (2 ¥ 25 ml, 1 :
1, v/v) before it was purified by column chromatography (silica
gel; 0.5% Et3N v/v, 20–50% EtOAc in cyclohexane) to afford 17
Melting temperature measurements
Tm measurements were performed on a PerkinElmer Lambda
1
as a yellow foam. Yield 1.27 g (98%). H NMR (DMSO-d6) d
35 UV/VIS spectrometer with
a PTP 6 thermostat and
1.60–1.71 (m, 1H, OCH2CHH), 1.90–1.97 (m, 1H, OCH2CHH),
2.48 (br. s, 1H, (CHOH), 3.13–3.29 (m, 2H, CH2ODMT), 3.79
(s, 6H, 2 ¥ OCH3), 4.02–4.15 (m, 3H, OCH2CH2, CH2CHCH2),
6.83 (d, J = 9.0 Hz, 4H, DMT), 6.89 (d, J = 8.7 Hz, 2H, Ar),
7.20–7.34 (m, 7H, Ar), 7.44 (d, J = 8.1 Hz, 2H, Ar) 7.62 (d, J =
9.0 Hz, 2H, Ar), 7.98–8.22 (m, 8H, Ar), 8.65 (d, J = 9.3 Hz, 1H,
Ar). 13C NMR (CDCl3) d 33.0 (OCH2CH2), 55.2 (2 ¥ OCH3), 64.9
(OCH2CH2), 67.4 (CH2CHOH), 68.4 (CH2ODMT), 86.2 (CPh3),
87.3, 95.2 (C∫C), 113.6, 114.7, 115.6, 118.2, 124.4, 124.5, 125.5,
125.5, 125.6, 126.2, 126.9, 127.3, 127.8, 127.9, 127.9, 128.1, 128.2,
129.4, 130.1, 131.0, 133.1, 131.3, 131.7, 133.1, 135.9, 158.5, 159.0
(Ar). HR-ESI-MS calcd for C49H40O5Na [M + Na]+ m/z 731.2768;
found m/z 731.2751.
PerkinElmer Templab 2.00 software. Triplexes were formed by
mixing 1.0 mM of each ssDNA and 1.5 mM of the TFO in
the corresponding buffer solution and duplexes were formed by
mixing 1.0 mM of each ONs. The solutions were heated to 80 ◦C for
5 min and afterward cooled to 4 ◦C and kept at this temperature for
30 minutes. The absorbance of triplexes/duplexes was measured
at 260 nm or 373 nm from 5 C to 80 C w◦ith a heating rate of
1.0 ◦C min-1. The melting temperatures (Tm, C) were determined
as the maximum of the first derivative plots of the melting curves.
All melting temperatures are within the uncertainty 0.5 ◦C.
◦
◦
Acknowledgements
(S)-1-(Bis(4-methoxyphenyl(phenyl)methoxy)-4-(4-(pyren-1-yl-
ethynyl)phenoxy)butan-2-yl) 2-cyanoethyl diisopropylphospho-
ramidite 18. Compound 18 was synthesized from 17 according
to the procedure described for 13. Yield (85%) yellow foam.
31P NMR (CDCl3) d 149.7, 150.1. HR-ESI-MS calcd for
C58H57N2NaO6P+ [M + Na]+ m/z 931.3848; found m/z 931.3870.
The Nucleic Acid Center is funded by The Danish National
Research Foundation for studies on nucleic acid chemical biology.
This work was supported by the Sixth Framework Program Marie
Curie Host Fellowships for Early Stage Research Training under
contract number MEST-CT-2004-504018.
References
Synthesis and purification of modified oligonucleotides
1 K. M. Vasquez and P. M. Glazer, Q. Rev. Biophys., 2002, 35, 89–107.
2 J. Y. Chin, E. B. Schleifman and P. M. Glazer, Front. Biosci., 2007, 12,
4288–4297.
3 M. Faria and C. Giovannangeli, J. Gene Med., 2001, 3, 299–310.
4 S. Buchini and C. J. Leumann, Curr. Opin. Chem. Biol., 2003, 7, 717–
726.
Modified oligonucleotides were synthesized on a 0.2 mmol scale
on 500 A CPG supports using an Expedite Nucleic Acid Synthesis
System Model 8909 (Applied Biosystems). Standard procedures
were used for the coupling of commercial phosphoramidites
whereas modified phosphoramidites were coupled with 1H-
˚
5 K. R. Fox, Curr. Med. Chem., 2000, 7, 17–37.
This journal is
The Royal Society of Chemistry 2008
Org. Biomol. Chem., 2008, 6, 3714–3722 | 3721
©

View Article Online
6 T. Højland, S. Kumar, B. R. Babu, T. Umemoto, N. Albæk, P. K.
Sharma, P. Nielsen and J. Wengel, Org. Biomol. Chem., 2007, 5, 2375–
2379.
7 V. V. Filichev, M. C. Nielsen, N. Bomholt, C. H. Jessen and E. B.
Pedersen, Angew. Chem., Int. Ed., 2006, 45, 5311–5315.
8 C. H. Jessen and E. B. Pedersen, Helv. Chim. Acta, 2004, 87, 2465–2471.
9 K. R. Fox and T. Brown, Q. Rev. Biophys., 2005, 38, 311–320.
10 V. V. Filichev and E. B. Pedersen, J. Am. Chem. Soc., 2005, 127, 14849–
14858.
12 I. Ge´ci, V. V. Filichev and E. B. Pedersen, Bioconjugate Chem., 2006,
17, 950–957.
13 V. V. Filichev, H. Gaber, T. R. Olsen, P. T. Jørgensen, C. H. Jessen and
E. B. Pedersen, Eur. J. Org. Chem., 2006, 3960–3968.
14 I. Ge´ci, V. V. Filichev and E. B. Pedersen, Chem.–Eur. J., 2007, 13,
6379–6386.
15 D. Globisch, N. Bomholt, V. V. Filichev and E. B. Pedersen, Helv. Chim.
Acta, 2008, 91, 805–818.
16 B. C. Froehler, S. Wadwani, T. J. Terhorst and S. R. Gerrard,
Tetrahedron Lett., 1992, 33, 5307.
11 M. Paramavisam, C. Susanna, V. V. Filichev, N. Bomholt, E. B.
Pedersen and L. E. Xodo, Nucleic Acids Res., 2008, 36, 3494–3507.
17 J.-L. Mergny and L. Lacroix, Oligonucleotides, 2003, 13, 515–537.
3722 | Org. Biomol. Chem., 2008, 6, 3714–3722
This journal is
The Royal Society of Chemistry 2008
©